>Feature sequence01 1291 452 gene locus_tag LOCUS_00010 1291 452 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_00010 1323 3890 gene locus_tag LOCUS_00020 1323 3890 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_00020 4018 6699 gene locus_tag LOCUS_00030 4018 6699 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_00030 7710 7135 gene locus_tag LOCUS_00040 gene folE 7710 7135 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_00040 8228 7710 gene locus_tag LOCUS_00050 8228 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9065 8313 gene locus_tag LOCUS_00060 gene tpiA 9065 8313 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_00060 9506 11620 gene locus_tag LOCUS_00070 gene uvrB 9506 11620 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_00070 11607 13541 gene locus_tag LOCUS_00080 11607 13541 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_00080 13748 15838 gene locus_tag LOCUS_00090 13748 15838 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_00090 15999 18443 gene locus_tag LOCUS_00100 gene feoB 15999 18443 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_00100 21132 18526 gene locus_tag LOCUS_00110 21132 18526 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_00110 21427 24021 gene locus_tag LOCUS_00120 gene gyrA 21427 24021 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_00120 24054 25277 gene locus_tag LOCUS_00130 24054 25277 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_00130 25483 26502 gene locus_tag LOCUS_00140 25483 26502 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_00140 26817 27440 gene locus_tag LOCUS_00150 26817 27440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 27517 27966 gene locus_tag LOCUS_00160 gene mreD 27517 27966 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762749.1 protein_id gnl|my_center|LOCUS_00160 27963 29816 gene locus_tag LOCUS_00170 gene mrdA 27963 29816 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_00170 30233 30039 gene locus_tag LOCUS_00180 30233 30039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 30433 31266 gene locus_tag LOCUS_00190 30433 31266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00190 31341 31703 gene locus_tag LOCUS_00200 31341 31703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 31747 32292 gene locus_tag LOCUS_00210 31747 32292 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_00210 32296 33111 gene locus_tag LOCUS_00220 32296 33111 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_00220 33823 33179 gene locus_tag LOCUS_00230 33823 33179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 34160 35590 gene locus_tag LOCUS_00240 34160 35590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 35761 36033 gene locus_tag LOCUS_00250 35761 36033 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_00250 36061 37698 gene locus_tag LOCUS_00260 gene groL 36061 37698 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_00260 37969 38466 gene locus_tag LOCUS_00270 37969 38466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 38628 39134 gene locus_tag LOCUS_00280 38628 39134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 39516 41465 gene locus_tag LOCUS_00290 39516 41465 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_00290 41487 43517 gene locus_tag LOCUS_00300 41487 43517 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_00300 43546 44286 gene locus_tag LOCUS_00310 43546 44286 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_00310 46116 46280 gene locus_tag LOCUS_00320 46116 46280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 46500 47546 gene locus_tag LOCUS_00330 46500 47546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 47933 48799 gene locus_tag LOCUS_00340 47933 48799 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_00340 48792 49457 gene locus_tag LOCUS_00350 48792 49457 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_00350 49523 50392 gene locus_tag LOCUS_00360 49523 50392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 50521 50943 gene locus_tag LOCUS_00370 50521 50943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 50940 52088 gene locus_tag LOCUS_00380 gene mnmA 50940 52088 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_00380 52099 52695 gene locus_tag LOCUS_00390 52099 52695 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_00390 52692 53189 gene locus_tag LOCUS_00400 52692 53189 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_00400 53200 54162 gene locus_tag LOCUS_00410 gene argC 53200 54162 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_00410 54238 54561 gene locus_tag LOCUS_00420 54238 54561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 54709 56607 gene locus_tag LOCUS_00430 gene speA 54709 56607 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_00430 56612 57385 gene locus_tag LOCUS_00440 gene truA 56612 57385 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_00440 57437 58369 gene locus_tag LOCUS_00450 57437 58369 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_00450 58376 60391 gene locus_tag LOCUS_00460 gene ligA 58376 60391 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_00460 62413 61058 gene locus_tag LOCUS_00470 gene lpdA 62413 61058 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_00470 63879 62410 gene locus_tag LOCUS_00480 gene gcvPB 63879 62410 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_00480 65292 63886 gene locus_tag LOCUS_00490 gene gcvPA 65292 63886 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948419.1 protein_id gnl|my_center|LOCUS_00490 65755 65375 gene locus_tag LOCUS_00500 gene gcvH 65755 65375 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418363.1 protein_id gnl|my_center|LOCUS_00500 66881 65787 gene locus_tag LOCUS_00510 66881 65787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 67226 68467 gene locus_tag LOCUS_00520 67226 68467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_00520 68557 70590 gene locus_tag LOCUS_00530 gene htpG 68557 70590 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_00530 72982 70658 gene locus_tag LOCUS_00540 72982 70658 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767049.1 protein_id gnl|my_center|LOCUS_00540 74928 73282 gene locus_tag LOCUS_00550 74928 73282 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_00550 75296 78607 gene locus_tag LOCUS_00560 75296 78607 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_00560 78636 79979 gene locus_tag LOCUS_00570 78636 79979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 79966 80880 gene locus_tag LOCUS_00580 79966 80880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00580 80861 82204 gene locus_tag LOCUS_00590 80861 82204 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_00590 82971 82309 gene locus_tag LOCUS_00600 82971 82309 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_00600 85264 83012 gene locus_tag LOCUS_00610 85264 83012 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_00610 85629 85462 gene locus_tag LOCUS_00620 85629 85462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 85619 86428 gene locus_tag LOCUS_00630 85619 86428 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_00630 86451 86906 gene locus_tag LOCUS_00640 86451 86906 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_00640 87691 86888 gene locus_tag LOCUS_00650 87691 86888 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786188.1 protein_id gnl|my_center|LOCUS_00650 88714 87770 gene locus_tag LOCUS_00660 88714 87770 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_00660 89072 89917 gene locus_tag LOCUS_00670 gene prmA 89072 89917 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_00670 90085 90675 gene locus_tag LOCUS_00680 90085 90675 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_00680 91308 93017 gene locus_tag LOCUS_00690 91308 93017 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107711.1 protein_id gnl|my_center|LOCUS_00690 93239 93805 gene locus_tag LOCUS_00700 93239 93805 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_00700 93821 95404 gene locus_tag LOCUS_00710 93821 95404 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_00710 95632 96462 gene locus_tag LOCUS_00720 95632 96462 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167175274.1 protein_id gnl|my_center|LOCUS_00720 96807 97268 gene locus_tag LOCUS_00730 96807 97268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 97393 98202 gene locus_tag LOCUS_00740 97393 98202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 99516 98263 gene locus_tag LOCUS_00750 99516 98263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 101410 99668 gene locus_tag LOCUS_00760 101410 99668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 101881 103215 gene locus_tag LOCUS_00770 101881 103215 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_00770 103870 103283 gene locus_tag LOCUS_00780 103870 103283 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_00780 104064 104981 gene locus_tag LOCUS_00790 gene glsB 104064 104981 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114599.1 protein_id gnl|my_center|LOCUS_00790 105086 106507 gene locus_tag LOCUS_00800 105086 106507 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_00800 107503 106622 gene locus_tag LOCUS_00810 107503 106622 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_00810 108644 107619 gene locus_tag LOCUS_00820 108644 107619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_00820 109900 108764 gene locus_tag LOCUS_00830 109900 108764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 111902 109890 gene locus_tag LOCUS_00840 111902 109890 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_00840 112520 113272 gene locus_tag LOCUS_00850 112520 113272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 113474 114508 gene locus_tag LOCUS_00860 gene asnA 113474 114508 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_00860 114908 116662 gene locus_tag LOCUS_00870 gene ilvD 114908 116662 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_00870 116679 118403 gene locus_tag LOCUS_00880 gene ilvB 116679 118403 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 protein_id gnl|my_center|LOCUS_00880 118417 118968 gene locus_tag LOCUS_00890 gene ilvN 118417 118968 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_00890 119002 120045 gene locus_tag LOCUS_00900 gene ilvC 119002 120045 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_00900 121728 120130 gene locus_tag LOCUS_00910 121728 120130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_00910 123701 121812 gene locus_tag LOCUS_00920 123701 121812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 129263 123834 gene locus_tag LOCUS_00930 129263 123834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 130286 129333 gene locus_tag LOCUS_00940 130286 129333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 131800 130499 gene locus_tag LOCUS_00950 131800 130499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 133350 131839 gene locus_tag LOCUS_00960 133350 131839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 136302 133966 gene locus_tag LOCUS_00970 136302 133966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 136673 140662 gene locus_tag LOCUS_00980 136673 140662 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_00980 140687 143020 gene locus_tag LOCUS_00990 140687 143020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 143765 143103 gene locus_tag LOCUS_01000 143765 143103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 143981 145444 gene locus_tag LOCUS_01010 143981 145444 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_01010 145898 145521 gene locus_tag LOCUS_01020 145898 145521 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 protein_id gnl|my_center|LOCUS_01020 146707 145910 gene locus_tag LOCUS_01030 146707 145910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791993.1 protein_id gnl|my_center|LOCUS_01030 147612 146770 gene locus_tag LOCUS_01040 147612 146770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_01040 147911 147675 gene locus_tag LOCUS_01050 147911 147675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 148899 147940 gene locus_tag LOCUS_01060 148899 147940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 149638 148949 gene locus_tag LOCUS_01070 149638 148949 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_01070 153230 149661 gene locus_tag LOCUS_01080 gene ileS 153230 149661 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107458.1 protein_id gnl|my_center|LOCUS_01080 154526 153318 gene locus_tag LOCUS_01090 154526 153318 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_01090 156125 154713 gene locus_tag LOCUS_01100 156125 154713 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_01100 156405 157346 gene locus_tag LOCUS_01110 gene dapA 156405 157346 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_01110 157346 159610 gene locus_tag LOCUS_01120 gene dnaG 157346 159610 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_01120 159681 160643 gene locus_tag LOCUS_01130 159681 160643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_01130 160662 161567 gene locus_tag LOCUS_01140 160662 161567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 162548 161631 gene locus_tag LOCUS_01150 gene miaA 162548 161631 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_01150 163891 162539 gene locus_tag LOCUS_01160 163891 162539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 166074 164005 gene locus_tag LOCUS_01170 166074 164005 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795983.1 protein_id gnl|my_center|LOCUS_01170 167827 166346 gene locus_tag LOCUS_01180 gene proS 167827 166346 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_01180 168287 167871 gene locus_tag LOCUS_01190 168287 167871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 168715 170811 gene locus_tag LOCUS_01200 168715 170811 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_01200 172249 170843 gene locus_tag LOCUS_01210 gene dnaA 172249 170843 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759760.1 protein_id gnl|my_center|LOCUS_01210 173420 172506 gene locus_tag LOCUS_01220 173420 172506 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_01220 174880 173417 gene locus_tag LOCUS_01230 174880 173417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 175565 175071 gene locus_tag LOCUS_01240 175565 175071 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_01240 175717 177000 gene locus_tag LOCUS_01250 175717 177000 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582782.1 protein_id gnl|my_center|LOCUS_01250 178759 177083 gene locus_tag LOCUS_01260 178759 177083 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_01260 179055 178876 gene locus_tag LOCUS_01270 179055 178876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 180142 178982 gene locus_tag LOCUS_01280 180142 178982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 180988 180314 gene locus_tag LOCUS_01290 180988 180314 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692148.1 protein_id gnl|my_center|LOCUS_01290 181208 183661 gene locus_tag LOCUS_01300 gene lon 181208 183661 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_01300 185545 183830 gene locus_tag LOCUS_01310 gene sulP 185545 183830 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_01310 186517 186705 gene locus_tag LOCUS_01320 186517 186705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 188995 186809 gene locus_tag LOCUS_01330 188995 186809 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_01330 190249 189020 gene locus_tag LOCUS_01340 190249 189020 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_01340 191175 190294 gene locus_tag LOCUS_01350 gene dapF 191175 190294 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765061.1 protein_id gnl|my_center|LOCUS_01350 192245 191439 gene locus_tag LOCUS_01360 192245 191439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 192826 195033 gene locus_tag LOCUS_01370 192826 195033 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_01370 197751 195184 gene locus_tag LOCUS_01380 197751 195184 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_01380 199443 197779 gene locus_tag LOCUS_01390 199443 197779 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_01390 200260 199853 gene locus_tag LOCUS_01400 200260 199853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 200555 201178 gene locus_tag LOCUS_01410 gene rsmG 200555 201178 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817853.1 protein_id gnl|my_center|LOCUS_01410 201295 201939 gene locus_tag LOCUS_01420 201295 201939 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_01420 202765 201998 gene locus_tag LOCUS_01430 202765 201998 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769176.1 protein_id gnl|my_center|LOCUS_01430 203217 202921 gene locus_tag LOCUS_01440 gene trxA 203217 202921 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_01440 203606 205108 gene locus_tag LOCUS_01450 203606 205108 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765644.1 protein_id gnl|my_center|LOCUS_01450 206326 205229 gene locus_tag LOCUS_01460 206326 205229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 207535 206354 gene locus_tag LOCUS_01470 207535 206354 CDS product fragipain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788546.1 protein_id gnl|my_center|LOCUS_01470 207888 209435 gene locus_tag LOCUS_01480 207888 209435 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_01480 209469 210185 gene locus_tag LOCUS_01490 209469 210185 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_01490 212199 210304 gene locus_tag LOCUS_01500 212199 210304 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_01500 213823 212207 gene locus_tag LOCUS_01510 213823 212207 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788170.1 protein_id gnl|my_center|LOCUS_01510 214545 215666 gene locus_tag LOCUS_01520 214545 215666 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768312.1 protein_id gnl|my_center|LOCUS_01520 216008 215841 gene locus_tag LOCUS_01530 216008 215841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 216468 216941 gene locus_tag LOCUS_01540 216468 216941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 216944 217327 gene locus_tag LOCUS_01550 216944 217327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 217346 220093 gene locus_tag LOCUS_01560 217346 220093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 236326 220217 gene locus_tag LOCUS_01570 236326 220217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 237509 236316 gene locus_tag LOCUS_01580 237509 236316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 237927 237511 gene locus_tag LOCUS_01590 237927 237511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 238098 238421 gene locus_tag LOCUS_01600 238098 238421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 238484 238942 gene locus_tag LOCUS_01610 238484 238942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 238970 239503 gene locus_tag LOCUS_01620 238970 239503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 239500 240033 gene locus_tag LOCUS_01630 239500 240033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 240788 240240 gene locus_tag LOCUS_01640 240788 240240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 241408 240785 gene locus_tag LOCUS_01650 241408 240785 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764600.1 protein_id gnl|my_center|LOCUS_01650 241940 241488 gene locus_tag LOCUS_01660 241940 241488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 243513 242014 gene locus_tag LOCUS_01670 243513 242014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 244013 243510 gene locus_tag LOCUS_01680 244013 243510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 244370 244041 gene locus_tag LOCUS_01690 244370 244041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 <246039 244424 gene locus_tag LOCUS_01700 <246039 244424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000527428.1:shufflon system plasmid conjugative transfer pilus tip adhesin PilV >Feature sequence02 482 1582 gene locus_tag LOCUS_01710 482 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 1705 5388 gene locus_tag LOCUS_01720 gene dnaE 1705 5388 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108183.1 protein_id gnl|my_center|LOCUS_01720 5521 5835 gene locus_tag LOCUS_01730 gene trxA 5521 5835 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_01730 6003 6905 gene locus_tag LOCUS_01740 6003 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 6893 8086 gene locus_tag LOCUS_01750 6893 8086 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_01750 8670 8113 gene locus_tag LOCUS_01760 8670 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9019 10512 gene locus_tag LOCUS_01770 9019 10512 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_01770 10733 11593 gene locus_tag LOCUS_01780 10733 11593 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_01780 12472 11720 gene locus_tag LOCUS_01790 12472 11720 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_01790 13988 12504 gene locus_tag LOCUS_01800 gene glpK 13988 12504 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_01800 15321 14044 gene locus_tag LOCUS_01810 gene glpC 15321 14044 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098021.1 protein_id gnl|my_center|LOCUS_01810 16617 15376 gene locus_tag LOCUS_01820 gene glpB 16617 15376 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211492.1 protein_id gnl|my_center|LOCUS_01820 18295 16652 gene locus_tag LOCUS_01830 gene glpA 18295 16652 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815350.1 protein_id gnl|my_center|LOCUS_01830 18650 19051 gene locus_tag LOCUS_01840 18650 19051 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813773.1 protein_id gnl|my_center|LOCUS_01840 19048 19290 gene locus_tag LOCUS_01850 19048 19290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 19462 20178 gene locus_tag LOCUS_01860 19462 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 20323 21075 gene locus_tag LOCUS_01870 20323 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 21232 21420 gene locus_tag LOCUS_01880 21232 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 21482 21667 gene locus_tag LOCUS_01890 21482 21667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 21830 22042 gene locus_tag LOCUS_01900 21830 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 22213 21926 gene locus_tag LOCUS_01910 22213 21926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 22273 22749 gene locus_tag LOCUS_01920 22273 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01920 23150 23494 gene locus_tag LOCUS_01930 23150 23494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 23491 25779 gene locus_tag LOCUS_01940 23491 25779 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_01940 25857 26768 gene locus_tag LOCUS_01950 25857 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 26826 28400 gene locus_tag LOCUS_01960 26826 28400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 30695 28587 gene locus_tag LOCUS_01970 30695 28587 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109177.1 protein_id gnl|my_center|LOCUS_01970 33686 30927 gene locus_tag LOCUS_01980 33686 30927 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_01980 33807 33589 gene locus_tag LOCUS_01990 33807 33589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 34408 33863 gene locus_tag LOCUS_02000 34408 33863 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763753.1 protein_id gnl|my_center|LOCUS_02000 35092 34427 gene locus_tag LOCUS_02010 35092 34427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 35570 35079 gene locus_tag LOCUS_02020 35570 35079 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_02020 37278 35623 gene locus_tag LOCUS_02030 37278 35623 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_02030 37711 37271 gene locus_tag LOCUS_02040 37711 37271 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_02040 38730 37789 gene locus_tag LOCUS_02050 gene trxB 38730 37789 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_02050 39563 38889 gene locus_tag LOCUS_02060 39563 38889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 42317 39630 gene locus_tag LOCUS_02070 42317 39630 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_02070 42859 44787 gene locus_tag LOCUS_02080 gene dxs 42859 44787 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_02080 44787 46121 gene locus_tag LOCUS_02090 gene trkA 44787 46121 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_02090 46124 47599 gene locus_tag LOCUS_02100 46124 47599 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_02100 50052 47779 gene locus_tag LOCUS_02110 50052 47779 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_02110 50480 52684 gene locus_tag LOCUS_02120 50480 52684 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_02120 52700 53200 gene locus_tag LOCUS_02130 gene nrdG 52700 53200 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108083.1 protein_id gnl|my_center|LOCUS_02130 54155 53214 gene locus_tag LOCUS_02140 54155 53214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 54694 54293 gene locus_tag LOCUS_02150 54694 54293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 54988 56679 gene locus_tag LOCUS_02160 54988 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 56824 57009 gene locus_tag LOCUS_02170 56824 57009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 57682 57023 gene locus_tag LOCUS_02180 57682 57023 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_02180 58749 57679 gene locus_tag LOCUS_02190 58749 57679 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_02190 59860 59426 gene locus_tag LOCUS_02200 59860 59426 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_02200 60515 59925 gene locus_tag LOCUS_02210 gene coaE 60515 59925 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_02210 61432 60527 gene locus_tag LOCUS_02220 61432 60527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 61891 61571 gene locus_tag LOCUS_02230 gene yajC 61891 61571 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_02230 63409 62015 gene locus_tag LOCUS_02240 63409 62015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 64355 63600 gene locus_tag LOCUS_02250 gene rlmB 64355 63600 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_02250 66044 64362 gene locus_tag LOCUS_02260 gene recN 66044 64362 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_02260 66964 66065 gene locus_tag LOCUS_02270 66964 66065 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_02270 68231 67032 gene locus_tag LOCUS_02280 gene coaBC 68231 67032 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_02280 69028 68231 gene locus_tag LOCUS_02290 69028 68231 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_02290 70169 69045 gene locus_tag LOCUS_02300 gene dnaN 70169 69045 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_02300 71759 70368 gene locus_tag LOCUS_02310 71759 70368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 72211 71879 gene locus_tag LOCUS_02320 72211 71879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 72731 72423 gene locus_tag LOCUS_02330 72731 72423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 73353 72910 gene locus_tag LOCUS_02340 gene rplI 73353 72910 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_02340 73650 73384 gene locus_tag LOCUS_02350 gene rpsR 73650 73384 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_02350 74042 73653 gene locus_tag LOCUS_02360 gene rpsF 74042 73653 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_02360 75048 74233 gene locus_tag LOCUS_02370 75048 74233 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107810.1 protein_id gnl|my_center|LOCUS_02370 76643 75183 gene locus_tag LOCUS_02380 76643 75183 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_02380 78040 76640 gene locus_tag LOCUS_02390 78040 76640 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764708.1 protein_id gnl|my_center|LOCUS_02390 78266 78099 gene locus_tag LOCUS_02400 78266 78099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 78271 79140 gene locus_tag LOCUS_02410 78271 79140 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_02410 79199 80227 gene locus_tag LOCUS_02420 79199 80227 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_02420 80227 81927 gene locus_tag LOCUS_02430 80227 81927 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_02430 82809 82093 gene locus_tag LOCUS_02440 82809 82093 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_02440 84330 82936 gene locus_tag LOCUS_02450 gene nhaA 84330 82936 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788084.1 protein_id gnl|my_center|LOCUS_02450 84992 84510 gene locus_tag LOCUS_02460 gene bcp 84992 84510 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_02460 86922 85135 gene locus_tag LOCUS_02470 gene lepA 86922 85135 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788089.1 protein_id gnl|my_center|LOCUS_02470 88275 87187 gene locus_tag LOCUS_02480 88275 87187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 89851 88298 gene locus_tag LOCUS_02490 89851 88298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 91029 90424 gene locus_tag LOCUS_02500 91029 90424 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203132.1 protein_id gnl|my_center|LOCUS_02500 91616 91074 gene locus_tag LOCUS_02510 91616 91074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 93138 91987 gene locus_tag LOCUS_02520 93138 91987 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694591.1 protein_id gnl|my_center|LOCUS_02520 94629 93229 gene locus_tag LOCUS_02530 94629 93229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 96997 94652 gene locus_tag LOCUS_02540 96997 94652 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108117.1 protein_id gnl|my_center|LOCUS_02540 97342 98355 gene locus_tag LOCUS_02550 97342 98355 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_02550 98358 99050 gene locus_tag LOCUS_02560 98358 99050 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_02560 99554 100825 gene locus_tag LOCUS_02570 99554 100825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 101975 100974 gene locus_tag LOCUS_02580 101975 100974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 103025 102624 gene locus_tag LOCUS_02590 103025 102624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 103414 103079 gene locus_tag LOCUS_02600 103414 103079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 105084 103714 gene locus_tag LOCUS_02610 105084 103714 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_02610 105584 106075 gene locus_tag LOCUS_02620 105584 106075 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203275.1 protein_id gnl|my_center|LOCUS_02620 106083 106676 gene locus_tag LOCUS_02630 106083 106676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 107127 109337 gene locus_tag LOCUS_02640 107127 109337 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_02640 109385 109732 gene locus_tag LOCUS_02650 109385 109732 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_02650 109782 111236 gene locus_tag LOCUS_02660 109782 111236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 111469 112437 gene locus_tag LOCUS_02670 gene ftsY 111469 112437 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_02670 112443 113750 gene locus_tag LOCUS_02680 gene rimO 112443 113750 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 protein_id gnl|my_center|LOCUS_02680 113769 114866 gene locus_tag LOCUS_02690 113769 114866 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_02690 114934 116940 gene locus_tag LOCUS_02700 114934 116940 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_02700 117975 117031 gene locus_tag LOCUS_02710 117975 117031 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_02710 119794 118037 gene locus_tag LOCUS_02720 119794 118037 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_02720 120636 119812 gene locus_tag LOCUS_02730 120636 119812 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 protein_id gnl|my_center|LOCUS_02730 125316 120745 gene locus_tag LOCUS_02740 125316 120745 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_02740 125628 126644 gene locus_tag LOCUS_02750 gene tsaD 125628 126644 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_02750 126657 127451 gene locus_tag LOCUS_02760 126657 127451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 127660 127923 gene locus_tag LOCUS_02770 gene rpmB 127660 127923 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765736.1 protein_id gnl|my_center|LOCUS_02770 127940 128128 gene locus_tag LOCUS_02780 gene rpmG 127940 128128 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_02780 128142 128291 gene locus_tag LOCUS_02790 128142 128291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 129307 128534 gene locus_tag LOCUS_02800 gene lpxA 129307 128534 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764415.1 protein_id gnl|my_center|LOCUS_02800 130692 129310 gene locus_tag LOCUS_02810 130692 129310 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_02810 131699 130689 gene locus_tag LOCUS_02820 gene lpxD 131699 130689 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_02820 131914 132333 gene locus_tag LOCUS_02830 gene mce 131914 132333 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_02830 132379 133932 gene locus_tag LOCUS_02840 132379 133932 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_02840 133954 134547 gene locus_tag LOCUS_02850 133954 134547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 134603 135052 gene locus_tag LOCUS_02860 134603 135052 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_02860 135085 136257 gene locus_tag LOCUS_02870 135085 136257 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_02870 136464 136805 gene locus_tag LOCUS_02880 136464 136805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 137532 136984 gene locus_tag LOCUS_02890 137532 136984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769509.1 protein_id gnl|my_center|LOCUS_02890 138940 137753 gene locus_tag LOCUS_02900 138940 137753 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_02900 139360 141255 gene locus_tag LOCUS_02910 gene dnaK 139360 141255 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_02910 141358 141600 gene locus_tag LOCUS_02920 141358 141600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 141688 141966 gene locus_tag LOCUS_02930 141688 141966 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762348.1 protein_id gnl|my_center|LOCUS_02930 142323 143195 gene locus_tag LOCUS_02940 142323 143195 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_02940 145141 143633 gene locus_tag LOCUS_02950 145141 143633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 146210 145197 gene locus_tag LOCUS_02960 146210 145197 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690326.1 protein_id gnl|my_center|LOCUS_02960 147179 146226 gene locus_tag LOCUS_02970 147179 146226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 148431 147919 gene locus_tag LOCUS_02980 148431 147919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 150174 148444 gene locus_tag LOCUS_02990 150174 148444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 150985 151302 gene locus_tag LOCUS_03000 150985 151302 CDS product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114086.1 protein_id gnl|my_center|LOCUS_03000 151541 151843 gene locus_tag LOCUS_03010 gene ureA 151541 151843 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 protein_id gnl|my_center|LOCUS_03010 151876 152415 gene locus_tag LOCUS_03020 151876 152415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 152421 154139 gene locus_tag LOCUS_03030 152421 154139 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815716.1 protein_id gnl|my_center|LOCUS_03030 154259 154846 gene locus_tag LOCUS_03040 gene ureE 154259 154846 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172973.1 protein_id gnl|my_center|LOCUS_03040 154881 155564 gene locus_tag LOCUS_03050 154881 155564 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212231.1 protein_id gnl|my_center|LOCUS_03050 155602 156222 gene locus_tag LOCUS_03060 gene ureG 155602 156222 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004390399.1 protein_id gnl|my_center|LOCUS_03060 156265 157218 gene locus_tag LOCUS_03070 156265 157218 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815718.1 protein_id gnl|my_center|LOCUS_03070 157312 158361 gene locus_tag LOCUS_03080 gene yut 157312 158361 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815719.1 protein_id gnl|my_center|LOCUS_03080 158455 159738 gene locus_tag LOCUS_03090 158455 159738 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971928.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03090 159753 160703 gene locus_tag LOCUS_03100 159753 160703 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_03100 160700 161497 gene locus_tag LOCUS_03110 gene cbiQ 160700 161497 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_03110 161502 162257 gene locus_tag LOCUS_03120 161502 162257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_03120 163105 162293 gene locus_tag LOCUS_03130 163105 162293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 163561 164685 gene locus_tag LOCUS_03140 163561 164685 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004329798.1 protein_id gnl|my_center|LOCUS_03140 165524 164919 gene locus_tag LOCUS_03150 165524 164919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 165860 165546 gene locus_tag LOCUS_03160 165860 165546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 166390 165983 gene locus_tag LOCUS_03170 166390 165983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 170517 166387 gene locus_tag LOCUS_03180 170517 166387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 171595 170519 gene locus_tag LOCUS_03190 171595 170519 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933236.1 protein_id gnl|my_center|LOCUS_03190 173625 171664 gene locus_tag LOCUS_03200 173625 171664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 173898 174068 gene locus_tag LOCUS_03210 173898 174068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 174212 174883 gene locus_tag LOCUS_03220 174212 174883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 175258 175524 gene locus_tag LOCUS_03230 175258 175524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 175531 175701 gene locus_tag LOCUS_03240 175531 175701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 175753 176229 gene locus_tag LOCUS_03250 175753 176229 CDS product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084993485.1 protein_id gnl|my_center|LOCUS_03250 177396 176245 gene locus_tag LOCUS_03260 177396 176245 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787744.1 protein_id gnl|my_center|LOCUS_03260 178748 177396 gene locus_tag LOCUS_03270 178748 177396 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_03270 180549 178993 gene locus_tag LOCUS_03280 180549 178993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 181008 180583 gene locus_tag LOCUS_03290 181008 180583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 181989 181315 gene locus_tag LOCUS_03300 181989 181315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_03300 184486 182075 gene locus_tag LOCUS_03310 184486 182075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107498.1 protein_id gnl|my_center|LOCUS_03310 185736 184486 gene locus_tag LOCUS_03320 185736 184486 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_03320 187266 185779 gene locus_tag LOCUS_03330 187266 185779 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_03330 187577 188983 gene locus_tag LOCUS_03340 187577 188983 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785179.1 protein_id gnl|my_center|LOCUS_03340 189301 190431 gene locus_tag LOCUS_03350 gene tgt 189301 190431 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_03350 190453 191703 gene locus_tag LOCUS_03360 190453 191703 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_03360 192214 191813 gene locus_tag LOCUS_03370 192214 191813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 193522 192263 gene locus_tag LOCUS_03380 193522 192263 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766203.1 protein_id gnl|my_center|LOCUS_03380 194717 193542 gene locus_tag LOCUS_03390 194717 193542 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_03390 195947 194859 gene locus_tag LOCUS_03400 195947 194859 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_03400 196696 195947 gene locus_tag LOCUS_03410 196696 195947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 196833 197633 gene locus_tag LOCUS_03420 gene bamD 196833 197633 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_03420 197677 198012 gene locus_tag LOCUS_03430 197677 198012 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_03430 198150 199163 gene locus_tag LOCUS_03440 198150 199163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107960.1 protein_id gnl|my_center|LOCUS_03440 199164 199907 gene locus_tag LOCUS_03450 199164 199907 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_03450 199904 200428 gene locus_tag LOCUS_03460 199904 200428 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_03460 200518 201099 gene locus_tag LOCUS_03470 200518 201099 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_03470 202184 201204 gene locus_tag LOCUS_03480 202184 201204 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_03480 202766 205357 gene locus_tag LOCUS_03490 gene clpB 202766 205357 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_03490 205743 205441 gene locus_tag LOCUS_03500 205743 205441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 206148 206579 gene locus_tag LOCUS_03510 206148 206579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 207036 206839 gene locus_tag LOCUS_03520 207036 206839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 207271 207462 gene locus_tag LOCUS_03530 207271 207462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 207443 208057 gene locus_tag LOCUS_03540 207443 208057 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295313.1 protein_id gnl|my_center|LOCUS_03540 215409 208120 gene locus_tag LOCUS_03550 gene sprA 215409 208120 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_03550 216175 215585 gene locus_tag LOCUS_03560 gene ruvA 216175 215585 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_03560 216355 217923 gene locus_tag LOCUS_03570 216355 217923 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_03570 218590 218997 gene locus_tag LOCUS_03580 218590 218997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 219861 219079 gene locus_tag LOCUS_03590 219861 219079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 220281 220907 gene locus_tag LOCUS_03600 gene recR 220281 220907 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_03600 220945 221463 gene locus_tag LOCUS_03610 220945 221463 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763510.1 protein_id gnl|my_center|LOCUS_03610 221548 222909 gene locus_tag LOCUS_03620 221548 222909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 222970 223575 gene locus_tag LOCUS_03630 gene yihA 222970 223575 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_03630 223630 224106 gene locus_tag LOCUS_03640 223630 224106 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767594.1 protein_id gnl|my_center|LOCUS_03640 224155 224622 gene locus_tag LOCUS_03650 gene rpiB 224155 224622 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_03650 224622 224978 gene locus_tag LOCUS_03660 gene folB 224622 224978 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_03660 225066 225142 gene locus_tag LOCUS_t00010 225066 225142 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 225150 225224 gene locus_tag LOCUS_t00020 225150 225224 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 225884 225378 gene locus_tag LOCUS_03670 gene tpx 225884 225378 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084394.1 protein_id gnl|my_center|LOCUS_03670 227560 226148 gene locus_tag LOCUS_03680 227560 226148 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108267.1 protein_id gnl|my_center|LOCUS_03680 229142 227652 gene locus_tag LOCUS_03690 229142 227652 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_03690 231272 229266 gene locus_tag LOCUS_03700 231272 229266 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760460.1 protein_id gnl|my_center|LOCUS_03700 234590 231291 gene locus_tag LOCUS_03710 234590 231291 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791958.1 protein_id gnl|my_center|LOCUS_03710 235926 234703 gene locus_tag LOCUS_03720 235926 234703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 236537 237550 gene locus_tag LOCUS_03730 236537 237550 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_03730 237665 238405 gene locus_tag LOCUS_03740 237665 238405 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_03740 239890 238640 gene locus_tag LOCUS_03750 239890 238640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 241262 239898 gene locus_tag LOCUS_03760 gene hisS 241262 239898 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_03760 241395 242090 gene locus_tag LOCUS_03770 241395 242090 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_03770 244484 242076 gene locus_tag LOCUS_03780 244484 242076 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_03780 244823 244722 gene locus_tag LOCUS_r00010 244823 244722 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence03 836 2344 gene locus_tag LOCUS_03790 836 2344 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_03790 3874 2621 gene locus_tag LOCUS_03800 3874 2621 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_03800 4662 3871 gene locus_tag LOCUS_03810 gene ubiE 4662 3871 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_03810 6038 4872 gene locus_tag LOCUS_03820 6038 4872 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_03820 6817 6035 gene locus_tag LOCUS_03830 6817 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 8153 6882 gene locus_tag LOCUS_03840 gene serS 8153 6882 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_03840 8625 8176 gene locus_tag LOCUS_03850 8625 8176 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_03850 8948 9922 gene locus_tag LOCUS_03860 8948 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 10059 10868 gene locus_tag LOCUS_03870 10059 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 11072 11776 gene locus_tag LOCUS_03880 11072 11776 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_03880 14122 11849 gene locus_tag LOCUS_03890 14122 11849 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_03890 16371 14782 gene locus_tag LOCUS_03900 16371 14782 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229316.1 protein_id gnl|my_center|LOCUS_03900 17449 16529 gene locus_tag LOCUS_03910 17449 16529 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_03910 18960 17617 gene locus_tag LOCUS_03920 18960 17617 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108072.1 protein_id gnl|my_center|LOCUS_03920 21422 19242 gene locus_tag LOCUS_03930 21422 19242 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_03930 21719 22606 gene locus_tag LOCUS_03940 21719 22606 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_03940 22790 24229 gene locus_tag LOCUS_03950 22790 24229 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_03950 24337 25545 gene locus_tag LOCUS_03960 24337 25545 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_03960 25970 29104 gene locus_tag LOCUS_03970 25970 29104 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_03970 29126 30829 gene locus_tag LOCUS_03980 29126 30829 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791957.1 protein_id gnl|my_center|LOCUS_03980 30826 32196 gene locus_tag LOCUS_03990 30826 32196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 32233 34539 gene locus_tag LOCUS_04000 32233 34539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 34622 36025 gene locus_tag LOCUS_04010 34622 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 36058 37155 gene locus_tag LOCUS_04020 36058 37155 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_04020 37185 38351 gene locus_tag LOCUS_04030 37185 38351 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_04030 38401 39828 gene locus_tag LOCUS_04040 38401 39828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_04040 39834 41060 gene locus_tag LOCUS_04050 39834 41060 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_04050 41223 42005 gene locus_tag LOCUS_04060 41223 42005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_04060 41998 42366 gene locus_tag LOCUS_04070 41998 42366 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_04070 43716 42502 gene locus_tag LOCUS_04080 43716 42502 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228372.1 protein_id gnl|my_center|LOCUS_04080 45606 44056 gene locus_tag LOCUS_04090 45606 44056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203570.1 protein_id gnl|my_center|LOCUS_04090 47308 45713 gene locus_tag LOCUS_04100 47308 45713 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_04100 47542 47796 gene locus_tag LOCUS_04110 47542 47796 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791529.1 protein_id gnl|my_center|LOCUS_04110 48466 47969 gene locus_tag LOCUS_04120 48466 47969 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759578.1 protein_id gnl|my_center|LOCUS_04120 49189 48485 gene locus_tag LOCUS_04130 49189 48485 CDS product DUF5012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108196.1 protein_id gnl|my_center|LOCUS_04130 50706 49219 gene locus_tag LOCUS_04140 50706 49219 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100991023.1 protein_id gnl|my_center|LOCUS_04140 53715 50719 gene locus_tag LOCUS_04150 53715 50719 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_04150 53950 53741 gene locus_tag LOCUS_04160 53950 53741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 55776 54316 gene locus_tag LOCUS_04170 55776 54316 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_04170 56578 55808 gene locus_tag LOCUS_04180 56578 55808 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_04180 56810 58366 gene locus_tag LOCUS_04190 56810 58366 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_04190 59126 58428 gene locus_tag LOCUS_04200 59126 58428 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762629.1 protein_id gnl|my_center|LOCUS_04200 59673 59314 gene locus_tag LOCUS_04210 59673 59314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 61987 59879 gene locus_tag LOCUS_04220 61987 59879 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_04220 63947 62133 gene locus_tag LOCUS_04230 63947 62133 CDS product glycoside hydrolase family 66 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108626.1 protein_id gnl|my_center|LOCUS_04230 65478 63985 gene locus_tag LOCUS_04240 65478 63985 CDS product SusF/SusE family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108627.1 protein_id gnl|my_center|LOCUS_04240 67008 65500 gene locus_tag LOCUS_04250 67008 65500 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_04250 69795 67045 gene locus_tag LOCUS_04260 69795 67045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 71769 69994 gene locus_tag LOCUS_04270 71769 69994 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_04270 73615 72704 gene locus_tag LOCUS_04280 gene rhuM 73615 72704 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_04280 75414 74272 gene locus_tag LOCUS_04290 75414 74272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 77357 76320 gene locus_tag LOCUS_04300 77357 76320 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_04300 79887 77386 gene locus_tag LOCUS_04310 79887 77386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 81395 79953 gene locus_tag LOCUS_04320 81395 79953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 82152 81403 gene locus_tag LOCUS_04330 82152 81403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 83924 82254 gene locus_tag LOCUS_04340 83924 82254 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_04340 85701 83956 gene locus_tag LOCUS_04350 85701 83956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 87050 85701 gene locus_tag LOCUS_04360 87050 85701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 87562 87966 gene locus_tag LOCUS_04370 87562 87966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 89117 88164 gene locus_tag LOCUS_04380 89117 88164 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_04380 90063 89272 gene locus_tag LOCUS_04390 gene rsmA 90063 89272 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_04390 91451 90189 gene locus_tag LOCUS_04400 91451 90189 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_04400 91682 92566 gene locus_tag LOCUS_04410 91682 92566 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_04410 92706 93563 gene locus_tag LOCUS_04420 92706 93563 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_04420 93556 94944 gene locus_tag LOCUS_04430 gene gltA 93556 94944 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_04430 95116 96663 gene locus_tag LOCUS_04440 gene lysS 95116 96663 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_04440 96663 97661 gene locus_tag LOCUS_04450 96663 97661 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759775.1 protein_id gnl|my_center|LOCUS_04450 97805 99142 gene locus_tag LOCUS_04460 97805 99142 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_04460 99430 100464 gene locus_tag LOCUS_04470 99430 100464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 100476 101663 gene locus_tag LOCUS_04480 100476 101663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818879.1 protein_id gnl|my_center|LOCUS_04480 101939 101864 gene locus_tag LOCUS_t00030 101939 101864 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 102047 101971 gene locus_tag LOCUS_t00040 102047 101971 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 102196 104781 gene locus_tag LOCUS_04490 102196 104781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 104778 105284 gene locus_tag LOCUS_04500 104778 105284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 107139 105367 gene locus_tag LOCUS_04510 107139 105367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 107413 107916 gene locus_tag LOCUS_04520 107413 107916 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203275.1 protein_id gnl|my_center|LOCUS_04520 108002 108610 gene locus_tag LOCUS_04530 108002 108610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 108778 109065 gene locus_tag LOCUS_04540 108778 109065 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_04540 109065 109322 gene locus_tag LOCUS_04550 109065 109322 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_04550 109515 110681 gene locus_tag LOCUS_04560 109515 110681 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762841.1 protein_id gnl|my_center|LOCUS_04560 111334 111053 gene locus_tag LOCUS_04570 111334 111053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 111625 112329 gene locus_tag LOCUS_04580 gene pyrH 111625 112329 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_04580 112471 113028 gene locus_tag LOCUS_04590 gene frr 112471 113028 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764014.1 protein_id gnl|my_center|LOCUS_04590 113137 114123 gene locus_tag LOCUS_04600 113137 114123 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446968.1 protein_id gnl|my_center|LOCUS_04600 114696 114163 gene locus_tag LOCUS_04610 114696 114163 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_04610 115656 114703 gene locus_tag LOCUS_04620 gene nadA 115656 114703 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762783.1 protein_id gnl|my_center|LOCUS_04620 117003 116467 gene locus_tag LOCUS_04630 117003 116467 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_04630 117780 117019 gene locus_tag LOCUS_04640 117780 117019 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_04640 118911 117817 gene locus_tag LOCUS_04650 118911 117817 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025074588.1 protein_id gnl|my_center|LOCUS_04650 120066 119362 gene locus_tag LOCUS_04660 120066 119362 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_04660 121580 120369 gene locus_tag LOCUS_04670 121580 120369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 122291 122202 gene locus_tag LOCUS_t00050 122291 122202 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 122510 123538 gene locus_tag LOCUS_04680 gene ruvB 122510 123538 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_04680 123616 125136 gene locus_tag LOCUS_04690 123616 125136 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_04690 125484 128582 gene locus_tag LOCUS_04700 125484 128582 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764447.1 protein_id gnl|my_center|LOCUS_04700 128599 130632 gene locus_tag LOCUS_04710 128599 130632 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764446.1 protein_id gnl|my_center|LOCUS_04710 130667 132046 gene locus_tag LOCUS_04720 130667 132046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 132191 134788 gene locus_tag LOCUS_04730 132191 134788 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764444.1 protein_id gnl|my_center|LOCUS_04730 134899 136464 gene locus_tag LOCUS_04740 134899 136464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 136536 138320 gene locus_tag LOCUS_04750 gene glaB 136536 138320 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_04750 138549 140339 gene locus_tag LOCUS_04760 138549 140339 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_04760 140349 141785 gene locus_tag LOCUS_04770 140349 141785 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108686.1 protein_id gnl|my_center|LOCUS_04770 141934 144039 gene locus_tag LOCUS_04780 141934 144039 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_04780 145466 144150 gene locus_tag LOCUS_04790 gene der 145466 144150 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_04790 146429 145518 gene locus_tag LOCUS_04800 gene era 146429 145518 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_04800 147628 146639 gene locus_tag LOCUS_04810 147628 146639 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_04810 147936 147754 gene locus_tag LOCUS_04820 gene rpmF 147936 147754 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_04820 148518 147994 gene locus_tag LOCUS_04830 148518 147994 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_04830 148608 148536 gene locus_tag LOCUS_t00060 148608 148536 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 149543 148767 gene locus_tag LOCUS_04840 149543 148767 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_04840 149803 150300 gene locus_tag LOCUS_04850 149803 150300 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_04850 150443 150889 gene locus_tag LOCUS_04860 150443 150889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 151011 152114 gene locus_tag LOCUS_04870 gene ychF 151011 152114 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_04870 153487 152279 gene locus_tag LOCUS_04880 153487 152279 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_04880 153951 155162 gene locus_tag LOCUS_04890 gene recA 153951 155162 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_229032746.1 protein_id gnl|my_center|LOCUS_04890 155551 157575 gene locus_tag LOCUS_04900 155551 157575 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108865.1 protein_id gnl|my_center|LOCUS_04900 158750 160519 gene locus_tag LOCUS_04910 158750 160519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_04910 160660 161049 gene locus_tag LOCUS_04920 160660 161049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 161134 161946 gene locus_tag LOCUS_04930 161134 161946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 162016 162426 gene locus_tag LOCUS_04940 162016 162426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 162484 164634 gene locus_tag LOCUS_04950 162484 164634 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_04950 164637 165587 gene locus_tag LOCUS_04960 164637 165587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 165780 165998 gene locus_tag LOCUS_04970 165780 165998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 167072 166176 gene locus_tag LOCUS_04980 167072 166176 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 protein_id gnl|my_center|LOCUS_04980 167291 167596 gene locus_tag LOCUS_04990 167291 167596 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_04990 167589 167978 gene locus_tag LOCUS_05000 167589 167978 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_05000 169365 168106 gene locus_tag LOCUS_05010 169365 168106 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_05010 172933 169577 gene locus_tag LOCUS_05020 gene mfd 172933 169577 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_05020 174627 172930 gene locus_tag LOCUS_05030 174627 172930 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791282.1 protein_id gnl|my_center|LOCUS_05030 176225 174642 gene locus_tag LOCUS_05040 gene nadB 176225 174642 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108697.1 protein_id gnl|my_center|LOCUS_05040 176820 176476 gene locus_tag LOCUS_05050 176820 176476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 177080 177718 gene locus_tag LOCUS_05060 177080 177718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 178546 177983 gene locus_tag LOCUS_05070 178546 177983 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_05070 180070 178772 gene locus_tag LOCUS_05080 180070 178772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 180299 181726 gene locus_tag LOCUS_05090 180299 181726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 181740 182897 gene locus_tag LOCUS_05100 181740 182897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 183084 186512 gene locus_tag LOCUS_05110 183084 186512 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_05110 186530 187951 gene locus_tag LOCUS_05120 186530 187951 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_05120 188741 188280 gene locus_tag LOCUS_05130 188741 188280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 189469 188738 gene locus_tag LOCUS_05140 189469 188738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 190277 189603 gene locus_tag LOCUS_05150 190277 189603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 191821 190697 gene locus_tag LOCUS_05160 191821 190697 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_05160 192388 191969 gene locus_tag LOCUS_05170 192388 191969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 192516 192965 gene locus_tag LOCUS_05180 192516 192965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 194003 193149 gene locus_tag LOCUS_05190 194003 193149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 194526 194056 gene locus_tag LOCUS_05200 194526 194056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 194132 194140 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 194834 194523 gene locus_tag LOCUS_05210 194834 194523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 195350 194940 gene locus_tag LOCUS_05220 195350 194940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 197517 195460 gene locus_tag LOCUS_05230 197517 195460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 198410 197613 gene locus_tag LOCUS_05240 198410 197613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 198934 199197 gene locus_tag LOCUS_05250 198934 199197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 199226 199711 gene locus_tag LOCUS_05260 199226 199711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 199698 199967 gene locus_tag LOCUS_05270 199698 199967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 200287 200018 gene locus_tag LOCUS_05280 200287 200018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 201005 200778 gene locus_tag LOCUS_05290 201005 200778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 201186 202634 gene locus_tag LOCUS_05300 201186 202634 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_05300 204974 203013 gene locus_tag LOCUS_05310 gene ygjK 204974 203013 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_05310 208088 205101 gene locus_tag LOCUS_05320 gene lacZ 208088 205101 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_05320 208881 208279 gene locus_tag LOCUS_05330 208881 208279 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759728.1 protein_id gnl|my_center|LOCUS_05330 209138 208878 gene locus_tag LOCUS_05340 209138 208878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 210779 209268 gene locus_tag LOCUS_05350 210779 209268 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_05350 213968 210804 gene locus_tag LOCUS_05360 213968 210804 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_05360 214353 214171 gene locus_tag LOCUS_05370 214353 214171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 214372 214467 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 216297 214756 gene locus_tag LOCUS_05380 216297 214756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 216597 216388 gene locus_tag LOCUS_05390 216597 216388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 218283 216847 gene locus_tag LOCUS_05400 218283 216847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 220253 218319 gene locus_tag LOCUS_05410 220253 218319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 221333 220266 gene locus_tag LOCUS_05420 221333 220266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 221543 221346 gene locus_tag LOCUS_05430 221543 221346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 222675 221557 gene locus_tag LOCUS_05440 222675 221557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 225566 222681 gene locus_tag LOCUS_05450 225566 222681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 226051 225590 gene locus_tag LOCUS_05460 226051 225590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 230530 226055 gene locus_tag LOCUS_05470 230530 226055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 230729 230532 gene locus_tag LOCUS_05480 230729 230532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 231259 230768 gene locus_tag LOCUS_05490 231259 230768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 231832 231263 gene locus_tag LOCUS_05500 231832 231263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 232149 231829 gene locus_tag LOCUS_05510 232149 231829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 232633 232133 gene locus_tag LOCUS_05520 232633 232133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 233191 232730 gene locus_tag LOCUS_05530 233191 232730 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767438.1 protein_id gnl|my_center|LOCUS_05530 234076 233195 gene locus_tag LOCUS_05540 234076 233195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence04 132 2396 gene locus_tag LOCUS_05550 132 2396 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918421.1 protein_id gnl|my_center|LOCUS_05550 2431 3060 gene locus_tag LOCUS_05560 2431 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4172 3006 gene locus_tag LOCUS_05570 4172 3006 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 protein_id gnl|my_center|LOCUS_05570 5504 4206 gene locus_tag LOCUS_05580 5504 4206 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762009.1 protein_id gnl|my_center|LOCUS_05580 5620 5820 gene locus_tag LOCUS_05590 5620 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5931 7364 gene locus_tag LOCUS_05600 gene aspA 5931 7364 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_05600 7666 9069 gene locus_tag LOCUS_05610 gene leuC 7666 9069 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_05610 9124 9723 gene locus_tag LOCUS_05620 gene leuD 9124 9723 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_05620 9729 11282 gene locus_tag LOCUS_05630 9729 11282 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_05630 11348 12409 gene locus_tag LOCUS_05640 gene leuB 11348 12409 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_05640 13168 12539 gene locus_tag LOCUS_05650 13168 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05650 13637 14944 gene locus_tag LOCUS_05660 13637 14944 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_05660 15012 15341 gene locus_tag LOCUS_05670 15012 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 15338 15640 gene locus_tag LOCUS_05680 15338 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292646.1 protein_id gnl|my_center|LOCUS_05680 16690 15704 gene locus_tag LOCUS_05690 16690 15704 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_05690 17224 16778 gene locus_tag LOCUS_05700 17224 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 18817 17375 gene locus_tag LOCUS_05710 18817 17375 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819242.1 protein_id gnl|my_center|LOCUS_05710 19253 18987 gene locus_tag LOCUS_05720 19253 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 19441 20322 gene locus_tag LOCUS_05730 19441 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 20387 22414 gene locus_tag LOCUS_05740 20387 22414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 23235 22450 gene locus_tag LOCUS_05750 23235 22450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 24185 23229 gene locus_tag LOCUS_05760 24185 23229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 24963 24280 gene locus_tag LOCUS_05770 24963 24280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_05770 27401 25125 gene locus_tag LOCUS_05780 27401 25125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107404.1 protein_id gnl|my_center|LOCUS_05780 27724 28311 gene locus_tag LOCUS_05790 27724 28311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 28298 29290 gene locus_tag LOCUS_05800 28298 29290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 30292 29291 gene locus_tag LOCUS_05810 30292 29291 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_05810 30481 31683 gene locus_tag LOCUS_05820 30481 31683 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109064.1 protein_id gnl|my_center|LOCUS_05820 32155 31862 gene locus_tag LOCUS_05830 32155 31862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 32046 33185 gene locus_tag LOCUS_05840 32046 33185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 33715 35046 gene locus_tag LOCUS_05850 33715 35046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 35052 38438 gene locus_tag LOCUS_05860 35052 38438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 38495 39391 gene locus_tag LOCUS_05870 38495 39391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 39476 41017 gene locus_tag LOCUS_05880 39476 41017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 41143 41661 gene locus_tag LOCUS_05890 41143 41661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 41762 42412 gene locus_tag LOCUS_05900 41762 42412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 43314 43766 gene locus_tag LOCUS_05910 gene purE 43314 43766 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932063.1 protein_id gnl|my_center|LOCUS_05910 43787 47494 gene locus_tag LOCUS_05920 43787 47494 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263132.1 protein_id gnl|my_center|LOCUS_05920 47560 48585 gene locus_tag LOCUS_05930 gene purM 47560 48585 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_05930 48625 49206 gene locus_tag LOCUS_05940 gene purN 48625 49206 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244322.1 protein_id gnl|my_center|LOCUS_05940 49286 50815 gene locus_tag LOCUS_05950 gene purH 49286 50815 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 protein_id gnl|my_center|LOCUS_05950 50822 52075 gene locus_tag LOCUS_05960 gene purD 50822 52075 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101962.1 protein_id gnl|my_center|LOCUS_05960 52139 52990 gene locus_tag LOCUS_05970 52139 52990 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192079.1 protein_id gnl|my_center|LOCUS_05970 53006 54304 gene locus_tag LOCUS_05980 gene purB 53006 54304 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733238.1 protein_id gnl|my_center|LOCUS_05980 54304 55596 gene locus_tag LOCUS_05990 54304 55596 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262728.1 protein_id gnl|my_center|LOCUS_05990 55644 57116 gene locus_tag LOCUS_06000 gene guaB 55644 57116 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_06000 57127 58653 gene locus_tag LOCUS_06010 gene guaA 57127 58653 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_06010 59015 58746 gene locus_tag LOCUS_06020 59015 58746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 60072 59563 gene locus_tag LOCUS_06030 60072 59563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 61503 60427 gene locus_tag LOCUS_06040 61503 60427 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_06040 62693 61500 gene locus_tag LOCUS_06050 62693 61500 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_06050 63691 62693 gene locus_tag LOCUS_06060 63691 62693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 64776 63688 gene locus_tag LOCUS_06070 64776 63688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 65822 64779 gene locus_tag LOCUS_06080 65822 64779 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141777.1 protein_id gnl|my_center|LOCUS_06080 66811 65825 gene locus_tag LOCUS_06090 66811 65825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 67881 66802 gene locus_tag LOCUS_06100 67881 66802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 68887 67946 gene locus_tag LOCUS_06110 68887 67946 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766013.1 protein_id gnl|my_center|LOCUS_06110 70276 68903 gene locus_tag LOCUS_06120 70276 68903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 71046 70276 gene locus_tag LOCUS_06130 71046 70276 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766014.1 protein_id gnl|my_center|LOCUS_06130 71678 71037 gene locus_tag LOCUS_06140 71678 71037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 73420 72539 gene locus_tag LOCUS_06150 gene rfbD 73420 72539 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_06150 73980 73417 gene locus_tag LOCUS_06160 gene rfbC 73980 73417 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_06160 75251 74118 gene locus_tag LOCUS_06170 gene rfbB 75251 74118 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202143.1 protein_id gnl|my_center|LOCUS_06170 76193 75288 gene locus_tag LOCUS_06180 gene rfbA 76193 75288 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_06180 77898 76279 gene locus_tag LOCUS_06190 77898 76279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 78762 78523 gene locus_tag LOCUS_06200 78762 78523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 79114 78782 gene locus_tag LOCUS_06210 79114 78782 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_06210 79406 79107 gene locus_tag LOCUS_06220 79406 79107 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_06220 80308 79658 gene locus_tag LOCUS_06230 80308 79658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 81576 80305 gene locus_tag LOCUS_06240 81576 80305 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108858.1 protein_id gnl|my_center|LOCUS_06240 83727 81688 gene locus_tag LOCUS_06250 83727 81688 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_06250 84857 84042 gene locus_tag LOCUS_06260 84857 84042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 86935 84935 gene locus_tag LOCUS_06270 86935 84935 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_06270 90183 87016 gene locus_tag LOCUS_06280 90183 87016 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764127.1 protein_id gnl|my_center|LOCUS_06280 91672 90200 gene locus_tag LOCUS_06290 91672 90200 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108751.1 protein_id gnl|my_center|LOCUS_06290 93513 91690 gene locus_tag LOCUS_06300 93513 91690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 93897 96194 gene locus_tag LOCUS_06310 93897 96194 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_06310 96327 98906 gene locus_tag LOCUS_06320 96327 98906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 99365 99027 gene locus_tag LOCUS_06330 99365 99027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 99588 99355 gene locus_tag LOCUS_06340 99588 99355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 102142 100325 gene locus_tag LOCUS_06350 102142 100325 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_06350 102976 102803 gene locus_tag LOCUS_06360 102976 102803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 103135 103938 gene locus_tag LOCUS_06370 103135 103938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06370 104038 107043 gene locus_tag LOCUS_06380 104038 107043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06380 107054 108649 gene locus_tag LOCUS_06390 107054 108649 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762491.1 protein_id gnl|my_center|LOCUS_06390 108649 109569 gene locus_tag LOCUS_06400 108649 109569 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_06400 110136 109732 gene locus_tag LOCUS_06410 110136 109732 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_06410 112644 110731 gene locus_tag LOCUS_06420 112644 110731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 115184 112641 gene locus_tag LOCUS_06430 115184 112641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 116950 115199 gene locus_tag LOCUS_06440 116950 115199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 118070 116994 gene locus_tag LOCUS_06450 118070 116994 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108433.1 protein_id gnl|my_center|LOCUS_06450 120285 118228 gene locus_tag LOCUS_06460 120285 118228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 121943 120462 gene locus_tag LOCUS_06470 121943 120462 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764436.1 protein_id gnl|my_center|LOCUS_06470 122625 122020 gene locus_tag LOCUS_06480 122625 122020 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154542243.1 protein_id gnl|my_center|LOCUS_06480 123541 124458 gene locus_tag LOCUS_06490 123541 124458 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_06490 126717 124525 gene locus_tag LOCUS_06500 126717 124525 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_06500 128160 126799 gene locus_tag LOCUS_06510 128160 126799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 130208 128340 gene locus_tag LOCUS_06520 130208 128340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 130807 132000 gene locus_tag LOCUS_06530 gene trpB 130807 132000 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_06530 132138 133529 gene locus_tag LOCUS_06540 132138 133529 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_06540 133544 134107 gene locus_tag LOCUS_06550 133544 134107 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_06550 134330 135325 gene locus_tag LOCUS_06560 gene trpD 134330 135325 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_06560 135331 136125 gene locus_tag LOCUS_06570 gene trpC 135331 136125 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_06570 136122 137543 gene locus_tag LOCUS_06580 136122 137543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 137784 137530 gene locus_tag LOCUS_06590 137784 137530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 138638 137853 gene locus_tag LOCUS_06600 138638 137853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 139149 138697 gene locus_tag LOCUS_06610 139149 138697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797557.1 protein_id gnl|my_center|LOCUS_06610 139521 139940 gene locus_tag LOCUS_06620 139521 139940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 140408 141682 gene locus_tag LOCUS_06630 140408 141682 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_06630 143165 141789 gene locus_tag LOCUS_06640 143165 141789 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_06640 147279 143233 gene locus_tag LOCUS_06650 147279 143233 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_06650 147623 149242 gene locus_tag LOCUS_06660 147623 149242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 149332 152331 gene locus_tag LOCUS_06670 149332 152331 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_06670 152378 154054 gene locus_tag LOCUS_06680 152378 154054 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_06680 154172 155827 gene locus_tag LOCUS_06690 154172 155827 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_06690 155842 158250 gene locus_tag LOCUS_06700 155842 158250 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_06700 160966 158375 gene locus_tag LOCUS_06710 160966 158375 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_06710 161496 160963 gene locus_tag LOCUS_06720 161496 160963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 162254 161988 gene locus_tag LOCUS_06730 162254 161988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 162775 162251 gene locus_tag LOCUS_06740 162775 162251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 162961 163290 gene locus_tag LOCUS_06750 162961 163290 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_06750 163336 163821 gene locus_tag LOCUS_06760 163336 163821 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_06760 164767 163871 gene locus_tag LOCUS_06770 164767 163871 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767372.1 protein_id gnl|my_center|LOCUS_06770 164975 164835 gene locus_tag LOCUS_06780 164975 164835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 165032 167512 gene locus_tag LOCUS_06790 165032 167512 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_06790 167927 169342 gene locus_tag LOCUS_06800 167927 169342 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_06800 169464 170648 gene locus_tag LOCUS_06810 gene purT 169464 170648 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938024.1 protein_id gnl|my_center|LOCUS_06810 170880 171032 gene locus_tag LOCUS_06820 170880 171032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 171007 171858 gene locus_tag LOCUS_06830 171007 171858 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_06830 171873 172352 gene locus_tag LOCUS_06840 171873 172352 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_06840 172356 173258 gene locus_tag LOCUS_06850 gene cynR 172356 173258 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237346.1 protein_id gnl|my_center|LOCUS_06850 173508 175520 gene locus_tag LOCUS_06860 173508 175520 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_06860 175818 177311 gene locus_tag LOCUS_06870 gene xylE 175818 177311 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107448.1 protein_id gnl|my_center|LOCUS_06870 177646 179115 gene locus_tag LOCUS_06880 177646 179115 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390018.1 protein_id gnl|my_center|LOCUS_06880 178981 179078 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 179112 179330 gene locus_tag LOCUS_06890 179112 179330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 179349 180068 gene locus_tag LOCUS_06900 gene pgeF 179349 180068 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888599.1 protein_id gnl|my_center|LOCUS_06900 180229 181611 gene locus_tag LOCUS_06910 180229 181611 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_06910 183747 181990 gene locus_tag LOCUS_06920 183747 181990 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107383.1 protein_id gnl|my_center|LOCUS_06920 184496 183747 gene locus_tag LOCUS_06930 gene lepB 184496 183747 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789018.1 protein_id gnl|my_center|LOCUS_06930 185705 184692 gene locus_tag LOCUS_06940 185705 184692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 185980 185705 gene locus_tag LOCUS_06950 185980 185705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 186774 186205 gene locus_tag LOCUS_06960 186774 186205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 189509 186792 gene locus_tag LOCUS_06970 189509 186792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 190836 189682 gene locus_tag LOCUS_06980 190836 189682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 191226 190924 gene locus_tag LOCUS_06990 191226 190924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 191537 191328 gene locus_tag LOCUS_07000 191537 191328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 192555 192172 gene locus_tag LOCUS_07010 192555 192172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 194561 192729 gene locus_tag LOCUS_07020 194561 192729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 196064 194787 gene locus_tag LOCUS_07030 196064 194787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 197577 196069 gene locus_tag LOCUS_07040 197577 196069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 199639 198131 gene locus_tag LOCUS_07050 199639 198131 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761361.1 protein_id gnl|my_center|LOCUS_07050 200292 199705 gene locus_tag LOCUS_07060 200292 199705 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_07060 200511 201662 gene locus_tag LOCUS_07070 200511 201662 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108736.1 protein_id gnl|my_center|LOCUS_07070 201745 205203 gene locus_tag LOCUS_07080 201745 205203 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_07080 205222 206634 gene locus_tag LOCUS_07090 205222 206634 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_07090 206668 208023 gene locus_tag LOCUS_07100 206668 208023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 208270 210486 gene locus_tag LOCUS_07110 208270 210486 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067209.1 protein_id gnl|my_center|LOCUS_07110 213329 210627 gene locus_tag LOCUS_07120 213329 210627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 213565 216618 gene locus_tag LOCUS_07130 213565 216618 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_07130 216665 218413 gene locus_tag LOCUS_07140 216665 218413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 218551 220011 gene locus_tag LOCUS_07150 218551 220011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 220119 221435 gene locus_tag LOCUS_07160 220119 221435 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703154.1 protein_id gnl|my_center|LOCUS_07160 226003 221504 gene locus_tag LOCUS_07170 gene gltB 226003 221504 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_07170 226459 228123 gene locus_tag LOCUS_07180 226459 228123 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_07180 228169 230466 gene locus_tag LOCUS_07190 228169 230466 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_07190 230789 232204 gene locus_tag LOCUS_07200 gene pyk 230789 232204 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791942.1 protein_id gnl|my_center|LOCUS_07200 233586 233236 gene locus_tag LOCUS_07210 233586 233236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence05 359 4345 gene locus_tag LOCUS_07220 359 4345 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_07220 4392 5021 gene locus_tag LOCUS_07230 4392 5021 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_07230 5014 6024 gene locus_tag LOCUS_07240 5014 6024 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_07240 6024 6929 gene locus_tag LOCUS_07250 6024 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 7039 7800 gene locus_tag LOCUS_07260 7039 7800 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_07260 7815 10790 gene locus_tag LOCUS_07270 7815 10790 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_07270 10813 11490 gene locus_tag LOCUS_07280 10813 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 12988 11504 gene locus_tag LOCUS_07290 12988 11504 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_07290 13137 14423 gene locus_tag LOCUS_07300 gene miaB 13137 14423 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_07300 15191 16735 gene locus_tag LOCUS_07310 15191 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 16848 17042 gene locus_tag LOCUS_07320 16848 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 17077 18384 gene locus_tag LOCUS_07330 17077 18384 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_07330 18581 18757 gene locus_tag LOCUS_07340 18581 18757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 18774 19094 gene locus_tag LOCUS_07350 18774 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 19493 21025 gene locus_tag LOCUS_07360 19493 21025 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_07360 21065 22315 gene locus_tag LOCUS_07370 21065 22315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 22410 23228 gene locus_tag LOCUS_07380 22410 23228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 23225 24355 gene locus_tag LOCUS_07390 gene glf 23225 24355 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_07390 24397 25386 gene locus_tag LOCUS_07400 24397 25386 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_07400 25472 26539 gene locus_tag LOCUS_07410 25472 26539 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824469.1 protein_id gnl|my_center|LOCUS_07410 26557 27054 gene locus_tag LOCUS_07420 gene vpsG 26557 27054 CDS product exopolysaccharide biosynthesis acetyltransferase VpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266826.1 protein_id gnl|my_center|LOCUS_07420 27113 27880 gene locus_tag LOCUS_07430 27113 27880 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 protein_id gnl|my_center|LOCUS_07430 27897 28787 gene locus_tag LOCUS_07440 27897 28787 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_07440 28831 29631 gene locus_tag LOCUS_07450 28831 29631 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 protein_id gnl|my_center|LOCUS_07450 29646 30641 gene locus_tag LOCUS_07460 29646 30641 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203384.1 protein_id gnl|my_center|LOCUS_07460 31706 30720 gene locus_tag LOCUS_07470 31706 30720 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_07470 32166 32444 gene locus_tag LOCUS_07480 32166 32444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 32461 32655 gene locus_tag LOCUS_07490 32461 32655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 32794 33966 gene locus_tag LOCUS_07500 32794 33966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 33978 34367 gene locus_tag LOCUS_07510 33978 34367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 34410 34634 gene locus_tag LOCUS_07520 34410 34634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 35322 35630 gene locus_tag LOCUS_07530 35322 35630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 36602 35847 gene locus_tag LOCUS_07540 36602 35847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 37033 36599 gene locus_tag LOCUS_07550 37033 36599 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_07550 37702 37079 gene locus_tag LOCUS_07560 37702 37079 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_07560 38590 37880 gene locus_tag LOCUS_07570 38590 37880 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_07570 38884 39393 gene locus_tag LOCUS_07580 38884 39393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 39439 40317 gene locus_tag LOCUS_07590 39439 40317 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_07590 41413 40322 gene locus_tag LOCUS_07600 41413 40322 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303108.1 protein_id gnl|my_center|LOCUS_07600 42371 41466 gene locus_tag LOCUS_07610 42371 41466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 42972 44819 gene locus_tag LOCUS_07620 42972 44819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 44967 46412 gene locus_tag LOCUS_07630 44967 46412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 46511 48334 gene locus_tag LOCUS_07640 46511 48334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 48471 50336 gene locus_tag LOCUS_07650 48471 50336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 50515 51828 gene locus_tag LOCUS_07660 50515 51828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 51848 53080 gene locus_tag LOCUS_07670 51848 53080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 53052 54497 gene locus_tag LOCUS_07680 53052 54497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 54508 55827 gene locus_tag LOCUS_07690 54508 55827 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073868.1 protein_id gnl|my_center|LOCUS_07690 55864 57132 gene locus_tag LOCUS_07700 55864 57132 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795347.1 protein_id gnl|my_center|LOCUS_07700 57187 59919 gene locus_tag LOCUS_07710 57187 59919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765000.1 protein_id gnl|my_center|LOCUS_07710 59947 61395 gene locus_tag LOCUS_07720 59947 61395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 61953 61585 gene locus_tag LOCUS_07730 gene secG 61953 61585 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109227.1 protein_id gnl|my_center|LOCUS_07730 62597 62013 gene locus_tag LOCUS_07740 62597 62013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 63098 62619 gene locus_tag LOCUS_07750 63098 62619 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_07750 64429 63206 gene locus_tag LOCUS_07760 64429 63206 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_07760 65379 64534 gene locus_tag LOCUS_07770 65379 64534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 66576 65530 gene locus_tag LOCUS_07780 66576 65530 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_07780 67732 66578 gene locus_tag LOCUS_07790 gene galK 67732 66578 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_07790 69025 68093 gene locus_tag LOCUS_07800 gene xerD 69025 68093 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_07800 69626 69042 gene locus_tag LOCUS_07810 69626 69042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 72124 69623 gene locus_tag LOCUS_07820 72124 69623 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_07820 72611 72150 gene locus_tag LOCUS_07830 72611 72150 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_07830 73982 72747 gene locus_tag LOCUS_07840 73982 72747 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_07840 74350 73979 gene locus_tag LOCUS_07850 gene rbfA 74350 73979 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_07850 75123 74485 gene locus_tag LOCUS_07860 75123 74485 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_07860 75548 75123 gene locus_tag LOCUS_07870 gene aroQ 75548 75123 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_07870 75763 75688 gene locus_tag LOCUS_t00070 75763 75688 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 76121 76045 gene locus_tag LOCUS_t00080 76121 76045 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 77995 76364 gene locus_tag LOCUS_07880 77995 76364 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_07880 79257 78079 gene locus_tag LOCUS_07890 79257 78079 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766211.1 protein_id gnl|my_center|LOCUS_07890 81470 79560 gene locus_tag LOCUS_07900 81470 79560 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_07900 82090 83868 gene locus_tag LOCUS_07910 82090 83868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 84091 87225 gene locus_tag LOCUS_07920 84091 87225 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_07920 87236 88945 gene locus_tag LOCUS_07930 87236 88945 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_07930 88980 89951 gene locus_tag LOCUS_07940 88980 89951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 90271 92019 gene locus_tag LOCUS_07950 90271 92019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 92209 94536 gene locus_tag LOCUS_07960 92209 94536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07960 94517 96172 gene locus_tag LOCUS_07970 94517 96172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07970 96365 96290 gene locus_tag LOCUS_t00090 96365 96290 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 97422 96583 gene locus_tag LOCUS_07980 97422 96583 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_07980 99284 97530 gene locus_tag LOCUS_07990 99284 97530 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108511.1 protein_id gnl|my_center|LOCUS_07990 101271 99268 gene locus_tag LOCUS_08000 101271 99268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 101813 101361 gene locus_tag LOCUS_08010 gene dtd 101813 101361 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_08010 102740 102042 gene locus_tag LOCUS_08020 102740 102042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 103065 104345 gene locus_tag LOCUS_08030 103065 104345 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_08030 104351 106012 gene locus_tag LOCUS_08040 104351 106012 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_08040 107552 106125 gene locus_tag LOCUS_08050 107552 106125 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_08050 109207 107714 gene locus_tag LOCUS_08060 109207 107714 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_08060 111505 109292 gene locus_tag LOCUS_08070 111505 109292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 111772 111945 gene locus_tag LOCUS_08080 111772 111945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 113178 115217 gene locus_tag LOCUS_08090 gene metG 113178 115217 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_08090 115884 115180 gene locus_tag LOCUS_08100 115884 115180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 116230 117018 gene locus_tag LOCUS_08110 116230 117018 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_08110 117091 118053 gene locus_tag LOCUS_08120 117091 118053 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_08120 118069 119361 gene locus_tag LOCUS_08130 gene tyrS 118069 119361 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_08130 119446 121413 gene locus_tag LOCUS_08140 119446 121413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 123084 121477 gene locus_tag LOCUS_08150 gene pckA 123084 121477 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_08150 126802 123452 gene locus_tag LOCUS_08160 126802 123452 CDS product DUF4906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108431.1 protein_id gnl|my_center|LOCUS_08160 128855 126834 gene locus_tag LOCUS_08170 128855 126834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 129944 128871 gene locus_tag LOCUS_08180 129944 128871 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764430.1 protein_id gnl|my_center|LOCUS_08180 132395 130332 gene locus_tag LOCUS_08190 132395 130332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 133885 132440 gene locus_tag LOCUS_08200 133885 132440 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103878196.1 protein_id gnl|my_center|LOCUS_08200 134516 133932 gene locus_tag LOCUS_08210 134516 133932 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108436.1 protein_id gnl|my_center|LOCUS_08210 135569 135814 gene locus_tag LOCUS_08220 135569 135814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 136514 136020 gene locus_tag LOCUS_08230 136514 136020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 136966 136511 gene locus_tag LOCUS_08240 136966 136511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 137103 137762 gene locus_tag LOCUS_08250 137103 137762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 138312 137740 gene locus_tag LOCUS_08260 138312 137740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 138557 138309 gene locus_tag LOCUS_08270 138557 138309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 140171 138657 gene locus_tag LOCUS_08280 140171 138657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 140972 140310 gene locus_tag LOCUS_08290 140972 140310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 141123 141554 gene locus_tag LOCUS_08300 141123 141554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 141542 143617 gene locus_tag LOCUS_08310 141542 143617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 145071 143773 gene locus_tag LOCUS_08320 145071 143773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 147702 145285 gene locus_tag LOCUS_08330 147702 145285 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_08330 149049 147853 gene locus_tag LOCUS_08340 149049 147853 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_08340 149831 149262 gene locus_tag LOCUS_08350 149831 149262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 150132 150539 gene locus_tag LOCUS_08360 gene tsaE 150132 150539 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_08360 150549 151277 gene locus_tag LOCUS_08370 150549 151277 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268654.1 protein_id gnl|my_center|LOCUS_08370 151385 152419 gene locus_tag LOCUS_08380 151385 152419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 152572 153153 gene locus_tag LOCUS_08390 152572 153153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 153312 153386 gene locus_tag LOCUS_t00100 153312 153386 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 153460 153657 gene locus_tag LOCUS_08400 153460 153657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 153660 153944 gene locus_tag LOCUS_08410 153660 153944 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676650.1 protein_id gnl|my_center|LOCUS_08410 154675 154073 gene locus_tag LOCUS_08420 154675 154073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 156785 154800 gene locus_tag LOCUS_08430 156785 154800 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_08430 157017 159986 gene locus_tag LOCUS_08440 157017 159986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 160315 161097 gene locus_tag LOCUS_08450 gene proC 160315 161097 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_08450 161157 162230 gene locus_tag LOCUS_08460 gene proB 161157 162230 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108944.1 protein_id gnl|my_center|LOCUS_08460 162248 163492 gene locus_tag LOCUS_08470 162248 163492 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_08470 163542 164909 gene locus_tag LOCUS_08480 163542 164909 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_08480 164919 166013 gene locus_tag LOCUS_08490 gene gmd 164919 166013 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_08490 166010 166834 gene locus_tag LOCUS_08500 166010 166834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 170961 166852 gene locus_tag LOCUS_08510 170961 166852 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_08510 171248 174313 gene locus_tag LOCUS_08520 171248 174313 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_08520 174316 176139 gene locus_tag LOCUS_08530 174316 176139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 176458 177021 gene locus_tag LOCUS_08540 176458 177021 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778522.1 protein_id gnl|my_center|LOCUS_08540 178443 177097 gene locus_tag LOCUS_08550 178443 177097 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_08550 179942 178653 gene locus_tag LOCUS_08560 179942 178653 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_08560 180523 181683 gene locus_tag LOCUS_08570 180523 181683 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 protein_id gnl|my_center|LOCUS_08570 181673 184765 gene locus_tag LOCUS_08580 181673 184765 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769702.1 protein_id gnl|my_center|LOCUS_08580 184778 186211 gene locus_tag LOCUS_08590 184778 186211 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 protein_id gnl|my_center|LOCUS_08590 186576 188717 gene locus_tag LOCUS_08600 186576 188717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_08600 188735 191254 gene locus_tag LOCUS_08610 188735 191254 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_08610 192071 193102 gene locus_tag LOCUS_08620 192071 193102 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202517.1 protein_id gnl|my_center|LOCUS_08620 193221 194375 gene locus_tag LOCUS_08630 193221 194375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 194632 195714 gene locus_tag LOCUS_08640 194632 195714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 195938 196084 gene locus_tag LOCUS_08650 195938 196084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence06 977 4285 gene locus_tag LOCUS_08660 977 4285 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_08660 4307 6019 gene locus_tag LOCUS_08670 4307 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6428 6123 gene locus_tag LOCUS_08680 6428 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 6544 9531 gene locus_tag LOCUS_08690 6544 9531 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_08690 9609 11090 gene locus_tag LOCUS_08700 9609 11090 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_08700 11129 12022 gene locus_tag LOCUS_08710 11129 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 12374 12090 gene locus_tag LOCUS_08720 12374 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 12664 14712 gene locus_tag LOCUS_08730 12664 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 16377 14821 gene locus_tag LOCUS_08740 16377 14821 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_08740 16620 16772 gene locus_tag LOCUS_08750 16620 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 16775 17323 gene locus_tag LOCUS_08760 16775 17323 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766601.1 protein_id gnl|my_center|LOCUS_08760 17422 18126 gene locus_tag LOCUS_08770 17422 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 18739 18317 gene locus_tag LOCUS_08780 18739 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 21674 19449 gene locus_tag LOCUS_08790 21674 19449 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_08790 24189 21757 gene locus_tag LOCUS_08800 24189 21757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 27074 24276 gene locus_tag LOCUS_08810 27074 24276 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036929.1 protein_id gnl|my_center|LOCUS_08810 31458 27370 gene locus_tag LOCUS_08820 31458 27370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 31936 35034 gene locus_tag LOCUS_08830 31936 35034 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_08830 35130 36845 gene locus_tag LOCUS_08840 35130 36845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 36897 38735 gene locus_tag LOCUS_08850 36897 38735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 38807 40567 gene locus_tag LOCUS_08860 38807 40567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 40815 43217 gene locus_tag LOCUS_08870 40815 43217 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_08870 43995 43204 gene locus_tag LOCUS_08880 43995 43204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 44668 44159 gene locus_tag LOCUS_08890 44668 44159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 44851 45333 gene locus_tag LOCUS_08900 44851 45333 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_08900 46536 45337 gene locus_tag LOCUS_08910 46536 45337 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803026.1 protein_id gnl|my_center|LOCUS_08910 47082 46573 gene locus_tag LOCUS_08920 47082 46573 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203496.1 protein_id gnl|my_center|LOCUS_08920 47411 48433 gene locus_tag LOCUS_08930 47411 48433 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_08930 48534 49193 gene locus_tag LOCUS_08940 48534 49193 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_08940 49311 50771 gene locus_tag LOCUS_08950 49311 50771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769494.1 protein_id gnl|my_center|LOCUS_08950 50916 52316 gene locus_tag LOCUS_08960 gene uxaC 50916 52316 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_08960 52321 53481 gene locus_tag LOCUS_08970 gene uxuA 52321 53481 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766742.1 protein_id gnl|my_center|LOCUS_08970 53598 54410 gene locus_tag LOCUS_08980 53598 54410 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_08980 54975 54520 gene locus_tag LOCUS_08990 54975 54520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 55840 55196 gene locus_tag LOCUS_09000 55840 55196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 56807 56061 gene locus_tag LOCUS_09010 56807 56061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 57145 56990 gene locus_tag LOCUS_09020 57145 56990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 57268 58269 gene locus_tag LOCUS_09030 57268 58269 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_09030 60782 58467 gene locus_tag LOCUS_09040 60782 58467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 60964 61782 gene locus_tag LOCUS_09050 60964 61782 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_09050 61796 63127 gene locus_tag LOCUS_09060 61796 63127 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_09060 63127 64404 gene locus_tag LOCUS_09070 63127 64404 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_09070 64418 64918 gene locus_tag LOCUS_09080 64418 64918 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_09080 67004 64944 gene locus_tag LOCUS_09090 67004 64944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 67823 67482 gene locus_tag LOCUS_09100 67823 67482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09100 68135 67845 gene locus_tag LOCUS_09110 68135 67845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09110 68304 68116 gene locus_tag LOCUS_09120 68304 68116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 69606 68725 gene locus_tag LOCUS_09130 69606 68725 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_09130 71983 69704 gene locus_tag LOCUS_09140 71983 69704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 73563 72247 gene locus_tag LOCUS_09150 73563 72247 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_09150 74903 73560 gene locus_tag LOCUS_09160 74903 73560 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_09160 76235 74982 gene locus_tag LOCUS_09170 76235 74982 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202451.1 protein_id gnl|my_center|LOCUS_09170 77533 76256 gene locus_tag LOCUS_09180 77533 76256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764773.1 protein_id gnl|my_center|LOCUS_09180 78261 77545 gene locus_tag LOCUS_09190 78261 77545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107844.1 protein_id gnl|my_center|LOCUS_09190 80068 78665 gene locus_tag LOCUS_09200 80068 78665 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107843.1 protein_id gnl|my_center|LOCUS_09200 81492 80263 gene locus_tag LOCUS_09210 81492 80263 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202451.1 protein_id gnl|my_center|LOCUS_09210 82798 81515 gene locus_tag LOCUS_09220 82798 81515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816640.1 protein_id gnl|my_center|LOCUS_09220 83559 82885 gene locus_tag LOCUS_09230 83559 82885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_09230 84962 83715 gene locus_tag LOCUS_09240 84962 83715 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291923.1 protein_id gnl|my_center|LOCUS_09240 85241 86215 gene locus_tag LOCUS_09250 85241 86215 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_09250 86274 87563 gene locus_tag LOCUS_09260 86274 87563 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_09260 87560 88324 gene locus_tag LOCUS_09270 87560 88324 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877206.1 protein_id gnl|my_center|LOCUS_09270 88348 90903 gene locus_tag LOCUS_09280 88348 90903 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109251.1 protein_id gnl|my_center|LOCUS_09280 94050 90898 gene locus_tag LOCUS_09290 94050 90898 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202854.1 protein_id gnl|my_center|LOCUS_09290 95403 94279 gene locus_tag LOCUS_09300 95403 94279 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292376.1 protein_id gnl|my_center|LOCUS_09300 96883 95480 gene locus_tag LOCUS_09310 96883 95480 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202853.1 protein_id gnl|my_center|LOCUS_09310 97348 98691 gene locus_tag LOCUS_09320 97348 98691 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_09320 98678 99322 gene locus_tag LOCUS_09330 98678 99322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 99641 99568 gene locus_tag LOCUS_t00110 99641 99568 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 99858 100826 gene locus_tag LOCUS_09340 99858 100826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 100823 101407 gene locus_tag LOCUS_09350 100823 101407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 105002 101526 gene locus_tag LOCUS_09360 gene secA 105002 101526 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_09360 106625 105042 gene locus_tag LOCUS_09370 106625 105042 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764529.1 protein_id gnl|my_center|LOCUS_09370 107917 106634 gene locus_tag LOCUS_09380 107917 106634 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_09380 109387 107993 gene locus_tag LOCUS_09390 gene asnS 109387 107993 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_09390 110958 109417 gene locus_tag LOCUS_09400 110958 109417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 111924 111337 gene locus_tag LOCUS_09410 111924 111337 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_09410 112595 112020 gene locus_tag LOCUS_09420 gene hpt 112595 112020 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_09420 113730 112606 gene locus_tag LOCUS_09430 113730 112606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 115072 113906 gene locus_tag LOCUS_09440 115072 113906 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764800.1 protein_id gnl|my_center|LOCUS_09440 117394 115115 gene locus_tag LOCUS_09450 117394 115115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 118341 118721 gene locus_tag LOCUS_09460 118341 118721 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_09460 118748 119008 gene locus_tag LOCUS_09470 118748 119008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 119197 120291 gene locus_tag LOCUS_09480 119197 120291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 120421 122331 gene locus_tag LOCUS_09490 120421 122331 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_09490 123036 122362 gene locus_tag LOCUS_09500 123036 122362 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_09500 124964 123444 gene locus_tag LOCUS_09510 gene gltX 124964 123444 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_09510 125623 124979 gene locus_tag LOCUS_09520 125623 124979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 127586 125637 gene locus_tag LOCUS_09530 127586 125637 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_09530 127751 129451 gene locus_tag LOCUS_09540 127751 129451 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_09540 130044 129646 gene locus_tag LOCUS_09550 130044 129646 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_09550 130511 130047 gene locus_tag LOCUS_09560 gene greA 130511 130047 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_09560 130882 133686 gene locus_tag LOCUS_09570 130882 133686 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_09570 134151 133825 gene locus_tag LOCUS_09580 134151 133825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 134414 134151 gene locus_tag LOCUS_09590 134414 134151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 134928 135353 gene locus_tag LOCUS_09600 134928 135353 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_09600 135422 136945 gene locus_tag LOCUS_09610 135422 136945 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_09610 137056 138765 gene locus_tag LOCUS_09620 137056 138765 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_09620 138907 140076 gene locus_tag LOCUS_09630 138907 140076 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_09630 140073 141734 gene locus_tag LOCUS_09640 140073 141734 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_09640 142039 142602 gene locus_tag LOCUS_09650 142039 142602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 143566 142553 gene locus_tag LOCUS_09660 143566 142553 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_09660 144322 143606 gene locus_tag LOCUS_09670 144322 143606 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_09670 144388 145710 gene locus_tag LOCUS_09680 144388 145710 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_09680 145804 146487 gene locus_tag LOCUS_09690 145804 146487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_09690 146611 146904 gene locus_tag LOCUS_09700 146611 146904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 146911 148389 gene locus_tag LOCUS_09710 gene cysS 146911 148389 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_09710 150173 148554 gene locus_tag LOCUS_09720 150173 148554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 151039 150209 gene locus_tag LOCUS_09730 151039 150209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 152182 151235 gene locus_tag LOCUS_09740 152182 151235 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_09740 153494 152247 gene locus_tag LOCUS_09750 153494 152247 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_09750 154426 153839 gene locus_tag LOCUS_09760 154426 153839 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_09760 154589 155323 gene locus_tag LOCUS_09770 154589 155323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 156571 155327 gene locus_tag LOCUS_09780 156571 155327 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_09780 157615 157349 gene locus_tag LOCUS_09790 157615 157349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence07 93 115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 189 1229 gene locus_tag LOCUS_09800 189 1229 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938772.1 protein_id gnl|my_center|LOCUS_09800 1906 1310 gene locus_tag LOCUS_09810 1906 1310 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295313.1 protein_id gnl|my_center|LOCUS_09810 2081 1899 gene locus_tag LOCUS_09820 2081 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2448 2834 gene locus_tag LOCUS_09830 2448 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3527 3183 gene locus_tag LOCUS_09840 3527 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4297 3545 gene locus_tag LOCUS_09850 4297 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5195 4830 gene locus_tag LOCUS_09860 5195 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 7541 5436 gene locus_tag LOCUS_09870 7541 5436 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_09870 9267 7687 gene locus_tag LOCUS_09880 9267 7687 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022472115.1 protein_id gnl|my_center|LOCUS_09880 9509 10828 gene locus_tag LOCUS_09890 9509 10828 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_09890 10873 11286 gene locus_tag LOCUS_09900 gene ruvX 10873 11286 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_09900 11320 13458 gene locus_tag LOCUS_09910 11320 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 15156 13579 gene locus_tag LOCUS_09920 15156 13579 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_09920 16036 15287 gene locus_tag LOCUS_09930 16036 15287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 17634 16039 gene locus_tag LOCUS_09940 17634 16039 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_09940 19356 17641 gene locus_tag LOCUS_09950 gene thiC 19356 17641 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_09950 20196 19792 gene locus_tag LOCUS_09960 20196 19792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 20756 20232 gene locus_tag LOCUS_09970 20756 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 21421 21152 gene locus_tag LOCUS_09980 21421 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 22337 21960 gene locus_tag LOCUS_09990 22337 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 22864 22556 gene locus_tag LOCUS_10000 22864 22556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 24404 23052 gene locus_tag LOCUS_10010 24404 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 24900 24751 gene locus_tag LOCUS_10020 24900 24751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 25063 24920 gene locus_tag LOCUS_10030 25063 24920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 25972 25679 gene locus_tag LOCUS_10040 25972 25679 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020811.1 protein_id gnl|my_center|LOCUS_10040 26415 26161 gene locus_tag LOCUS_10050 26415 26161 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678397.1 protein_id gnl|my_center|LOCUS_10050 27171 26545 gene locus_tag LOCUS_10060 27171 26545 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_10060 28940 27249 gene locus_tag LOCUS_10070 28940 27249 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_10070 29184 30077 gene locus_tag LOCUS_10080 29184 30077 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_10080 30155 30892 gene locus_tag LOCUS_10090 30155 30892 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880253.1 protein_id gnl|my_center|LOCUS_10090 32708 31026 gene locus_tag LOCUS_10100 gene ettA 32708 31026 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_10100 33331 32771 gene locus_tag LOCUS_10110 gene def 33331 32771 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786565.1 protein_id gnl|my_center|LOCUS_10110 35831 33381 gene locus_tag LOCUS_10120 35831 33381 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_10120 36143 36937 gene locus_tag LOCUS_10130 36143 36937 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107141.1 protein_id gnl|my_center|LOCUS_10130 37548 36940 gene locus_tag LOCUS_10140 37548 36940 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_10140 38272 37583 gene locus_tag LOCUS_10150 38272 37583 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202968.1 protein_id gnl|my_center|LOCUS_10150 39168 38596 gene locus_tag LOCUS_10160 39168 38596 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_10160 39575 41179 gene locus_tag LOCUS_10170 39575 41179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 42731 41376 gene locus_tag LOCUS_10180 42731 41376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 44760 43009 gene locus_tag LOCUS_10190 44760 43009 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_10190 45134 46009 gene locus_tag LOCUS_10200 45134 46009 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_10200 46006 46599 gene locus_tag LOCUS_10210 gene gmk 46006 46599 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_10210 46596 47177 gene locus_tag LOCUS_10220 gene nadD 46596 47177 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_10220 47257 47691 gene locus_tag LOCUS_10230 47257 47691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 47719 49020 gene locus_tag LOCUS_10240 47719 49020 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434194.1 protein_id gnl|my_center|LOCUS_10240 49251 50609 gene locus_tag LOCUS_10250 gene tig 49251 50609 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_10250 50764 51483 gene locus_tag LOCUS_10260 gene clpP 50764 51483 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_10260 51504 52763 gene locus_tag LOCUS_10270 gene clpX 51504 52763 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_10270 52935 55115 gene locus_tag LOCUS_10280 gene recQ 52935 55115 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_10280 55271 57169 gene locus_tag LOCUS_10290 55271 57169 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_10290 57349 58161 gene locus_tag LOCUS_10300 57349 58161 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814398.1 protein_id gnl|my_center|LOCUS_10300 58161 59537 gene locus_tag LOCUS_10310 58161 59537 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_10310 59626 62142 gene locus_tag LOCUS_10320 59626 62142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 62139 64121 gene locus_tag LOCUS_10330 gene mutL 62139 64121 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760778.1 protein_id gnl|my_center|LOCUS_10330 64212 65627 gene locus_tag LOCUS_10340 64212 65627 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790372.1 protein_id gnl|my_center|LOCUS_10340 65761 66228 gene locus_tag LOCUS_10350 65761 66228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 66266 66415 gene locus_tag LOCUS_10360 66266 66415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 67119 67652 gene locus_tag LOCUS_10370 67119 67652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 68787 69245 gene locus_tag LOCUS_10380 68787 69245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 70936 69443 gene locus_tag LOCUS_10390 70936 69443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 72209 71025 gene locus_tag LOCUS_10400 72209 71025 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_10400 73692 72337 gene locus_tag LOCUS_10410 73692 72337 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_10410 73849 75177 gene locus_tag LOCUS_10420 73849 75177 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_10420 75410 76597 gene locus_tag LOCUS_10430 75410 76597 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_10430 76594 77547 gene locus_tag LOCUS_10440 gene metF 76594 77547 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_10440 77610 81212 gene locus_tag LOCUS_10450 gene metH 77610 81212 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963898.1 protein_id gnl|my_center|LOCUS_10450 81224 82111 gene locus_tag LOCUS_10460 81224 82111 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_10460 82143 83312 gene locus_tag LOCUS_10470 82143 83312 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_10470 83338 84417 gene locus_tag LOCUS_10480 83338 84417 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_10480 85066 85599 gene locus_tag LOCUS_10490 85066 85599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 85829 86167 gene locus_tag LOCUS_10500 85829 86167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 86726 86822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89560 88634 gene locus_tag LOCUS_10510 gene cas1 89560 88634 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_10510 93378 89557 gene locus_tag LOCUS_10520 gene cas9 93378 89557 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963637.1 protein_id gnl|my_center|LOCUS_10520 93996 93805 gene locus_tag LOCUS_10530 93996 93805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 94429 96606 gene locus_tag LOCUS_10540 94429 96606 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_10540 96621 97304 gene locus_tag LOCUS_10550 gene cas5c 96621 97304 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_10550 97301 99007 gene locus_tag LOCUS_10560 gene cas8c 97301 99007 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_10560 99011 99856 gene locus_tag LOCUS_10570 gene cas7c 99011 99856 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_10570 99897 100262 gene locus_tag LOCUS_10580 99897 100262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 100486 100650 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaccccgcgtgggtgcgtgaattgaaac 100960 103437 gene locus_tag LOCUS_10590 100960 103437 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108921.1 protein_id gnl|my_center|LOCUS_10590 104010 103582 gene locus_tag LOCUS_10600 104010 103582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 104148 105038 gene locus_tag LOCUS_10610 104148 105038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 105165 108365 gene locus_tag LOCUS_10620 gene carB 105165 108365 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 protein_id gnl|my_center|LOCUS_10620 108628 109878 gene locus_tag LOCUS_10630 108628 109878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 111982 109991 gene locus_tag LOCUS_10640 111982 109991 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_10640 113259 112081 gene locus_tag LOCUS_10650 113259 112081 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_10650 114762 113287 gene locus_tag LOCUS_10660 gene rseP 114762 113287 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_10660 115997 114825 gene locus_tag LOCUS_10670 115997 114825 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_10670 116792 116022 gene locus_tag LOCUS_10680 116792 116022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 117259 118512 gene locus_tag LOCUS_10690 117259 118512 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786002.1 protein_id gnl|my_center|LOCUS_10690 119836 118655 gene locus_tag LOCUS_10700 119836 118655 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798870.1 protein_id gnl|my_center|LOCUS_10700 120001 120810 gene locus_tag LOCUS_10710 120001 120810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 121162 121365 gene locus_tag LOCUS_10720 121162 121365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 121648 122739 gene locus_tag LOCUS_10730 121648 122739 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_10730 122750 122905 gene locus_tag LOCUS_10740 122750 122905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 123070 123144 gene locus_tag LOCUS_t00120 123070 123144 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 123374 124468 gene locus_tag LOCUS_10750 123374 124468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 124801 124547 gene locus_tag LOCUS_10760 124801 124547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 125394 125588 gene locus_tag LOCUS_10770 125394 125588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 126100 127176 gene locus_tag LOCUS_10780 126100 127176 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933236.1 protein_id gnl|my_center|LOCUS_10780 127173 129794 gene locus_tag LOCUS_10790 127173 129794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 131053 132321 gene locus_tag LOCUS_10800 131053 132321 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_10800 133827 132487 gene locus_tag LOCUS_10810 gene gdhA 133827 132487 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_10810 134246 134620 gene locus_tag LOCUS_10820 134246 134620 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 protein_id gnl|my_center|LOCUS_10820 134713 136509 gene locus_tag LOCUS_10830 134713 136509 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_10830 136513 137595 gene locus_tag LOCUS_10840 136513 137595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 139025 137736 gene locus_tag LOCUS_10850 139025 137736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 139589 139296 gene locus_tag LOCUS_10860 139589 139296 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789142.1 protein_id gnl|my_center|LOCUS_10860 141213 139594 gene locus_tag LOCUS_10870 141213 139594 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_10870 142698 141604 gene locus_tag LOCUS_10880 142698 141604 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_10880 144183 142729 gene locus_tag LOCUS_10890 144183 142729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 145016 144210 gene locus_tag LOCUS_10900 145016 144210 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_10900 145300 146166 gene locus_tag LOCUS_10910 gene panC 145300 146166 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764495.1 protein_id gnl|my_center|LOCUS_10910 146171 146518 gene locus_tag LOCUS_10920 146171 146518 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785327.1 protein_id gnl|my_center|LOCUS_10920 146553 147899 gene locus_tag LOCUS_10930 gene ffh 146553 147899 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_10930 149013 147985 gene locus_tag LOCUS_10940 gene galE 149013 147985 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_10940 149926 149027 gene locus_tag LOCUS_10950 149926 149027 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_10950 151108 149966 gene locus_tag LOCUS_10960 151108 149966 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_10960 151596 154496 gene locus_tag LOCUS_10970 151596 154496 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_10970 154617 155879 gene locus_tag LOCUS_10980 154617 155879 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_10980 156103 157014 gene locus_tag LOCUS_10990 156103 157014 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764764.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence08 450 1376 gene locus_tag LOCUS_11000 450 1376 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_11000 1632 1886 gene locus_tag LOCUS_11010 1632 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1977 2162 gene locus_tag LOCUS_11020 1977 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2296 2745 gene locus_tag LOCUS_11030 2296 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2752 2916 gene locus_tag LOCUS_11040 2752 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5601 3223 gene locus_tag LOCUS_11050 5601 3223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202761.1 protein_id gnl|my_center|LOCUS_11050 6054 8186 gene locus_tag LOCUS_11060 6054 8186 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_11060 8480 9790 gene locus_tag LOCUS_11070 8480 9790 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_11070 9871 10953 gene locus_tag LOCUS_11080 gene lysA 9871 10953 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788814.1 protein_id gnl|my_center|LOCUS_11080 12250 11102 gene locus_tag LOCUS_11090 gene nifS 12250 11102 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_11090 12459 12250 gene locus_tag LOCUS_11100 12459 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 13879 12446 gene locus_tag LOCUS_11110 13879 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 16253 13896 gene locus_tag LOCUS_11120 16253 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 20652 16489 gene locus_tag LOCUS_11130 20652 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 22985 20655 gene locus_tag LOCUS_11140 22985 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 26191 22991 gene locus_tag LOCUS_11150 26191 22991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 28562 27009 gene locus_tag LOCUS_11160 28562 27009 CDS product DUF4975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841481.1 protein_id gnl|my_center|LOCUS_11160 31417 28622 gene locus_tag LOCUS_11170 31417 28622 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_11170 32958 31576 gene locus_tag LOCUS_11180 32958 31576 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 protein_id gnl|my_center|LOCUS_11180 35488 33122 gene locus_tag LOCUS_11190 35488 33122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 37068 35599 gene locus_tag LOCUS_11200 37068 35599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 38774 37098 gene locus_tag LOCUS_11210 38774 37098 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_11210 41831 38793 gene locus_tag LOCUS_11220 41831 38793 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_11220 42331 45453 gene locus_tag LOCUS_11230 42331 45453 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_11230 45488 47224 gene locus_tag LOCUS_11240 45488 47224 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136013900.1 protein_id gnl|my_center|LOCUS_11240 47221 48756 gene locus_tag LOCUS_11250 47221 48756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 48759 50288 gene locus_tag LOCUS_11260 48759 50288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 53154 50413 gene locus_tag LOCUS_11270 53154 50413 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_11270 53431 55275 gene locus_tag LOCUS_11280 53431 55275 CDS product DUF4980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767782.1 protein_id gnl|my_center|LOCUS_11280 55395 56519 gene locus_tag LOCUS_11290 55395 56519 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763289.1 protein_id gnl|my_center|LOCUS_11290 56576 57457 gene locus_tag LOCUS_11300 56576 57457 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_11300 58538 57591 gene locus_tag LOCUS_11310 58538 57591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 59334 58600 gene locus_tag LOCUS_11320 59334 58600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 60995 59442 gene locus_tag LOCUS_11330 60995 59442 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_11330 61248 62006 gene locus_tag LOCUS_11340 61248 62006 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705598.1 protein_id gnl|my_center|LOCUS_11340 62106 63821 gene locus_tag LOCUS_11350 62106 63821 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_11350 64145 63969 gene locus_tag LOCUS_11360 64145 63969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 64144 67068 gene locus_tag LOCUS_11370 64144 67068 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_11370 67081 68610 gene locus_tag LOCUS_11380 67081 68610 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767524.1 protein_id gnl|my_center|LOCUS_11380 68662 70155 gene locus_tag LOCUS_11390 68662 70155 CDS product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108760.1 protein_id gnl|my_center|LOCUS_11390 70324 72345 gene locus_tag LOCUS_11400 70324 72345 CDS product DUF5125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108761.1 protein_id gnl|my_center|LOCUS_11400 72559 74799 gene locus_tag LOCUS_11410 72559 74799 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_11410 74942 75256 gene locus_tag LOCUS_11420 74942 75256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 75253 75504 gene locus_tag LOCUS_11430 75253 75504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 75715 76485 gene locus_tag LOCUS_11440 75715 76485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 80732 77136 gene locus_tag LOCUS_11450 80732 77136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 83890 80765 gene locus_tag LOCUS_11460 83890 80765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 85477 83924 gene locus_tag LOCUS_11470 85477 83924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 86478 85588 gene locus_tag LOCUS_11480 86478 85588 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108433.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11480 86641 86429 gene locus_tag LOCUS_11490 86641 86429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11490 88321 86678 gene locus_tag LOCUS_11500 88321 86678 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108434.1 protein_id gnl|my_center|LOCUS_11500 89987 88494 gene locus_tag LOCUS_11510 89987 88494 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103878196.1 protein_id gnl|my_center|LOCUS_11510 90619 90044 gene locus_tag LOCUS_11520 90619 90044 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108436.1 protein_id gnl|my_center|LOCUS_11520 93791 91329 gene locus_tag LOCUS_11530 93791 91329 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_11530 94999 93860 gene locus_tag LOCUS_11540 94999 93860 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_11540 95328 95065 gene locus_tag LOCUS_11550 95328 95065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_11550 96369 95539 gene locus_tag LOCUS_11560 96369 95539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 98203 96359 gene locus_tag LOCUS_11570 98203 96359 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_11570 99172 98258 gene locus_tag LOCUS_11580 99172 98258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 99970 99185 gene locus_tag LOCUS_11590 99970 99185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 101016 99967 gene locus_tag LOCUS_11600 101016 99967 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_11600 102071 101094 gene locus_tag LOCUS_11610 102071 101094 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_11610 103099 102068 gene locus_tag LOCUS_11620 103099 102068 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_11620 104013 103132 gene locus_tag LOCUS_11630 104013 103132 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_11630 105119 104124 gene locus_tag LOCUS_11640 105119 104124 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_11640 106334 105267 gene locus_tag LOCUS_11650 gene thiL 106334 105267 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_11650 107223 106411 gene locus_tag LOCUS_11660 107223 106411 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_11660 108434 107310 gene locus_tag LOCUS_11670 gene lpxK 108434 107310 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_11670 110348 108534 gene locus_tag LOCUS_11680 gene sppA 110348 108534 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_11680 111783 110404 gene locus_tag LOCUS_11690 gene glmM 111783 110404 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_11690 112410 111802 gene locus_tag LOCUS_11700 112410 111802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 113516 112482 gene locus_tag LOCUS_11710 113516 112482 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_11710 113750 114556 gene locus_tag LOCUS_11720 gene mazG 113750 114556 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_11720 114553 116448 gene locus_tag LOCUS_11730 114553 116448 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_11730 116692 117291 gene locus_tag LOCUS_11740 116692 117291 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761010.1 protein_id gnl|my_center|LOCUS_11740 117501 118430 gene locus_tag LOCUS_11750 gene mdh 117501 118430 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760830.1 protein_id gnl|my_center|LOCUS_11750 118824 118561 gene locus_tag LOCUS_11760 118824 118561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 119666 118821 gene locus_tag LOCUS_11770 119666 118821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 122115 120634 gene locus_tag LOCUS_11780 122115 120634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_11780 123070 122255 gene locus_tag LOCUS_11790 gene thiD 123070 122255 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_11790 123754 123125 gene locus_tag LOCUS_11800 gene tenA 123754 123125 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066884.1 protein_id gnl|my_center|LOCUS_11800 124462 123761 gene locus_tag LOCUS_11810 124462 123761 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870634.1 protein_id gnl|my_center|LOCUS_11810 125212 124514 gene locus_tag LOCUS_11820 125212 124514 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107370.1 protein_id gnl|my_center|LOCUS_11820 126353 125244 gene locus_tag LOCUS_11830 gene thiH 126353 125244 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_11830 127131 126364 gene locus_tag LOCUS_11840 127131 126364 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_11840 128358 127204 gene locus_tag LOCUS_11850 128358 127204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 128578 128363 gene locus_tag LOCUS_11860 128578 128363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 129146 131893 gene locus_tag LOCUS_11870 129146 131893 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_11870 131925 134009 gene locus_tag LOCUS_11880 131925 134009 CDS product choice-of-anchor J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787155.1 protein_id gnl|my_center|LOCUS_11880 134572 134135 gene locus_tag LOCUS_11890 134572 134135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 136363 134816 gene locus_tag LOCUS_11900 136363 134816 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_11900 136669 138903 gene locus_tag LOCUS_11910 136669 138903 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_11910 139011 141206 gene locus_tag LOCUS_11920 139011 141206 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 protein_id gnl|my_center|LOCUS_11920 143225 141315 gene locus_tag LOCUS_11930 143225 141315 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11930 143501 143286 gene locus_tag LOCUS_11940 143501 143286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11940 144193 144639 gene locus_tag LOCUS_11950 144193 144639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 144719 145222 gene locus_tag LOCUS_11960 144719 145222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 145505 146890 gene locus_tag LOCUS_11970 145505 146890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 146915 147454 gene locus_tag LOCUS_11980 146915 147454 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_11980 147466 148479 gene locus_tag LOCUS_11990 147466 148479 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence09 <1 2040 gene locus_tag LOCUS_12000 <1 2040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202756.1:zinc-dependent metalloprotease 2155 5403 gene locus_tag LOCUS_12010 2155 5403 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_12010 5403 6731 gene locus_tag LOCUS_12020 5403 6731 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_12020 6801 8414 gene locus_tag LOCUS_12030 6801 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 8811 10292 gene locus_tag LOCUS_12040 8811 10292 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_12040 13732 10364 gene locus_tag LOCUS_12050 13732 10364 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104711.1 protein_id gnl|my_center|LOCUS_12050 14991 13807 gene locus_tag LOCUS_12060 14991 13807 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203161.1 protein_id gnl|my_center|LOCUS_12060 15456 15058 gene locus_tag LOCUS_12070 15456 15058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 16749 17327 gene locus_tag LOCUS_12080 16749 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 17993 19897 gene locus_tag LOCUS_12090 17993 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 21557 20238 gene locus_tag LOCUS_12100 21557 20238 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_12100 22181 21561 gene locus_tag LOCUS_12110 22181 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 24084 22222 gene locus_tag LOCUS_12120 24084 22222 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555875.1 protein_id gnl|my_center|LOCUS_12120 25750 24512 gene locus_tag LOCUS_12130 25750 24512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 26363 25755 gene locus_tag LOCUS_12140 26363 25755 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 protein_id gnl|my_center|LOCUS_12140 26522 26863 gene locus_tag LOCUS_12150 26522 26863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 26928 27314 gene locus_tag LOCUS_12160 gene crcB 26928 27314 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963905.1 protein_id gnl|my_center|LOCUS_12160 27322 27678 gene locus_tag LOCUS_12170 gene crcB 27322 27678 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969203.1 protein_id gnl|my_center|LOCUS_12170 27850 29973 gene locus_tag LOCUS_12180 27850 29973 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_12180 30205 30615 gene locus_tag LOCUS_12190 30205 30615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12190 30673 31194 gene locus_tag LOCUS_12200 30673 31194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12200 31670 32515 gene locus_tag LOCUS_12210 31670 32515 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_12210 34218 32590 gene locus_tag LOCUS_12220 34218 32590 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_12220 37445 34728 gene locus_tag LOCUS_12230 gene ppdK 37445 34728 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_12230 37637 39157 gene locus_tag LOCUS_12240 gene rlmD 37637 39157 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_12240 39154 39924 gene locus_tag LOCUS_12250 39154 39924 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_12250 39997 40506 gene locus_tag LOCUS_12260 39997 40506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 40888 43056 gene locus_tag LOCUS_12270 40888 43056 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_12270 43151 44419 gene locus_tag LOCUS_12280 43151 44419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 44550 45401 gene locus_tag LOCUS_12290 44550 45401 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202902.1 protein_id gnl|my_center|LOCUS_12290 45416 49324 gene locus_tag LOCUS_12300 45416 49324 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202905.1 protein_id gnl|my_center|LOCUS_12300 49321 49821 gene locus_tag LOCUS_12310 49321 49821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 49818 50408 gene locus_tag LOCUS_12320 49818 50408 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788015.1 protein_id gnl|my_center|LOCUS_12320 50405 50740 gene locus_tag LOCUS_12330 50405 50740 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788017.1 protein_id gnl|my_center|LOCUS_12330 50758 51906 gene locus_tag LOCUS_12340 50758 51906 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_12340 51903 52937 gene locus_tag LOCUS_12350 51903 52937 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_12350 52934 53941 gene locus_tag LOCUS_12360 52934 53941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_12360 53960 55363 gene locus_tag LOCUS_12370 gene cobJ 53960 55363 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788019.1 protein_id gnl|my_center|LOCUS_12370 55356 56543 gene locus_tag LOCUS_12380 55356 56543 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788021.1 protein_id gnl|my_center|LOCUS_12380 56569 58338 gene locus_tag LOCUS_12390 gene cobM 56569 58338 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788023.1 protein_id gnl|my_center|LOCUS_12390 58335 60164 gene locus_tag LOCUS_12400 gene cbiD 58335 60164 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993058.1 protein_id gnl|my_center|LOCUS_12400 60161 61441 gene locus_tag LOCUS_12410 60161 61441 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932609.1 protein_id gnl|my_center|LOCUS_12410 61457 62029 gene locus_tag LOCUS_12420 61457 62029 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555647.1 protein_id gnl|my_center|LOCUS_12420 62347 64635 gene locus_tag LOCUS_12430 62347 64635 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202903.1 protein_id gnl|my_center|LOCUS_12430 64934 66004 gene locus_tag LOCUS_12440 64934 66004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 67094 66063 gene locus_tag LOCUS_12450 67094 66063 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_12450 67093 67329 gene locus_tag LOCUS_12460 67093 67329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 68652 67333 gene locus_tag LOCUS_12470 68652 67333 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_12470 69417 68743 gene locus_tag LOCUS_12480 69417 68743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_12480 71782 69440 gene locus_tag LOCUS_12490 71782 69440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_12490 73193 71934 gene locus_tag LOCUS_12500 73193 71934 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_12500 74512 73184 gene locus_tag LOCUS_12510 74512 73184 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_12510 75064 76011 gene locus_tag LOCUS_12520 75064 76011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 76031 77185 gene locus_tag LOCUS_12530 76031 77185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 77242 77928 gene locus_tag LOCUS_12540 77242 77928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 79418 78045 gene locus_tag LOCUS_12550 79418 78045 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 protein_id gnl|my_center|LOCUS_12550 79811 81367 gene locus_tag LOCUS_12560 79811 81367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 81645 82232 gene locus_tag LOCUS_12570 81645 82232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 82308 83489 gene locus_tag LOCUS_12580 82308 83489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 83657 83887 gene locus_tag LOCUS_12590 83657 83887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 84020 84343 gene locus_tag LOCUS_12600 84020 84343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 85000 85239 gene locus_tag LOCUS_12610 85000 85239 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_12610 85330 85569 gene locus_tag LOCUS_12620 85330 85569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 85578 85865 gene locus_tag LOCUS_12630 85578 85865 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262427.1 protein_id gnl|my_center|LOCUS_12630 87473 86487 gene locus_tag LOCUS_12640 87473 86487 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_12640 88531 87494 gene locus_tag LOCUS_12650 88531 87494 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_12650 90047 88626 gene locus_tag LOCUS_12660 90047 88626 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966721.1 protein_id gnl|my_center|LOCUS_12660 91991 90063 gene locus_tag LOCUS_12670 91991 90063 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_12670 93518 92049 gene locus_tag LOCUS_12680 93518 92049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 95564 93543 gene locus_tag LOCUS_12690 95564 93543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 96878 95613 gene locus_tag LOCUS_12700 96878 95613 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_12700 98216 97077 gene locus_tag LOCUS_12710 98216 97077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 99530 98367 gene locus_tag LOCUS_12720 99530 98367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 101706 99601 gene locus_tag LOCUS_12730 101706 99601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 102845 101772 gene locus_tag LOCUS_12740 102845 101772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 104632 102863 gene locus_tag LOCUS_12750 104632 102863 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_12750 107499 104632 gene locus_tag LOCUS_12760 107499 104632 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_12760 109437 107524 gene locus_tag LOCUS_12770 109437 107524 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_12770 112549 109463 gene locus_tag LOCUS_12780 112549 109463 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_12780 114414 112699 gene locus_tag LOCUS_12790 114414 112699 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994209.1 protein_id gnl|my_center|LOCUS_12790 116726 115104 gene locus_tag LOCUS_12800 116726 115104 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108653.1 protein_id gnl|my_center|LOCUS_12800 120868 116807 gene locus_tag LOCUS_12810 120868 116807 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_12810 123465 121135 gene locus_tag LOCUS_12820 123465 121135 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_12820 123985 124335 gene locus_tag LOCUS_12830 123985 124335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 124376 125458 gene locus_tag LOCUS_12840 124376 125458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12840 125463 126521 gene locus_tag LOCUS_12850 gene hydE 125463 126521 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_12850 126514 127932 gene locus_tag LOCUS_12860 gene hydG 126514 127932 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108015.1 protein_id gnl|my_center|LOCUS_12860 127984 129129 gene locus_tag LOCUS_12870 gene hydF 127984 129129 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_12870 129735 129214 gene locus_tag LOCUS_12880 129735 129214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 132470 130011 gene locus_tag LOCUS_12890 132470 130011 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_12890 132778 132515 gene locus_tag LOCUS_12900 132778 132515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 133108 133593 gene locus_tag LOCUS_12910 133108 133593 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_12910 133586 134221 gene locus_tag LOCUS_12920 133586 134221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 134271 136769 gene locus_tag LOCUS_12930 134271 136769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 137160 136882 gene locus_tag LOCUS_12940 137160 136882 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760436.1 protein_id gnl|my_center|LOCUS_12940 137485 137147 gene locus_tag LOCUS_12950 137485 137147 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_12950 138061 137822 gene locus_tag LOCUS_12960 138061 137822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 138706 138356 gene locus_tag LOCUS_12970 138706 138356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 139383 138703 gene locus_tag LOCUS_12980 139383 138703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 141153 140260 gene locus_tag LOCUS_12990 141153 140260 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence10 144 359 gene locus_tag LOCUS_13000 144 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 359 856 gene locus_tag LOCUS_13010 359 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 834 1064 gene locus_tag LOCUS_13020 834 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3872 1206 gene locus_tag LOCUS_13030 3872 1206 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183697638.1 protein_id gnl|my_center|LOCUS_13030 4363 3935 gene locus_tag LOCUS_13040 4363 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 5903 4509 gene locus_tag LOCUS_13050 5903 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 9129 6070 gene locus_tag LOCUS_13060 gene lacZ 9129 6070 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_13060 9691 9455 gene locus_tag LOCUS_13070 9691 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 10985 9795 gene locus_tag LOCUS_13080 10985 9795 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797749.1 protein_id gnl|my_center|LOCUS_13080 11371 11805 gene locus_tag LOCUS_13090 11371 11805 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_13090 11798 12433 gene locus_tag LOCUS_13100 gene pth 11798 12433 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_13100 12633 13283 gene locus_tag LOCUS_13110 12633 13283 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_13110 15461 13395 gene locus_tag LOCUS_13120 15461 13395 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_13120 15689 17623 gene locus_tag LOCUS_13130 gene thrS 15689 17623 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_13130 17665 18390 gene locus_tag LOCUS_13140 gene infC 17665 18390 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_13140 18456 18653 gene locus_tag LOCUS_13150 gene rpmI 18456 18653 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_13150 18794 19138 gene locus_tag LOCUS_13160 gene rplT 18794 19138 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_13160 19986 19234 gene locus_tag LOCUS_13170 gene nfsA 19986 19234 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004543.1 protein_id gnl|my_center|LOCUS_13170 20963 20619 gene locus_tag LOCUS_13180 20963 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 21337 20975 gene locus_tag LOCUS_13190 21337 20975 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760687.1 protein_id gnl|my_center|LOCUS_13190 21621 21427 gene locus_tag LOCUS_13200 21621 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 21878 21675 gene locus_tag LOCUS_13210 21878 21675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 22626 22081 gene locus_tag LOCUS_13220 22626 22081 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787692.1 protein_id gnl|my_center|LOCUS_13220 24095 22704 gene locus_tag LOCUS_13230 24095 22704 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_13230 25191 24148 gene locus_tag LOCUS_13240 25191 24148 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_13240 25379 25188 gene locus_tag LOCUS_13250 25379 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 26050 25853 gene locus_tag LOCUS_13260 26050 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 26435 26842 gene locus_tag LOCUS_13270 26435 26842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 26867 27409 gene locus_tag LOCUS_13280 26867 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788217.1 protein_id gnl|my_center|LOCUS_13280 27684 28790 gene locus_tag LOCUS_13290 gene ald 27684 28790 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107857.1 protein_id gnl|my_center|LOCUS_13290 29103 29303 gene locus_tag LOCUS_13300 29103 29303 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_13300 29311 29553 gene locus_tag LOCUS_13310 29311 29553 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_13310 30510 29656 gene locus_tag LOCUS_13320 30510 29656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 31574 30732 gene locus_tag LOCUS_13330 31574 30732 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763207.1 protein_id gnl|my_center|LOCUS_13330 33778 31727 gene locus_tag LOCUS_13340 33778 31727 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_13340 34326 35225 gene locus_tag LOCUS_13350 gene lipA 34326 35225 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764405.1 protein_id gnl|my_center|LOCUS_13350 35258 35941 gene locus_tag LOCUS_13360 gene lipB 35258 35941 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_13360 36688 35906 gene locus_tag LOCUS_13370 36688 35906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_13370 37420 36713 gene locus_tag LOCUS_13380 37420 36713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_13380 37767 38387 gene locus_tag LOCUS_13390 gene udk 37767 38387 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_13390 38402 39334 gene locus_tag LOCUS_13400 gene lptB 38402 39334 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_13400 39321 40226 gene locus_tag LOCUS_13410 39321 40226 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931924.1 protein_id gnl|my_center|LOCUS_13410 40242 41285 gene locus_tag LOCUS_13420 gene holA 40242 41285 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_13420 41309 42085 gene locus_tag LOCUS_13430 41309 42085 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_13430 42633 42091 gene locus_tag LOCUS_13440 42633 42091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 45255 42715 gene locus_tag LOCUS_13450 gene alaS 45255 42715 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_13450 45507 46475 gene locus_tag LOCUS_13460 45507 46475 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_13460 46526 46867 gene locus_tag LOCUS_13470 46526 46867 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_13470 47341 46901 gene locus_tag LOCUS_13480 47341 46901 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_13480 47530 50145 gene locus_tag LOCUS_13490 47530 50145 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_13490 50606 50193 gene locus_tag LOCUS_13500 50606 50193 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_13500 51461 50922 gene locus_tag LOCUS_13510 51461 50922 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_13510 51872 54082 gene locus_tag LOCUS_13520 51872 54082 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_13520 54087 54692 gene locus_tag LOCUS_13530 gene pnuC 54087 54692 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_13530 54878 56182 gene locus_tag LOCUS_13540 54878 56182 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_13540 57110 56169 gene locus_tag LOCUS_13550 57110 56169 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759763.1 protein_id gnl|my_center|LOCUS_13550 57794 57114 gene locus_tag LOCUS_13560 gene mtnN 57794 57114 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209368.1 protein_id gnl|my_center|LOCUS_13560 58736 57819 gene locus_tag LOCUS_13570 58736 57819 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813861.1 protein_id gnl|my_center|LOCUS_13570 59069 58743 gene locus_tag LOCUS_13580 59069 58743 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_13580 59352 60545 gene locus_tag LOCUS_13590 59352 60545 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_13590 60542 61141 gene locus_tag LOCUS_13600 60542 61141 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840622.1 protein_id gnl|my_center|LOCUS_13600 61162 61848 gene locus_tag LOCUS_13610 61162 61848 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_13610 61876 62520 gene locus_tag LOCUS_13620 gene rpe 61876 62520 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_13620 62699 62773 gene locus_tag LOCUS_t00130 62699 62773 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 62893 64857 gene locus_tag LOCUS_13630 62893 64857 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761012.1 protein_id gnl|my_center|LOCUS_13630 64941 65258 gene locus_tag LOCUS_13640 64941 65258 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_13640 66319 65366 gene locus_tag LOCUS_13650 66319 65366 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_13650 67352 66306 gene locus_tag LOCUS_13660 67352 66306 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_13660 67574 68134 gene locus_tag LOCUS_13670 67574 68134 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_13670 68124 69464 gene locus_tag LOCUS_13680 68124 69464 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100232.1 protein_id gnl|my_center|LOCUS_13680 69973 69500 gene locus_tag LOCUS_13690 gene rlmH 69973 69500 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107863.1 protein_id gnl|my_center|LOCUS_13690 70014 70862 gene locus_tag LOCUS_13700 gene nadC 70014 70862 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_13700 70877 71257 gene locus_tag LOCUS_13710 70877 71257 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_13710 73162 71339 gene locus_tag LOCUS_13720 73162 71339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 74023 73178 gene locus_tag LOCUS_13730 gene nfo 74023 73178 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_13730 74215 74892 gene locus_tag LOCUS_13740 74215 74892 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_13740 74983 76344 gene locus_tag LOCUS_13750 gene radA 74983 76344 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_13750 76482 77927 gene locus_tag LOCUS_13760 76482 77927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 78166 78672 gene locus_tag LOCUS_13770 78166 78672 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767710.1 protein_id gnl|my_center|LOCUS_13770 78744 79988 gene locus_tag LOCUS_13780 78744 79988 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_13780 80253 80723 gene locus_tag LOCUS_13790 80253 80723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 81208 81405 gene locus_tag LOCUS_13800 81208 81405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 81562 81774 gene locus_tag LOCUS_13810 81562 81774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 81784 82005 gene locus_tag LOCUS_13820 81784 82005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 83291 82374 gene locus_tag LOCUS_13830 83291 82374 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292180.1 protein_id gnl|my_center|LOCUS_13830 84404 83370 gene locus_tag LOCUS_13840 gene serC 84404 83370 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_13840 85736 84555 gene locus_tag LOCUS_13850 85736 84555 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_13850 86490 85831 gene locus_tag LOCUS_13860 86490 85831 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794216.1 protein_id gnl|my_center|LOCUS_13860 86902 88401 gene locus_tag LOCUS_13870 86902 88401 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_13870 88401 89102 gene locus_tag LOCUS_13880 gene tsaB 88401 89102 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_13880 89178 89783 gene locus_tag LOCUS_13890 89178 89783 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_13890 89796 91109 gene locus_tag LOCUS_13900 gene murA 89796 91109 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_13900 91106 91663 gene locus_tag LOCUS_13910 gene rimM 91106 91663 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_13910 91712 92035 gene locus_tag LOCUS_13920 91712 92035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 92061 92693 gene locus_tag LOCUS_13930 92061 92693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 92726 93241 gene locus_tag LOCUS_13940 gene cobU 92726 93241 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_13940 93283 94332 gene locus_tag LOCUS_13950 gene cobT 93283 94332 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202890.1 protein_id gnl|my_center|LOCUS_13950 94551 95102 gene locus_tag LOCUS_13960 94551 95102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 95099 95641 gene locus_tag LOCUS_13970 gene cobC 95099 95641 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424906.1 protein_id gnl|my_center|LOCUS_13970 96928 95846 gene locus_tag LOCUS_13980 96928 95846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 99349 97811 gene locus_tag LOCUS_13990 gene recJ 99349 97811 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_13990 99831 100607 gene locus_tag LOCUS_14000 99831 100607 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_14000 101320 102282 gene locus_tag LOCUS_14010 101320 102282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 102943 102858 gene locus_tag LOCUS_t00140 102943 102858 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 103088 104143 gene locus_tag LOCUS_14020 103088 104143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 104373 104448 gene locus_tag LOCUS_t00150 104373 104448 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 104492 104567 gene locus_tag LOCUS_t00160 104492 104567 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 104583 104667 gene locus_tag LOCUS_t00170 104583 104667 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 104746 107112 gene locus_tag LOCUS_14030 104746 107112 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_14030 107286 107954 gene locus_tag LOCUS_14040 107286 107954 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788818.1 protein_id gnl|my_center|LOCUS_14040 108186 110039 gene locus_tag LOCUS_14050 gene mutA 108186 110039 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 protein_id gnl|my_center|LOCUS_14050 110041 112194 gene locus_tag LOCUS_14060 gene scpA 110041 112194 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_14060 112315 113046 gene locus_tag LOCUS_14070 112315 113046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 113058 113510 gene locus_tag LOCUS_14080 gene smpB 113058 113510 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_14080 113599 115407 gene locus_tag LOCUS_14090 113599 115407 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_14090 115746 115474 gene locus_tag LOCUS_14100 115746 115474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 118823 116016 gene locus_tag LOCUS_14110 gene uvrA 118823 116016 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_14110 119032 118961 gene locus_tag LOCUS_t00180 119032 118961 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 119125 119054 gene locus_tag LOCUS_t00190 119125 119054 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 119218 119147 gene locus_tag LOCUS_t00200 119218 119147 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 119311 119240 gene locus_tag LOCUS_t00210 119311 119240 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 123793 119669 gene locus_tag LOCUS_14120 123793 119669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 127081 124253 gene locus_tag LOCUS_14130 gene uvrA 127081 124253 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_14130 128316 127147 gene locus_tag LOCUS_14140 128316 127147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 128315 128527 gene locus_tag LOCUS_14150 128315 128527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 129636 129052 gene locus_tag LOCUS_14160 129636 129052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 131741 130494 gene locus_tag LOCUS_14170 131741 130494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 132211 132888 gene locus_tag LOCUS_14180 132211 132888 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_14180 133166 133399 gene locus_tag LOCUS_14190 133166 133399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 133408 135720 gene locus_tag LOCUS_14200 133408 135720 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107378.1 protein_id gnl|my_center|LOCUS_14200 135856 136998 gene locus_tag LOCUS_14210 gene nspC 135856 136998 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence11 174 100 gene locus_tag LOCUS_t00220 174 100 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 297 223 gene locus_tag LOCUS_t00230 297 223 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 617 1900 gene locus_tag LOCUS_14220 gene pepT 617 1900 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_14220 1912 2829 gene locus_tag LOCUS_14230 gene miaA 1912 2829 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_14230 3449 2817 gene locus_tag LOCUS_14240 3449 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3816 4355 gene locus_tag LOCUS_14250 3816 4355 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_14250 4685 5743 gene locus_tag LOCUS_14260 gene trpS 4685 5743 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_14260 5798 7027 gene locus_tag LOCUS_14270 5798 7027 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_14270 7402 7917 gene locus_tag LOCUS_14280 7402 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 8094 9569 gene locus_tag LOCUS_14290 8094 9569 CDS product MutH/Sau3AI family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183204.1 protein_id gnl|my_center|LOCUS_14290 9523 10953 gene locus_tag LOCUS_14300 gene dcm 9523 10953 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962895.1 protein_id gnl|my_center|LOCUS_14300 10967 12628 gene locus_tag LOCUS_14310 10967 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 13057 12809 gene locus_tag LOCUS_14320 13057 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 14492 13254 gene locus_tag LOCUS_14330 14492 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 15396 16727 gene locus_tag LOCUS_14340 15396 16727 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_14340 16862 17344 gene locus_tag LOCUS_14350 16862 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 17561 17887 gene locus_tag LOCUS_14360 17561 17887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 17942 18700 gene locus_tag LOCUS_14370 17942 18700 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_14370 18719 18898 gene locus_tag LOCUS_14380 18719 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 18895 19407 gene locus_tag LOCUS_14390 18895 19407 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766601.1 protein_id gnl|my_center|LOCUS_14390 19881 19588 gene locus_tag LOCUS_14400 19881 19588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 22720 20087 gene locus_tag LOCUS_14410 22720 20087 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_14410 23011 25395 gene locus_tag LOCUS_14420 23011 25395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 25392 26438 gene locus_tag LOCUS_14430 gene mcrC 25392 26438 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_14430 26592 27803 gene locus_tag LOCUS_14440 26592 27803 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803349.1 protein_id gnl|my_center|LOCUS_14440 27822 30914 gene locus_tag LOCUS_14450 27822 30914 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_14450 30911 32095 gene locus_tag LOCUS_14460 30911 32095 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_14460 33119 32184 gene locus_tag LOCUS_14470 33119 32184 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_14470 33340 34806 gene locus_tag LOCUS_14480 33340 34806 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_14480 34808 35635 gene locus_tag LOCUS_14490 34808 35635 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_14490 35963 35622 gene locus_tag LOCUS_14500 35963 35622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 36675 36139 gene locus_tag LOCUS_14510 36675 36139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 37287 36697 gene locus_tag LOCUS_14520 37287 36697 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_14520 38929 37385 gene locus_tag LOCUS_14530 38929 37385 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_14530 39193 39744 gene locus_tag LOCUS_14540 39193 39744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 42185 39768 gene locus_tag LOCUS_14550 42185 39768 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_14550 43014 42445 gene locus_tag LOCUS_14560 43014 42445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 43191 45155 gene locus_tag LOCUS_14570 43191 45155 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_14570 45376 46959 gene locus_tag LOCUS_14580 45376 46959 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_14580 46992 47933 gene locus_tag LOCUS_14590 46992 47933 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288197.1 protein_id gnl|my_center|LOCUS_14590 49062 48043 gene locus_tag LOCUS_14600 49062 48043 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_14600 49968 49090 gene locus_tag LOCUS_14610 gene fabD 49968 49090 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_14610 51541 50150 gene locus_tag LOCUS_14620 51541 50150 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_14620 51825 53126 gene locus_tag LOCUS_14630 gene eno 51825 53126 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_14630 54372 53191 gene locus_tag LOCUS_14640 54372 53191 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_14640 54643 56139 gene locus_tag LOCUS_14650 54643 56139 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_14650 56466 57902 gene locus_tag LOCUS_14660 56466 57902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 59444 58125 gene locus_tag LOCUS_14670 59444 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 59921 61375 gene locus_tag LOCUS_14680 59921 61375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 62933 61593 gene locus_tag LOCUS_14690 62933 61593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 63242 65827 gene locus_tag LOCUS_14700 63242 65827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 66930 65974 gene locus_tag LOCUS_14710 gene bla 66930 65974 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_14710 68517 67063 gene locus_tag LOCUS_14720 68517 67063 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_14720 68991 68698 gene locus_tag LOCUS_14730 68991 68698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_14730 72125 69006 gene locus_tag LOCUS_14740 72125 69006 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_14740 73253 72192 gene locus_tag LOCUS_14750 73253 72192 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762064.1 protein_id gnl|my_center|LOCUS_14750 74605 73319 gene locus_tag LOCUS_14760 74605 73319 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_14760 75505 74822 gene locus_tag LOCUS_14770 75505 74822 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_14770 76634 75675 gene locus_tag LOCUS_14780 76634 75675 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762406.1 protein_id gnl|my_center|LOCUS_14780 76842 78035 gene locus_tag LOCUS_14790 gene kbl 76842 78035 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_14790 78155 78643 gene locus_tag LOCUS_14800 78155 78643 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_14800 78636 79292 gene locus_tag LOCUS_14810 78636 79292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 79309 81888 gene locus_tag LOCUS_14820 79309 81888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 83017 82004 gene locus_tag LOCUS_14830 83017 82004 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107661.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14830 84052 83237 gene locus_tag LOCUS_14840 84052 83237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 86117 84072 gene locus_tag LOCUS_14850 86117 84072 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_14850 88311 86791 gene locus_tag LOCUS_14860 88311 86791 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_14860 89096 88371 gene locus_tag LOCUS_14870 89096 88371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 91300 89093 gene locus_tag LOCUS_14880 91300 89093 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_14880 91790 92506 gene locus_tag LOCUS_14890 91790 92506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 94778 92529 gene locus_tag LOCUS_14900 94778 92529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 96740 94809 gene locus_tag LOCUS_14910 96740 94809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 97867 96743 gene locus_tag LOCUS_14920 97867 96743 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883155.1 protein_id gnl|my_center|LOCUS_14920 98702 97872 gene locus_tag LOCUS_14930 98702 97872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 100418 101977 gene locus_tag LOCUS_14940 100418 101977 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108671.1 protein_id gnl|my_center|LOCUS_14940 103211 102168 gene locus_tag LOCUS_14950 103211 102168 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_14950 106335 103471 gene locus_tag LOCUS_14960 106335 103471 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_14960 106776 107906 gene locus_tag LOCUS_14970 106776 107906 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767707.1 protein_id gnl|my_center|LOCUS_14970 108113 108697 gene locus_tag LOCUS_14980 108113 108697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 109583 109038 gene locus_tag LOCUS_14990 109583 109038 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_14990 109699 111006 gene locus_tag LOCUS_15000 109699 111006 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_15000 111121 111045 gene locus_tag LOCUS_t00240 111121 111045 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 111229 111153 gene locus_tag LOCUS_t00250 111229 111153 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 111987 111406 gene locus_tag LOCUS_15010 gene rsxA 111987 111406 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_15010 112583 111993 gene locus_tag LOCUS_15020 112583 111993 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_15020 113211 112615 gene locus_tag LOCUS_15030 113211 112615 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813361.1 protein_id gnl|my_center|LOCUS_15030 114194 113208 gene locus_tag LOCUS_15040 114194 113208 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_15040 115402 114191 gene locus_tag LOCUS_15050 gene rsxC 115402 114191 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_15050 116327 115635 gene locus_tag LOCUS_15060 116327 115635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15060 116807 116352 gene locus_tag LOCUS_15070 116807 116352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 117700 116909 gene locus_tag LOCUS_15080 117700 116909 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203333.1 protein_id gnl|my_center|LOCUS_15080 117969 118589 gene locus_tag LOCUS_15090 117969 118589 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_15090 118837 120777 gene locus_tag LOCUS_15100 118837 120777 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_15100 122065 120962 gene locus_tag LOCUS_15110 122065 120962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 123041 122151 gene locus_tag LOCUS_15120 123041 122151 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202224.1 protein_id gnl|my_center|LOCUS_15120 124106 123045 gene locus_tag LOCUS_15130 gene aroC 124106 123045 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_15130 124675 124196 gene locus_tag LOCUS_15140 gene ybaK 124675 124196 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_15140 126922 124685 gene locus_tag LOCUS_15150 gene rho 126922 124685 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798804.1 protein_id gnl|my_center|LOCUS_15150 128239 127292 gene locus_tag LOCUS_15160 128239 127292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 128322 128873 gene locus_tag LOCUS_15170 128322 128873 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_15170 129781 129071 gene locus_tag LOCUS_15180 129781 129071 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_15180 130939 129818 gene locus_tag LOCUS_15190 130939 129818 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_15190 132152 130932 gene locus_tag LOCUS_15200 132152 130932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_15200 132911 132168 gene locus_tag LOCUS_15210 132911 132168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_15210 134076 132916 gene locus_tag LOCUS_15220 134076 132916 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_15220 135459 134086 gene locus_tag LOCUS_15230 135459 134086 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 protein_id gnl|my_center|LOCUS_15230 135818 136153 gene locus_tag LOCUS_15240 135818 136153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 136224 136412 gene locus_tag LOCUS_15250 136224 136412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence12 1026 82 gene locus_tag LOCUS_15260 1026 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2160 1690 gene locus_tag LOCUS_15270 2160 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4102 2396 gene locus_tag LOCUS_15280 gene menD 4102 2396 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_15280 5100 4099 gene locus_tag LOCUS_15290 gene fmt 5100 4099 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_15290 6931 5129 gene locus_tag LOCUS_15300 6931 5129 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_15300 8331 6943 gene locus_tag LOCUS_15310 8331 6943 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143780.1 protein_id gnl|my_center|LOCUS_15310 8980 8414 gene locus_tag LOCUS_15320 8980 8414 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_15320 10950 8998 gene locus_tag LOCUS_15330 10950 8998 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_15330 12232 11111 gene locus_tag LOCUS_15340 12232 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 13884 12415 gene locus_tag LOCUS_15350 13884 12415 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_15350 15438 13921 gene locus_tag LOCUS_15360 15438 13921 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785038.1 protein_id gnl|my_center|LOCUS_15360 17422 15473 gene locus_tag LOCUS_15370 gene nuoL 17422 15473 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_15370 17737 17426 gene locus_tag LOCUS_15380 gene nuoK 17737 17426 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_15380 18271 17744 gene locus_tag LOCUS_15390 18271 17744 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 protein_id gnl|my_center|LOCUS_15390 18940 18308 gene locus_tag LOCUS_15400 18940 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 19875 18985 gene locus_tag LOCUS_15410 19875 18985 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_15410 21562 19988 gene locus_tag LOCUS_15420 gene atpA 21562 19988 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_15420 22112 21567 gene locus_tag LOCUS_15430 gene atpH 22112 21567 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_15430 22611 22117 gene locus_tag LOCUS_15440 gene atpF 22611 22117 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_15440 22887 22642 gene locus_tag LOCUS_15450 22887 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 24187 22934 gene locus_tag LOCUS_15460 gene atpB 24187 22934 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_15460 24527 24291 gene locus_tag LOCUS_15470 24527 24291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 26073 24571 gene locus_tag LOCUS_15480 gene atpD 26073 24571 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_15480 27182 26106 gene locus_tag LOCUS_15490 gene nuoH 27182 26106 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_15490 28868 27237 gene locus_tag LOCUS_15500 28868 27237 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760950.1 protein_id gnl|my_center|LOCUS_15500 29525 28914 gene locus_tag LOCUS_15510 29525 28914 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_15510 29887 29516 gene locus_tag LOCUS_15520 29887 29516 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_15520 31144 30146 gene locus_tag LOCUS_15530 31144 30146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 33453 31243 gene locus_tag LOCUS_15540 33453 31243 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_15540 33613 34827 gene locus_tag LOCUS_15550 33613 34827 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_15550 35092 34916 gene locus_tag LOCUS_15560 35092 34916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 35024 35734 gene locus_tag LOCUS_15570 35024 35734 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_15570 41526 35884 gene locus_tag LOCUS_15580 41526 35884 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072066367.1 protein_id gnl|my_center|LOCUS_15580 42190 41732 gene locus_tag LOCUS_15590 42190 41732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 42763 42281 gene locus_tag LOCUS_15600 42763 42281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 43577 43023 gene locus_tag LOCUS_15610 43577 43023 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_15610 43794 43606 gene locus_tag LOCUS_15620 43794 43606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 43831 44463 gene locus_tag LOCUS_15630 43831 44463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 44709 45203 gene locus_tag LOCUS_15640 44709 45203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 45391 45310 gene locus_tag LOCUS_t00260 45391 45310 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46164 45601 gene locus_tag LOCUS_15650 46164 45601 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940933.1 protein_id gnl|my_center|LOCUS_15650 46618 47505 gene locus_tag LOCUS_15660 46618 47505 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_15660 47674 50424 gene locus_tag LOCUS_15670 47674 50424 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_15670 50481 51338 gene locus_tag LOCUS_15680 50481 51338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 51340 52401 gene locus_tag LOCUS_15690 51340 52401 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_15690 52663 52427 gene locus_tag LOCUS_15700 52663 52427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797802.1 protein_id gnl|my_center|LOCUS_15700 52886 53848 gene locus_tag LOCUS_15710 52886 53848 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_15710 53966 55825 gene locus_tag LOCUS_15720 gene aspS 53966 55825 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_15720 55846 56646 gene locus_tag LOCUS_15730 55846 56646 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_15730 56663 57475 gene locus_tag LOCUS_15740 56663 57475 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_15740 58142 57543 gene locus_tag LOCUS_15750 58142 57543 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_15750 58461 58129 gene locus_tag LOCUS_15760 58461 58129 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764612.1 protein_id gnl|my_center|LOCUS_15760 59121 58465 gene locus_tag LOCUS_15770 gene queC 59121 58465 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 protein_id gnl|my_center|LOCUS_15770 59647 59135 gene locus_tag LOCUS_15780 gene queF 59647 59135 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689837.1 protein_id gnl|my_center|LOCUS_15780 61276 59831 gene locus_tag LOCUS_15790 61276 59831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 62959 61448 gene locus_tag LOCUS_15800 62959 61448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 63188 63601 gene locus_tag LOCUS_15810 63188 63601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 65702 63795 gene locus_tag LOCUS_15820 65702 63795 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_15820 65996 67009 gene locus_tag LOCUS_15830 gene pta 65996 67009 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_15830 67033 68226 gene locus_tag LOCUS_15840 67033 68226 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_15840 68311 69207 gene locus_tag LOCUS_15850 gene lgt 68311 69207 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_15850 70572 69352 gene locus_tag LOCUS_15860 70572 69352 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_15860 71934 70576 gene locus_tag LOCUS_15870 gene sufD 71934 70576 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201910.1 protein_id gnl|my_center|LOCUS_15870 72706 71939 gene locus_tag LOCUS_15880 gene sufC 72706 71939 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_15880 73055 72699 gene locus_tag LOCUS_15890 73055 72699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 73638 74354 gene locus_tag LOCUS_15900 73638 74354 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208150.1 protein_id gnl|my_center|LOCUS_15900 74538 77867 gene locus_tag LOCUS_15910 gene porU 74538 77867 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_15910 77891 78526 gene locus_tag LOCUS_15920 77891 78526 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_15920 78526 79131 gene locus_tag LOCUS_15930 78526 79131 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 protein_id gnl|my_center|LOCUS_15930 79141 80364 gene locus_tag LOCUS_15940 gene porV 79141 80364 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_15940 80553 81029 gene locus_tag LOCUS_15950 gene ispF 80553 81029 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_15950 81019 83127 gene locus_tag LOCUS_15960 81019 83127 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_15960 83368 83138 gene locus_tag LOCUS_15970 83368 83138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 83846 83370 gene locus_tag LOCUS_15980 83846 83370 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803082.1 protein_id gnl|my_center|LOCUS_15980 84082 83843 gene locus_tag LOCUS_15990 84082 83843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 84473 85687 gene locus_tag LOCUS_16000 84473 85687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 88265 85698 gene locus_tag LOCUS_16010 88265 85698 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_16010 88320 88448 gene locus_tag LOCUS_16020 88320 88448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 89784 88582 gene locus_tag LOCUS_16030 gene dnaJ 89784 88582 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_16030 90442 89831 gene locus_tag LOCUS_16040 90442 89831 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_16040 91489 90599 gene locus_tag LOCUS_16050 gene ispE 91489 90599 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107363.1 protein_id gnl|my_center|LOCUS_16050 92818 91493 gene locus_tag LOCUS_16060 92818 91493 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_16060 94107 92890 gene locus_tag LOCUS_16070 94107 92890 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_16070 94713 94177 gene locus_tag LOCUS_16080 94713 94177 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_16080 95443 94718 gene locus_tag LOCUS_16090 95443 94718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 96615 95569 gene locus_tag LOCUS_16100 96615 95569 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_16100 97750 96869 gene locus_tag LOCUS_16110 97750 96869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 98170 98976 gene locus_tag LOCUS_16120 98170 98976 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109300.1 protein_id gnl|my_center|LOCUS_16120 99164 99835 gene locus_tag LOCUS_16130 99164 99835 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942617.1 protein_id gnl|my_center|LOCUS_16130 100013 101011 gene locus_tag LOCUS_16140 gene neuB 100013 101011 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_16140 101031 102188 gene locus_tag LOCUS_16150 gene neuC 101031 102188 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459665.1 protein_id gnl|my_center|LOCUS_16150 102276 103322 gene locus_tag LOCUS_16160 102276 103322 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761025.1 protein_id gnl|my_center|LOCUS_16160 103939 103415 gene locus_tag LOCUS_16170 103939 103415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 104927 104064 gene locus_tag LOCUS_16180 104927 104064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 105662 104952 gene locus_tag LOCUS_16190 gene rsmI 105662 104952 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_16190 106424 105699 gene locus_tag LOCUS_16200 106424 105699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 107649 106417 gene locus_tag LOCUS_16210 107649 106417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 107915 109018 gene locus_tag LOCUS_16220 107915 109018 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_16220 109076 111415 gene locus_tag LOCUS_16230 109076 111415 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_16230 112146 111526 gene locus_tag LOCUS_16240 112146 111526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 114221 112200 gene locus_tag LOCUS_16250 114221 112200 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_16250 114982 114218 gene locus_tag LOCUS_16260 114982 114218 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_16260 115947 114979 gene locus_tag LOCUS_16270 115947 114979 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_16270 116586 115951 gene locus_tag LOCUS_16280 116586 115951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 116750 116838 gene locus_tag LOCUS_t00270 116750 116838 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 117236 116901 gene locus_tag LOCUS_16290 117236 116901 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_16290 117504 117250 gene locus_tag LOCUS_16300 117504 117250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 118983 117775 gene locus_tag LOCUS_16310 118983 117775 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048040655.1 protein_id gnl|my_center|LOCUS_16310 120006 119149 gene locus_tag LOCUS_16320 120006 119149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 121710 120034 gene locus_tag LOCUS_16330 121710 120034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 124957 121742 gene locus_tag LOCUS_16340 124957 121742 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_16340 126422 125142 gene locus_tag LOCUS_16350 126422 125142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence13 710 507 gene locus_tag LOCUS_16360 710 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 2807 714 gene locus_tag LOCUS_16370 2807 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4292 2838 gene locus_tag LOCUS_16380 4292 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4648 4421 gene locus_tag LOCUS_16390 4648 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5085 4714 gene locus_tag LOCUS_16400 5085 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 6941 5310 gene locus_tag LOCUS_16410 6941 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761175.1 protein_id gnl|my_center|LOCUS_16410 8138 7086 gene locus_tag LOCUS_16420 gene queA 8138 7086 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_16420 8997 8158 gene locus_tag LOCUS_16430 gene truB 8997 8158 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_16430 9821 8994 gene locus_tag LOCUS_16440 9821 8994 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767449.1 protein_id gnl|my_center|LOCUS_16440 10115 9831 gene locus_tag LOCUS_16450 10115 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 11087 10209 gene locus_tag LOCUS_16460 11087 10209 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_16460 12640 11348 gene locus_tag LOCUS_16470 gene argH 12640 11348 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_16470 13736 12642 gene locus_tag LOCUS_16480 13736 12642 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_16480 14506 13733 gene locus_tag LOCUS_16490 gene argB 14506 13733 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_16490 15498 14545 gene locus_tag LOCUS_16500 15498 14545 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_16500 16616 15495 gene locus_tag LOCUS_16510 16616 15495 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_16510 17633 16665 gene locus_tag LOCUS_16520 gene argC 17633 16665 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_16520 18851 17634 gene locus_tag LOCUS_16530 18851 17634 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_16530 19566 18937 gene locus_tag LOCUS_16540 19566 18937 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_16540 20045 20656 gene locus_tag LOCUS_16550 20045 20656 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_16550 20684 22057 gene locus_tag LOCUS_16560 20684 22057 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764614.1 protein_id gnl|my_center|LOCUS_16560 22098 22706 gene locus_tag LOCUS_16570 22098 22706 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764615.1 protein_id gnl|my_center|LOCUS_16570 22745 24331 gene locus_tag LOCUS_16580 22745 24331 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107792.1 protein_id gnl|my_center|LOCUS_16580 25446 24454 gene locus_tag LOCUS_16590 25446 24454 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_16590 26810 25479 gene locus_tag LOCUS_16600 gene mtaB 26810 25479 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_16600 27012 27785 gene locus_tag LOCUS_16610 gene surE 27012 27785 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784852.1 protein_id gnl|my_center|LOCUS_16610 28223 30697 gene locus_tag LOCUS_16620 28223 30697 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_16620 31056 30850 gene locus_tag LOCUS_16630 31056 30850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 32499 31102 gene locus_tag LOCUS_16640 gene xseA 32499 31102 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_16640 33587 32496 gene locus_tag LOCUS_16650 33587 32496 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_16650 35166 33592 gene locus_tag LOCUS_16660 35166 33592 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_16660 35418 36470 gene locus_tag LOCUS_16670 35418 36470 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107721.1 protein_id gnl|my_center|LOCUS_16670 36645 37646 gene locus_tag LOCUS_16680 36645 37646 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_16680 38904 37768 gene locus_tag LOCUS_16690 38904 37768 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_16690 39200 40429 gene locus_tag LOCUS_16700 39200 40429 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_16700 42126 41548 gene locus_tag LOCUS_16710 42126 41548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 43262 42141 gene locus_tag LOCUS_16720 43262 42141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 44262 43327 gene locus_tag LOCUS_16730 44262 43327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 45017 44289 gene locus_tag LOCUS_16740 45017 44289 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_16740 47485 45083 gene locus_tag LOCUS_16750 47485 45083 CDS product tyrosine-protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765281.1 protein_id gnl|my_center|LOCUS_16750 48404 47574 gene locus_tag LOCUS_16760 48404 47574 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_16760 49552 48425 gene locus_tag LOCUS_16770 49552 48425 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_16770 49929 51386 gene locus_tag LOCUS_16780 49929 51386 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_16780 51383 51838 gene locus_tag LOCUS_16790 51383 51838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 51999 53981 gene locus_tag LOCUS_16800 51999 53981 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_16800 55233 54118 gene locus_tag LOCUS_16810 gene prfB 55233 54118 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800204.1 protein_id gnl|my_center|LOCUS_16810 57097 55280 gene locus_tag LOCUS_16820 57097 55280 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784128.1 protein_id gnl|my_center|LOCUS_16820 58347 57241 gene locus_tag LOCUS_16830 gene meaB 58347 57241 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_16830 59479 58400 gene locus_tag LOCUS_16840 59479 58400 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_16840 59896 59489 gene locus_tag LOCUS_16850 59896 59489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 60160 61116 gene locus_tag LOCUS_16860 60160 61116 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_16860 61157 62134 gene locus_tag LOCUS_16870 gene legB 61157 62134 CDS product 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786732.1 protein_id gnl|my_center|LOCUS_16870 62131 63084 gene locus_tag LOCUS_16880 62131 63084 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965488.1 protein_id gnl|my_center|LOCUS_16880 63071 63790 gene locus_tag LOCUS_16890 63071 63790 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_16890 63765 65897 gene locus_tag LOCUS_16900 gene recQ 63765 65897 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555810.1 protein_id gnl|my_center|LOCUS_16900 66031 66106 gene locus_tag LOCUS_t00280 66031 66106 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 66826 66209 gene locus_tag LOCUS_16910 66826 66209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 66989 67726 gene locus_tag LOCUS_16920 66989 67726 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_16920 67886 67971 gene locus_tag LOCUS_t00290 67886 67971 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 68725 68108 gene locus_tag LOCUS_16930 68725 68108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 69294 68722 gene locus_tag LOCUS_16940 69294 68722 CDS product holin-associated N-acetylmuramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337867.1 protein_id gnl|my_center|LOCUS_16940 69916 69311 gene locus_tag LOCUS_16950 69916 69311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 70354 69932 gene locus_tag LOCUS_16960 70354 69932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 71363 70332 gene locus_tag LOCUS_16970 71363 70332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 71996 71643 gene locus_tag LOCUS_16980 71996 71643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 73421 72093 gene locus_tag LOCUS_16990 73421 72093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 73695 73435 gene locus_tag LOCUS_17000 73695 73435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 78174 73831 gene locus_tag LOCUS_17010 78174 73831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 79376 78159 gene locus_tag LOCUS_17020 79376 78159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 79887 79378 gene locus_tag LOCUS_17030 79887 79378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 84123 79900 gene locus_tag LOCUS_17040 84123 79900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 84308 84120 gene locus_tag LOCUS_17050 84308 84120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 84934 84359 gene locus_tag LOCUS_17060 84934 84359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 85519 85013 gene locus_tag LOCUS_17070 85519 85013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 85956 85540 gene locus_tag LOCUS_17080 85956 85540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 86417 85956 gene locus_tag LOCUS_17090 86417 85956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 86806 86408 gene locus_tag LOCUS_17100 86806 86408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 87111 86800 gene locus_tag LOCUS_17110 87111 86800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 88348 87242 gene locus_tag LOCUS_17120 88348 87242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 88947 88372 gene locus_tag LOCUS_17130 88947 88372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 89706 88981 gene locus_tag LOCUS_17140 89706 88981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 90148 90651 gene locus_tag LOCUS_17150 90148 90651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 90659 90904 gene locus_tag LOCUS_17160 90659 90904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 91089 91313 gene locus_tag LOCUS_17170 91089 91313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 91363 91656 gene locus_tag LOCUS_17180 91363 91656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 91660 91962 gene locus_tag LOCUS_17190 91660 91962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 94237 91955 gene locus_tag LOCUS_17200 94237 91955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 95891 94404 gene locus_tag LOCUS_17210 95891 94404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 97374 95914 gene locus_tag LOCUS_17220 97374 95914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 97817 97374 gene locus_tag LOCUS_17230 97817 97374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 99268 97850 gene locus_tag LOCUS_17240 99268 97850 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940138.1 protein_id gnl|my_center|LOCUS_17240 99722 99444 gene locus_tag LOCUS_17250 99722 99444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 100196 99729 gene locus_tag LOCUS_17260 100196 99729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 100604 100299 gene locus_tag LOCUS_17270 100604 100299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 101415 100702 gene locus_tag LOCUS_17280 101415 100702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 102030 101422 gene locus_tag LOCUS_17290 102030 101422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 102785 102138 gene locus_tag LOCUS_17300 102785 102138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 103344 102742 gene locus_tag LOCUS_17310 103344 102742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 104449 103583 gene locus_tag LOCUS_17320 104449 103583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 104743 104453 gene locus_tag LOCUS_17330 104743 104453 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_17330 105326 104757 gene locus_tag LOCUS_17340 105326 104757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 105554 105351 gene locus_tag LOCUS_17350 105554 105351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 105754 105551 gene locus_tag LOCUS_17360 105754 105551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 106509 105757 gene locus_tag LOCUS_17370 106509 105757 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390536.1 protein_id gnl|my_center|LOCUS_17370 107411 106509 gene locus_tag LOCUS_17380 107411 106509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 109531 107426 gene locus_tag LOCUS_17390 109531 107426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 109849 109556 gene locus_tag LOCUS_17400 109849 109556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 110087 109836 gene locus_tag LOCUS_17410 110087 109836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 110491 110084 gene locus_tag LOCUS_17420 110491 110084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 110724 110482 gene locus_tag LOCUS_17430 110724 110482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 111147 110923 gene locus_tag LOCUS_17440 111147 110923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 111374 111144 gene locus_tag LOCUS_17450 111374 111144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 111734 111387 gene locus_tag LOCUS_17460 111734 111387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 111784 112191 gene locus_tag LOCUS_17470 111784 112191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 112417 112596 gene locus_tag LOCUS_17480 112417 112596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 112584 112898 gene locus_tag LOCUS_17490 112584 112898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 112882 114219 gene locus_tag LOCUS_17500 112882 114219 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_17500 114702 115358 gene locus_tag LOCUS_17510 114702 115358 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_17510 115791 117020 gene locus_tag LOCUS_17520 115791 117020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 117044 117880 gene locus_tag LOCUS_17530 117044 117880 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence14 3683 333 gene locus_tag LOCUS_17540 3683 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 5093 3684 gene locus_tag LOCUS_17550 5093 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 5600 6796 gene locus_tag LOCUS_17560 5600 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 7347 6868 gene locus_tag LOCUS_17570 7347 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 8567 7719 gene locus_tag LOCUS_17580 8567 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 8947 8741 gene locus_tag LOCUS_17590 8947 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 9769 9062 gene locus_tag LOCUS_17600 9769 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10878 10150 gene locus_tag LOCUS_17610 10878 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 11667 11401 gene locus_tag LOCUS_17620 11667 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 13879 11669 gene locus_tag LOCUS_17630 13879 11669 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_17630 16455 13876 gene locus_tag LOCUS_17640 16455 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 17291 16452 gene locus_tag LOCUS_17650 17291 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 17525 17364 gene locus_tag LOCUS_17660 17525 17364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 18320 17637 gene locus_tag LOCUS_17670 18320 17637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 19066 18890 gene locus_tag LOCUS_17680 19066 18890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 20681 19167 gene locus_tag LOCUS_17690 20681 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 21100 20732 gene locus_tag LOCUS_17700 21100 20732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 22968 21241 gene locus_tag LOCUS_17710 22968 21241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_17710 24993 23146 gene locus_tag LOCUS_17720 24993 23146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 27176 25335 gene locus_tag LOCUS_17730 27176 25335 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183761824.1 protein_id gnl|my_center|LOCUS_17730 29129 27219 gene locus_tag LOCUS_17740 29129 27219 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229046.1 protein_id gnl|my_center|LOCUS_17740 30722 29148 gene locus_tag LOCUS_17750 30722 29148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107132.1 protein_id gnl|my_center|LOCUS_17750 32040 30793 gene locus_tag LOCUS_17760 32040 30793 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_17760 33745 32072 gene locus_tag LOCUS_17770 33745 32072 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_17770 36291 34033 gene locus_tag LOCUS_17780 36291 34033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 39320 36627 gene locus_tag LOCUS_17790 39320 36627 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107134.1 protein_id gnl|my_center|LOCUS_17790 40000 40794 gene locus_tag LOCUS_17800 40000 40794 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783664.1 protein_id gnl|my_center|LOCUS_17800 40798 42219 gene locus_tag LOCUS_17810 40798 42219 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_17810 42221 43141 gene locus_tag LOCUS_17820 gene kduI 42221 43141 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_17820 44172 43219 gene locus_tag LOCUS_17830 44172 43219 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_17830 44568 44284 gene locus_tag LOCUS_17840 44568 44284 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916506.1 protein_id gnl|my_center|LOCUS_17840 44804 44565 gene locus_tag LOCUS_17850 44804 44565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 45925 45104 gene locus_tag LOCUS_17860 45925 45104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 46700 45972 gene locus_tag LOCUS_17870 46700 45972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 47182 46697 gene locus_tag LOCUS_17880 47182 46697 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791699.1 protein_id gnl|my_center|LOCUS_17880 49217 47496 gene locus_tag LOCUS_17890 49217 47496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 49933 51174 gene locus_tag LOCUS_17900 49933 51174 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478434.1 protein_id gnl|my_center|LOCUS_17900 51178 51819 gene locus_tag LOCUS_17910 51178 51819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 52078 51830 gene locus_tag LOCUS_17920 52078 51830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 52223 53584 gene locus_tag LOCUS_17930 52223 53584 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785877.1 protein_id gnl|my_center|LOCUS_17930 56190 53752 gene locus_tag LOCUS_17940 56190 53752 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_17940 56609 57967 gene locus_tag LOCUS_17950 56609 57967 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_17950 60264 58042 gene locus_tag LOCUS_17960 60264 58042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 60651 60385 gene locus_tag LOCUS_17970 60651 60385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 61324 60752 gene locus_tag LOCUS_17980 61324 60752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 62681 61404 gene locus_tag LOCUS_17990 62681 61404 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803026.1 protein_id gnl|my_center|LOCUS_17990 63513 62740 gene locus_tag LOCUS_18000 63513 62740 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791104.1 protein_id gnl|my_center|LOCUS_18000 65424 63685 gene locus_tag LOCUS_18010 65424 63685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 68699 65448 gene locus_tag LOCUS_18020 68699 65448 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_18020 70434 69112 gene locus_tag LOCUS_18030 70434 69112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 71819 70515 gene locus_tag LOCUS_18040 71819 70515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 72796 71975 gene locus_tag LOCUS_18050 gene panB 72796 71975 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787461.1 protein_id gnl|my_center|LOCUS_18050 73130 75892 gene locus_tag LOCUS_18060 gene leuS 73130 75892 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_18060 75994 76593 gene locus_tag LOCUS_18070 75994 76593 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963926.1 protein_id gnl|my_center|LOCUS_18070 76615 79074 gene locus_tag LOCUS_18080 76615 79074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 79106 79876 gene locus_tag LOCUS_18090 gene trmB 79106 79876 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_18090 79931 81055 gene locus_tag LOCUS_18100 79931 81055 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_18100 82212 81166 gene locus_tag LOCUS_18110 82212 81166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 83416 82223 gene locus_tag LOCUS_18120 83416 82223 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 protein_id gnl|my_center|LOCUS_18120 84319 83474 gene locus_tag LOCUS_18130 84319 83474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 84813 86195 gene locus_tag LOCUS_18140 84813 86195 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787452.1 protein_id gnl|my_center|LOCUS_18140 86192 87742 gene locus_tag LOCUS_18150 86192 87742 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_18150 88073 88714 gene locus_tag LOCUS_18160 88073 88714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 88761 90854 gene locus_tag LOCUS_18170 88761 90854 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790480.1 protein_id gnl|my_center|LOCUS_18170 91040 93634 gene locus_tag LOCUS_18180 91040 93634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 93693 94577 gene locus_tag LOCUS_18190 93693 94577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 94613 96301 gene locus_tag LOCUS_18200 94613 96301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_18200 96335 96658 gene locus_tag LOCUS_18210 96335 96658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 96628 97281 gene locus_tag LOCUS_18220 96628 97281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18220 98211 97288 gene locus_tag LOCUS_18230 98211 97288 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_18230 102365 98217 gene locus_tag LOCUS_18240 102365 98217 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_18240 102786 102367 gene locus_tag LOCUS_18250 102786 102367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 103235 104380 gene locus_tag LOCUS_18260 103235 104380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 106030 104381 gene locus_tag LOCUS_18270 106030 104381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 106760 106209 gene locus_tag LOCUS_18280 106760 106209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 107413 106787 gene locus_tag LOCUS_18290 107413 106787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence15 507 40 gene locus_tag LOCUS_18300 507 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2424 535 gene locus_tag LOCUS_18310 2424 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 3346 2426 gene locus_tag LOCUS_18320 gene prpC 3346 2426 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_18320 4119 3343 gene locus_tag LOCUS_18330 4119 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4941 4123 gene locus_tag LOCUS_18340 4941 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5787 5065 gene locus_tag LOCUS_18350 5787 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 6443 5799 gene locus_tag LOCUS_18360 6443 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6825 6448 gene locus_tag LOCUS_18370 6825 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 7460 8623 gene locus_tag LOCUS_18380 7460 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 8891 10030 gene locus_tag LOCUS_18390 gene fucP 8891 10030 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_18390 10078 10947 gene locus_tag LOCUS_18400 10078 10947 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_18400 12308 10950 gene locus_tag LOCUS_18410 12308 10950 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_18410 14877 12595 gene locus_tag LOCUS_18420 14877 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 15370 15104 gene locus_tag LOCUS_18430 15370 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 17564 15372 gene locus_tag LOCUS_18440 17564 15372 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_18440 19855 17582 gene locus_tag LOCUS_18450 19855 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 21346 19940 gene locus_tag LOCUS_18460 21346 19940 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993585.1 protein_id gnl|my_center|LOCUS_18460 21570 21331 gene locus_tag LOCUS_18470 21570 21331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 22103 21753 gene locus_tag LOCUS_18480 22103 21753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 22472 24130 gene locus_tag LOCUS_18490 22472 24130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 26537 24171 gene locus_tag LOCUS_18500 gene pnp 26537 24171 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_18500 26659 27753 gene locus_tag LOCUS_18510 26659 27753 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_18510 27799 28956 gene locus_tag LOCUS_18520 27799 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 28970 29326 gene locus_tag LOCUS_18530 28970 29326 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_18530 29348 32836 gene locus_tag LOCUS_18540 29348 32836 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_18540 32945 34282 gene locus_tag LOCUS_18550 32945 34282 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_18550 34285 35010 gene locus_tag LOCUS_18560 34285 35010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 35288 35031 gene locus_tag LOCUS_18570 35288 35031 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786499.1 protein_id gnl|my_center|LOCUS_18570 36111 35296 gene locus_tag LOCUS_18580 gene murI 36111 35296 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108947.1 protein_id gnl|my_center|LOCUS_18580 36738 36232 gene locus_tag LOCUS_18590 36738 36232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 37335 36820 gene locus_tag LOCUS_18600 37335 36820 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_18600 40162 37502 gene locus_tag LOCUS_18610 40162 37502 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_18610 40935 40159 gene locus_tag LOCUS_18620 40935 40159 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_18620 41607 40942 gene locus_tag LOCUS_18630 41607 40942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 43221 41674 gene locus_tag LOCUS_18640 43221 41674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 44284 43355 gene locus_tag LOCUS_18650 gene ribD 44284 43355 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_18650 46419 44371 gene locus_tag LOCUS_18660 46419 44371 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_18660 47618 46506 gene locus_tag LOCUS_18670 47618 46506 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_18670 48548 47667 gene locus_tag LOCUS_18680 48548 47667 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_18680 49179 48532 gene locus_tag LOCUS_18690 49179 48532 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_18690 49467 51806 gene locus_tag LOCUS_18700 49467 51806 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_18700 52043 52306 gene locus_tag LOCUS_18710 52043 52306 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_18710 52500 54275 gene locus_tag LOCUS_18720 gene argS 52500 54275 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_18720 54419 55141 gene locus_tag LOCUS_18730 54419 55141 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_18730 57203 55626 gene locus_tag LOCUS_18740 57203 55626 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_18740 58853 57264 gene locus_tag LOCUS_18750 58853 57264 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_18750 59862 59254 gene locus_tag LOCUS_18760 gene hisIE 59862 59254 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_18760 60781 60026 gene locus_tag LOCUS_18770 gene hisF 60781 60026 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_18770 61538 60816 gene locus_tag LOCUS_18780 gene hisA 61538 60816 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_18780 62141 61557 gene locus_tag LOCUS_18790 gene hisH 62141 61557 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_18790 63244 62138 gene locus_tag LOCUS_18800 gene hisB 63244 62138 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_18800 64304 63270 gene locus_tag LOCUS_18810 gene hisC 64304 63270 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_18810 65605 64310 gene locus_tag LOCUS_18820 gene hisD 65605 64310 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_18820 66456 65605 gene locus_tag LOCUS_18830 gene hisG 66456 65605 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_18830 68585 66684 gene locus_tag LOCUS_18840 68585 66684 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_18840 68733 70061 gene locus_tag LOCUS_18850 68733 70061 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082638.1 protein_id gnl|my_center|LOCUS_18850 70215 70130 gene locus_tag LOCUS_t00300 70215 70130 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 70424 70284 gene locus_tag LOCUS_18860 70424 70284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 70643 71803 gene locus_tag LOCUS_18870 70643 71803 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_18870 71927 73624 gene locus_tag LOCUS_18880 71927 73624 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_18880 73667 74326 gene locus_tag LOCUS_18890 73667 74326 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_18890 74404 75090 gene locus_tag LOCUS_18900 74404 75090 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_18900 75239 76768 gene locus_tag LOCUS_18910 gene araA 75239 76768 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_18910 76780 78378 gene locus_tag LOCUS_18920 76780 78378 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_18920 82565 78597 gene locus_tag LOCUS_18930 82565 78597 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 protein_id gnl|my_center|LOCUS_18930 83962 82577 gene locus_tag LOCUS_18940 83962 82577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 84308 84487 gene locus_tag LOCUS_18950 84308 84487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 84491 84682 gene locus_tag LOCUS_18960 84491 84682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 84697 85095 gene locus_tag LOCUS_18970 84697 85095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18970 86022 85231 gene locus_tag LOCUS_18980 86022 85231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 88507 86219 gene locus_tag LOCUS_18990 88507 86219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 89845 88586 gene locus_tag LOCUS_19000 89845 88586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 90250 89852 gene locus_tag LOCUS_19010 90250 89852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 91320 90307 gene locus_tag LOCUS_19020 91320 90307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 93018 91351 gene locus_tag LOCUS_19030 93018 91351 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_19030 96075 93031 gene locus_tag LOCUS_19040 96075 93031 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_19040 98558 96105 gene locus_tag LOCUS_19050 98558 96105 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_19050 98778 100763 gene locus_tag LOCUS_19060 98778 100763 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_19060 101051 103408 gene locus_tag LOCUS_19070 101051 103408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 103525 105939 gene locus_tag LOCUS_19080 103525 105939 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_19080 106268 107305 gene locus_tag LOCUS_19090 106268 107305 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence16 122 907 gene locus_tag LOCUS_19100 122 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 904 4110 gene locus_tag LOCUS_19110 904 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_19110 4107 5213 gene locus_tag LOCUS_19120 4107 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 5220 7493 gene locus_tag LOCUS_19130 5220 7493 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_19130 7490 7723 gene locus_tag LOCUS_19140 7490 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 7720 9879 gene locus_tag LOCUS_19150 7720 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 9881 10468 gene locus_tag LOCUS_19160 9881 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 10886 10623 gene locus_tag LOCUS_19170 10886 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 11574 10879 gene locus_tag LOCUS_19180 11574 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 12009 11578 gene locus_tag LOCUS_19190 12009 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 12206 12124 gene locus_tag LOCUS_t00310 12206 12124 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13098 12427 gene locus_tag LOCUS_19200 13098 12427 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963332.1 protein_id gnl|my_center|LOCUS_19200 13996 13118 gene locus_tag LOCUS_19210 13996 13118 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108724.1 protein_id gnl|my_center|LOCUS_19210 14288 16990 gene locus_tag LOCUS_19220 gene polA 14288 16990 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_19220 18104 17013 gene locus_tag LOCUS_19230 18104 17013 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922545.1 protein_id gnl|my_center|LOCUS_19230 19284 18175 gene locus_tag LOCUS_19240 19284 18175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 20055 19528 gene locus_tag LOCUS_19250 20055 19528 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_19250 23486 20058 gene locus_tag LOCUS_19260 23486 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 24418 23669 gene locus_tag LOCUS_19270 24418 23669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108118.1 protein_id gnl|my_center|LOCUS_19270 25224 24415 gene locus_tag LOCUS_19280 25224 24415 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_19280 26437 25208 gene locus_tag LOCUS_19290 26437 25208 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_19290 27291 26512 gene locus_tag LOCUS_19300 27291 26512 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_19300 28699 27689 gene locus_tag LOCUS_19310 28699 27689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 29699 28974 gene locus_tag LOCUS_19320 29699 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 30067 29696 gene locus_tag LOCUS_19330 30067 29696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 31788 32924 gene locus_tag LOCUS_19340 31788 32924 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120046688.1 protein_id gnl|my_center|LOCUS_19340 33429 33998 gene locus_tag LOCUS_19350 33429 33998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19350 33995 34624 gene locus_tag LOCUS_19360 33995 34624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19360 34937 36775 gene locus_tag LOCUS_19370 34937 36775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_19370 36908 37750 gene locus_tag LOCUS_19380 36908 37750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 37764 38150 gene locus_tag LOCUS_19390 37764 38150 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728907.1 protein_id gnl|my_center|LOCUS_19390 39466 38243 gene locus_tag LOCUS_19400 39466 38243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 protein_id gnl|my_center|LOCUS_19400 40677 39511 gene locus_tag LOCUS_19410 40677 39511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 protein_id gnl|my_center|LOCUS_19410 41785 40733 gene locus_tag LOCUS_19420 41785 40733 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_19420 43309 41879 gene locus_tag LOCUS_19430 43309 41879 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_19430 43671 45065 gene locus_tag LOCUS_19440 43671 45065 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_19440 45145 45921 gene locus_tag LOCUS_19450 45145 45921 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_19450 45988 46863 gene locus_tag LOCUS_19460 45988 46863 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_19460 46865 47623 gene locus_tag LOCUS_19470 46865 47623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 47636 49294 gene locus_tag LOCUS_19480 47636 49294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 50016 49438 gene locus_tag LOCUS_19490 50016 49438 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_19490 50859 50041 gene locus_tag LOCUS_19500 50859 50041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 53110 50951 gene locus_tag LOCUS_19510 53110 50951 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_19510 55351 53129 gene locus_tag LOCUS_19520 55351 53129 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_19520 56587 56084 gene locus_tag LOCUS_19530 gene ribH 56587 56084 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764452.1 protein_id gnl|my_center|LOCUS_19530 57527 56604 gene locus_tag LOCUS_19540 57527 56604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 58168 57524 gene locus_tag LOCUS_19550 58168 57524 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762908.1 protein_id gnl|my_center|LOCUS_19550 58664 58203 gene locus_tag LOCUS_19560 58664 58203 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109028.1 protein_id gnl|my_center|LOCUS_19560 58954 58661 gene locus_tag LOCUS_19570 58954 58661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 60062 58956 gene locus_tag LOCUS_19580 gene recF 60062 58956 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_19580 60811 60137 gene locus_tag LOCUS_19590 gene upp 60811 60137 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_19590 61861 60983 gene locus_tag LOCUS_19600 61861 60983 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108346.1 protein_id gnl|my_center|LOCUS_19600 62505 61858 gene locus_tag LOCUS_19610 62505 61858 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_19610 62745 63731 gene locus_tag LOCUS_19620 gene pfkA 62745 63731 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_19620 64124 64041 gene locus_tag LOCUS_t00320 64124 64041 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 65437 64244 gene locus_tag LOCUS_19630 65437 64244 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_19630 65779 67098 gene locus_tag LOCUS_19640 65779 67098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 67095 67751 gene locus_tag LOCUS_19650 67095 67751 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840608.1 protein_id gnl|my_center|LOCUS_19650 67777 68964 gene locus_tag LOCUS_19660 67777 68964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109198.1 protein_id gnl|my_center|LOCUS_19660 69415 72306 gene locus_tag LOCUS_19670 69415 72306 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_19670 72357 73898 gene locus_tag LOCUS_19680 72357 73898 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109369.1 protein_id gnl|my_center|LOCUS_19680 73925 74812 gene locus_tag LOCUS_19690 73925 74812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 74836 75909 gene locus_tag LOCUS_19700 74836 75909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 76525 76680 gene locus_tag LOCUS_19710 76525 76680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 76783 79626 gene locus_tag LOCUS_19720 76783 79626 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_19720 79644 81353 gene locus_tag LOCUS_19730 79644 81353 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109369.1 protein_id gnl|my_center|LOCUS_19730 81374 82642 gene locus_tag LOCUS_19740 81374 82642 CDS product SusF/SusE family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767006.1 protein_id gnl|my_center|LOCUS_19740 82703 84163 gene locus_tag LOCUS_19750 82703 84163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 84692 85630 gene locus_tag LOCUS_19760 84692 85630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 85925 87394 gene locus_tag LOCUS_19770 gene sufB 85925 87394 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_19770 87426 88424 gene locus_tag LOCUS_19780 87426 88424 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_19780 88495 89586 gene locus_tag LOCUS_19790 88495 89586 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_19790 89619 90059 gene locus_tag LOCUS_19800 89619 90059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 90140 92908 gene locus_tag LOCUS_19810 90140 92908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 94138 93221 gene locus_tag LOCUS_19820 94138 93221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 94579 94226 gene locus_tag LOCUS_19830 94579 94226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 94872 94663 gene locus_tag LOCUS_19840 94872 94663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 95260 95174 gene locus_tag LOCUS_t00330 95260 95174 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 95505 96272 gene locus_tag LOCUS_19850 95505 96272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 97716 96304 gene locus_tag LOCUS_19860 97716 96304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 99275 97893 gene locus_tag LOCUS_19870 gene rpoN 99275 97893 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_19870 99526 100209 gene locus_tag LOCUS_19880 99526 100209 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785232.1 protein_id gnl|my_center|LOCUS_19880 101617 100334 gene locus_tag LOCUS_19890 101617 100334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence17 490 5070 gene locus_tag LOCUS_19900 490 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 5969 6499 gene locus_tag LOCUS_19910 5969 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 6507 9614 gene locus_tag LOCUS_19920 6507 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 9616 10359 gene locus_tag LOCUS_19930 9616 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 10381 11382 gene locus_tag LOCUS_19940 10381 11382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 11375 12217 gene locus_tag LOCUS_19950 11375 12217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 12327 13301 gene locus_tag LOCUS_19960 12327 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 13429 14991 gene locus_tag LOCUS_19970 13429 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 14988 15773 gene locus_tag LOCUS_19980 14988 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 15853 16464 gene locus_tag LOCUS_19990 15853 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 17729 16761 gene locus_tag LOCUS_20000 17729 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 18058 19383 gene locus_tag LOCUS_20010 18058 19383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 19364 20182 gene locus_tag LOCUS_20020 19364 20182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 20311 21132 gene locus_tag LOCUS_20030 gene menB 20311 21132 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_20030 21135 22193 gene locus_tag LOCUS_20040 21135 22193 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_20040 22304 23257 gene locus_tag LOCUS_20050 22304 23257 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_20050 23472 24173 gene locus_tag LOCUS_20060 23472 24173 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_20060 25774 24320 gene locus_tag LOCUS_20070 25774 24320 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_20070 27085 25820 gene locus_tag LOCUS_20080 27085 25820 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_20080 29055 27082 gene locus_tag LOCUS_20090 29055 27082 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_20090 30774 29347 gene locus_tag LOCUS_20100 30774 29347 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_20100 32006 31320 gene locus_tag LOCUS_20110 32006 31320 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_20110 32229 32624 gene locus_tag LOCUS_20120 32229 32624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 32667 33533 gene locus_tag LOCUS_20130 32667 33533 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_20130 33637 35586 gene locus_tag LOCUS_20140 33637 35586 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_20140 35683 36927 gene locus_tag LOCUS_20150 gene serB 35683 36927 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 protein_id gnl|my_center|LOCUS_20150 37338 39608 gene locus_tag LOCUS_20160 37338 39608 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840909.1 protein_id gnl|my_center|LOCUS_20160 40488 39565 gene locus_tag LOCUS_20170 40488 39565 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764710.1 protein_id gnl|my_center|LOCUS_20170 40734 41324 gene locus_tag LOCUS_20180 40734 41324 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_20180 41481 43217 gene locus_tag LOCUS_20190 41481 43217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_20190 43461 45560 gene locus_tag LOCUS_20200 43461 45560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 46517 45537 gene locus_tag LOCUS_20210 46517 45537 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_20210 47239 46514 gene locus_tag LOCUS_20220 47239 46514 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_20220 47499 48095 gene locus_tag LOCUS_20230 47499 48095 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_20230 48874 48101 gene locus_tag LOCUS_20240 gene yjjG 48874 48101 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925810.1 protein_id gnl|my_center|LOCUS_20240 49065 49337 gene locus_tag LOCUS_20250 49065 49337 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_20250 49680 51308 gene locus_tag LOCUS_20260 49680 51308 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_20260 51802 51488 gene locus_tag LOCUS_20270 51802 51488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 52390 53682 gene locus_tag LOCUS_20280 52390 53682 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_20280 53679 54443 gene locus_tag LOCUS_20290 53679 54443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 55925 54684 gene locus_tag LOCUS_20300 55925 54684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108356.1 protein_id gnl|my_center|LOCUS_20300 57667 55934 gene locus_tag LOCUS_20310 57667 55934 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108360.1 protein_id gnl|my_center|LOCUS_20310 57990 59147 gene locus_tag LOCUS_20320 57990 59147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 60546 59245 gene locus_tag LOCUS_20330 60546 59245 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_20330 61224 60616 gene locus_tag LOCUS_20340 61224 60616 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_20340 61886 61266 gene locus_tag LOCUS_20350 61886 61266 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_20350 63191 62040 gene locus_tag LOCUS_20360 gene cydB 63191 62040 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_20360 64763 63195 gene locus_tag LOCUS_20370 64763 63195 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786918.1 protein_id gnl|my_center|LOCUS_20370 65005 64826 gene locus_tag LOCUS_20380 65005 64826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 65615 67027 gene locus_tag LOCUS_20390 65615 67027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20390 66934 68973 gene locus_tag LOCUS_20400 66934 68973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20400 68986 70587 gene locus_tag LOCUS_20410 68986 70587 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750838.1 protein_id gnl|my_center|LOCUS_20410 70754 71677 gene locus_tag LOCUS_20420 70754 71677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 71674 72384 gene locus_tag LOCUS_20430 71674 72384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 72551 73594 gene locus_tag LOCUS_20440 72551 73594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 73789 74961 gene locus_tag LOCUS_20450 73789 74961 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_20450 75443 75901 gene locus_tag LOCUS_20460 75443 75901 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 protein_id gnl|my_center|LOCUS_20460 75904 76572 gene locus_tag LOCUS_20470 75904 76572 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_20470 76711 77994 gene locus_tag LOCUS_20480 76711 77994 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_20480 78782 78123 gene locus_tag LOCUS_20490 78782 78123 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_20490 78907 78835 gene locus_tag LOCUS_t00340 78907 78835 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 79202 79786 gene locus_tag LOCUS_20500 79202 79786 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_20500 79841 80785 gene locus_tag LOCUS_20510 79841 80785 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_20510 80990 81736 gene locus_tag LOCUS_20520 gene fabG 80990 81736 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_20520 81743 82435 gene locus_tag LOCUS_20530 81743 82435 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_20530 82464 84623 gene locus_tag LOCUS_20540 gene recG 82464 84623 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_20540 84728 86062 gene locus_tag LOCUS_20550 84728 86062 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_20550 86343 89930 gene locus_tag LOCUS_20560 gene nifJ 86343 89930 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789619.1 protein_id gnl|my_center|LOCUS_20560 91511 90177 gene locus_tag LOCUS_20570 gene nhaD 91511 90177 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_20570 93026 91656 gene locus_tag LOCUS_20580 gene bioC 93026 91656 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202493.1 protein_id gnl|my_center|LOCUS_20580 94158 93016 gene locus_tag LOCUS_20590 94158 93016 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107783.1 protein_id gnl|my_center|LOCUS_20590 95444 94146 gene locus_tag LOCUS_20600 95444 94146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 95918 97288 gene locus_tag LOCUS_20610 95918 97288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence18 837 70 gene locus_tag LOCUS_20620 837 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2772 1225 gene locus_tag LOCUS_20630 2772 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3617 2754 gene locus_tag LOCUS_20640 3617 2754 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786594.1 protein_id gnl|my_center|LOCUS_20640 3859 4830 gene locus_tag LOCUS_20650 3859 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4865 5419 gene locus_tag LOCUS_20660 4865 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 5485 6486 gene locus_tag LOCUS_20670 5485 6486 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_20670 6486 7016 gene locus_tag LOCUS_20680 6486 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 7020 7937 gene locus_tag LOCUS_20690 7020 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 9111 8110 gene locus_tag LOCUS_20700 gene yfdV 9111 8110 CDS product transporter YfdV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955028.1 protein_id gnl|my_center|LOCUS_20700 10946 9189 gene locus_tag LOCUS_20710 gene oxc 10946 9189 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283505.1 protein_id gnl|my_center|LOCUS_20710 12321 11020 gene locus_tag LOCUS_20720 gene frc 12321 11020 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549137.1 protein_id gnl|my_center|LOCUS_20720 12583 12903 gene locus_tag LOCUS_20730 gene rplU 12583 12903 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_20730 12922 13182 gene locus_tag LOCUS_20740 gene rpmA 12922 13182 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_20740 13929 13315 gene locus_tag LOCUS_20750 13929 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 14215 14856 gene locus_tag LOCUS_20760 14215 14856 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969910.1 protein_id gnl|my_center|LOCUS_20760 14929 16218 gene locus_tag LOCUS_20770 14929 16218 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_20770 16881 16315 gene locus_tag LOCUS_20780 16881 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 17512 16883 gene locus_tag LOCUS_20790 17512 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 19097 17544 gene locus_tag LOCUS_20800 19097 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 20831 19209 gene locus_tag LOCUS_20810 20831 19209 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_20810 21349 20897 gene locus_tag LOCUS_20820 gene coaD 21349 20897 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_20820 23470 21401 gene locus_tag LOCUS_20830 23470 21401 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_20830 24298 23630 gene locus_tag LOCUS_20840 gene aat 24298 23630 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_20840 25528 24332 gene locus_tag LOCUS_20850 25528 24332 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760938.1 protein_id gnl|my_center|LOCUS_20850 27941 25677 gene locus_tag LOCUS_20860 gene clpA 27941 25677 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965130.1 protein_id gnl|my_center|LOCUS_20860 28292 27990 gene locus_tag LOCUS_20870 gene clpS 28292 27990 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 protein_id gnl|my_center|LOCUS_20870 28394 28732 gene locus_tag LOCUS_20880 28394 28732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 29072 31609 gene locus_tag LOCUS_20890 29072 31609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 30931 31028 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31682 38461 gene locus_tag LOCUS_20900 31682 38461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 40041 41141 gene locus_tag LOCUS_20910 40041 41141 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765009.1 protein_id gnl|my_center|LOCUS_20910 41138 42172 gene locus_tag LOCUS_20920 41138 42172 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203225.1 protein_id gnl|my_center|LOCUS_20920 43177 43809 gene locus_tag LOCUS_20930 43177 43809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 43940 44749 gene locus_tag LOCUS_20940 43940 44749 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_20940 46398 44788 gene locus_tag LOCUS_20950 46398 44788 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_20950 47977 47135 gene locus_tag LOCUS_20960 47977 47135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 48183 49124 gene locus_tag LOCUS_20970 48183 49124 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_20970 49418 49807 gene locus_tag LOCUS_20980 49418 49807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 49951 50703 gene locus_tag LOCUS_20990 49951 50703 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203143.1 protein_id gnl|my_center|LOCUS_20990 53886 50806 gene locus_tag LOCUS_21000 53886 50806 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639999.1 protein_id gnl|my_center|LOCUS_21000 54128 55630 gene locus_tag LOCUS_21010 54128 55630 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785885.1 protein_id gnl|my_center|LOCUS_21010 55827 56519 gene locus_tag LOCUS_21020 55827 56519 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_21020 56506 57930 gene locus_tag LOCUS_21030 56506 57930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 58024 60333 gene locus_tag LOCUS_21040 58024 60333 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_21040 60368 61327 gene locus_tag LOCUS_21050 60368 61327 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108880.1 protein_id gnl|my_center|LOCUS_21050 61708 62340 gene locus_tag LOCUS_21060 61708 62340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 62924 62454 gene locus_tag LOCUS_21070 62924 62454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 63377 64201 gene locus_tag LOCUS_21080 63377 64201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 64479 65807 gene locus_tag LOCUS_21090 64479 65807 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109014.1 protein_id gnl|my_center|LOCUS_21090 65794 67275 gene locus_tag LOCUS_21100 65794 67275 CDS product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109015.1 protein_id gnl|my_center|LOCUS_21100 67272 68348 gene locus_tag LOCUS_21110 67272 68348 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_21110 68426 70660 gene locus_tag LOCUS_21120 68426 70660 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_21120 70700 71827 gene locus_tag LOCUS_21130 70700 71827 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_21130 72888 71860 gene locus_tag LOCUS_21140 72888 71860 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_21140 73207 72881 gene locus_tag LOCUS_21150 73207 72881 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784907.1 protein_id gnl|my_center|LOCUS_21150 73416 73213 gene locus_tag LOCUS_21160 73416 73213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 73888 74913 gene locus_tag LOCUS_21170 73888 74913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 75119 75907 gene locus_tag LOCUS_21180 75119 75907 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694907.1 protein_id gnl|my_center|LOCUS_21180 75914 76501 gene locus_tag LOCUS_21190 75914 76501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 77992 76598 gene locus_tag LOCUS_21200 77992 76598 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_21200 78294 79832 gene locus_tag LOCUS_21210 78294 79832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 80402 79863 gene locus_tag LOCUS_21220 80402 79863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 81301 80399 gene locus_tag LOCUS_21230 81301 80399 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867916.1 protein_id gnl|my_center|LOCUS_21230 81925 82758 gene locus_tag LOCUS_21240 81925 82758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 82792 83856 gene locus_tag LOCUS_21250 82792 83856 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_21250 84085 84471 gene locus_tag LOCUS_21260 84085 84471 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119729.1 protein_id gnl|my_center|LOCUS_21260 84468 85676 gene locus_tag LOCUS_21270 84468 85676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 85745 88039 gene locus_tag LOCUS_21280 85745 88039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 88089 88943 gene locus_tag LOCUS_21290 88089 88943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 89513 89208 gene locus_tag LOCUS_21300 89513 89208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 89766 90590 gene locus_tag LOCUS_21310 89766 90590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 90688 91122 gene locus_tag LOCUS_21320 90688 91122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 91406 92218 gene locus_tag LOCUS_21330 91406 92218 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_21330 92231 93034 gene locus_tag LOCUS_21340 92231 93034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 93082 93399 gene locus_tag LOCUS_21350 93082 93399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 93697 94605 gene locus_tag LOCUS_21360 93697 94605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 94732 95013 gene locus_tag LOCUS_21370 94732 95013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 95482 95024 gene locus_tag LOCUS_21380 95482 95024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence19 <1 3102 gene locus_tag LOCUS_21390 <1 3102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263951.1:Ig-like domain-containing protein 3496 3675 gene locus_tag LOCUS_21400 3496 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3962 4519 gene locus_tag LOCUS_21410 3962 4519 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430302.1 protein_id gnl|my_center|LOCUS_21410 4938 5288 gene locus_tag LOCUS_21420 4938 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 5304 5963 gene locus_tag LOCUS_21430 5304 5963 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480360.1 protein_id gnl|my_center|LOCUS_21430 5968 6606 gene locus_tag LOCUS_21440 5968 6606 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 protein_id gnl|my_center|LOCUS_21440 6689 7327 gene locus_tag LOCUS_21450 6689 7327 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253659.1 protein_id gnl|my_center|LOCUS_21450 7371 8030 gene locus_tag LOCUS_21460 7371 8030 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964845.1 protein_id gnl|my_center|LOCUS_21460 8069 9148 gene locus_tag LOCUS_21470 8069 9148 CDS product TerY-C metal binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253656.1 protein_id gnl|my_center|LOCUS_21470 9191 10660 gene locus_tag LOCUS_21480 9191 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 10671 12146 gene locus_tag LOCUS_21490 10671 12146 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 protein_id gnl|my_center|LOCUS_21490 12493 12245 gene locus_tag LOCUS_21500 12493 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 14925 12931 gene locus_tag LOCUS_21510 14925 12931 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_21510 15307 16722 gene locus_tag LOCUS_21520 15307 16722 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_21520 16715 17404 gene locus_tag LOCUS_21530 16715 17404 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_21530 17734 17961 gene locus_tag LOCUS_21540 17734 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 19203 18337 gene locus_tag LOCUS_21550 19203 18337 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_21550 19510 20958 gene locus_tag LOCUS_21560 19510 20958 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405542.1 protein_id gnl|my_center|LOCUS_21560 20992 22059 gene locus_tag LOCUS_21570 20992 22059 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_21570 22225 25329 gene locus_tag LOCUS_21580 22225 25329 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_21580 25342 26850 gene locus_tag LOCUS_21590 25342 26850 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_21590 26850 27821 gene locus_tag LOCUS_21600 26850 27821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 27897 29336 gene locus_tag LOCUS_21610 27897 29336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 29413 30819 gene locus_tag LOCUS_21620 29413 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 30827 32014 gene locus_tag LOCUS_21630 30827 32014 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_21630 33826 32252 gene locus_tag LOCUS_21640 gene ahpF 33826 32252 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695883.1 protein_id gnl|my_center|LOCUS_21640 34419 33853 gene locus_tag LOCUS_21650 gene ahpC 34419 33853 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775969.1 protein_id gnl|my_center|LOCUS_21650 34731 35243 gene locus_tag LOCUS_21660 34731 35243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 35262 36617 gene locus_tag LOCUS_21670 35262 36617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 37204 39318 gene locus_tag LOCUS_21680 37204 39318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 39398 40111 gene locus_tag LOCUS_21690 39398 40111 CDS product BT1926 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202312.1 protein_id gnl|my_center|LOCUS_21690 40502 40768 gene locus_tag LOCUS_21700 40502 40768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 40740 41150 gene locus_tag LOCUS_21710 40740 41150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 41157 41726 gene locus_tag LOCUS_21720 41157 41726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 42103 43527 gene locus_tag LOCUS_21730 42103 43527 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_21730 44062 43574 gene locus_tag LOCUS_21740 44062 43574 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_21740 45025 44075 gene locus_tag LOCUS_21750 gene cysK 45025 44075 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_21750 45781 49518 gene locus_tag LOCUS_21760 45781 49518 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303138.1 protein_id gnl|my_center|LOCUS_21760 49745 52714 gene locus_tag LOCUS_21770 49745 52714 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109370.1 protein_id gnl|my_center|LOCUS_21770 52726 54339 gene locus_tag LOCUS_21780 52726 54339 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109369.1 protein_id gnl|my_center|LOCUS_21780 54350 56059 gene locus_tag LOCUS_21790 54350 56059 CDS product DUF5114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109368.1 protein_id gnl|my_center|LOCUS_21790 56099 57160 gene locus_tag LOCUS_21800 56099 57160 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109367.1 protein_id gnl|my_center|LOCUS_21800 57160 59685 gene locus_tag LOCUS_21810 gene galB 57160 59685 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_21810 61353 60148 gene locus_tag LOCUS_21820 61353 60148 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946621.1 protein_id gnl|my_center|LOCUS_21820 62455 61775 gene locus_tag LOCUS_21830 62455 61775 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_21830 63758 62442 gene locus_tag LOCUS_21840 63758 62442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 63892 64647 gene locus_tag LOCUS_21850 63892 64647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 65673 65137 gene locus_tag LOCUS_21860 65673 65137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485363.1 protein_id gnl|my_center|LOCUS_21860 66310 65666 gene locus_tag LOCUS_21870 66310 65666 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485361.1 protein_id gnl|my_center|LOCUS_21870 66527 66348 gene locus_tag LOCUS_21880 66527 66348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 68322 67762 gene locus_tag LOCUS_21890 68322 67762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 68816 68325 gene locus_tag LOCUS_21900 68816 68325 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_21900 69617 68985 gene locus_tag LOCUS_21910 69617 68985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 70227 69673 gene locus_tag LOCUS_21920 70227 69673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 70814 70614 gene locus_tag LOCUS_21930 70814 70614 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992809.1 protein_id gnl|my_center|LOCUS_21930 71325 70825 gene locus_tag LOCUS_21940 71325 70825 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 protein_id gnl|my_center|LOCUS_21940 71609 71322 gene locus_tag LOCUS_21950 71609 71322 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945876.1 protein_id gnl|my_center|LOCUS_21950 72915 72340 gene locus_tag LOCUS_21960 72915 72340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21960 74000 72804 gene locus_tag LOCUS_21970 74000 72804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 74748 74134 gene locus_tag LOCUS_21980 74748 74134 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787373.1 protein_id gnl|my_center|LOCUS_21980 75572 75069 gene locus_tag LOCUS_21990 gene fldA 75572 75069 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765037.1 protein_id gnl|my_center|LOCUS_21990 76013 75687 gene locus_tag LOCUS_22000 76013 75687 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765016.1 protein_id gnl|my_center|LOCUS_22000 76588 76010 gene locus_tag LOCUS_22010 76588 76010 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763053.1 protein_id gnl|my_center|LOCUS_22010 77265 76585 gene locus_tag LOCUS_22020 77265 76585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202978.1 protein_id gnl|my_center|LOCUS_22020 81262 77291 gene locus_tag LOCUS_22030 81262 77291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 83444 81270 gene locus_tag LOCUS_22040 83444 81270 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107297.1 protein_id gnl|my_center|LOCUS_22040 84031 83441 gene locus_tag LOCUS_22050 84031 83441 CDS product HmuY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765021.1 protein_id gnl|my_center|LOCUS_22050 84981 84163 gene locus_tag LOCUS_22060 84981 84163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 85224 86171 gene locus_tag LOCUS_22070 85224 86171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 86450 86229 gene locus_tag LOCUS_22080 86450 86229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 86817 87020 gene locus_tag LOCUS_22090 86817 87020 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992809.1 protein_id gnl|my_center|LOCUS_22090 87815 87063 gene locus_tag LOCUS_22100 87815 87063 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22100 88092 88442 gene locus_tag LOCUS_22110 88092 88442 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_22110 88835 88467 gene locus_tag LOCUS_22120 88835 88467 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_22120 88989 89603 gene locus_tag LOCUS_22130 88989 89603 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_22130 89842 90207 gene locus_tag LOCUS_22140 89842 90207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 90879 90496 gene locus_tag LOCUS_22150 90879 90496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 93191 91098 gene locus_tag LOCUS_22160 93191 91098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 94946 93348 gene locus_tag LOCUS_22170 94946 93348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence20 1 798 gene locus_tag LOCUS_22180 1 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 811 1185 gene locus_tag LOCUS_22190 811 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1178 1864 gene locus_tag LOCUS_22200 1178 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2155 2985 gene locus_tag LOCUS_22210 gene dinD 2155 2985 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_22210 2995 5751 gene locus_tag LOCUS_22220 2995 5751 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244282.1 protein_id gnl|my_center|LOCUS_22220 5748 6488 gene locus_tag LOCUS_22230 5748 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 6481 8457 gene locus_tag LOCUS_22240 6481 8457 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 protein_id gnl|my_center|LOCUS_22240 8454 9653 gene locus_tag LOCUS_22250 8454 9653 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039746.1 protein_id gnl|my_center|LOCUS_22250 9650 10459 gene locus_tag LOCUS_22260 9650 10459 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774903.1 protein_id gnl|my_center|LOCUS_22260 10459 10839 gene locus_tag LOCUS_22270 10459 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 10999 11979 gene locus_tag LOCUS_22280 10999 11979 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_22280 11995 13677 gene locus_tag LOCUS_22290 11995 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 14171 14374 gene locus_tag LOCUS_22300 14171 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 16438 14456 gene locus_tag LOCUS_22310 16438 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 20221 16442 gene locus_tag LOCUS_22320 20221 16442 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254336.1 protein_id gnl|my_center|LOCUS_22320 21562 20672 gene locus_tag LOCUS_22330 21562 20672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 24138 21559 gene locus_tag LOCUS_22340 24138 21559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 24995 24135 gene locus_tag LOCUS_22350 24995 24135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 25849 24995 gene locus_tag LOCUS_22360 25849 24995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 26745 26074 gene locus_tag LOCUS_22370 26745 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 27668 26766 gene locus_tag LOCUS_22380 27668 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 29737 27734 gene locus_tag LOCUS_22390 29737 27734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22390 30200 29739 gene locus_tag LOCUS_22400 30200 29739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 30634 30197 gene locus_tag LOCUS_22410 30634 30197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 31247 30747 gene locus_tag LOCUS_22420 31247 30747 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_22420 31951 31583 gene locus_tag LOCUS_22430 31951 31583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 33957 31948 gene locus_tag LOCUS_22440 33957 31948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 34390 34109 gene locus_tag LOCUS_22450 34390 34109 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_22450 35016 34387 gene locus_tag LOCUS_22460 35016 34387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107867.1 protein_id gnl|my_center|LOCUS_22460 35376 35185 gene locus_tag LOCUS_22470 35376 35185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 36951 35620 gene locus_tag LOCUS_22480 36951 35620 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_22480 37748 37233 gene locus_tag LOCUS_22490 37748 37233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 39035 37752 gene locus_tag LOCUS_22500 39035 37752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 39028 39243 gene locus_tag LOCUS_22510 39028 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 40261 39227 gene locus_tag LOCUS_22520 40261 39227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 41238 40258 gene locus_tag LOCUS_22530 41238 40258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 42955 41402 gene locus_tag LOCUS_22540 42955 41402 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108473.1 protein_id gnl|my_center|LOCUS_22540 43686 43354 gene locus_tag LOCUS_22550 43686 43354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 44671 43793 gene locus_tag LOCUS_22560 44671 43793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 45651 44800 gene locus_tag LOCUS_22570 45651 44800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 48274 45662 gene locus_tag LOCUS_22580 48274 45662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 49519 48338 gene locus_tag LOCUS_22590 49519 48338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 50004 49633 gene locus_tag LOCUS_22600 50004 49633 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_22600 52375 50273 gene locus_tag LOCUS_22610 52375 50273 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_22610 53510 52497 gene locus_tag LOCUS_22620 53510 52497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 53998 53639 gene locus_tag LOCUS_22630 53998 53639 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759873.1 protein_id gnl|my_center|LOCUS_22630 54305 54853 gene locus_tag LOCUS_22640 54305 54853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109081.1 protein_id gnl|my_center|LOCUS_22640 54858 55163 gene locus_tag LOCUS_22650 54858 55163 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764277.1 protein_id gnl|my_center|LOCUS_22650 57525 55219 gene locus_tag LOCUS_22660 57525 55219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 58989 57658 gene locus_tag LOCUS_22670 58989 57658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 59682 59140 gene locus_tag LOCUS_22680 59682 59140 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107559.1 protein_id gnl|my_center|LOCUS_22680 60651 59701 gene locus_tag LOCUS_22690 60651 59701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 61006 60641 gene locus_tag LOCUS_22700 61006 60641 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461871.1 protein_id gnl|my_center|LOCUS_22700 63423 61138 gene locus_tag LOCUS_22710 63423 61138 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_22710 65300 63633 gene locus_tag LOCUS_22720 65300 63633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 66102 65470 gene locus_tag LOCUS_22730 66102 65470 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 protein_id gnl|my_center|LOCUS_22730 66250 66089 gene locus_tag LOCUS_22740 66250 66089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 66975 67334 gene locus_tag LOCUS_22750 66975 67334 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786310.1 protein_id gnl|my_center|LOCUS_22750 68006 67338 gene locus_tag LOCUS_22760 gene yycF 68006 67338 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100856.1 protein_id gnl|my_center|LOCUS_22760 69475 68003 gene locus_tag LOCUS_22770 69475 68003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 69667 70548 gene locus_tag LOCUS_22780 69667 70548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 70599 73103 gene locus_tag LOCUS_22790 70599 73103 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_22790 74630 73314 gene locus_tag LOCUS_22800 gene xylA 74630 73314 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_22800 76333 74855 gene locus_tag LOCUS_22810 76333 74855 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_22810 77104 76373 gene locus_tag LOCUS_22820 77104 76373 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787639.1 protein_id gnl|my_center|LOCUS_22820 77767 77288 gene locus_tag LOCUS_22830 77767 77288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 78025 77825 gene locus_tag LOCUS_22840 78025 77825 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_22840 78428 78015 gene locus_tag LOCUS_22850 78428 78015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 79857 80420 gene locus_tag LOCUS_22860 79857 80420 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_22860 80404 80583 gene locus_tag LOCUS_22870 80404 80583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 81288 81554 gene locus_tag LOCUS_22880 81288 81554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 81570 82595 gene locus_tag LOCUS_22890 81570 82595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22890 83886 82933 gene locus_tag LOCUS_22900 83886 82933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 85277 84054 gene locus_tag LOCUS_22910 85277 84054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 92203 85280 gene locus_tag LOCUS_22920 92203 85280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 92606 92358 gene locus_tag LOCUS_22930 92606 92358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence21 1221 991 gene locus_tag LOCUS_22940 1221 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2482 1448 gene locus_tag LOCUS_22950 2482 1448 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_22950 2948 3985 gene locus_tag LOCUS_22960 2948 3985 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 protein_id gnl|my_center|LOCUS_22960 4034 5044 gene locus_tag LOCUS_22970 gene cobD 4034 5044 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_22970 5029 5961 gene locus_tag LOCUS_22980 gene cbiB 5029 5961 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_22980 8473 5993 gene locus_tag LOCUS_22990 gene galB 8473 5993 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_22990 8746 9297 gene locus_tag LOCUS_23000 8746 9297 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766965.1 protein_id gnl|my_center|LOCUS_23000 9312 10970 gene locus_tag LOCUS_23010 9312 10970 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_23010 12178 11072 gene locus_tag LOCUS_23020 12178 11072 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785425.1 protein_id gnl|my_center|LOCUS_23020 13287 12220 gene locus_tag LOCUS_23030 13287 12220 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_23030 14826 13609 gene locus_tag LOCUS_23040 14826 13609 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_23040 15073 15960 gene locus_tag LOCUS_23050 15073 15960 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_23050 18779 16032 gene locus_tag LOCUS_23060 18779 16032 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_23060 22117 18833 gene locus_tag LOCUS_23070 22117 18833 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_23070 23531 22149 gene locus_tag LOCUS_23080 23531 22149 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_23080 23798 25153 gene locus_tag LOCUS_23090 gene trkA 23798 25153 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_23090 25171 26640 gene locus_tag LOCUS_23100 25171 26640 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_23100 29205 26647 gene locus_tag LOCUS_23110 29205 26647 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_23110 29628 31526 gene locus_tag LOCUS_23120 29628 31526 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_23120 31570 34665 gene locus_tag LOCUS_23130 31570 34665 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_23130 34754 36346 gene locus_tag LOCUS_23140 34754 36346 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_23140 36702 38693 gene locus_tag LOCUS_23150 36702 38693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 38763 40289 gene locus_tag LOCUS_23160 38763 40289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 40652 44560 gene locus_tag LOCUS_23170 40652 44560 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_23170 44790 45017 gene locus_tag LOCUS_23180 44790 45017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 45098 45943 gene locus_tag LOCUS_23190 45098 45943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 46090 46830 gene locus_tag LOCUS_23200 46090 46830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 46848 49481 gene locus_tag LOCUS_23210 46848 49481 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_23210 49725 50138 gene locus_tag LOCUS_23220 49725 50138 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_23220 50162 51553 gene locus_tag LOCUS_23230 50162 51553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 52613 51663 gene locus_tag LOCUS_23240 52613 51663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 54028 52682 gene locus_tag LOCUS_23250 54028 52682 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_23250 54505 54341 gene locus_tag LOCUS_23260 54505 54341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 55487 54513 gene locus_tag LOCUS_23270 55487 54513 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_23270 55724 55993 gene locus_tag LOCUS_23280 55724 55993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 56252 55995 gene locus_tag LOCUS_23290 56252 55995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 56451 57410 gene locus_tag LOCUS_23300 56451 57410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 57473 58720 gene locus_tag LOCUS_23310 57473 58720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 58920 59747 gene locus_tag LOCUS_23320 58920 59747 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817038.1 protein_id gnl|my_center|LOCUS_23320 60906 59821 gene locus_tag LOCUS_23330 60906 59821 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_23330 63231 60973 gene locus_tag LOCUS_23340 63231 60973 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_23340 64142 63240 gene locus_tag LOCUS_23350 64142 63240 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_23350 66423 64279 gene locus_tag LOCUS_23360 66423 64279 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_23360 67462 66650 gene locus_tag LOCUS_23370 67462 66650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 69006 67792 gene locus_tag LOCUS_23380 69006 67792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 71087 69207 gene locus_tag LOCUS_23390 71087 69207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 72662 71142 gene locus_tag LOCUS_23400 72662 71142 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_23400 75877 72695 gene locus_tag LOCUS_23410 75877 72695 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_23410 77321 75966 gene locus_tag LOCUS_23420 77321 75966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 80477 77688 gene locus_tag LOCUS_23430 80477 77688 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013547257.1 protein_id gnl|my_center|LOCUS_23430 81431 82324 gene locus_tag LOCUS_23440 gene metX 81431 82324 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_23440 82462 83322 gene locus_tag LOCUS_23450 82462 83322 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_23450 83397 83912 gene locus_tag LOCUS_23460 83397 83912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 84786 83893 gene locus_tag LOCUS_23470 84786 83893 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783689.1 protein_id gnl|my_center|LOCUS_23470 84911 85762 gene locus_tag LOCUS_23480 84911 85762 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107575.1 protein_id gnl|my_center|LOCUS_23480 86130 86588 gene locus_tag LOCUS_23490 86130 86588 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_23490 86918 87886 gene locus_tag LOCUS_23500 86918 87886 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_23500 88054 88125 gene locus_tag LOCUS_t00350 88054 88125 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence22 1558 314 gene locus_tag LOCUS_23510 1558 314 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_23510 2520 1681 gene locus_tag LOCUS_23520 2520 1681 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583591.1 protein_id gnl|my_center|LOCUS_23520 2863 2528 gene locus_tag LOCUS_23530 2863 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3701 3000 gene locus_tag LOCUS_23540 gene pssA 3701 3000 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_23540 4474 3698 gene locus_tag LOCUS_23550 4474 3698 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_23550 4573 5517 gene locus_tag LOCUS_23560 4573 5517 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_23560 6602 5574 gene locus_tag LOCUS_23570 6602 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 7831 6665 gene locus_tag LOCUS_23580 7831 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 8163 7831 gene locus_tag LOCUS_23590 8163 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 8805 8632 gene locus_tag LOCUS_23600 8805 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 10234 8828 gene locus_tag LOCUS_23610 gene guaD 10234 8828 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419799.1 protein_id gnl|my_center|LOCUS_23610 10703 11800 gene locus_tag LOCUS_23620 10703 11800 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130101.1 protein_id gnl|my_center|LOCUS_23620 11874 13580 gene locus_tag LOCUS_23630 11874 13580 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108473.1 protein_id gnl|my_center|LOCUS_23630 13677 15329 gene locus_tag LOCUS_23640 13677 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 15498 17555 gene locus_tag LOCUS_23650 15498 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 17659 18123 gene locus_tag LOCUS_23660 17659 18123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 18120 19181 gene locus_tag LOCUS_23670 18120 19181 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_23670 21009 19402 gene locus_tag LOCUS_23680 21009 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 22045 21011 gene locus_tag LOCUS_23690 22045 21011 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203225.1 protein_id gnl|my_center|LOCUS_23690 23274 22042 gene locus_tag LOCUS_23700 23274 22042 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765009.1 protein_id gnl|my_center|LOCUS_23700 25260 23866 gene locus_tag LOCUS_23710 25260 23866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 28213 25451 gene locus_tag LOCUS_23720 28213 25451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 28809 28321 gene locus_tag LOCUS_23730 28809 28321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 29490 30119 gene locus_tag LOCUS_23740 29490 30119 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568299.1 protein_id gnl|my_center|LOCUS_23740 30700 30536 gene locus_tag LOCUS_23750 30700 30536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23750 30981 30634 gene locus_tag LOCUS_23760 30981 30634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23760 32231 31290 gene locus_tag LOCUS_23770 32231 31290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 32483 32719 gene locus_tag LOCUS_23780 32483 32719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 32970 32749 gene locus_tag LOCUS_23790 32970 32749 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_23790 33632 33075 gene locus_tag LOCUS_23800 33632 33075 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_23800 33881 35731 gene locus_tag LOCUS_23810 33881 35731 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_23810 35973 36437 gene locus_tag LOCUS_23820 gene rimP 35973 36437 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_23820 36444 37691 gene locus_tag LOCUS_23830 gene nusA 36444 37691 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_23830 37754 40735 gene locus_tag LOCUS_23840 gene infB 37754 40735 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_23840 40735 41202 gene locus_tag LOCUS_23850 gene folK 40735 41202 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_23850 41203 41949 gene locus_tag LOCUS_23860 41203 41949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 42243 42557 gene locus_tag LOCUS_23870 42243 42557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 42624 47591 gene locus_tag LOCUS_23880 42624 47591 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_23880 47599 49902 gene locus_tag LOCUS_23890 47599 49902 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_23890 49905 50234 gene locus_tag LOCUS_23900 49905 50234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 50231 51073 gene locus_tag LOCUS_23910 50231 51073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 54189 51127 gene locus_tag LOCUS_23920 54189 51127 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922218.1 protein_id gnl|my_center|LOCUS_23920 54790 54173 gene locus_tag LOCUS_23930 54790 54173 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_23930 54992 54783 gene locus_tag LOCUS_23940 54992 54783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 56992 55118 gene locus_tag LOCUS_23950 56992 55118 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_23950 57749 56985 gene locus_tag LOCUS_23960 57749 56985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 58347 57742 gene locus_tag LOCUS_23970 58347 57742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 61587 58351 gene locus_tag LOCUS_23980 61587 58351 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_23980 62517 63710 gene locus_tag LOCUS_23990 62517 63710 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_23990 64701 63802 gene locus_tag LOCUS_24000 64701 63802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 65846 64800 gene locus_tag LOCUS_24010 65846 64800 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764761.1 protein_id gnl|my_center|LOCUS_24010 67205 66084 gene locus_tag LOCUS_24020 67205 66084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 69886 67193 gene locus_tag LOCUS_24030 69886 67193 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_24030 70365 69895 gene locus_tag LOCUS_24040 70365 69895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 70995 70486 gene locus_tag LOCUS_24050 70995 70486 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_24050 71519 71007 gene locus_tag LOCUS_24060 71519 71007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107054.1 protein_id gnl|my_center|LOCUS_24060 71691 71521 gene locus_tag LOCUS_24070 71691 71521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 73187 71814 gene locus_tag LOCUS_24080 73187 71814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 74042 73221 gene locus_tag LOCUS_24090 74042 73221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 75904 74138 gene locus_tag LOCUS_24100 75904 74138 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_24100 78942 75904 gene locus_tag LOCUS_24110 78942 75904 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_24110 81613 79019 gene locus_tag LOCUS_24120 81613 79019 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767505.1 protein_id gnl|my_center|LOCUS_24120 84714 82180 gene locus_tag LOCUS_24130 84714 82180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence23 452 895 gene locus_tag LOCUS_24140 452 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3966 2380 gene locus_tag LOCUS_24150 3966 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 5315 4092 gene locus_tag LOCUS_24160 5315 4092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_24160 6030 5551 gene locus_tag LOCUS_24170 6030 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 6162 6518 gene locus_tag LOCUS_24180 6162 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 7207 6659 gene locus_tag LOCUS_24190 7207 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 8358 7549 gene locus_tag LOCUS_24200 8358 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 14545 8402 gene locus_tag LOCUS_24210 14545 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 14985 14566 gene locus_tag LOCUS_24220 14985 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 15502 15080 gene locus_tag LOCUS_24230 15502 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 17335 15722 gene locus_tag LOCUS_24240 17335 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 18347 17574 gene locus_tag LOCUS_24250 18347 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 19321 18527 gene locus_tag LOCUS_24260 19321 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 19792 21768 gene locus_tag LOCUS_24270 19792 21768 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_24270 21775 23316 gene locus_tag LOCUS_24280 21775 23316 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_24280 23838 24593 gene locus_tag LOCUS_24290 23838 24593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 25375 24611 gene locus_tag LOCUS_24300 25375 24611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 25614 26009 gene locus_tag LOCUS_24310 25614 26009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 26015 28276 gene locus_tag LOCUS_24320 26015 28276 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_24320 28282 29268 gene locus_tag LOCUS_24330 28282 29268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 29520 30941 gene locus_tag LOCUS_24340 29520 30941 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_24340 33834 31390 gene locus_tag LOCUS_24350 33834 31390 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229518.1 protein_id gnl|my_center|LOCUS_24350 34057 35376 gene locus_tag LOCUS_24360 34057 35376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_24360 35507 36631 gene locus_tag LOCUS_24370 35507 36631 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680409.1 protein_id gnl|my_center|LOCUS_24370 36633 38060 gene locus_tag LOCUS_24380 36633 38060 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680411.1 protein_id gnl|my_center|LOCUS_24380 38149 39312 gene locus_tag LOCUS_24390 38149 39312 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748002.1 protein_id gnl|my_center|LOCUS_24390 39312 40037 gene locus_tag LOCUS_24400 39312 40037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680413.1 protein_id gnl|my_center|LOCUS_24400 40030 41127 gene locus_tag LOCUS_24410 40030 41127 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_24410 41340 43118 gene locus_tag LOCUS_24420 gene ccsA 41340 43118 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680415.1 protein_id gnl|my_center|LOCUS_24420 44519 43374 gene locus_tag LOCUS_24430 44519 43374 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_24430 45753 44743 gene locus_tag LOCUS_24440 gene gap 45753 44743 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_24440 46119 46562 gene locus_tag LOCUS_24450 gene mscL 46119 46562 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_24450 49743 46654 gene locus_tag LOCUS_24460 49743 46654 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_24460 50194 51012 gene locus_tag LOCUS_24470 gene tatC 50194 51012 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_24470 52397 51084 gene locus_tag LOCUS_24480 52397 51084 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_24480 53513 52416 gene locus_tag LOCUS_24490 53513 52416 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_24490 54860 53604 gene locus_tag LOCUS_24500 54860 53604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_24500 56096 54873 gene locus_tag LOCUS_24510 56096 54873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_24510 56788 56093 gene locus_tag LOCUS_24520 56788 56093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_24520 57126 58163 gene locus_tag LOCUS_24530 57126 58163 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_24530 58207 58704 gene locus_tag LOCUS_24540 58207 58704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 61628 58779 gene locus_tag LOCUS_24550 61628 58779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 64856 61893 gene locus_tag LOCUS_24560 64856 61893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 65234 66409 gene locus_tag LOCUS_24570 65234 66409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 66574 66837 gene locus_tag LOCUS_24580 66574 66837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 66842 67039 gene locus_tag LOCUS_24590 66842 67039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24590 67768 67580 gene locus_tag LOCUS_24600 67768 67580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 67902 68117 gene locus_tag LOCUS_24610 67902 68117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 68132 68701 gene locus_tag LOCUS_24620 68132 68701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 68792 69553 gene locus_tag LOCUS_24630 68792 69553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 69939 71138 gene locus_tag LOCUS_24640 69939 71138 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_24640 71320 72675 gene locus_tag LOCUS_24650 71320 72675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 72794 73033 gene locus_tag LOCUS_24660 72794 73033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 73698 73324 gene locus_tag LOCUS_24670 73698 73324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence24 2040 385 gene locus_tag LOCUS_24680 2040 385 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_24680 2872 2114 gene locus_tag LOCUS_24690 gene kdsB 2872 2114 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_24690 3993 2869 gene locus_tag LOCUS_24700 3993 2869 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_24700 5273 4080 gene locus_tag LOCUS_24710 5273 4080 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814817.1 protein_id gnl|my_center|LOCUS_24710 5456 5385 gene locus_tag LOCUS_t00360 5456 5385 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6932 5634 gene locus_tag LOCUS_24720 6932 5634 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765733.1 protein_id gnl|my_center|LOCUS_24720 7203 6922 gene locus_tag LOCUS_24730 7203 6922 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787931.1 protein_id gnl|my_center|LOCUS_24730 7478 8359 gene locus_tag LOCUS_24740 7478 8359 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_24740 8577 8969 gene locus_tag LOCUS_24750 8577 8969 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_24750 9159 10865 gene locus_tag LOCUS_24760 9159 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 12304 11003 gene locus_tag LOCUS_24770 12304 11003 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_24770 12940 13407 gene locus_tag LOCUS_24780 gene ndk 12940 13407 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_24780 13449 14393 gene locus_tag LOCUS_24790 13449 14393 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_24790 15354 14521 gene locus_tag LOCUS_24800 gene kdsA 15354 14521 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785350.1 protein_id gnl|my_center|LOCUS_24800 16129 15422 gene locus_tag LOCUS_24810 16129 15422 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_24810 17430 16126 gene locus_tag LOCUS_24820 17430 16126 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767999.1 protein_id gnl|my_center|LOCUS_24820 18498 17839 gene locus_tag LOCUS_24830 18498 17839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 18796 18722 gene locus_tag LOCUS_t00370 18796 18722 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19157 20071 gene locus_tag LOCUS_24840 19157 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 20136 21917 gene locus_tag LOCUS_24850 20136 21917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 23109 22000 gene locus_tag LOCUS_24860 gene prfA 23109 22000 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_24860 23499 23861 gene locus_tag LOCUS_24870 23499 23861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 23972 24044 gene locus_tag LOCUS_t00380 23972 24044 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 24069 24141 gene locus_tag LOCUS_t00390 24069 24141 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 25272 24544 gene locus_tag LOCUS_24880 25272 24544 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_24880 26762 25269 gene locus_tag LOCUS_24890 26762 25269 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_24890 27066 28319 gene locus_tag LOCUS_24900 27066 28319 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_24900 28663 29508 gene locus_tag LOCUS_24910 28663 29508 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763543.1 protein_id gnl|my_center|LOCUS_24910 29569 30291 gene locus_tag LOCUS_24920 29569 30291 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763544.1 protein_id gnl|my_center|LOCUS_24920 30296 31081 gene locus_tag LOCUS_24930 30296 31081 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792003.1 protein_id gnl|my_center|LOCUS_24930 31117 31992 gene locus_tag LOCUS_24940 31117 31992 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_24940 32197 32403 gene locus_tag LOCUS_24950 32197 32403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 32363 32566 gene locus_tag LOCUS_24960 32363 32566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 32529 33485 gene locus_tag LOCUS_24970 32529 33485 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_24970 33689 35323 gene locus_tag LOCUS_24980 33689 35323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964295.1 protein_id gnl|my_center|LOCUS_24980 35500 36831 gene locus_tag LOCUS_24990 35500 36831 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_24990 36885 38072 gene locus_tag LOCUS_25000 36885 38072 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_25000 38088 38861 gene locus_tag LOCUS_25010 38088 38861 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_25010 38874 39494 gene locus_tag LOCUS_25020 38874 39494 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_25020 39542 40156 gene locus_tag LOCUS_25030 gene nqrE 39542 40156 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_25030 40215 41507 gene locus_tag LOCUS_25040 gene nqrF 40215 41507 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_25040 41707 42987 gene locus_tag LOCUS_25050 41707 42987 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_25050 43136 43801 gene locus_tag LOCUS_25060 gene bioD 43136 43801 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107786.1 protein_id gnl|my_center|LOCUS_25060 43794 44531 gene locus_tag LOCUS_25070 43794 44531 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_25070 44534 44728 gene locus_tag LOCUS_25080 44534 44728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 45791 45030 gene locus_tag LOCUS_25090 45791 45030 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767009.1 protein_id gnl|my_center|LOCUS_25090 46200 45802 gene locus_tag LOCUS_25100 46200 45802 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108936.1 protein_id gnl|my_center|LOCUS_25100 46441 47049 gene locus_tag LOCUS_25110 46441 47049 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_25110 47108 47719 gene locus_tag LOCUS_25120 47108 47719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 47789 50197 gene locus_tag LOCUS_25130 gene priA 47789 50197 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_25130 50622 50224 gene locus_tag LOCUS_25140 50622 50224 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080552.1 protein_id gnl|my_center|LOCUS_25140 50936 50619 gene locus_tag LOCUS_25150 50936 50619 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764355.1 protein_id gnl|my_center|LOCUS_25150 52016 51117 gene locus_tag LOCUS_25160 52016 51117 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288197.1 protein_id gnl|my_center|LOCUS_25160 53495 52404 gene locus_tag LOCUS_25170 gene gmd 53495 52404 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_25170 54156 53602 gene locus_tag LOCUS_25180 54156 53602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 55513 54146 gene locus_tag LOCUS_25190 55513 54146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 56009 55704 gene locus_tag LOCUS_25200 56009 55704 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_25200 56385 56065 gene locus_tag LOCUS_25210 56385 56065 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066199.1 protein_id gnl|my_center|LOCUS_25210 57075 56572 gene locus_tag LOCUS_25220 57075 56572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 57559 57083 gene locus_tag LOCUS_25230 57559 57083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 58690 58040 gene locus_tag LOCUS_25240 58690 58040 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422862.1 protein_id gnl|my_center|LOCUS_25240 59636 58809 gene locus_tag LOCUS_25250 59636 58809 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056838.1 protein_id gnl|my_center|LOCUS_25250 60261 59989 gene locus_tag LOCUS_25260 60261 59989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 61320 60493 gene locus_tag LOCUS_25270 61320 60493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 62499 62744 gene locus_tag LOCUS_25280 62499 62744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 64285 63131 gene locus_tag LOCUS_25290 64285 63131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 65433 64294 gene locus_tag LOCUS_25300 gene glf 65433 64294 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_25300 66434 65433 gene locus_tag LOCUS_25310 66434 65433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 67580 66441 gene locus_tag LOCUS_25320 67580 66441 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_25320 68602 67610 gene locus_tag LOCUS_25330 68602 67610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 70047 68587 gene locus_tag LOCUS_25340 70047 68587 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202463.1 protein_id gnl|my_center|LOCUS_25340 71423 70272 gene locus_tag LOCUS_25350 71423 70272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 73245 71449 gene locus_tag LOCUS_25360 73245 71449 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202462.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence25 2622 463 gene locus_tag LOCUS_25370 2622 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3920 2622 gene locus_tag LOCUS_25380 3920 2622 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993585.1 protein_id gnl|my_center|LOCUS_25380 4289 4065 gene locus_tag LOCUS_25390 4289 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 6311 5208 gene locus_tag LOCUS_25400 6311 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 6914 6411 gene locus_tag LOCUS_25410 6914 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 7632 7270 gene locus_tag LOCUS_25420 7632 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 8551 9897 gene locus_tag LOCUS_25430 8551 9897 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939558.1 protein_id gnl|my_center|LOCUS_25430 9885 10829 gene locus_tag LOCUS_25440 9885 10829 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_25440 10946 11848 gene locus_tag LOCUS_25450 10946 11848 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_25450 11848 12372 gene locus_tag LOCUS_25460 11848 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 15065 12453 gene locus_tag LOCUS_25470 15065 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 15985 15062 gene locus_tag LOCUS_25480 15985 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 17030 15996 gene locus_tag LOCUS_25490 17030 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 17407 17030 gene locus_tag LOCUS_25500 17407 17030 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759873.1 protein_id gnl|my_center|LOCUS_25500 18275 17517 gene locus_tag LOCUS_25510 18275 17517 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203643.1 protein_id gnl|my_center|LOCUS_25510 18296 18517 gene locus_tag LOCUS_25520 18296 18517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 18517 18717 gene locus_tag LOCUS_25530 18517 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 18731 19381 gene locus_tag LOCUS_25540 18731 19381 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 protein_id gnl|my_center|LOCUS_25540 19999 19598 gene locus_tag LOCUS_tm00010 19999 19598 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 20482 20904 gene locus_tag LOCUS_25550 gene ybeY 20482 20904 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_25550 20910 22865 gene locus_tag LOCUS_25560 gene mnmG 20910 22865 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_25560 22961 23485 gene locus_tag LOCUS_25570 22961 23485 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762874.1 protein_id gnl|my_center|LOCUS_25570 23688 25646 gene locus_tag LOCUS_25580 gene uvrC 23688 25646 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_25580 25743 28007 gene locus_tag LOCUS_25590 gene rnr 25743 28007 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_25590 28074 30404 gene locus_tag LOCUS_25600 28074 30404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 30564 31562 gene locus_tag LOCUS_25610 30564 31562 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 protein_id gnl|my_center|LOCUS_25610 31827 31901 gene locus_tag LOCUS_t00400 31827 31901 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 32030 32359 gene locus_tag LOCUS_25620 32030 32359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 32352 33011 gene locus_tag LOCUS_25630 gene ruvC 32352 33011 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_25630 33094 33972 gene locus_tag LOCUS_25640 gene deoC 33094 33972 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_25640 34618 34094 gene locus_tag LOCUS_25650 34618 34094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 36115 34850 gene locus_tag LOCUS_25660 gene fabF 36115 34850 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762962.1 protein_id gnl|my_center|LOCUS_25660 36382 36146 gene locus_tag LOCUS_25670 36382 36146 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_25670 37581 36559 gene locus_tag LOCUS_25680 37581 36559 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_25680 39440 37587 gene locus_tag LOCUS_25690 39440 37587 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108505.1 protein_id gnl|my_center|LOCUS_25690 41194 39650 gene locus_tag LOCUS_25700 41194 39650 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_25700 42199 41228 gene locus_tag LOCUS_25710 42199 41228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 42974 42357 gene locus_tag LOCUS_25720 42974 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 44292 43204 gene locus_tag LOCUS_25730 44292 43204 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_25730 46146 44356 gene locus_tag LOCUS_25740 46146 44356 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_25740 46307 46807 gene locus_tag LOCUS_25750 46307 46807 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_25750 46866 48146 gene locus_tag LOCUS_25760 46866 48146 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_25760 48151 49053 gene locus_tag LOCUS_25770 48151 49053 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_25770 49053 50168 gene locus_tag LOCUS_25780 49053 50168 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_25780 50210 51376 gene locus_tag LOCUS_25790 gene obgE 50210 51376 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_25790 51369 52196 gene locus_tag LOCUS_25800 51369 52196 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_25800 53335 52241 gene locus_tag LOCUS_25810 53335 52241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 54458 53403 gene locus_tag LOCUS_25820 54458 53403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 55786 54614 gene locus_tag LOCUS_25830 55786 54614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 56121 55810 gene locus_tag LOCUS_25840 56121 55810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 57473 56319 gene locus_tag LOCUS_25850 57473 56319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 58266 57484 gene locus_tag LOCUS_25860 58266 57484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 58344 58559 gene locus_tag LOCUS_25870 58344 58559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 58892 60994 gene locus_tag LOCUS_25880 gene yidC 58892 60994 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_25880 61092 61910 gene locus_tag LOCUS_25890 61092 61910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 61985 62779 gene locus_tag LOCUS_25900 61985 62779 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_25900 63381 65153 gene locus_tag LOCUS_25910 63381 65153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_25910 65282 65680 gene locus_tag LOCUS_25920 65282 65680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence26 851 381 gene locus_tag LOCUS_25930 851 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1654 1187 gene locus_tag LOCUS_25940 1654 1187 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_25940 3072 1804 gene locus_tag LOCUS_25950 3072 1804 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_25950 3676 3122 gene locus_tag LOCUS_25960 3676 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 5015 3756 gene locus_tag LOCUS_25970 5015 3756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_25970 5874 5095 gene locus_tag LOCUS_25980 5874 5095 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_25980 6352 5882 gene locus_tag LOCUS_25990 6352 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 6696 6388 gene locus_tag LOCUS_26000 6696 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 7141 7647 gene locus_tag LOCUS_26010 7141 7647 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_26010 7973 9271 gene locus_tag LOCUS_26020 7973 9271 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_26020 9268 10170 gene locus_tag LOCUS_26030 9268 10170 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_26030 10155 10934 gene locus_tag LOCUS_26040 gene kdsB 10155 10934 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030749.1 protein_id gnl|my_center|LOCUS_26040 10948 11976 gene locus_tag LOCUS_26050 10948 11976 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_26050 11973 13817 gene locus_tag LOCUS_26060 11973 13817 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_26060 13819 15795 gene locus_tag LOCUS_26070 13819 15795 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_26070 15816 16007 gene locus_tag LOCUS_26080 15816 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 16064 17245 gene locus_tag LOCUS_26090 16064 17245 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_26090 17335 18177 gene locus_tag LOCUS_26100 17335 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 19326 18226 gene locus_tag LOCUS_26110 19326 18226 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222112.1 protein_id gnl|my_center|LOCUS_26110 20372 19323 gene locus_tag LOCUS_26120 20372 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 21078 20401 gene locus_tag LOCUS_26130 gene trmD 21078 20401 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_26130 21987 23864 gene locus_tag LOCUS_26140 21987 23864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 23975 26332 gene locus_tag LOCUS_26150 23975 26332 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767047.1 protein_id gnl|my_center|LOCUS_26150 26496 27377 gene locus_tag LOCUS_26160 26496 27377 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_26160 28858 27530 gene locus_tag LOCUS_26170 28858 27530 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_26170 29998 29273 gene locus_tag LOCUS_26180 29998 29273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 30983 30030 gene locus_tag LOCUS_26190 30983 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 31849 30980 gene locus_tag LOCUS_26200 31849 30980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 32574 31861 gene locus_tag LOCUS_26210 32574 31861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 33737 32571 gene locus_tag LOCUS_26220 gene pdxA 33737 32571 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_26220 34796 33744 gene locus_tag LOCUS_26230 gene rlmN 34796 33744 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840521.1 protein_id gnl|my_center|LOCUS_26230 37032 34903 gene locus_tag LOCUS_26240 37032 34903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 38577 37255 gene locus_tag LOCUS_26250 gene metK 38577 37255 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_26250 39003 38929 gene locus_tag LOCUS_t00410 39003 38929 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 39273 39968 gene locus_tag LOCUS_26260 39273 39968 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951353.1 protein_id gnl|my_center|LOCUS_26260 41366 40308 gene locus_tag LOCUS_26270 41366 40308 CDS product DUF4973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762471.1 protein_id gnl|my_center|LOCUS_26270 43626 41458 gene locus_tag LOCUS_26280 43626 41458 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767681.1 protein_id gnl|my_center|LOCUS_26280 46772 43638 gene locus_tag LOCUS_26290 46772 43638 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767691.1 protein_id gnl|my_center|LOCUS_26290 48338 46806 gene locus_tag LOCUS_26300 48338 46806 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108853.1 protein_id gnl|my_center|LOCUS_26300 50940 48472 gene locus_tag LOCUS_26310 50940 48472 CDS product glutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108848.1 protein_id gnl|my_center|LOCUS_26310 51261 52277 gene locus_tag LOCUS_26320 51261 52277 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767655.1 protein_id gnl|my_center|LOCUS_26320 56334 52396 gene locus_tag LOCUS_26330 56334 52396 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_26330 59327 56646 gene locus_tag LOCUS_26340 59327 56646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 59604 64109 gene locus_tag LOCUS_26350 59604 64109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence27 173 271 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 303 521 gene locus_tag LOCUS_26360 303 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 547 795 gene locus_tag LOCUS_26370 547 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 779 1204 gene locus_tag LOCUS_26380 779 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1456 3123 gene locus_tag LOCUS_26390 1456 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3206 5443 gene locus_tag LOCUS_26400 3206 5443 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202102.1 protein_id gnl|my_center|LOCUS_26400 5440 6516 gene locus_tag LOCUS_26410 5440 6516 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_26410 6435 6671 gene locus_tag LOCUS_26420 6435 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6823 7248 gene locus_tag LOCUS_26430 6823 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 8169 7399 gene locus_tag LOCUS_26440 8169 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 8645 8878 gene locus_tag LOCUS_26450 8645 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 8784 9599 gene locus_tag LOCUS_26460 8784 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 9645 10352 gene locus_tag LOCUS_26470 9645 10352 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_26470 10965 10423 gene locus_tag LOCUS_26480 10965 10423 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763367.1 protein_id gnl|my_center|LOCUS_26480 11572 11018 gene locus_tag LOCUS_26490 11572 11018 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_26490 12098 12646 gene locus_tag LOCUS_26500 12098 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 13172 12933 gene locus_tag LOCUS_26510 13172 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 13669 13199 gene locus_tag LOCUS_26520 13669 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 15193 13757 gene locus_tag LOCUS_26530 15193 13757 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_26530 16359 15190 gene locus_tag LOCUS_26540 16359 15190 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202732.1 protein_id gnl|my_center|LOCUS_26540 17180 16332 gene locus_tag LOCUS_26550 17180 16332 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_26550 17752 18600 gene locus_tag LOCUS_26560 17752 18600 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_26560 19792 22311 gene locus_tag LOCUS_26570 19792 22311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 22311 22766 gene locus_tag LOCUS_26580 22311 22766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 22768 26250 gene locus_tag LOCUS_26590 22768 26250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 26240 28669 gene locus_tag LOCUS_26600 26240 28669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 28666 30102 gene locus_tag LOCUS_26610 28666 30102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 30132 30419 gene locus_tag LOCUS_26620 30132 30419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 30428 32653 gene locus_tag LOCUS_26630 30428 32653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 32660 33199 gene locus_tag LOCUS_26640 32660 33199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 33661 34065 gene locus_tag LOCUS_26650 33661 34065 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_26650 34670 34194 gene locus_tag LOCUS_26660 34670 34194 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107759.1 protein_id gnl|my_center|LOCUS_26660 36138 34858 gene locus_tag LOCUS_26670 36138 34858 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202363.1 protein_id gnl|my_center|LOCUS_26670 36722 36135 gene locus_tag LOCUS_26680 36722 36135 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_26680 37512 36820 gene locus_tag LOCUS_26690 37512 36820 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_26690 38601 37849 gene locus_tag LOCUS_26700 38601 37849 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947915.1 protein_id gnl|my_center|LOCUS_26700 38961 39434 gene locus_tag LOCUS_26710 38961 39434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 39578 40999 gene locus_tag LOCUS_26720 39578 40999 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787973.1 protein_id gnl|my_center|LOCUS_26720 41135 40986 gene locus_tag LOCUS_26730 41135 40986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 43176 41104 gene locus_tag LOCUS_26740 43176 41104 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 protein_id gnl|my_center|LOCUS_26740 43564 43217 gene locus_tag LOCUS_26750 43564 43217 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784350.1 protein_id gnl|my_center|LOCUS_26750 43776 44690 gene locus_tag LOCUS_26760 43776 44690 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_26760 45063 44656 gene locus_tag LOCUS_26770 45063 44656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 45454 47214 gene locus_tag LOCUS_26780 45454 47214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 47631 47320 gene locus_tag LOCUS_26790 47631 47320 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005820814.1 protein_id gnl|my_center|LOCUS_26790 47976 47635 gene locus_tag LOCUS_26800 47976 47635 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555815.1 protein_id gnl|my_center|LOCUS_26800 48651 50012 gene locus_tag LOCUS_26810 48651 50012 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767969.1 protein_id gnl|my_center|LOCUS_26810 50681 50187 gene locus_tag LOCUS_26820 50681 50187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 51303 50689 gene locus_tag LOCUS_26830 51303 50689 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_26830 51707 51324 gene locus_tag LOCUS_26840 51707 51324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 51907 52263 gene locus_tag LOCUS_26850 51907 52263 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293542.1 protein_id gnl|my_center|LOCUS_26850 53953 52268 gene locus_tag LOCUS_26860 53953 52268 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_26860 54502 54137 gene locus_tag LOCUS_26870 54502 54137 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202355.1 protein_id gnl|my_center|LOCUS_26870 56114 54570 gene locus_tag LOCUS_26880 gene hcp 56114 54570 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062937.1 protein_id gnl|my_center|LOCUS_26880 56697 56347 gene locus_tag LOCUS_26890 56697 56347 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_26890 57655 56720 gene locus_tag LOCUS_26900 57655 56720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 58739 58826 gene locus_tag LOCUS_t00420 58739 58826 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 59545 58991 gene locus_tag LOCUS_26910 59545 58991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 60575 59562 gene locus_tag LOCUS_26920 60575 59562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 60847 60575 gene locus_tag LOCUS_26930 60847 60575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 61266 60859 gene locus_tag LOCUS_26940 61266 60859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 61814 61530 gene locus_tag LOCUS_26950 61814 61530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 62192 61818 gene locus_tag LOCUS_26960 62192 61818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence28 1669 1028 gene locus_tag LOCUS_26970 1669 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2354 1674 gene locus_tag LOCUS_26980 2354 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3951 2431 gene locus_tag LOCUS_26990 3951 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 4154 3990 gene locus_tag LOCUS_27000 4154 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 4890 4156 gene locus_tag LOCUS_27010 4890 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 5040 5468 gene locus_tag LOCUS_27020 5040 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 5465 7564 gene locus_tag LOCUS_27030 5465 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 9541 7577 gene locus_tag LOCUS_27040 9541 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 10349 9651 gene locus_tag LOCUS_27050 10349 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 10742 10581 gene locus_tag LOCUS_27060 10742 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 11005 10739 gene locus_tag LOCUS_27070 11005 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 11193 11002 gene locus_tag LOCUS_27080 11193 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 11357 11163 gene locus_tag LOCUS_27090 11357 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 12010 11357 gene locus_tag LOCUS_27100 12010 11357 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217650.1 protein_id gnl|my_center|LOCUS_27100 12966 12556 gene locus_tag LOCUS_27110 12966 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 13208 12963 gene locus_tag LOCUS_27120 13208 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 13729 13223 gene locus_tag LOCUS_27130 13729 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 14651 13797 gene locus_tag LOCUS_27140 14651 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 15025 14657 gene locus_tag LOCUS_27150 15025 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 15297 15022 gene locus_tag LOCUS_27160 15297 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 15452 15294 gene locus_tag LOCUS_27170 15452 15294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 15671 15462 gene locus_tag LOCUS_27180 15671 15462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 17115 15676 gene locus_tag LOCUS_27190 17115 15676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 17776 17090 gene locus_tag LOCUS_27200 17776 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 18999 17779 gene locus_tag LOCUS_27210 18999 17779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 19984 19022 gene locus_tag LOCUS_27220 19984 19022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 20515 20273 gene locus_tag LOCUS_27230 20515 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 20856 20566 gene locus_tag LOCUS_27240 20856 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 21002 20853 gene locus_tag LOCUS_27250 21002 20853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 21191 21658 gene locus_tag LOCUS_27260 21191 21658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 21681 22337 gene locus_tag LOCUS_27270 21681 22337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 22717 23706 gene locus_tag LOCUS_27280 22717 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 23992 24585 gene locus_tag LOCUS_27290 23992 24585 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_27290 24606 24797 gene locus_tag LOCUS_27300 24606 24797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 24949 25569 gene locus_tag LOCUS_27310 24949 25569 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768961.1 protein_id gnl|my_center|LOCUS_27310 25666 26244 gene locus_tag LOCUS_27320 25666 26244 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788037.1 protein_id gnl|my_center|LOCUS_27320 26501 26860 gene locus_tag LOCUS_27330 gene rsfS 26501 26860 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784862.1 protein_id gnl|my_center|LOCUS_27330 26960 28978 gene locus_tag LOCUS_27340 gene ftsH 26960 28978 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_27340 29580 30626 gene locus_tag LOCUS_27350 29580 30626 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_27350 30671 34042 gene locus_tag LOCUS_27360 30671 34042 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118819.1 protein_id gnl|my_center|LOCUS_27360 34058 35452 gene locus_tag LOCUS_27370 34058 35452 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_27370 35481 36278 gene locus_tag LOCUS_27380 gene lpxA 35481 36278 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_27380 37413 36379 gene locus_tag LOCUS_27390 37413 36379 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390097.1 protein_id gnl|my_center|LOCUS_27390 37624 39621 gene locus_tag LOCUS_27400 37624 39621 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765435.1 protein_id gnl|my_center|LOCUS_27400 39633 41330 gene locus_tag LOCUS_27410 39633 41330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 41422 42663 gene locus_tag LOCUS_27420 gene hutI 41422 42663 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_27420 42708 44213 gene locus_tag LOCUS_27430 gene hutH 42708 44213 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797649.1 protein_id gnl|my_center|LOCUS_27430 45200 44409 gene locus_tag LOCUS_27440 45200 44409 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797826.1 protein_id gnl|my_center|LOCUS_27440 45761 45982 gene locus_tag LOCUS_27450 45761 45982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 46007 47239 gene locus_tag LOCUS_27460 46007 47239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 47272 47727 gene locus_tag LOCUS_27470 47272 47727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 48506 50323 gene locus_tag LOCUS_27480 48506 50323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 50333 50722 gene locus_tag LOCUS_27490 50333 50722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 50729 52759 gene locus_tag LOCUS_27500 50729 52759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 52762 54837 gene locus_tag LOCUS_27510 52762 54837 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004318448.1 protein_id gnl|my_center|LOCUS_27510 54993 56414 gene locus_tag LOCUS_27520 54993 56414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 56487 57698 gene locus_tag LOCUS_27530 56487 57698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 58120 58305 gene locus_tag LOCUS_27540 58120 58305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 58308 58877 gene locus_tag LOCUS_27550 58308 58877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 59827 59027 gene locus_tag LOCUS_27560 59827 59027 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_27560 59943 60458 gene locus_tag LOCUS_27570 59943 60458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 60635 61243 gene locus_tag LOCUS_27580 60635 61243 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437445.1 protein_id gnl|my_center|LOCUS_27580 61456 62157 gene locus_tag LOCUS_27590 61456 62157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence29 828 37 gene locus_tag LOCUS_27600 828 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2292 976 gene locus_tag LOCUS_27610 2292 976 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_27610 2935 2522 gene locus_tag LOCUS_27620 2935 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4323 2932 gene locus_tag LOCUS_27630 4323 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 5521 6099 gene locus_tag LOCUS_27640 5521 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 6304 6155 gene locus_tag LOCUS_27650 6304 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 6327 7700 gene locus_tag LOCUS_27660 6327 7700 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_27660 7697 8626 gene locus_tag LOCUS_27670 gene gluQRS 7697 8626 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_27670 10164 8701 gene locus_tag LOCUS_27680 10164 8701 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107221.1 protein_id gnl|my_center|LOCUS_27680 10563 14849 gene locus_tag LOCUS_27690 10563 14849 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107220.1 protein_id gnl|my_center|LOCUS_27690 15078 16913 gene locus_tag LOCUS_27700 15078 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 17015 20068 gene locus_tag LOCUS_27710 17015 20068 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_27710 20084 21853 gene locus_tag LOCUS_27720 20084 21853 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_27720 21891 25124 gene locus_tag LOCUS_27730 21891 25124 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107217.1 protein_id gnl|my_center|LOCUS_27730 25143 26912 gene locus_tag LOCUS_27740 25143 26912 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_27740 26959 28863 gene locus_tag LOCUS_27750 26959 28863 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107215.1 protein_id gnl|my_center|LOCUS_27750 28998 29666 gene locus_tag LOCUS_27760 28998 29666 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203724.1 protein_id gnl|my_center|LOCUS_27760 29682 30236 gene locus_tag LOCUS_27770 29682 30236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 30236 30454 gene locus_tag LOCUS_27780 30236 30454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 30476 31336 gene locus_tag LOCUS_27790 30476 31336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 31922 31557 gene locus_tag LOCUS_27800 31922 31557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 32583 32062 gene locus_tag LOCUS_27810 32583 32062 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765417.1 protein_id gnl|my_center|LOCUS_27810 32771 35866 gene locus_tag LOCUS_27820 32771 35866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 35881 37602 gene locus_tag LOCUS_27830 35881 37602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 38716 37892 gene locus_tag LOCUS_27840 38716 37892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 39147 41525 gene locus_tag LOCUS_27850 39147 41525 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_27850 41533 42663 gene locus_tag LOCUS_27860 41533 42663 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_27860 42699 43529 gene locus_tag LOCUS_27870 42699 43529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 45562 43589 gene locus_tag LOCUS_27880 gene gyrB 45562 43589 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_27880 45925 48309 gene locus_tag LOCUS_27890 gene topA 45925 48309 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_27890 48480 49925 gene locus_tag LOCUS_27900 48480 49925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108645.1 protein_id gnl|my_center|LOCUS_27900 50181 51569 gene locus_tag LOCUS_27910 50181 51569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 52979 51672 gene locus_tag LOCUS_27920 gene thrC 52979 51672 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_27920 54263 53046 gene locus_tag LOCUS_27930 54263 53046 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_27930 56755 54311 gene locus_tag LOCUS_27940 gene thrA 56755 54311 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_27940 57661 57419 gene locus_tag LOCUS_27950 57661 57419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence30 537 1448 gene locus_tag LOCUS_27960 537 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1633 2280 gene locus_tag LOCUS_27970 1633 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 2292 3818 gene locus_tag LOCUS_27980 gene lidL 2292 3818 CDS product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_27980 3879 4787 gene locus_tag LOCUS_27990 3879 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 5802 4852 gene locus_tag LOCUS_28000 gene mltG 5802 4852 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_28000 6528 6235 gene locus_tag LOCUS_28010 gene raiA 6528 6235 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_28010 8323 6731 gene locus_tag LOCUS_28020 8323 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 16372 8990 gene locus_tag LOCUS_28030 16372 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 19323 16384 gene locus_tag LOCUS_28040 19323 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 20529 19552 gene locus_tag LOCUS_28050 gene xerC 20529 19552 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_28050 20849 20658 gene locus_tag LOCUS_28060 gene rpsU 20849 20658 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_28060 22160 20994 gene locus_tag LOCUS_28070 22160 20994 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795850.1 protein_id gnl|my_center|LOCUS_28070 23183 22233 gene locus_tag LOCUS_28080 23183 22233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_28080 23619 23176 gene locus_tag LOCUS_28090 23619 23176 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802402.1 protein_id gnl|my_center|LOCUS_28090 24023 23616 gene locus_tag LOCUS_28100 24023 23616 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802400.1 protein_id gnl|my_center|LOCUS_28100 24535 24020 gene locus_tag LOCUS_28110 24535 24020 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_28110 26391 24592 gene locus_tag LOCUS_28120 26391 24592 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_28120 28321 27116 gene locus_tag LOCUS_28130 28321 27116 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_28130 28864 29247 gene locus_tag LOCUS_28140 gene rpsL 28864 29247 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_28140 29347 29871 gene locus_tag LOCUS_28150 gene rpsG 29347 29871 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_28150 29890 32013 gene locus_tag LOCUS_28160 gene fusA 29890 32013 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_28160 32032 32337 gene locus_tag LOCUS_28170 gene rpsJ 32032 32337 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_28170 32432 33049 gene locus_tag LOCUS_28180 gene rplC 32432 33049 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762034.1 protein_id gnl|my_center|LOCUS_28180 33049 33684 gene locus_tag LOCUS_28190 gene rplD 33049 33684 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_28190 33704 33994 gene locus_tag LOCUS_28200 gene rplW 33704 33994 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_28200 34001 34873 gene locus_tag LOCUS_28210 gene rplB 34001 34873 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_28210 34896 35165 gene locus_tag LOCUS_28220 gene rpsS 34896 35165 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_28220 35218 35622 gene locus_tag LOCUS_28230 gene rplV 35218 35622 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_28230 35630 36361 gene locus_tag LOCUS_28240 gene rpsC 35630 36361 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_28240 36377 36808 gene locus_tag LOCUS_28250 gene rplP 36377 36808 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_28250 36835 37056 gene locus_tag LOCUS_28260 gene rpmC 36835 37056 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963462.1 protein_id gnl|my_center|LOCUS_28260 37079 37339 gene locus_tag LOCUS_28270 gene rpsQ 37079 37339 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_28270 37342 37707 gene locus_tag LOCUS_28280 gene rplN 37342 37707 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_28280 37735 38055 gene locus_tag LOCUS_28290 gene rplX 37735 38055 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_28290 38055 38603 gene locus_tag LOCUS_28300 gene rplE 38055 38603 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 protein_id gnl|my_center|LOCUS_28300 38609 38911 gene locus_tag LOCUS_28310 gene rpsN 38609 38911 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762042.1 protein_id gnl|my_center|LOCUS_28310 39094 39492 gene locus_tag LOCUS_28320 gene rpsH 39094 39492 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 protein_id gnl|my_center|LOCUS_28320 39511 40065 gene locus_tag LOCUS_28330 gene rplF 39511 40065 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_28330 40084 40425 gene locus_tag LOCUS_28340 gene rplR 40084 40425 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_28340 40435 40953 gene locus_tag LOCUS_28350 gene rpsE 40435 40953 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_28350 40965 41144 gene locus_tag LOCUS_28360 gene rpmD 40965 41144 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_28360 41159 41605 gene locus_tag LOCUS_28370 gene rplO 41159 41605 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_28370 41611 42948 gene locus_tag LOCUS_28380 gene secY 41611 42948 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_28380 42969 43760 gene locus_tag LOCUS_28390 gene map 42969 43760 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108453.1 protein_id gnl|my_center|LOCUS_28390 43792 44010 gene locus_tag LOCUS_28400 gene infA 43792 44010 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_28400 44178 44558 gene locus_tag LOCUS_28410 gene rpsM 44178 44558 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_28410 44568 44957 gene locus_tag LOCUS_28420 gene rpsK 44568 44957 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_28420 45086 45691 gene locus_tag LOCUS_28430 gene rpsD 45086 45691 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_28430 45708 46706 gene locus_tag LOCUS_28440 45708 46706 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_28440 46713 47201 gene locus_tag LOCUS_28450 gene rplQ 46713 47201 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791577.1 protein_id gnl|my_center|LOCUS_28450 47305 48750 gene locus_tag LOCUS_28460 gene cls 47305 48750 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_28460 48859 49443 gene locus_tag LOCUS_28470 48859 49443 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_28470 49851 49779 gene locus_tag LOCUS_t00430 49851 49779 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 49938 50606 gene locus_tag LOCUS_28480 gene ung 49938 50606 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_28480 50600 51850 gene locus_tag LOCUS_28490 50600 51850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 53931 51922 gene locus_tag LOCUS_28500 gene pulA 53931 51922 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109382.1 protein_id gnl|my_center|LOCUS_28500 54426 54701 gene locus_tag LOCUS_28510 gene rpsO 54426 54701 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_28510 56088 54823 gene locus_tag LOCUS_28520 56088 54823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence31 824 438 gene locus_tag LOCUS_28530 824 438 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788387.1 protein_id gnl|my_center|LOCUS_28530 1070 1420 gene locus_tag LOCUS_28540 1070 1420 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_28540 1648 4455 gene locus_tag LOCUS_28550 1648 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_28550 4490 6025 gene locus_tag LOCUS_28560 4490 6025 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_28560 6035 7012 gene locus_tag LOCUS_28570 6035 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 7959 7024 gene locus_tag LOCUS_28580 gene queG 7959 7024 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 protein_id gnl|my_center|LOCUS_28580 8627 7962 gene locus_tag LOCUS_28590 8627 7962 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_28590 9683 8676 gene locus_tag LOCUS_28600 gene pdxB 9683 8676 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_28600 10693 9704 gene locus_tag LOCUS_28610 10693 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 12495 10714 gene locus_tag LOCUS_28620 12495 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 13992 12619 gene locus_tag LOCUS_28630 gene ftsZ 13992 12619 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763706.1 protein_id gnl|my_center|LOCUS_28630 15387 14071 gene locus_tag LOCUS_28640 gene ftsA 15387 14071 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108835.1 protein_id gnl|my_center|LOCUS_28640 16265 15456 gene locus_tag LOCUS_28650 16265 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 17689 16280 gene locus_tag LOCUS_28660 gene murC 17689 16280 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_28660 18822 17692 gene locus_tag LOCUS_28670 gene murG 18822 17692 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_28670 20180 18819 gene locus_tag LOCUS_28680 20180 18819 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_28680 21599 20220 gene locus_tag LOCUS_28690 gene murD 21599 20220 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_28690 23001 21682 gene locus_tag LOCUS_28700 gene mraY 23001 21682 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_28700 24458 22998 gene locus_tag LOCUS_28710 24458 22998 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_28710 26644 24503 gene locus_tag LOCUS_28720 26644 24503 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_28720 27040 26663 gene locus_tag LOCUS_28730 27040 26663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 27991 27080 gene locus_tag LOCUS_28740 gene rsmH 27991 27080 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_28740 28553 28233 gene locus_tag LOCUS_28750 28553 28233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 31442 28812 gene locus_tag LOCUS_28760 gene mutS 31442 28812 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_28760 32823 31456 gene locus_tag LOCUS_28770 gene mgtE 32823 31456 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_28770 34496 32943 gene locus_tag LOCUS_28780 34496 32943 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_28780 36298 34628 gene locus_tag LOCUS_28790 36298 34628 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_28790 36671 36745 gene locus_tag LOCUS_t00440 36671 36745 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 36784 37038 gene locus_tag LOCUS_28800 gene rpsT 36784 37038 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_28800 37134 37207 gene locus_tag LOCUS_t00450 37134 37207 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 37441 38049 gene locus_tag LOCUS_28810 37441 38049 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_28810 38152 41124 gene locus_tag LOCUS_28820 38152 41124 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_28820 41148 43028 gene locus_tag LOCUS_28830 41148 43028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 43165 43698 gene locus_tag LOCUS_28840 43165 43698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 44666 43719 gene locus_tag LOCUS_28850 44666 43719 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994687.1 protein_id gnl|my_center|LOCUS_28850 44998 44669 gene locus_tag LOCUS_28860 44998 44669 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_28860 45942 44998 gene locus_tag LOCUS_28870 45942 44998 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791345.1 protein_id gnl|my_center|LOCUS_28870 46927 46139 gene locus_tag LOCUS_28880 46927 46139 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_28880 47277 47753 gene locus_tag LOCUS_28890 47277 47753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence32 1520 204 gene locus_tag LOCUS_28900 1520 204 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202712.1 protein_id gnl|my_center|LOCUS_28900 2064 1990 gene locus_tag LOCUS_t00460 2064 1990 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2225 3073 gene locus_tag LOCUS_28910 gene prmC 2225 3073 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_28910 3070 3576 gene locus_tag LOCUS_28920 3070 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3587 4276 gene locus_tag LOCUS_28930 3587 4276 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_28930 4456 5100 gene locus_tag LOCUS_28940 gene pyrE 4456 5100 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_28940 5122 5565 gene locus_tag LOCUS_28950 5122 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 5562 6095 gene locus_tag LOCUS_28960 5562 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 6219 6800 gene locus_tag LOCUS_28970 6219 6800 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_28970 6797 7897 gene locus_tag LOCUS_28980 6797 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 8174 9478 gene locus_tag LOCUS_28990 8174 9478 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108221.1 protein_id gnl|my_center|LOCUS_28990 9475 10437 gene locus_tag LOCUS_29000 9475 10437 CDS product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927908.1 protein_id gnl|my_center|LOCUS_29000 10519 11835 gene locus_tag LOCUS_29010 10519 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 12182 13039 gene locus_tag LOCUS_29020 12182 13039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 13076 14173 gene locus_tag LOCUS_29030 13076 14173 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767329.1 protein_id gnl|my_center|LOCUS_29030 14170 15312 gene locus_tag LOCUS_29040 14170 15312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 15933 15349 gene locus_tag LOCUS_29050 15933 15349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 16878 15967 gene locus_tag LOCUS_29060 16878 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 18496 16883 gene locus_tag LOCUS_29070 18496 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 19448 18537 gene locus_tag LOCUS_29080 19448 18537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 20261 19527 gene locus_tag LOCUS_29090 20261 19527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 21403 20510 gene locus_tag LOCUS_29100 21403 20510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 24995 21492 gene locus_tag LOCUS_29110 24995 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 25950 25030 gene locus_tag LOCUS_29120 25950 25030 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203478.1 protein_id gnl|my_center|LOCUS_29120 26311 27495 gene locus_tag LOCUS_29130 26311 27495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_29130 28206 27835 gene locus_tag LOCUS_29140 28206 27835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 28941 28240 gene locus_tag LOCUS_29150 28941 28240 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_29150 30459 29596 gene locus_tag LOCUS_29160 30459 29596 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 protein_id gnl|my_center|LOCUS_29160 31705 32775 gene locus_tag LOCUS_29170 31705 32775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 33420 32845 gene locus_tag LOCUS_29180 33420 32845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 34450 33869 gene locus_tag LOCUS_29190 34450 33869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 36186 34435 gene locus_tag LOCUS_29200 36186 34435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 43424 36183 gene locus_tag LOCUS_29210 43424 36183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 43873 43574 gene locus_tag LOCUS_29220 43873 43574 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_29220 45760 43901 gene locus_tag LOCUS_29230 45760 43901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence33 971 399 gene locus_tag LOCUS_29240 971 399 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261826.1 protein_id gnl|my_center|LOCUS_29240 1417 1040 gene locus_tag LOCUS_29250 1417 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 2170 1433 gene locus_tag LOCUS_29260 2170 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 4674 2182 gene locus_tag LOCUS_29270 4674 2182 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107440.1 protein_id gnl|my_center|LOCUS_29270 6514 4856 gene locus_tag LOCUS_29280 6514 4856 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 protein_id gnl|my_center|LOCUS_29280 6808 7410 gene locus_tag LOCUS_29290 6808 7410 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_29290 7428 8150 gene locus_tag LOCUS_29300 gene cmk 7428 8150 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_29300 8192 9076 gene locus_tag LOCUS_29310 8192 9076 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_29310 9063 9548 gene locus_tag LOCUS_29320 9063 9548 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_29320 9809 10747 gene locus_tag LOCUS_29330 9809 10747 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_29330 10852 11751 gene locus_tag LOCUS_29340 10852 11751 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797932.1 protein_id gnl|my_center|LOCUS_29340 11866 13419 gene locus_tag LOCUS_29350 gene dnaB 11866 13419 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_29350 13581 13796 gene locus_tag LOCUS_29360 13581 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 14454 15020 gene locus_tag LOCUS_29370 gene efp 14454 15020 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784338.1 protein_id gnl|my_center|LOCUS_29370 15051 16061 gene locus_tag LOCUS_29380 15051 16061 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_29380 16076 16810 gene locus_tag LOCUS_29390 gene radC 16076 16810 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932298.1 protein_id gnl|my_center|LOCUS_29390 18016 16823 gene locus_tag LOCUS_29400 18016 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 19631 18057 gene locus_tag LOCUS_29410 19631 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 21202 19694 gene locus_tag LOCUS_29420 gene gpmI 21202 19694 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108817.1 protein_id gnl|my_center|LOCUS_29420 21787 21422 gene locus_tag LOCUS_29430 gene rplS 21787 21422 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_29430 23000 21981 gene locus_tag LOCUS_29440 gene porQ 23000 21981 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714810.1 protein_id gnl|my_center|LOCUS_29440 23288 23731 gene locus_tag LOCUS_29450 23288 23731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 24091 23882 gene locus_tag LOCUS_29460 24091 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 24323 25312 gene locus_tag LOCUS_29470 gene rsgA 24323 25312 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_29470 26139 25369 gene locus_tag LOCUS_29480 gene cdaA 26139 25369 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_29480 26997 26188 gene locus_tag LOCUS_29490 gene folP 26997 26188 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_29490 28861 27062 gene locus_tag LOCUS_29500 gene typA 28861 27062 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_29500 30614 29040 gene locus_tag LOCUS_29510 30614 29040 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790465.1 protein_id gnl|my_center|LOCUS_29510 31926 30682 gene locus_tag LOCUS_29520 31926 30682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 32762 31968 gene locus_tag LOCUS_29530 32762 31968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_29530 35009 32775 gene locus_tag LOCUS_29540 35009 32775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 36354 35035 gene locus_tag LOCUS_29550 36354 35035 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797878.1 protein_id gnl|my_center|LOCUS_29550 38958 36364 gene locus_tag LOCUS_29560 38958 36364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 40090 39305 gene locus_tag LOCUS_29570 40090 39305 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798129.1 protein_id gnl|my_center|LOCUS_29570 41229 40096 gene locus_tag LOCUS_29580 41229 40096 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766479.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence34 1415 63 gene locus_tag LOCUS_29590 1415 63 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_29590 2945 1911 gene locus_tag LOCUS_29600 2945 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3173 2964 gene locus_tag LOCUS_29610 3173 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3978 5258 gene locus_tag LOCUS_29620 gene pyrC 3978 5258 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108375.1 protein_id gnl|my_center|LOCUS_29620 5347 6435 gene locus_tag LOCUS_29630 5347 6435 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830071.1 protein_id gnl|my_center|LOCUS_29630 6470 9655 gene locus_tag LOCUS_29640 gene carB 6470 9655 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_29640 9665 10417 gene locus_tag LOCUS_29650 gene pyrK 9665 10417 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_29650 10408 11334 gene locus_tag LOCUS_29660 10408 11334 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369312.1 protein_id gnl|my_center|LOCUS_29660 11383 12102 gene locus_tag LOCUS_29670 gene pyrF 11383 12102 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_29670 12229 12867 gene locus_tag LOCUS_29680 gene pyrE 12229 12867 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_29680 12864 13952 gene locus_tag LOCUS_29690 gene pyrB 12864 13952 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_29690 14317 15678 gene locus_tag LOCUS_29700 14317 15678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 protein_id gnl|my_center|LOCUS_29700 16514 17326 gene locus_tag LOCUS_29710 16514 17326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 17330 17734 gene locus_tag LOCUS_29720 17330 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 18476 17949 gene locus_tag LOCUS_29730 18476 17949 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 protein_id gnl|my_center|LOCUS_29730 18689 19186 gene locus_tag LOCUS_29740 18689 19186 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_29740 19213 20091 gene locus_tag LOCUS_29750 19213 20091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 20110 20595 gene locus_tag LOCUS_29760 20110 20595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 20805 21806 gene locus_tag LOCUS_29770 20805 21806 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_29770 21819 23513 gene locus_tag LOCUS_29780 21819 23513 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_29780 24631 23531 gene locus_tag LOCUS_29790 24631 23531 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091813.1 protein_id gnl|my_center|LOCUS_29790 25284 24628 gene locus_tag LOCUS_29800 gene nth 25284 24628 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_29800 26353 25328 gene locus_tag LOCUS_29810 gene pheS 26353 25328 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_29810 26627 27373 gene locus_tag LOCUS_29820 26627 27373 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_29820 31809 27550 gene locus_tag LOCUS_29830 gene rpoC 31809 27550 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_29830 35652 31840 gene locus_tag LOCUS_29840 gene rpoB 35652 31840 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762029.1 protein_id gnl|my_center|LOCUS_29840 36210 35836 gene locus_tag LOCUS_29850 gene rplL 36210 35836 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_29850 36767 36243 gene locus_tag LOCUS_29860 gene rplJ 36767 36243 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_29860 37480 36785 gene locus_tag LOCUS_29870 gene rplA 37480 36785 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_29870 37936 37493 gene locus_tag LOCUS_29880 gene rplK 37936 37493 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762027.1 protein_id gnl|my_center|LOCUS_29880 38555 38004 gene locus_tag LOCUS_29890 gene nusG 38555 38004 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_29890 38759 38577 gene locus_tag LOCUS_29900 gene secE 38759 38577 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_29900 38856 38781 gene locus_tag LOCUS_t00470 38856 38781 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence35 100 3060 gene locus_tag LOCUS_29910 100 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3136 4341 gene locus_tag LOCUS_29920 3136 4341 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_29920 4607 5512 gene locus_tag LOCUS_29930 4607 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 5521 7545 gene locus_tag LOCUS_29940 5521 7545 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761732.1 protein_id gnl|my_center|LOCUS_29940 7573 8331 gene locus_tag LOCUS_29950 7573 8331 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_29950 8673 9980 gene locus_tag LOCUS_29960 8673 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 10228 11511 gene locus_tag LOCUS_29970 10228 11511 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_29970 11551 12141 gene locus_tag LOCUS_29980 11551 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 12147 12842 gene locus_tag LOCUS_29990 12147 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 13456 12863 gene locus_tag LOCUS_30000 13456 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 14153 13497 gene locus_tag LOCUS_30010 14153 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 14302 16035 gene locus_tag LOCUS_30020 14302 16035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 16189 16578 gene locus_tag LOCUS_30030 16189 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 16697 17068 gene locus_tag LOCUS_30040 16697 17068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 17065 18648 gene locus_tag LOCUS_30050 17065 18648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 18747 19118 gene locus_tag LOCUS_30060 18747 19118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 20254 20553 gene locus_tag LOCUS_30070 20254 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 21968 20658 gene locus_tag LOCUS_30080 gene lpxB 21968 20658 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_30080 22076 23512 gene locus_tag LOCUS_30090 22076 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_30090 24325 23453 gene locus_tag LOCUS_30100 24325 23453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 25253 24327 gene locus_tag LOCUS_30110 25253 24327 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118888.1 protein_id gnl|my_center|LOCUS_30110 25558 26496 gene locus_tag LOCUS_30120 25558 26496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 26750 26908 gene locus_tag LOCUS_30130 26750 26908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 27301 27819 gene locus_tag LOCUS_30140 27301 27819 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_30140 29559 28219 gene locus_tag LOCUS_30150 29559 28219 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_30150 32093 29601 gene locus_tag LOCUS_30160 32093 29601 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036929.1 protein_id gnl|my_center|LOCUS_30160 33692 32418 gene locus_tag LOCUS_30170 33692 32418 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_30170 35146 33899 gene locus_tag LOCUS_30180 35146 33899 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence36 196 1236 gene locus_tag LOCUS_30190 196 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 2077 1913 gene locus_tag LOCUS_30200 2077 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 2093 3646 gene locus_tag LOCUS_30210 2093 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 5856 3925 gene locus_tag LOCUS_30220 5856 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202019.1 protein_id gnl|my_center|LOCUS_30220 6395 6718 gene locus_tag LOCUS_30230 6395 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 6732 7625 gene locus_tag LOCUS_30240 6732 7625 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203167.1 protein_id gnl|my_center|LOCUS_30240 7988 9067 gene locus_tag LOCUS_30250 7988 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 9366 10106 gene locus_tag LOCUS_30260 gene lepB 9366 10106 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789018.1 protein_id gnl|my_center|LOCUS_30260 10103 11659 gene locus_tag LOCUS_30270 10103 11659 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767165.1 protein_id gnl|my_center|LOCUS_30270 11790 12017 gene locus_tag LOCUS_30280 11790 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 12128 13135 gene locus_tag LOCUS_30290 12128 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 13577 14950 gene locus_tag LOCUS_30300 13577 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 15094 16563 gene locus_tag LOCUS_30310 15094 16563 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795271.1 protein_id gnl|my_center|LOCUS_30310 16719 17774 gene locus_tag LOCUS_30320 16719 17774 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_30320 17812 20823 gene locus_tag LOCUS_30330 17812 20823 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107391.1 protein_id gnl|my_center|LOCUS_30330 20816 23965 gene locus_tag LOCUS_30340 20816 23965 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027450770.1 protein_id gnl|my_center|LOCUS_30340 24437 24024 gene locus_tag LOCUS_30350 24437 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 25306 24446 gene locus_tag LOCUS_30360 25306 24446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 28959 25303 gene locus_tag LOCUS_30370 28959 25303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203140.1 protein_id gnl|my_center|LOCUS_30370 29494 28943 gene locus_tag LOCUS_30380 29494 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788879.1 protein_id gnl|my_center|LOCUS_30380 30681 29491 gene locus_tag LOCUS_30390 30681 29491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788880.1 protein_id gnl|my_center|LOCUS_30390 31579 30779 gene locus_tag LOCUS_30400 31579 30779 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_30400 32082 32393 gene locus_tag LOCUS_30410 32082 32393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30410 32466 32633 gene locus_tag LOCUS_30420 32466 32633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 32971 33150 gene locus_tag LOCUS_30430 32971 33150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 >Feature sequence37 587 1702 gene locus_tag LOCUS_30440 587 1702 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822199.1 protein_id gnl|my_center|LOCUS_30440 3262 2006 gene locus_tag LOCUS_30450 3262 2006 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916221.1 protein_id gnl|my_center|LOCUS_30450 3385 4410 gene locus_tag LOCUS_30460 3385 4410 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_30460 4515 5960 gene locus_tag LOCUS_30470 gene arcD 4515 5960 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267884.1 protein_id gnl|my_center|LOCUS_30470 6184 9378 gene locus_tag LOCUS_30480 6184 9378 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107757.1 protein_id gnl|my_center|LOCUS_30480 9675 10862 gene locus_tag LOCUS_30490 9675 10862 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104822.1 protein_id gnl|my_center|LOCUS_30490 10849 11409 gene locus_tag LOCUS_30500 10849 11409 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358972.1 protein_id gnl|my_center|LOCUS_30500 11641 13671 gene locus_tag LOCUS_30510 11641 13671 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107334.1 protein_id gnl|my_center|LOCUS_30510 13668 14387 gene locus_tag LOCUS_30520 13668 14387 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765085.1 protein_id gnl|my_center|LOCUS_30520 15340 14525 gene locus_tag LOCUS_30530 15340 14525 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_30530 16991 15423 gene locus_tag LOCUS_30540 16991 15423 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_30540 17876 17064 gene locus_tag LOCUS_30550 17876 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 18931 18017 gene locus_tag LOCUS_30560 18931 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 19898 18975 gene locus_tag LOCUS_30570 19898 18975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 20395 19976 gene locus_tag LOCUS_30580 20395 19976 CDS product DUF6108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841026.1 protein_id gnl|my_center|LOCUS_30580 20895 20413 gene locus_tag LOCUS_30590 20895 20413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 21391 20888 gene locus_tag LOCUS_30600 21391 20888 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_30600 21516 24752 gene locus_tag LOCUS_30610 21516 24752 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_30610 26101 24902 gene locus_tag LOCUS_30620 26101 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 26621 26268 gene locus_tag LOCUS_30630 26621 26268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 26939 26622 gene locus_tag LOCUS_30640 26939 26622 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798232.1 protein_id gnl|my_center|LOCUS_30640 27388 27167 gene locus_tag LOCUS_30650 27388 27167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 28338 28156 gene locus_tag LOCUS_30660 28338 28156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 29318 28524 gene locus_tag LOCUS_30670 29318 28524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203400.1 protein_id gnl|my_center|LOCUS_30670 >Feature sequence38 2165 321 gene locus_tag LOCUS_30680 gene glmS 2165 321 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_30680 3581 2931 gene locus_tag LOCUS_30690 3581 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 5219 3768 gene locus_tag LOCUS_30700 5219 3768 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_30700 6062 5277 gene locus_tag LOCUS_30710 6062 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 7516 6059 gene locus_tag LOCUS_30720 7516 6059 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_30720 8024 8629 gene locus_tag LOCUS_30730 8024 8629 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_30730 8878 10110 gene locus_tag LOCUS_30740 gene hflX 8878 10110 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_30740 10094 11794 gene locus_tag LOCUS_30750 10094 11794 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796342.1 protein_id gnl|my_center|LOCUS_30750 12031 13818 gene locus_tag LOCUS_30760 gene rpsA 12031 13818 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_30760 13970 14302 gene locus_tag LOCUS_30770 13970 14302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 14343 15368 gene locus_tag LOCUS_30780 14343 15368 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_30780 15376 15912 gene locus_tag LOCUS_30790 15376 15912 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108149.1 protein_id gnl|my_center|LOCUS_30790 16227 18929 gene locus_tag LOCUS_30800 16227 18929 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_30800 19119 19415 gene locus_tag LOCUS_30810 19119 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 19412 19723 gene locus_tag LOCUS_30820 19412 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 19882 21423 gene locus_tag LOCUS_30830 gene rny 19882 21423 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_30830 21439 22704 gene locus_tag LOCUS_30840 21439 22704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 22831 23301 gene locus_tag LOCUS_30850 22831 23301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 23298 24479 gene locus_tag LOCUS_30860 23298 24479 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766347.1 protein_id gnl|my_center|LOCUS_30860 24598 26025 gene locus_tag LOCUS_30870 24598 26025 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_30870 27167 26175 gene locus_tag LOCUS_30880 gene tsf 27167 26175 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_30880 28011 27187 gene locus_tag LOCUS_30890 gene rpsB 28011 27187 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_30890 28559 28173 gene locus_tag LOCUS_30900 gene rpsI 28559 28173 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_30900 29048 28569 gene locus_tag LOCUS_30910 gene rplM 29048 28569 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence39 1089 187 gene locus_tag LOCUS_30920 1089 187 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_30920 1899 1141 gene locus_tag LOCUS_30930 1899 1141 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_30930 2512 2958 gene locus_tag LOCUS_30940 gene dut 2512 2958 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_30940 3036 4835 gene locus_tag LOCUS_30950 3036 4835 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_30950 4952 5683 gene locus_tag LOCUS_30960 4952 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 5727 7505 gene locus_tag LOCUS_30970 5727 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 8989 7538 gene locus_tag LOCUS_30980 8989 7538 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203395.1 protein_id gnl|my_center|LOCUS_30980 9077 10048 gene locus_tag LOCUS_30990 9077 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 11158 10025 gene locus_tag LOCUS_31000 11158 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 12740 11178 gene locus_tag LOCUS_31010 12740 11178 CDS product GldM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203062.1 protein_id gnl|my_center|LOCUS_31010 13739 12756 gene locus_tag LOCUS_31020 13739 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 15147 13744 gene locus_tag LOCUS_31030 gene gldK 15147 13744 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_31030 16235 15231 gene locus_tag LOCUS_31040 16235 15231 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_31040 16915 16232 gene locus_tag LOCUS_31050 16915 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 17106 18428 gene locus_tag LOCUS_31060 17106 18428 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_31060 18513 19760 gene locus_tag LOCUS_31070 18513 19760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 19841 20617 gene locus_tag LOCUS_31080 19841 20617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 21367 20756 gene locus_tag LOCUS_31090 21367 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 22373 21369 gene locus_tag LOCUS_31100 22373 21369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 24209 23148 gene locus_tag LOCUS_31110 24209 23148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence40 972 391 gene locus_tag LOCUS_31120 gene rfbC 972 391 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_31120 1886 981 gene locus_tag LOCUS_31130 gene rfbA 1886 981 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_31130 3035 1959 gene locus_tag LOCUS_31140 3035 1959 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905197.1 protein_id gnl|my_center|LOCUS_31140 3906 3244 gene locus_tag LOCUS_31150 3906 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 5231 3903 gene locus_tag LOCUS_31160 5231 3903 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105320.1 protein_id gnl|my_center|LOCUS_31160 6453 5350 gene locus_tag LOCUS_31170 6453 5350 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_31170 7541 6450 gene locus_tag LOCUS_31180 7541 6450 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107235.1 protein_id gnl|my_center|LOCUS_31180 8728 7538 gene locus_tag LOCUS_31190 8728 7538 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766018.1 protein_id gnl|my_center|LOCUS_31190 9923 8697 gene locus_tag LOCUS_31200 9923 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 10886 9948 gene locus_tag LOCUS_31210 10886 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 12313 11348 gene locus_tag LOCUS_31220 12313 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 13616 12855 gene locus_tag LOCUS_31230 13616 12855 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 protein_id gnl|my_center|LOCUS_31230 14671 13613 gene locus_tag LOCUS_31240 14671 13613 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042001299.1 protein_id gnl|my_center|LOCUS_31240 14898 14671 gene locus_tag LOCUS_31250 14898 14671 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775528.1 protein_id gnl|my_center|LOCUS_31250 15535 14900 gene locus_tag LOCUS_31260 gene vioB 15535 14900 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_31260 16644 15532 gene locus_tag LOCUS_31270 16644 15532 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762980.1 protein_id gnl|my_center|LOCUS_31270 18090 16657 gene locus_tag LOCUS_31280 18090 16657 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_31280 19923 18370 gene locus_tag LOCUS_31290 19923 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence41 154 2643 gene locus_tag LOCUS_31300 gene pheT 154 2643 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_31300 2711 3427 gene locus_tag LOCUS_31310 2711 3427 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_31310 3727 4029 gene locus_tag LOCUS_31320 3727 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 4026 5075 gene locus_tag LOCUS_31330 4026 5075 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_31330 5474 6688 gene locus_tag LOCUS_31340 5474 6688 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_31340 7914 7012 gene locus_tag LOCUS_31350 7914 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 11595 8215 gene locus_tag LOCUS_31360 11595 8215 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203260.1 protein_id gnl|my_center|LOCUS_31360 12269 13702 gene locus_tag LOCUS_31370 12269 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 13745 14377 gene locus_tag LOCUS_31380 13745 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 14466 15593 gene locus_tag LOCUS_31390 14466 15593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 15695 16576 gene locus_tag LOCUS_31400 15695 16576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence42 690 370 gene locus_tag LOCUS_31410 690 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 1717 941 gene locus_tag LOCUS_31420 1717 941 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 protein_id gnl|my_center|LOCUS_31420 3011 1749 gene locus_tag LOCUS_31430 3011 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 3813 3004 gene locus_tag LOCUS_31440 3813 3004 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963421.1 protein_id gnl|my_center|LOCUS_31440 4931 3849 gene locus_tag LOCUS_31450 4931 3849 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690973.1 protein_id gnl|my_center|LOCUS_31450 6198 5026 gene locus_tag LOCUS_31460 6198 5026 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476086.1 protein_id gnl|my_center|LOCUS_31460 7399 6230 gene locus_tag LOCUS_31470 7399 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 8573 7464 gene locus_tag LOCUS_31480 8573 7464 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476092.1 protein_id gnl|my_center|LOCUS_31480 9220 8570 gene locus_tag LOCUS_31490 9220 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 10083 9238 gene locus_tag LOCUS_31500 10083 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 11497 10142 gene locus_tag LOCUS_31510 11497 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 12978 11521 gene locus_tag LOCUS_31520 12978 11521 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722014.1 protein_id gnl|my_center|LOCUS_31520 13686 12994 gene locus_tag LOCUS_31530 13686 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 14072 13695 gene locus_tag LOCUS_31540 14072 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 15545 14496 gene locus_tag LOCUS_31550 15545 14496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 >Feature sequence43 532 2169 gene locus_tag LOCUS_31560 532 2169 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068837.1 protein_id gnl|my_center|LOCUS_31560 2411 2590 gene locus_tag LOCUS_31570 2411 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 3015 2779 gene locus_tag LOCUS_31580 3015 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3388 3008 gene locus_tag LOCUS_31590 3388 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3518 3375 gene locus_tag LOCUS_31600 3518 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 4024 4884 gene locus_tag LOCUS_31610 4024 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31610 4844 5491 gene locus_tag LOCUS_31620 4844 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 6040 6564 gene locus_tag LOCUS_31630 6040 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 7564 6650 gene locus_tag LOCUS_31640 7564 6650 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_31640 7848 10304 gene locus_tag LOCUS_31650 7848 10304 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108297.1 protein_id gnl|my_center|LOCUS_31650 10356 10721 gene locus_tag LOCUS_31660 10356 10721 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784476.1 protein_id gnl|my_center|LOCUS_31660 11312 12352 gene locus_tag LOCUS_31670 11312 12352 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_31670 12462 13679 gene locus_tag LOCUS_31680 12462 13679 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039969.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence44 278 778 gene locus_tag LOCUS_31690 278 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 1087 1716 gene locus_tag LOCUS_31700 1087 1716 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767460.1 protein_id gnl|my_center|LOCUS_31700 1813 2766 gene locus_tag LOCUS_31710 1813 2766 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202513.1 protein_id gnl|my_center|LOCUS_31710 2904 3656 gene locus_tag LOCUS_31720 gene dapB 2904 3656 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_31720 3722 5191 gene locus_tag LOCUS_31730 3722 5191 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_31730 5185 5754 gene locus_tag LOCUS_31740 5185 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 5839 6495 gene locus_tag LOCUS_31750 5839 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 8309 6627 gene locus_tag LOCUS_31760 8309 6627 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791939.1 protein_id gnl|my_center|LOCUS_31760 8612 8685 gene locus_tag LOCUS_t00480 8612 8685 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence45 488 414 gene locus_tag LOCUS_t00490 488 414 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2248 770 gene locus_tag LOCUS_31770 2248 770 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_31770 3098 2289 gene locus_tag LOCUS_31780 3098 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 4180 3200 gene locus_tag LOCUS_31790 gene dusB 4180 3200 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_31790 5434 4211 gene locus_tag LOCUS_31800 5434 4211 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_31800 5540 7144 gene locus_tag LOCUS_31810 5540 7144 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767001.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence46 159 1103 gene locus_tag LOCUS_31820 159 1103 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_31820 1183 1956 gene locus_tag LOCUS_31830 1183 1956 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_31830 2922 2059 gene locus_tag LOCUS_31840 2922 2059 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769011.1 protein_id gnl|my_center|LOCUS_31840