>Feature sequence01 329 478 gene locus_tag LOCUS_00010 329 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 989 1111 gene locus_tag LOCUS_00020 989 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1274 1525 gene locus_tag LOCUS_00030 1274 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2687 2926 gene locus_tag LOCUS_00040 2687 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3413 4606 gene locus_tag LOCUS_00050 3413 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4961 5140 gene locus_tag LOCUS_00060 4961 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5608 7293 gene locus_tag LOCUS_00070 5608 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00070 7300 7614 gene locus_tag LOCUS_00080 7300 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00080 7903 8181 gene locus_tag LOCUS_00090 7903 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00090 8227 8799 gene locus_tag LOCUS_00100 8227 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00100 8947 9135 gene locus_tag LOCUS_00110 8947 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00110 9208 9336 gene locus_tag LOCUS_00120 9208 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9733 9915 gene locus_tag LOCUS_00130 9733 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10094 9918 gene locus_tag LOCUS_00140 10094 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10511 10185 gene locus_tag LOCUS_00150 10511 10185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00150 10727 10545 gene locus_tag LOCUS_00160 10727 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 10997 10812 gene locus_tag LOCUS_00170 10997 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 11115 10990 gene locus_tag LOCUS_00180 11115 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 11628 11185 gene locus_tag LOCUS_00190 11628 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00190 12165 11926 gene locus_tag LOCUS_00200 12165 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00200 12239 12664 gene locus_tag LOCUS_00210 12239 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00210 12845 13084 gene locus_tag LOCUS_00220 12845 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00220 13198 13425 gene locus_tag LOCUS_00230 13198 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 13504 13737 gene locus_tag LOCUS_00240 13504 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00240 14401 14766 gene locus_tag LOCUS_00250 14401 14766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 15070 15384 gene locus_tag LOCUS_00260 15070 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 15421 15582 gene locus_tag LOCUS_00270 15421 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 16394 16143 gene locus_tag LOCUS_00280 16394 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 16458 17153 gene locus_tag LOCUS_00290 16458 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 17247 17885 gene locus_tag LOCUS_00300 17247 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 17951 18289 gene locus_tag LOCUS_00310 17951 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 18320 18460 gene locus_tag LOCUS_00320 18320 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 18505 19014 gene locus_tag LOCUS_00330 18505 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 19654 19475 gene locus_tag LOCUS_00340 19654 19475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 20134 19901 gene locus_tag LOCUS_00350 20134 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 20699 20124 gene locus_tag LOCUS_00360 gene yqeK 20699 20124 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263508.1 protein_id gnl|my_center|LOCUS_00360 21197 20859 gene locus_tag LOCUS_00370 21197 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00370 21577 21404 gene locus_tag LOCUS_00380 21577 21404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 21516 21761 gene locus_tag LOCUS_00390 21516 21761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00390 21955 21746 gene locus_tag LOCUS_00400 21955 21746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 21870 22115 gene locus_tag LOCUS_00410 21870 22115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00410 22489 22797 gene locus_tag LOCUS_00420 22489 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 22769 22915 gene locus_tag LOCUS_00430 22769 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00430 22922 23065 gene locus_tag LOCUS_00440 22922 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00440 23159 23944 gene locus_tag LOCUS_00450 23159 23944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00450 24835 23945 gene locus_tag LOCUS_00460 24835 23945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 25078 24866 gene locus_tag LOCUS_00470 25078 24866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 25856 25137 gene locus_tag LOCUS_00480 gene trxB 25856 25137 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182961.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00480 26060 25899 gene locus_tag LOCUS_00490 26060 25899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00490 26712 26074 gene locus_tag LOCUS_00500 26712 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00500 27579 26785 gene locus_tag LOCUS_00510 27579 26785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00510 28674 27850 gene locus_tag LOCUS_00520 28674 27850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00520 29205 28930 gene locus_tag LOCUS_00530 29205 28930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00530 29742 29227 gene locus_tag LOCUS_00540 29742 29227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00540 31364 30552 gene locus_tag LOCUS_00550 31364 30552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00550 33182 31497 gene locus_tag LOCUS_00560 33182 31497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00560 33491 33333 gene locus_tag LOCUS_00570 33491 33333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00570 33869 33744 gene locus_tag LOCUS_00580 33869 33744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 34119 34193 gene locus_tag LOCUS_t00010 34119 34193 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 34197 34272 gene locus_tag LOCUS_t00020 34197 34272 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 34279 34354 gene locus_tag LOCUS_t00030 34279 34354 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34356 34431 gene locus_tag LOCUS_t00040 34356 34431 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 34434 34509 gene locus_tag LOCUS_t00050 34434 34509 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 34581 34664 gene locus_tag LOCUS_t00060 34581 34664 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35232 34969 gene locus_tag LOCUS_00590 35232 34969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 36411 36064 gene locus_tag LOCUS_00600 36411 36064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 37020 36478 gene locus_tag LOCUS_00610 37020 36478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 38238 37471 gene locus_tag LOCUS_00620 38238 37471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00620 39069 38644 gene locus_tag LOCUS_00630 39069 38644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00630 39294 39112 gene locus_tag LOCUS_00640 39294 39112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00640 39348 39554 gene locus_tag LOCUS_00650 39348 39554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 39535 40389 gene locus_tag LOCUS_00660 39535 40389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00660 40600 41118 gene locus_tag LOCUS_00670 40600 41118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00670 42232 41537 gene locus_tag LOCUS_00680 42232 41537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00680 42529 42254 gene locus_tag LOCUS_00690 42529 42254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00690 43384 43175 gene locus_tag LOCUS_00700 43384 43175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 43594 43415 gene locus_tag LOCUS_00710 43594 43415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 43963 43775 gene locus_tag LOCUS_00720 43963 43775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 44407 44018 gene locus_tag LOCUS_00730 44407 44018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 45436 45212 gene locus_tag LOCUS_00740 45436 45212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 46317 46144 gene locus_tag LOCUS_00750 46317 46144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 46481 46903 gene locus_tag LOCUS_00760 46481 46903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 47583 47864 gene locus_tag LOCUS_00770 47583 47864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 48667 48855 gene locus_tag LOCUS_00780 48667 48855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 50132 50392 gene locus_tag LOCUS_00790 50132 50392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 50624 51229 gene locus_tag LOCUS_00800 50624 51229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 52082 51786 gene locus_tag LOCUS_00810 52082 51786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 52526 52101 gene locus_tag LOCUS_00820 52526 52101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00820 52806 53075 gene locus_tag LOCUS_00830 52806 53075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 53239 53054 gene locus_tag LOCUS_00840 53239 53054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 53986 53297 gene locus_tag LOCUS_00850 53986 53297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 54436 55704 gene locus_tag LOCUS_00860 54436 55704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00860 57099 56389 gene locus_tag LOCUS_00870 57099 56389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00870 57477 57190 gene locus_tag LOCUS_00880 57477 57190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00880 57908 57597 gene locus_tag LOCUS_00890 57908 57597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 58747 58238 gene locus_tag LOCUS_00900 58747 58238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00900 59069 58752 gene locus_tag LOCUS_00910 59069 58752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00910 59249 59100 gene locus_tag LOCUS_00920 59249 59100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00920 59525 59319 gene locus_tag LOCUS_00930 59525 59319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 59826 59638 gene locus_tag LOCUS_00940 59826 59638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 60879 60013 gene locus_tag LOCUS_00950 60879 60013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00950 61008 61784 gene locus_tag LOCUS_00960 61008 61784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 63231 61786 gene locus_tag LOCUS_00970 gene mgtE 63231 61786 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898141.1 protein_id gnl|my_center|LOCUS_00970 63712 63260 gene locus_tag LOCUS_00980 63712 63260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 64866 63919 gene locus_tag LOCUS_00990 64866 63919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 65256 65017 gene locus_tag LOCUS_01000 65256 65017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 65472 65397 gene locus_tag LOCUS_t00070 65472 65397 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66606 65491 gene locus_tag LOCUS_01010 66606 65491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 67179 66682 gene locus_tag LOCUS_01020 67179 66682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 67405 67169 gene locus_tag LOCUS_01030 67405 67169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 68289 67513 gene locus_tag LOCUS_01040 68289 67513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 69048 68692 gene locus_tag LOCUS_01050 69048 68692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 69138 69278 gene locus_tag LOCUS_01060 69138 69278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 69291 69464 gene locus_tag LOCUS_01070 69291 69464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 69513 69728 gene locus_tag LOCUS_01080 69513 69728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 69809 69734 gene locus_tag LOCUS_t00080 69809 69734 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 70035 69838 gene locus_tag LOCUS_01090 70035 69838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 70662 70327 gene locus_tag LOCUS_01100 70662 70327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 71664 70696 gene locus_tag LOCUS_01110 71664 70696 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724031.1 protein_id gnl|my_center|LOCUS_01110 71968 71726 gene locus_tag LOCUS_01120 71968 71726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 72208 72077 gene locus_tag LOCUS_01130 72208 72077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01130 72799 72236 gene locus_tag LOCUS_01140 72799 72236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01140 73153 72815 gene locus_tag LOCUS_01150 73153 72815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01150 73833 74351 gene locus_tag LOCUS_01160 73833 74351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 74440 74736 gene locus_tag LOCUS_01170 74440 74736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01170 74740 74964 gene locus_tag LOCUS_01180 74740 74964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01180 74954 75682 gene locus_tag LOCUS_01190 74954 75682 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_01190 75702 76286 gene locus_tag LOCUS_01200 75702 76286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 76301 76870 gene locus_tag LOCUS_01210 76301 76870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01210 77126 77542 gene locus_tag LOCUS_01220 77126 77542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 77553 77840 gene locus_tag LOCUS_01230 77553 77840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 78128 78424 gene locus_tag LOCUS_01240 78128 78424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 79010 78702 gene locus_tag LOCUS_01250 79010 78702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 79079 79363 gene locus_tag LOCUS_01260 79079 79363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 79575 79276 gene locus_tag LOCUS_01270 79575 79276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01270 80127 79582 gene locus_tag LOCUS_01280 80127 79582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01280 80772 80620 gene locus_tag LOCUS_01290 gene rpmG 80772 80620 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_01290 81099 80854 gene locus_tag LOCUS_01300 81099 80854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 81528 81220 gene locus_tag LOCUS_01310 81528 81220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 81777 81559 gene locus_tag LOCUS_01320 81777 81559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01320 82016 81816 gene locus_tag LOCUS_01330 82016 81816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 82958 82140 gene locus_tag LOCUS_01340 82958 82140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 83833 83675 gene locus_tag LOCUS_01350 83833 83675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 84469 83981 gene locus_tag LOCUS_01360 84469 83981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 84954 84466 gene locus_tag LOCUS_01370 84954 84466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 86577 85111 gene locus_tag LOCUS_01380 86577 85111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 86782 86603 gene locus_tag LOCUS_01390 86782 86603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01390 87130 86912 gene locus_tag LOCUS_01400 87130 86912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01400 87559 87233 gene locus_tag LOCUS_01410 87559 87233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 87994 87788 gene locus_tag LOCUS_01420 87994 87788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 88273 88049 gene locus_tag LOCUS_01430 88273 88049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 88589 88251 gene locus_tag LOCUS_01440 88589 88251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 88748 88617 gene locus_tag LOCUS_01450 88748 88617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 89099 89365 gene locus_tag LOCUS_01460 gene rpsT 89099 89365 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_01460 89973 89743 gene locus_tag LOCUS_01470 89973 89743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 90630 90430 gene locus_tag LOCUS_01480 90630 90430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 91139 91708 gene locus_tag LOCUS_01490 91139 91708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01490 91760 91999 gene locus_tag LOCUS_01500 91760 91999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 92321 92764 gene locus_tag LOCUS_01510 92321 92764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01510 92973 92821 gene locus_tag LOCUS_01520 92973 92821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01520 94332 92983 gene locus_tag LOCUS_01530 94332 92983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01530 94605 94360 gene locus_tag LOCUS_01540 94605 94360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01540 94755 94636 gene locus_tag LOCUS_01550 94755 94636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01550 95277 94897 gene locus_tag LOCUS_01560 95277 94897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01560 95514 95293 gene locus_tag LOCUS_01570 95514 95293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01570 95724 95554 gene locus_tag LOCUS_01580 95724 95554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01580 95657 95854 gene locus_tag LOCUS_01590 95657 95854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 96252 95890 gene locus_tag LOCUS_01600 96252 95890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01600 97486 96290 gene locus_tag LOCUS_01610 gene tuf 97486 96290 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356194.1 protein_id gnl|my_center|LOCUS_01610 98011 97622 gene locus_tag LOCUS_01620 98011 97622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01620 98779 98027 gene locus_tag LOCUS_01630 98779 98027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01630 98986 98798 gene locus_tag LOCUS_01640 98986 98798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01640 99313 99471 gene locus_tag LOCUS_01650 99313 99471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 99940 100122 gene locus_tag LOCUS_01660 99940 100122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 100619 100798 gene locus_tag LOCUS_01670 100619 100798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 100844 101035 gene locus_tag LOCUS_01680 100844 101035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 101713 101417 gene locus_tag LOCUS_01690 101713 101417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 102453 101833 gene locus_tag LOCUS_01700 102453 101833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 102864 102730 gene locus_tag LOCUS_01710 102864 102730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 103137 103364 gene locus_tag LOCUS_01720 103137 103364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01720 103656 105485 gene locus_tag LOCUS_01730 103656 105485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01730 105581 106000 gene locus_tag LOCUS_01740 gene ruvX 105581 106000 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_01740 106027 106845 gene locus_tag LOCUS_01750 106027 106845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 106885 107160 gene locus_tag LOCUS_01760 106885 107160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 107194 107619 gene locus_tag LOCUS_01770 107194 107619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 107873 107631 gene locus_tag LOCUS_01780 107873 107631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 108524 108228 gene locus_tag LOCUS_01790 108524 108228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 108561 108875 gene locus_tag LOCUS_01800 108561 108875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01800 109514 109230 gene locus_tag LOCUS_01810 109514 109230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 109498 109701 gene locus_tag LOCUS_01820 109498 109701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 110087 109848 gene locus_tag LOCUS_01830 110087 109848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 110453 110211 gene locus_tag LOCUS_01840 110453 110211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 111122 110463 gene locus_tag LOCUS_01850 111122 110463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 112061 111417 gene locus_tag LOCUS_01860 112061 111417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 112170 112427 gene locus_tag LOCUS_01870 112170 112427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 112530 113000 gene locus_tag LOCUS_01880 112530 113000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 113007 113405 gene locus_tag LOCUS_01890 113007 113405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 113445 113612 gene locus_tag LOCUS_01900 113445 113612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 113634 113840 gene locus_tag LOCUS_01910 113634 113840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 115447 113828 gene locus_tag LOCUS_01920 115447 113828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01920 116671 115460 gene locus_tag LOCUS_01930 116671 115460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01930 116853 116674 gene locus_tag LOCUS_01940 116853 116674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 117204 117482 gene locus_tag LOCUS_01950 117204 117482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 117609 117824 gene locus_tag LOCUS_01960 117609 117824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 118098 118337 gene locus_tag LOCUS_01970 118098 118337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 118926 118651 gene locus_tag LOCUS_01980 118926 118651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 119349 118969 gene locus_tag LOCUS_01990 119349 118969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 119544 119383 gene locus_tag LOCUS_02000 119544 119383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 120696 119716 gene locus_tag LOCUS_02010 120696 119716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 120770 121003 gene locus_tag LOCUS_02020 120770 121003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 122043 121345 gene locus_tag LOCUS_02030 122043 121345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 122474 122088 gene locus_tag LOCUS_02040 122474 122088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 122883 122764 gene locus_tag LOCUS_02050 122883 122764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02050 123324 122938 gene locus_tag LOCUS_02060 123324 122938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02060 123546 123403 gene locus_tag LOCUS_02070 123546 123403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 123797 124063 gene locus_tag LOCUS_02080 123797 124063 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166936.1 protein_id gnl|my_center|LOCUS_02080 124212 125129 gene locus_tag LOCUS_02090 124212 125129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02090 125178 125702 gene locus_tag LOCUS_02100 125178 125702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02100 125709 125918 gene locus_tag LOCUS_02110 125709 125918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02110 126198 126001 gene locus_tag LOCUS_02120 126198 126001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02120 127104 126214 gene locus_tag LOCUS_02130 gene ychF 127104 126214 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524669.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02130 127142 127480 gene locus_tag LOCUS_02140 127142 127480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 127998 127450 gene locus_tag LOCUS_02150 127998 127450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 128048 128311 gene locus_tag LOCUS_02160 128048 128311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 128430 128248 gene locus_tag LOCUS_02170 128430 128248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 128594 128893 gene locus_tag LOCUS_02180 128594 128893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 129425 129303 gene locus_tag LOCUS_02190 129425 129303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 129740 129931 gene locus_tag LOCUS_02200 129740 129931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 130072 130215 gene locus_tag LOCUS_02210 130072 130215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 130324 130593 gene locus_tag LOCUS_02220 130324 130593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 130755 131165 gene locus_tag LOCUS_02230 130755 131165 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013447851.1 protein_id gnl|my_center|LOCUS_02230 131213 131491 gene locus_tag LOCUS_02240 131213 131491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 131915 132064 gene locus_tag LOCUS_02250 131915 132064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 132982 132662 gene locus_tag LOCUS_02260 132982 132662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 132981 133274 gene locus_tag LOCUS_02270 132981 133274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 133488 133769 gene locus_tag LOCUS_02280 133488 133769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02280 133785 134219 gene locus_tag LOCUS_02290 133785 134219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02290 134399 135226 gene locus_tag LOCUS_02300 gene truB 134399 135226 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583573.1 protein_id gnl|my_center|LOCUS_02300 135231 135371 gene locus_tag LOCUS_02310 135231 135371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 135912 136046 gene locus_tag LOCUS_02320 135912 136046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 136056 136628 gene locus_tag LOCUS_02330 136056 136628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 137935 137756 gene locus_tag LOCUS_02340 137935 137756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 138066 138287 gene locus_tag LOCUS_02350 138066 138287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 138351 138527 gene locus_tag LOCUS_02360 138351 138527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 140264 139653 gene locus_tag LOCUS_02370 140264 139653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02370 140480 140268 gene locus_tag LOCUS_02380 140480 140268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02380 141544 140612 gene locus_tag LOCUS_02390 gene tsaD 141544 140612 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166293.1 protein_id gnl|my_center|LOCUS_02390 142068 141547 gene locus_tag LOCUS_02400 142068 141547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 142318 142169 gene locus_tag LOCUS_02410 142318 142169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 142670 142494 gene locus_tag LOCUS_02420 142670 142494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 143653 143153 gene locus_tag LOCUS_02430 143653 143153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02430 144070 143924 gene locus_tag LOCUS_02440 144070 143924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02440 144556 144167 gene locus_tag LOCUS_02450 144556 144167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02450 144987 144832 gene locus_tag LOCUS_02460 144987 144832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 146105 144999 gene locus_tag LOCUS_02470 146105 144999 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166213.1 protein_id gnl|my_center|LOCUS_02470 146747 146355 gene locus_tag LOCUS_02480 146747 146355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02480 147482 146826 gene locus_tag LOCUS_02490 147482 146826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02490 148000 147656 gene locus_tag LOCUS_02500 148000 147656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 148317 148021 gene locus_tag LOCUS_02510 148317 148021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 148800 148543 gene locus_tag LOCUS_02520 148800 148543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 148834 149493 gene locus_tag LOCUS_02530 148834 149493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 149995 149831 gene locus_tag LOCUS_02540 149995 149831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 150401 150328 gene locus_tag LOCUS_t00090 150401 150328 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 150932 150429 gene locus_tag LOCUS_02550 150932 150429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 151388 151134 gene locus_tag LOCUS_02560 151388 151134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 151596 152384 gene locus_tag LOCUS_02570 gene whiA 151596 152384 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243775.1 protein_id gnl|my_center|LOCUS_02570 153584 154081 gene locus_tag LOCUS_02580 gene rpsD 153584 154081 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166475.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02580 154316 154459 gene locus_tag LOCUS_02590 154316 154459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02590 154489 154971 gene locus_tag LOCUS_02600 154489 154971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02600 155343 155618 gene locus_tag LOCUS_02610 155343 155618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 155808 156080 gene locus_tag LOCUS_02620 155808 156080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 156342 156512 gene locus_tag LOCUS_02630 156342 156512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 156564 156884 gene locus_tag LOCUS_02640 156564 156884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 156887 157486 gene locus_tag LOCUS_02650 156887 157486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02650 157490 157627 gene locus_tag LOCUS_02660 157490 157627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 157694 158044 gene locus_tag LOCUS_02670 157694 158044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02670 158168 158434 gene locus_tag LOCUS_02680 158168 158434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02680 158571 158960 gene locus_tag LOCUS_02690 158571 158960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02690 159222 159608 gene locus_tag LOCUS_02700 159222 159608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02700 159777 159983 gene locus_tag LOCUS_02710 159777 159983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 160124 160315 gene locus_tag LOCUS_02720 160124 160315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 160958 161107 gene locus_tag LOCUS_02730 160958 161107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 161208 161483 gene locus_tag LOCUS_02740 161208 161483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 162018 162167 gene locus_tag LOCUS_02750 162018 162167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 162231 162773 gene locus_tag LOCUS_02760 162231 162773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 162786 163298 gene locus_tag LOCUS_02770 162786 163298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02770 163545 164060 gene locus_tag LOCUS_02780 163545 164060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02780 164105 164803 gene locus_tag LOCUS_02790 gene deoD 164105 164803 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183561.1 protein_id gnl|my_center|LOCUS_02790 164820 165155 gene locus_tag LOCUS_02800 164820 165155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 165369 165908 gene locus_tag LOCUS_02810 165369 165908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 166414 166581 gene locus_tag LOCUS_02820 166414 166581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 166672 166824 gene locus_tag LOCUS_02830 166672 166824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 167356 167625 gene locus_tag LOCUS_02840 167356 167625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 167638 167880 gene locus_tag LOCUS_02850 167638 167880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 168367 168810 gene locus_tag LOCUS_02860 168367 168810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 169081 169338 gene locus_tag LOCUS_02870 169081 169338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 169504 170124 gene locus_tag LOCUS_02880 169504 170124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 170333 170208 gene locus_tag LOCUS_02890 170333 170208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 170591 170442 gene locus_tag LOCUS_02900 170591 170442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 170623 170907 gene locus_tag LOCUS_02910 170623 170907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 171046 171834 gene locus_tag LOCUS_02920 171046 171834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 172153 172587 gene locus_tag LOCUS_02930 172153 172587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 172961 173695 gene locus_tag LOCUS_02940 172961 173695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 173699 173911 gene locus_tag LOCUS_02950 173699 173911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 174317 174496 gene locus_tag LOCUS_02960 174317 174496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 175208 174642 gene locus_tag LOCUS_02970 gene rnc 175208 174642 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166663.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02970 175411 175208 gene locus_tag LOCUS_02980 175411 175208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02980 175458 175634 gene locus_tag LOCUS_02990 175458 175634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 176203 175739 gene locus_tag LOCUS_03000 176203 175739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03000 177507 176206 gene locus_tag LOCUS_03010 177507 176206 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289723.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03010 177846 177556 gene locus_tag LOCUS_03020 177846 177556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03020 178153 178034 gene locus_tag LOCUS_03030 178153 178034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 179679 178453 gene locus_tag LOCUS_03040 179679 178453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 180018 179737 gene locus_tag LOCUS_03050 180018 179737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 180377 180697 gene locus_tag LOCUS_03060 180377 180697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 180905 181261 gene locus_tag LOCUS_03070 180905 181261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 181265 181909 gene locus_tag LOCUS_03080 181265 181909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 181913 182230 gene locus_tag LOCUS_03090 181913 182230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03090 182402 183085 gene locus_tag LOCUS_03100 182402 183085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03100 183089 183334 gene locus_tag LOCUS_03110 183089 183334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 183449 183748 gene locus_tag LOCUS_03120 183449 183748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03120 183749 184531 gene locus_tag LOCUS_03130 183749 184531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03130 184743 184892 gene locus_tag LOCUS_03140 184743 184892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 185697 185392 gene locus_tag LOCUS_03150 185697 185392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 186225 185968 gene locus_tag LOCUS_03160 186225 185968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 186705 186310 gene locus_tag LOCUS_03170 186705 186310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 187140 186883 gene locus_tag LOCUS_03180 187140 186883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 187256 187393 gene locus_tag LOCUS_03190 187256 187393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03190 187394 188299 gene locus_tag LOCUS_03200 187394 188299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03200 188357 190189 gene locus_tag LOCUS_03210 188357 190189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03210 190306 190656 gene locus_tag LOCUS_03220 190306 190656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03220 190702 191871 gene locus_tag LOCUS_03230 190702 191871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03230 192628 192398 gene locus_tag LOCUS_03240 192628 192398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 192867 192995 gene locus_tag LOCUS_03250 192867 192995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 193467 193637 gene locus_tag LOCUS_03260 193467 193637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 193806 194513 gene locus_tag LOCUS_03270 193806 194513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 194919 195185 gene locus_tag LOCUS_03280 194919 195185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 195464 195640 gene locus_tag LOCUS_03290 195464 195640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 196067 196363 gene locus_tag LOCUS_03300 196067 196363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 196601 196810 gene locus_tag LOCUS_03310 196601 196810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 197438 197764 gene locus_tag LOCUS_03320 197438 197764 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183142.1 protein_id gnl|my_center|LOCUS_03320 197765 198142 gene locus_tag LOCUS_03330 197765 198142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 198149 198421 gene locus_tag LOCUS_03340 198149 198421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 198896 199159 gene locus_tag LOCUS_03350 198896 199159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03350 199310 199597 gene locus_tag LOCUS_03360 199310 199597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03360 199702 199893 gene locus_tag LOCUS_03370 gene rpmB 199702 199893 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183124.1 protein_id gnl|my_center|LOCUS_03370 200101 200256 gene locus_tag LOCUS_03380 200101 200256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 200299 201129 gene locus_tag LOCUS_03390 200299 201129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 201187 201381 gene locus_tag LOCUS_03400 201187 201381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 202015 202134 gene locus_tag LOCUS_03410 202015 202134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 202492 202313 gene locus_tag LOCUS_03420 202492 202313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 202786 202535 gene locus_tag LOCUS_03430 202786 202535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03430 203026 202850 gene locus_tag LOCUS_03440 203026 202850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03440 203968 203813 gene locus_tag LOCUS_03450 203968 203813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03450 204375 204698 gene locus_tag LOCUS_03460 204375 204698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 205068 205337 gene locus_tag LOCUS_03470 205068 205337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 205490 205645 gene locus_tag LOCUS_03480 205490 205645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 205965 205798 gene locus_tag LOCUS_03490 205965 205798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 205955 206197 gene locus_tag LOCUS_03500 205955 206197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 206543 206971 gene locus_tag LOCUS_03510 206543 206971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 207044 207238 gene locus_tag LOCUS_03520 207044 207238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 207611 207453 gene locus_tag LOCUS_03530 207611 207453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 208192 208365 gene locus_tag LOCUS_03540 208192 208365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 208631 208512 gene locus_tag LOCUS_03550 208631 208512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 208642 208944 gene locus_tag LOCUS_03560 208642 208944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 208947 209216 gene locus_tag LOCUS_03570 208947 209216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 209421 209732 gene locus_tag LOCUS_03580 209421 209732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 210438 210659 gene locus_tag LOCUS_03590 210438 210659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 211057 210911 gene locus_tag LOCUS_03600 211057 210911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 211038 211484 gene locus_tag LOCUS_03610 211038 211484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 211536 211946 gene locus_tag LOCUS_03620 211536 211946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 212969 213127 gene locus_tag LOCUS_03630 212969 213127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 213164 213319 gene locus_tag LOCUS_03640 213164 213319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 213467 213604 gene locus_tag LOCUS_03650 213467 213604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 213719 214162 gene locus_tag LOCUS_03660 213719 214162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 214205 214381 gene locus_tag LOCUS_03670 214205 214381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 214739 215095 gene locus_tag LOCUS_03680 214739 215095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 215960 216136 gene locus_tag LOCUS_03690 215960 216136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 216509 216994 gene locus_tag LOCUS_03700 216509 216994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 217445 217585 gene locus_tag LOCUS_03710 217445 217585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 217898 218149 gene locus_tag LOCUS_03720 217898 218149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence02 1653 1399 gene locus_tag LOCUS_03730 1653 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03730 1968 1813 gene locus_tag LOCUS_03740 1968 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2214 2035 gene locus_tag LOCUS_03750 2214 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 3249 2377 gene locus_tag LOCUS_03760 gene recA 3249 2377 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166605.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03760 4279 4091 gene locus_tag LOCUS_03770 gene rpmI 4279 4091 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830767.1 protein_id gnl|my_center|LOCUS_03770 4954 4292 gene locus_tag LOCUS_03780 gene infC 4954 4292 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183085.1 protein_id gnl|my_center|LOCUS_03780 5649 5017 gene locus_tag LOCUS_03790 gene tmk 5649 5017 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183572.1 protein_id gnl|my_center|LOCUS_03790 6242 5958 gene locus_tag LOCUS_03800 6242 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6529 6242 gene locus_tag LOCUS_03810 6529 6242 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262625.1 protein_id gnl|my_center|LOCUS_03810 6693 6541 gene locus_tag LOCUS_03820 6693 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 8790 6829 gene locus_tag LOCUS_03830 gene dnaX 8790 6829 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829412.1 protein_id gnl|my_center|LOCUS_03830 9217 9549 gene locus_tag LOCUS_03840 9217 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03840 9550 10065 gene locus_tag LOCUS_03850 9550 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03850 10308 10538 gene locus_tag LOCUS_03860 10308 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 11231 10776 gene locus_tag LOCUS_03870 11231 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03870 11960 11247 gene locus_tag LOCUS_03880 11960 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03880 12377 12036 gene locus_tag LOCUS_03890 12377 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03890 12992 12558 gene locus_tag LOCUS_03900 12992 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03900 13739 13062 gene locus_tag LOCUS_03910 13739 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03910 13859 14140 gene locus_tag LOCUS_03920 13859 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 14319 14041 gene locus_tag LOCUS_03930 14319 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 14718 14377 gene locus_tag LOCUS_03940 14718 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 15138 14815 gene locus_tag LOCUS_03950 15138 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 15495 15199 gene locus_tag LOCUS_03960 15495 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 15909 15574 gene locus_tag LOCUS_03970 15909 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 16355 16528 gene locus_tag LOCUS_03980 16355 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 16743 17468 gene locus_tag LOCUS_03990 16743 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 17484 17945 gene locus_tag LOCUS_04000 17484 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 18006 18365 gene locus_tag LOCUS_04010 18006 18365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 18434 18724 gene locus_tag LOCUS_04020 18434 18724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 18908 19135 gene locus_tag LOCUS_04030 18908 19135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 19688 19894 gene locus_tag LOCUS_04040 19688 19894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04040 20009 20644 gene locus_tag LOCUS_04050 20009 20644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 20650 20772 gene locus_tag LOCUS_04060 20650 20772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 20881 21108 gene locus_tag LOCUS_04070 20881 21108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 21199 21420 gene locus_tag LOCUS_04080 21199 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 21557 22228 gene locus_tag LOCUS_04090 21557 22228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166519.1 protein_id gnl|my_center|LOCUS_04090 22875 23426 gene locus_tag LOCUS_04100 22875 23426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 24246 24491 gene locus_tag LOCUS_04110 24246 24491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 24513 25244 gene locus_tag LOCUS_04120 24513 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 26226 26480 gene locus_tag LOCUS_04130 26226 26480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 26616 26864 gene locus_tag LOCUS_04140 26616 26864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 26931 27461 gene locus_tag LOCUS_04150 26931 27461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 27600 27875 gene locus_tag LOCUS_04160 27600 27875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 27880 28080 gene locus_tag LOCUS_04170 27880 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 28265 28272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28585 28815 gene locus_tag LOCUS_04180 28585 28815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 29647 30033 gene locus_tag LOCUS_04190 29647 30033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 30169 30666 gene locus_tag LOCUS_04200 30169 30666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 30913 31155 gene locus_tag LOCUS_04210 30913 31155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 31162 31653 gene locus_tag LOCUS_04220 31162 31653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 31663 31812 gene locus_tag LOCUS_04230 31663 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 31816 32040 gene locus_tag LOCUS_04240 31816 32040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 32329 32652 gene locus_tag LOCUS_04250 32329 32652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04250 32668 33219 gene locus_tag LOCUS_04260 32668 33219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04260 33265 33651 gene locus_tag LOCUS_04270 33265 33651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04270 33826 34152 gene locus_tag LOCUS_04280 33826 34152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 34423 34629 gene locus_tag LOCUS_04290 34423 34629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 34642 35649 gene locus_tag LOCUS_04300 34642 35649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04300 35722 36036 gene locus_tag LOCUS_04310 35722 36036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 36408 36731 gene locus_tag LOCUS_04320 36408 36731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 36891 37997 gene locus_tag LOCUS_04330 36891 37997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04330 38028 38435 gene locus_tag LOCUS_04340 38028 38435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04340 38416 38859 gene locus_tag LOCUS_04350 gene rplI 38416 38859 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724881.1 protein_id gnl|my_center|LOCUS_04350 38843 39733 gene locus_tag LOCUS_04360 38843 39733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04360 39764 40186 gene locus_tag LOCUS_04370 39764 40186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04370 40549 40190 gene locus_tag LOCUS_04380 40549 40190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 41041 40871 gene locus_tag LOCUS_04390 41041 40871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 41442 41747 gene locus_tag LOCUS_04400 41442 41747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 41951 42154 gene locus_tag LOCUS_04410 41951 42154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04410 42554 43042 gene locus_tag LOCUS_04420 42554 43042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04420 43208 43504 gene locus_tag LOCUS_04430 gene trxA 43208 43504 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932522.1 protein_id gnl|my_center|LOCUS_04430 43704 43901 gene locus_tag LOCUS_04440 43704 43901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 44061 44354 gene locus_tag LOCUS_04450 44061 44354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 44400 44473 gene locus_tag LOCUS_t00100 44400 44473 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 44477 44553 gene locus_tag LOCUS_t00110 44477 44553 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45772 45176 gene locus_tag LOCUS_04460 45772 45176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04460 46057 45869 gene locus_tag LOCUS_04470 46057 45869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 47358 46189 gene locus_tag LOCUS_04480 47358 46189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04480 48792 47545 gene locus_tag LOCUS_04490 48792 47545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04490 49019 49999 gene locus_tag LOCUS_04500 49019 49999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 50069 50383 gene locus_tag LOCUS_04510 50069 50383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 50753 51190 gene locus_tag LOCUS_04520 50753 51190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 51745 52821 gene locus_tag LOCUS_04530 51745 52821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 52821 53456 gene locus_tag LOCUS_04540 52821 53456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 53487 54980 gene locus_tag LOCUS_04550 gene atpA 53487 54980 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125754.1 protein_id gnl|my_center|LOCUS_04550 55084 56337 gene locus_tag LOCUS_04560 55084 56337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04560 56392 57183 gene locus_tag LOCUS_04570 56392 57183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04570 57263 57640 gene locus_tag LOCUS_04580 57263 57640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 57881 58447 gene locus_tag LOCUS_04590 57881 58447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 58487 58654 gene locus_tag LOCUS_04600 58487 58654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 58709 59020 gene locus_tag LOCUS_04610 58709 59020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 59408 59890 gene locus_tag LOCUS_04620 59408 59890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 60125 60805 gene locus_tag LOCUS_04630 60125 60805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 60881 63604 gene locus_tag LOCUS_04640 gene gyrA 60881 63604 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282851.1 protein_id gnl|my_center|LOCUS_04640 63613 64140 gene locus_tag LOCUS_04650 63613 64140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04650 64792 65139 gene locus_tag LOCUS_04660 64792 65139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 65491 65826 gene locus_tag LOCUS_04670 65491 65826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 65844 66134 gene locus_tag LOCUS_04680 65844 66134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 66141 66683 gene locus_tag LOCUS_04690 66141 66683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04690 66786 67037 gene locus_tag LOCUS_04700 66786 67037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 67287 67463 gene locus_tag LOCUS_04710 67287 67463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 67456 67875 gene locus_tag LOCUS_04720 67456 67875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04720 68011 68313 gene locus_tag LOCUS_04730 68011 68313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04730 68350 68709 gene locus_tag LOCUS_04740 68350 68709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 68722 68874 gene locus_tag LOCUS_04750 68722 68874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 70362 69967 gene locus_tag LOCUS_04760 70362 69967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 70645 70352 gene locus_tag LOCUS_04770 70645 70352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 71749 71558 gene locus_tag LOCUS_04780 71749 71558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04780 71883 72122 gene locus_tag LOCUS_04790 71883 72122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04790 72129 73550 gene locus_tag LOCUS_04800 72129 73550 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182989.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04800 73622 73780 gene locus_tag LOCUS_04810 73622 73780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 73935 73750 gene locus_tag LOCUS_04820 73935 73750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 74190 73981 gene locus_tag LOCUS_04830 74190 73981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04830 74961 74314 gene locus_tag LOCUS_04840 74961 74314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04840 75064 76020 gene locus_tag LOCUS_04850 gene holA 75064 76020 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_04850 76375 76575 gene locus_tag LOCUS_04860 76375 76575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 77539 76853 gene locus_tag LOCUS_04870 77539 76853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04870 77734 77543 gene locus_tag LOCUS_04880 77734 77543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04880 78170 78598 gene locus_tag LOCUS_04890 78170 78598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 79066 78599 gene locus_tag LOCUS_04900 79066 78599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04900 79279 79094 gene locus_tag LOCUS_04910 79279 79094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 79450 79295 gene locus_tag LOCUS_04920 79450 79295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04920 79539 79679 gene locus_tag LOCUS_04930 79539 79679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04930 79680 80024 gene locus_tag LOCUS_04940 79680 80024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04940 80106 80411 gene locus_tag LOCUS_04950 80106 80411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04950 80616 80846 gene locus_tag LOCUS_04960 80616 80846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04960 81188 81472 gene locus_tag LOCUS_04970 81188 81472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 81475 81657 gene locus_tag LOCUS_04980 81475 81657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 81688 81867 gene locus_tag LOCUS_04990 81688 81867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04990 81931 82007 gene locus_tag LOCUS_t00120 81931 82007 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 82243 82103 gene locus_tag LOCUS_05000 82243 82103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 82570 82262 gene locus_tag LOCUS_05010 82570 82262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 83665 82874 gene locus_tag LOCUS_05020 83665 82874 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 protein_id gnl|my_center|LOCUS_05020 84155 84418 gene locus_tag LOCUS_05030 84155 84418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05030 84512 85186 gene locus_tag LOCUS_05040 84512 85186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05040 85196 85357 gene locus_tag LOCUS_05050 85196 85357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05050 85664 85837 gene locus_tag LOCUS_05060 85664 85837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 85862 86239 gene locus_tag LOCUS_05070 85862 86239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05070 86341 87252 gene locus_tag LOCUS_05080 gene pfkB 86341 87252 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_05080 87357 87674 gene locus_tag LOCUS_05090 87357 87674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 88071 87766 gene locus_tag LOCUS_05100 88071 87766 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125552.1 protein_id gnl|my_center|LOCUS_05100 88253 88741 gene locus_tag LOCUS_05110 gene recU 88253 88741 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874885.1 protein_id gnl|my_center|LOCUS_05110 88783 89304 gene locus_tag LOCUS_05120 88783 89304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05120 89317 89676 gene locus_tag LOCUS_05130 89317 89676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05130 89752 90525 gene locus_tag LOCUS_05140 89752 90525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05140 90679 91422 gene locus_tag LOCUS_05150 90679 91422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05150 91660 91493 gene locus_tag LOCUS_05160 91660 91493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 92848 93123 gene locus_tag LOCUS_05170 92848 93123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 93179 93781 gene locus_tag LOCUS_05180 93179 93781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 93781 93990 gene locus_tag LOCUS_05190 93781 93990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 94015 94332 gene locus_tag LOCUS_05200 94015 94332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 94334 95083 gene locus_tag LOCUS_05210 94334 95083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05210 95084 95899 gene locus_tag LOCUS_05220 95084 95899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05220 95903 96091 gene locus_tag LOCUS_05230 95903 96091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 96158 96760 gene locus_tag LOCUS_05240 96158 96760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05240 96753 98153 gene locus_tag LOCUS_05250 gene atpD 96753 98153 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_05250 98153 98404 gene locus_tag LOCUS_05260 98153 98404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 98559 98750 gene locus_tag LOCUS_05270 98559 98750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 98781 98954 gene locus_tag LOCUS_05280 98781 98954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 99376 99600 gene locus_tag LOCUS_05290 99376 99600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 99640 99864 gene locus_tag LOCUS_05300 99640 99864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 100123 100665 gene locus_tag LOCUS_05310 100123 100665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 100862 101362 gene locus_tag LOCUS_05320 100862 101362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 101420 101584 gene locus_tag LOCUS_05330 101420 101584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 102017 102406 gene locus_tag LOCUS_05340 102017 102406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 102422 102847 gene locus_tag LOCUS_05350 102422 102847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 103170 103012 gene locus_tag LOCUS_05360 103170 103012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 103836 103600 gene locus_tag LOCUS_05370 103836 103600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 104066 104206 gene locus_tag LOCUS_05380 104066 104206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 104378 104293 gene locus_tag LOCUS_t00130 104378 104293 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 104802 105167 gene locus_tag LOCUS_05390 104802 105167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05390 105456 105665 gene locus_tag LOCUS_05400 105456 105665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05400 106380 107057 gene locus_tag LOCUS_05410 106380 107057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05410 107694 107509 gene locus_tag LOCUS_05420 107694 107509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 108514 108424 gene locus_tag LOCUS_t00140 108514 108424 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 108724 108548 gene locus_tag LOCUS_05430 108724 108548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 109098 109316 gene locus_tag LOCUS_05440 109098 109316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 109873 109526 gene locus_tag LOCUS_05450 109873 109526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 109924 110304 gene locus_tag LOCUS_tm00010 109924 110304 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 110680 110342 gene locus_tag LOCUS_05460 110680 110342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05460 111157 110864 gene locus_tag LOCUS_05470 111157 110864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05470 111403 111158 gene locus_tag LOCUS_05480 111403 111158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05480 111721 111467 gene locus_tag LOCUS_05490 111721 111467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05490 112009 111755 gene locus_tag LOCUS_05500 112009 111755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05500 112485 112174 gene locus_tag LOCUS_05510 112485 112174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 112692 112564 gene locus_tag LOCUS_05520 112692 112564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 113370 112834 gene locus_tag LOCUS_05530 gene rsmD 113370 112834 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948373.1 protein_id gnl|my_center|LOCUS_05530 113426 114055 gene locus_tag LOCUS_05540 gene upp 113426 114055 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699935.1 protein_id gnl|my_center|LOCUS_05540 114063 114368 gene locus_tag LOCUS_05550 114063 114368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05550 114417 114626 gene locus_tag LOCUS_05560 114417 114626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05560 115291 114947 gene locus_tag LOCUS_05570 115291 114947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 115900 115616 gene locus_tag LOCUS_05580 115900 115616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 116125 115910 gene locus_tag LOCUS_05590 116125 115910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 116913 116599 gene locus_tag LOCUS_05600 116913 116599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 117684 116956 gene locus_tag LOCUS_05610 117684 116956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 118344 117877 gene locus_tag LOCUS_05620 118344 117877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 118864 118646 gene locus_tag LOCUS_05630 118864 118646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 119188 118919 gene locus_tag LOCUS_05640 119188 118919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 119950 119603 gene locus_tag LOCUS_05650 119950 119603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 120394 120245 gene locus_tag LOCUS_05660 120394 120245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 120877 120996 gene locus_tag LOCUS_05670 120877 120996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 121558 122169 gene locus_tag LOCUS_05680 121558 122169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05680 122170 122319 gene locus_tag LOCUS_05690 122170 122319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 122309 123040 gene locus_tag LOCUS_05700 122309 123040 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788527.1 protein_id gnl|my_center|LOCUS_05700 123466 123801 gene locus_tag LOCUS_05710 123466 123801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05710 123834 124130 gene locus_tag LOCUS_05720 123834 124130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05720 125301 124930 gene locus_tag LOCUS_05730 125301 124930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 125610 125371 gene locus_tag LOCUS_05740 125610 125371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 125953 126657 gene locus_tag LOCUS_05750 125953 126657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05750 126667 127140 gene locus_tag LOCUS_05760 126667 127140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05760 127130 127357 gene locus_tag LOCUS_05770 127130 127357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 127448 127861 gene locus_tag LOCUS_05780 gene rpsL 127448 127861 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183521.1 protein_id gnl|my_center|LOCUS_05780 127927 128235 gene locus_tag LOCUS_05790 127927 128235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 128272 128394 gene locus_tag LOCUS_05800 128272 128394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05800 128414 128629 gene locus_tag LOCUS_05810 128414 128629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05810 129053 129940 gene locus_tag LOCUS_05820 129053 129940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05820 130052 130495 gene locus_tag LOCUS_05830 130052 130495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05830 131011 130589 gene locus_tag LOCUS_05840 131011 130589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05840 131253 131474 gene locus_tag LOCUS_05850 131253 131474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 131505 131580 gene locus_tag LOCUS_t00150 131505 131580 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 131652 131807 gene locus_tag LOCUS_05860 131652 131807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 131908 133596 gene locus_tag LOCUS_05870 131908 133596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05870 133720 134010 gene locus_tag LOCUS_05880 133720 134010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05880 134583 134014 gene locus_tag LOCUS_05890 134583 134014 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_05890 134701 134838 gene locus_tag LOCUS_05900 134701 134838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 135055 135243 gene locus_tag LOCUS_05910 135055 135243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 135794 135537 gene locus_tag LOCUS_05920 135794 135537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 136415 136203 gene locus_tag LOCUS_05930 136415 136203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 136489 136674 gene locus_tag LOCUS_05940 136489 136674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 137306 136911 gene locus_tag LOCUS_05950 137306 136911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 137975 138730 gene locus_tag LOCUS_05960 137975 138730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05960 138854 139225 gene locus_tag LOCUS_05970 138854 139225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05970 139235 139807 gene locus_tag LOCUS_05980 139235 139807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05980 140674 141441 gene locus_tag LOCUS_05990 gene dprA 140674 141441 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015240.1 protein_id gnl|my_center|LOCUS_05990 142111 141449 gene locus_tag LOCUS_06000 142111 141449 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081500.1 protein_id gnl|my_center|LOCUS_06000 142361 142750 gene locus_tag LOCUS_06010 142361 142750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 142907 143056 gene locus_tag LOCUS_06020 142907 143056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 143394 143573 gene locus_tag LOCUS_06030 143394 143573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 143937 144122 gene locus_tag LOCUS_06040 143937 144122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 144127 144909 gene locus_tag LOCUS_06050 144127 144909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06050 144970 145137 gene locus_tag LOCUS_06060 144970 145137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06060 145267 145452 gene locus_tag LOCUS_06070 145267 145452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06070 145546 145701 gene locus_tag LOCUS_06080 145546 145701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 145801 146298 gene locus_tag LOCUS_06090 145801 146298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06090 146834 147358 gene locus_tag LOCUS_06100 146834 147358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 147446 147889 gene locus_tag LOCUS_06110 147446 147889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 148277 147939 gene locus_tag LOCUS_06120 148277 147939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06120 148886 148419 gene locus_tag LOCUS_06130 148886 148419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 149591 149220 gene locus_tag LOCUS_06140 149591 149220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 150224 149817 gene locus_tag LOCUS_06150 150224 149817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 150423 150304 gene locus_tag LOCUS_06160 150423 150304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06160 150915 150493 gene locus_tag LOCUS_06170 150915 150493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06170 151302 151000 gene locus_tag LOCUS_06180 151302 151000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06180 151661 151410 gene locus_tag LOCUS_06190 151661 151410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 152483 152193 gene locus_tag LOCUS_06200 152483 152193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 152761 152483 gene locus_tag LOCUS_06210 152761 152483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06210 153505 153371 gene locus_tag LOCUS_06220 153505 153371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 153660 153505 gene locus_tag LOCUS_06230 153660 153505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 154056 153856 gene locus_tag LOCUS_06240 154056 153856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 154494 154309 gene locus_tag LOCUS_06250 154494 154309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 155001 154852 gene locus_tag LOCUS_06260 155001 154852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 155718 155149 gene locus_tag LOCUS_06270 155718 155149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 156447 155767 gene locus_tag LOCUS_06280 156447 155767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 156888 156556 gene locus_tag LOCUS_06290 156888 156556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 157377 156952 gene locus_tag LOCUS_06300 157377 156952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 157259 157498 gene locus_tag LOCUS_06310 157259 157498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 157576 157806 gene locus_tag LOCUS_06320 157576 157806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 158104 158370 gene locus_tag LOCUS_06330 158104 158370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 158419 159162 gene locus_tag LOCUS_06340 158419 159162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 159662 159381 gene locus_tag LOCUS_06350 gene rpsO 159662 159381 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166540.1 protein_id gnl|my_center|LOCUS_06350 159909 159736 gene locus_tag LOCUS_06360 159909 159736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 160215 160060 gene locus_tag LOCUS_06370 160215 160060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 160916 160224 gene locus_tag LOCUS_06380 gene rplA 160916 160224 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183505.1 protein_id gnl|my_center|LOCUS_06380 161578 161096 gene locus_tag LOCUS_06390 gene rplK 161578 161096 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183506.1 protein_id gnl|my_center|LOCUS_06390 162140 161673 gene locus_tag LOCUS_06400 162140 161673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 164031 162763 gene locus_tag LOCUS_06410 164031 162763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 164693 165352 gene locus_tag LOCUS_06420 164693 165352 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616588.1 protein_id gnl|my_center|LOCUS_06420 165574 166329 gene locus_tag LOCUS_06430 165574 166329 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 protein_id gnl|my_center|LOCUS_06430 166333 166917 gene locus_tag LOCUS_06440 gene scpB 166333 166917 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_06440 166920 167435 gene locus_tag LOCUS_06450 166920 167435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06450 167487 167756 gene locus_tag LOCUS_06460 167487 167756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06460 167869 168099 gene locus_tag LOCUS_06470 167869 168099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 168350 168162 gene locus_tag LOCUS_06480 168350 168162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06480 169244 169062 gene locus_tag LOCUS_06490 169244 169062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 169401 170126 gene locus_tag LOCUS_06500 169401 170126 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355139.1 protein_id gnl|my_center|LOCUS_06500 170982 170179 gene locus_tag LOCUS_06510 gene era 170982 170179 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964607.1 protein_id gnl|my_center|LOCUS_06510 171438 171022 gene locus_tag LOCUS_06520 gene cdd 171438 171022 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121875.1 protein_id gnl|my_center|LOCUS_06520 172180 171491 gene locus_tag LOCUS_06530 172180 171491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06530 173647 172436 gene locus_tag LOCUS_06540 173647 172436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06540 173891 174391 gene locus_tag LOCUS_06550 gene rplJ 173891 174391 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_06550 174427 174795 gene locus_tag LOCUS_06560 gene rplL 174427 174795 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003033114.1 protein_id gnl|my_center|LOCUS_06560 175328 175468 gene locus_tag LOCUS_06570 175328 175468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 175676 175990 gene locus_tag LOCUS_06580 175676 175990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 176150 177418 gene locus_tag LOCUS_06590 176150 177418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 177449 178060 gene locus_tag LOCUS_06600 177449 178060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 178121 178282 gene locus_tag LOCUS_06610 178121 178282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06610 178337 178474 gene locus_tag LOCUS_06620 178337 178474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 178867 179151 gene locus_tag LOCUS_06630 178867 179151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 179425 179685 gene locus_tag LOCUS_06640 179425 179685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 179818 179985 gene locus_tag LOCUS_06650 179818 179985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 180052 180783 gene locus_tag LOCUS_06660 180052 180783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 180942 180868 gene locus_tag LOCUS_t00160 180942 180868 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 181029 180946 gene locus_tag LOCUS_t00170 181029 180946 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 181238 181414 gene locus_tag LOCUS_06670 181238 181414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 181416 182006 gene locus_tag LOCUS_06680 gene ruvA 181416 182006 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545070.1 protein_id gnl|my_center|LOCUS_06680 181969 182934 gene locus_tag LOCUS_06690 gene ruvB 181969 182934 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476176.1 protein_id gnl|my_center|LOCUS_06690 183421 183128 gene locus_tag LOCUS_06700 183421 183128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 184696 183473 gene locus_tag LOCUS_06710 184696 183473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06710 185432 185070 gene locus_tag LOCUS_06720 185432 185070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06720 185858 185550 gene locus_tag LOCUS_06730 185858 185550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06730 186377 185859 gene locus_tag LOCUS_06740 186377 185859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06740 186773 186495 gene locus_tag LOCUS_06750 186773 186495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06750 187561 186770 gene locus_tag LOCUS_06760 187561 186770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 187907 188116 gene locus_tag LOCUS_06770 187907 188116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06770 188168 188707 gene locus_tag LOCUS_06780 188168 188707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06780 188954 189583 gene locus_tag LOCUS_06790 188954 189583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06790 189590 190255 gene locus_tag LOCUS_06800 189590 190255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06800 190346 190591 gene locus_tag LOCUS_06810 190346 190591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06810 190604 190840 gene locus_tag LOCUS_06820 190604 190840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06820 190927 191400 gene locus_tag LOCUS_06830 gene greA 190927 191400 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262548.1 protein_id gnl|my_center|LOCUS_06830 191663 191791 gene locus_tag LOCUS_06840 191663 191791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 191861 192265 gene locus_tag LOCUS_06850 191861 192265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06850 192793 193008 gene locus_tag LOCUS_06860 192793 193008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06860 193588 193896 gene locus_tag LOCUS_06870 193588 193896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06870 193948 194184 gene locus_tag LOCUS_06880 193948 194184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 194200 194526 gene locus_tag LOCUS_06890 194200 194526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 194535 195428 gene locus_tag LOCUS_06900 194535 195428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 195732 196280 gene locus_tag LOCUS_06910 195732 196280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06910 196954 196406 gene locus_tag LOCUS_06920 196954 196406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 197560 196961 gene locus_tag LOCUS_06930 197560 196961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06930 198895 197759 gene locus_tag LOCUS_06940 198895 197759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 199344 198919 gene locus_tag LOCUS_06950 199344 198919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06950 199809 199411 gene locus_tag LOCUS_06960 199809 199411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06960 200252 199908 gene locus_tag LOCUS_06970 gene mraZ 200252 199908 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583616.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06970 200568 201827 gene locus_tag LOCUS_06980 gene gpmI 200568 201827 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874985.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06980 201936 202067 gene locus_tag LOCUS_06990 201936 202067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 202593 202769 gene locus_tag LOCUS_07000 202593 202769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 203070 203369 gene locus_tag LOCUS_07010 203070 203369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 203712 203879 gene locus_tag LOCUS_07020 203712 203879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07020 204105 204707 gene locus_tag LOCUS_07030 gene trmD 204105 204707 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016280.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07030 204772 205134 gene locus_tag LOCUS_07040 gene rplS 204772 205134 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_07040 205790 206521 gene locus_tag LOCUS_07050 205790 206521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07050 206908 206525 gene locus_tag LOCUS_07060 206908 206525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 207935 207024 gene locus_tag LOCUS_07070 207935 207024 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_07070 208095 207943 gene locus_tag LOCUS_07080 208095 207943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 208515 208219 gene locus_tag LOCUS_07090 208515 208219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 208752 208534 gene locus_tag LOCUS_07100 208752 208534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 209879 208779 gene locus_tag LOCUS_07110 209879 208779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07110 210752 210141 gene locus_tag LOCUS_07120 210752 210141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07120 210840 211115 gene locus_tag LOCUS_07130 210840 211115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07130 211269 211520 gene locus_tag LOCUS_07140 211269 211520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07140 211838 211656 gene locus_tag LOCUS_07150 211838 211656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 212162 211992 gene locus_tag LOCUS_07160 212162 211992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07160 212852 212310 gene locus_tag LOCUS_07170 212852 212310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07170 213119 212940 gene locus_tag LOCUS_07180 213119 212940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07180 213687 213250 gene locus_tag LOCUS_07190 gene rpiB 213687 213250 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015889.1 protein_id gnl|my_center|LOCUS_07190 214213 213746 gene locus_tag LOCUS_07200 214213 213746 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544944.1 protein_id gnl|my_center|LOCUS_07200 214431 214210 gene locus_tag LOCUS_07210 214431 214210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 214641 214513 gene locus_tag LOCUS_07220 214641 214513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 215649 214714 gene locus_tag LOCUS_07230 215649 214714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07230 >Feature sequence03 92 355 gene locus_tag LOCUS_07240 92 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 1078 659 gene locus_tag LOCUS_07250 1078 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07250 1657 1343 gene locus_tag LOCUS_07260 1657 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07260 2417 1761 gene locus_tag LOCUS_07270 2417 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2681 2487 gene locus_tag LOCUS_07280 2681 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3126 2719 gene locus_tag LOCUS_07290 3126 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4174 3110 gene locus_tag LOCUS_07300 4174 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07300 4915 4325 gene locus_tag LOCUS_07310 4915 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07310 6191 5301 gene locus_tag LOCUS_07320 6191 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07320 7112 6372 gene locus_tag LOCUS_07330 7112 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07330 7365 7093 gene locus_tag LOCUS_07340 gene rulR 7365 7093 CDS product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 protein_id gnl|my_center|LOCUS_07340 7652 7380 gene locus_tag LOCUS_07350 7652 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 8447 7788 gene locus_tag LOCUS_07360 8447 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07360 8879 8493 gene locus_tag LOCUS_07370 8879 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9318 9019 gene locus_tag LOCUS_07380 9318 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 9470 10129 gene locus_tag LOCUS_07390 9470 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07390 10130 10453 gene locus_tag LOCUS_07400 10130 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07400 10541 10765 gene locus_tag LOCUS_07410 10541 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 10920 11222 gene locus_tag LOCUS_07420 10920 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 11289 11501 gene locus_tag LOCUS_07430 11289 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 11583 11786 gene locus_tag LOCUS_07440 11583 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 11880 12686 gene locus_tag LOCUS_07450 11880 12686 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584029.1 protein_id gnl|my_center|LOCUS_07450 13622 13005 gene locus_tag LOCUS_07460 13622 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07460 14078 13761 gene locus_tag LOCUS_07470 14078 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 14316 14080 gene locus_tag LOCUS_07480 14316 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07480 14556 14386 gene locus_tag LOCUS_07490 14556 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07490 14943 14563 gene locus_tag LOCUS_07500 14943 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07500 15450 14965 gene locus_tag LOCUS_07510 15450 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 16181 15651 gene locus_tag LOCUS_07520 16181 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 16712 16566 gene locus_tag LOCUS_07530 16712 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 17531 16722 gene locus_tag LOCUS_07540 gene folD 17531 16722 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831669.1 protein_id gnl|my_center|LOCUS_07540 17948 17535 gene locus_tag LOCUS_07550 17948 17535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 18569 18405 gene locus_tag LOCUS_07560 18569 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07560 18589 18753 gene locus_tag LOCUS_07570 18589 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 19433 18948 gene locus_tag LOCUS_07580 19433 18948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07580 19799 19671 gene locus_tag LOCUS_07590 19799 19671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07590 20320 20099 gene locus_tag LOCUS_07600 20320 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 20594 20439 gene locus_tag LOCUS_07610 20594 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 21446 20898 gene locus_tag LOCUS_07620 21446 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 22823 21486 gene locus_tag LOCUS_07630 22823 21486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 23341 23048 gene locus_tag LOCUS_07640 23341 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 23659 23357 gene locus_tag LOCUS_07650 23659 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07650 24195 24422 gene locus_tag LOCUS_07660 24195 24422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 24991 24413 gene locus_tag LOCUS_07670 24991 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 25237 25049 gene locus_tag LOCUS_07680 25237 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 25567 25382 gene locus_tag LOCUS_07690 25567 25382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 26065 25682 gene locus_tag LOCUS_07700 26065 25682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 26597 26673 gene locus_tag LOCUS_t00180 26597 26673 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26682 26758 gene locus_tag LOCUS_t00190 26682 26758 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 26760 26836 gene locus_tag LOCUS_t00200 26760 26836 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26863 26939 gene locus_tag LOCUS_t00210 26863 26939 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26945 27037 gene locus_tag LOCUS_t00220 26945 27037 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27109 27184 gene locus_tag LOCUS_t00230 27109 27184 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27268 27344 gene locus_tag LOCUS_t00240 27268 27344 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 27348 27423 gene locus_tag LOCUS_t00250 27348 27423 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 28724 27549 gene locus_tag LOCUS_07710 gene obgE 28724 27549 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166623.1 protein_id gnl|my_center|LOCUS_07710 29740 28739 gene locus_tag LOCUS_07720 29740 28739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 30731 29910 gene locus_tag LOCUS_07730 30731 29910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 31052 30732 gene locus_tag LOCUS_07740 31052 30732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 31579 31082 gene locus_tag LOCUS_07750 31579 31082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 32999 32208 gene locus_tag LOCUS_07760 gene hrcA 32999 32208 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183316.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07760 34174 33062 gene locus_tag LOCUS_07770 34174 33062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07770 34654 34247 gene locus_tag LOCUS_07780 34654 34247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07780 34870 34739 gene locus_tag LOCUS_07790 34870 34739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07790 35067 35480 gene locus_tag LOCUS_07800 35067 35480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 35658 35834 gene locus_tag LOCUS_07810 35658 35834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 36325 35948 gene locus_tag LOCUS_07820 36325 35948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 37054 36512 gene locus_tag LOCUS_07830 37054 36512 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903490.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07830 37241 37675 gene locus_tag LOCUS_07840 37241 37675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07840 38303 38455 gene locus_tag LOCUS_07850 38303 38455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 38634 38398 gene locus_tag LOCUS_07860 38634 38398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 39083 39976 gene locus_tag LOCUS_07870 39083 39976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 40114 39932 gene locus_tag LOCUS_07880 40114 39932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 40717 40926 gene locus_tag LOCUS_07890 40717 40926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 40969 41403 gene locus_tag LOCUS_07900 40969 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 41307 41316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41515 41838 gene locus_tag LOCUS_07910 41515 41838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 42195 42386 gene locus_tag LOCUS_07920 42195 42386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 42630 42809 gene locus_tag LOCUS_07930 42630 42809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 43284 43445 gene locus_tag LOCUS_07940 43284 43445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 44271 44531 gene locus_tag LOCUS_07950 44271 44531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 45021 45803 gene locus_tag LOCUS_07960 45021 45803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 46174 45944 gene locus_tag LOCUS_07970 46174 45944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 46323 46982 gene locus_tag LOCUS_07980 46323 46982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 47398 47174 gene locus_tag LOCUS_07990 47398 47174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 47778 48251 gene locus_tag LOCUS_08000 47778 48251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 48723 49283 gene locus_tag LOCUS_08010 gene pth 48723 49283 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_08010 49285 49512 gene locus_tag LOCUS_08020 49285 49512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08020 49618 49935 gene locus_tag LOCUS_08030 49618 49935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 49999 50181 gene locus_tag LOCUS_08040 49999 50181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 50786 51925 gene locus_tag LOCUS_08050 50786 51925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08050 51929 52411 gene locus_tag LOCUS_08060 51929 52411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08060 52426 53016 gene locus_tag LOCUS_08070 52426 53016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08070 53358 53957 gene locus_tag LOCUS_08080 53358 53957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08080 54099 54626 gene locus_tag LOCUS_08090 54099 54626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08090 55033 55623 gene locus_tag LOCUS_08100 55033 55623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08100 55843 56907 gene locus_tag LOCUS_08110 55843 56907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08110 56933 57058 gene locus_tag LOCUS_08120 56933 57058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 57200 57331 gene locus_tag LOCUS_08130 57200 57331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 57646 58356 gene locus_tag LOCUS_08140 57646 58356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 58399 58554 gene locus_tag LOCUS_08150 58399 58554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 58564 59544 gene locus_tag LOCUS_08160 58564 59544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 59590 59781 gene locus_tag LOCUS_08170 59590 59781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 60002 60256 gene locus_tag LOCUS_08180 60002 60256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 60590 60958 gene locus_tag LOCUS_08190 60590 60958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08190 61094 61264 gene locus_tag LOCUS_08200 61094 61264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08200 61899 62033 gene locus_tag LOCUS_08210 61899 62033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 62154 62081 gene locus_tag LOCUS_t00260 62154 62081 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 62217 62699 gene locus_tag LOCUS_08220 62217 62699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08220 62724 63044 gene locus_tag LOCUS_08230 62724 63044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 63626 63051 gene locus_tag LOCUS_08240 63626 63051 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364542.1 protein_id gnl|my_center|LOCUS_08240 63674 64786 gene locus_tag LOCUS_08250 gene dnaJ 63674 64786 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043938.1 protein_id gnl|my_center|LOCUS_08250 64882 65247 gene locus_tag LOCUS_08260 64882 65247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 65249 65509 gene locus_tag LOCUS_08270 65249 65509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08270 65618 65911 gene locus_tag LOCUS_08280 65618 65911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08280 66269 66457 gene locus_tag LOCUS_08290 66269 66457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 66848 67243 gene locus_tag LOCUS_08300 66848 67243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08300 67849 67658 gene locus_tag LOCUS_08310 67849 67658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 68611 68781 gene locus_tag LOCUS_08320 68611 68781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08320 68857 69087 gene locus_tag LOCUS_08330 68857 69087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 69100 69252 gene locus_tag LOCUS_08340 69100 69252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08340 69899 69363 gene locus_tag LOCUS_08350 gene def 69899 69363 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565220.1 protein_id gnl|my_center|LOCUS_08350 70814 69909 gene locus_tag LOCUS_08360 70814 69909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 71305 70817 gene locus_tag LOCUS_08370 71305 70817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08370 71551 71339 gene locus_tag LOCUS_08380 71551 71339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08380 71837 71565 gene locus_tag LOCUS_08390 71837 71565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08390 72134 71901 gene locus_tag LOCUS_08400 72134 71901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08400 72370 72549 gene locus_tag LOCUS_08410 72370 72549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 72625 73002 gene locus_tag LOCUS_08420 72625 73002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 73033 73320 gene locus_tag LOCUS_08430 73033 73320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 73508 73864 gene locus_tag LOCUS_08440 73508 73864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 73869 74072 gene locus_tag LOCUS_08450 73869 74072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 75372 74029 gene locus_tag LOCUS_08460 gene ffh 75372 74029 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166607.1 protein_id gnl|my_center|LOCUS_08460 75590 75384 gene locus_tag LOCUS_08470 75590 75384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 75875 75699 gene locus_tag LOCUS_08480 75875 75699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 76071 75868 gene locus_tag LOCUS_08490 76071 75868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 76494 76090 gene locus_tag LOCUS_08500 76494 76090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 76460 76657 gene locus_tag LOCUS_08510 76460 76657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 77588 77403 gene locus_tag LOCUS_08520 77588 77403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08520 78316 77846 gene locus_tag LOCUS_08530 78316 77846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08530 78769 78317 gene locus_tag LOCUS_08540 78769 78317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08540 79034 78867 gene locus_tag LOCUS_08550 79034 78867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 79424 79170 gene locus_tag LOCUS_08560 79424 79170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 79755 79958 gene locus_tag LOCUS_08570 79755 79958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08570 80037 80600 gene locus_tag LOCUS_08580 80037 80600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08580 80745 81254 gene locus_tag LOCUS_08590 80745 81254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 81774 81514 gene locus_tag LOCUS_08600 81774 81514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 82248 82114 gene locus_tag LOCUS_08610 82248 82114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 82799 82542 gene locus_tag LOCUS_08620 82799 82542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 83621 83166 gene locus_tag LOCUS_08630 83621 83166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 84101 84337 gene locus_tag LOCUS_08640 84101 84337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 84724 84942 gene locus_tag LOCUS_08650 84724 84942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 85594 85755 gene locus_tag LOCUS_08660 85594 85755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 85780 86325 gene locus_tag LOCUS_08670 85780 86325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08670 86318 86695 gene locus_tag LOCUS_08680 86318 86695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08680 86744 87064 gene locus_tag LOCUS_08690 86744 87064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08690 87173 87490 gene locus_tag LOCUS_08700 87173 87490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08700 87477 87647 gene locus_tag LOCUS_08710 87477 87647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 87960 88265 gene locus_tag LOCUS_08720 87960 88265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 88302 88463 gene locus_tag LOCUS_08730 88302 88463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 88791 89801 gene locus_tag LOCUS_08740 88791 89801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 89913 90635 gene locus_tag LOCUS_08750 89913 90635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 91011 91217 gene locus_tag LOCUS_08760 91011 91217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 91705 92013 gene locus_tag LOCUS_08770 gene rpsJ 91705 92013 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918607.1 protein_id gnl|my_center|LOCUS_08770 92044 92412 gene locus_tag LOCUS_08780 92044 92412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08780 92518 92913 gene locus_tag LOCUS_08790 92518 92913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08790 92913 93179 gene locus_tag LOCUS_08800 92913 93179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08800 93234 93551 gene locus_tag LOCUS_08810 93234 93551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08810 93611 94099 gene locus_tag LOCUS_08820 93611 94099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 94161 94919 gene locus_tag LOCUS_08830 gene rplB 94161 94919 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829788.1 protein_id gnl|my_center|LOCUS_08830 95009 95287 gene locus_tag LOCUS_08840 gene rpsS 95009 95287 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027275662.1 protein_id gnl|my_center|LOCUS_08840 95291 95656 gene locus_tag LOCUS_08850 gene rplV 95291 95656 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166908.1 protein_id gnl|my_center|LOCUS_08850 95834 96286 gene locus_tag LOCUS_08860 95834 96286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08860 96625 96756 gene locus_tag LOCUS_08870 96625 96756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08870 97070 97345 gene locus_tag LOCUS_08880 gene rpsQ 97070 97345 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638069.1 protein_id gnl|my_center|LOCUS_08880 97345 97713 gene locus_tag LOCUS_08890 gene rplN 97345 97713 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723686.1 protein_id gnl|my_center|LOCUS_08890 97729 98046 gene locus_tag LOCUS_08900 gene rplX 97729 98046 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919138.1 protein_id gnl|my_center|LOCUS_08900 98050 98343 gene locus_tag LOCUS_08910 98050 98343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08910 98350 98604 gene locus_tag LOCUS_08920 98350 98604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08920 98621 98803 gene locus_tag LOCUS_08930 98621 98803 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183033.1 protein_id gnl|my_center|LOCUS_08930 98810 99208 gene locus_tag LOCUS_08940 gene rpsH 98810 99208 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583359.1 protein_id gnl|my_center|LOCUS_08940 99226 99765 gene locus_tag LOCUS_08950 gene rplF 99226 99765 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166898.1 protein_id gnl|my_center|LOCUS_08950 99776 100126 gene locus_tag LOCUS_08960 gene rplR 99776 100126 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166897.1 protein_id gnl|my_center|LOCUS_08960 100126 100830 gene locus_tag LOCUS_08970 gene rpsE 100126 100830 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166896.1 protein_id gnl|my_center|LOCUS_08970 100845 101009 gene locus_tag LOCUS_08980 100845 101009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08980 101019 101282 gene locus_tag LOCUS_08990 101019 101282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08990 101414 101815 gene locus_tag LOCUS_09000 101414 101815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09000 101996 102271 gene locus_tag LOCUS_09010 101996 102271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09010 102272 102724 gene locus_tag LOCUS_09020 102272 102724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09020 102750 103391 gene locus_tag LOCUS_09030 102750 103391 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 protein_id gnl|my_center|LOCUS_09030 103411 104064 gene locus_tag LOCUS_09040 gene map 103411 104064 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_09040 104172 104387 gene locus_tag LOCUS_09050 gene infA 104172 104387 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_09050 104524 104889 gene locus_tag LOCUS_09060 gene rpsM 104524 104889 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288713.1 protein_id gnl|my_center|LOCUS_09060 105132 105293 gene locus_tag LOCUS_09070 105132 105293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09070 105300 106307 gene locus_tag LOCUS_09080 105300 106307 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166890.1 protein_id gnl|my_center|LOCUS_09080 106358 106669 gene locus_tag LOCUS_09090 gene rplQ 106358 106669 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701337.1 protein_id gnl|my_center|LOCUS_09090 106868 107206 gene locus_tag LOCUS_09100 106868 107206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 107526 107846 gene locus_tag LOCUS_09110 107526 107846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09110 107954 108124 gene locus_tag LOCUS_09120 107954 108124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09120 108440 108622 gene locus_tag LOCUS_09130 108440 108622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 108647 108886 gene locus_tag LOCUS_09140 108647 108886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 109352 108888 gene locus_tag LOCUS_09150 109352 108888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 110355 109369 gene locus_tag LOCUS_09160 110355 109369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 110620 111090 gene locus_tag LOCUS_09170 110620 111090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09170 111136 111309 gene locus_tag LOCUS_09180 111136 111309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09180 111390 111566 gene locus_tag LOCUS_09190 111390 111566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 111585 112451 gene locus_tag LOCUS_09200 gene pfkA 111585 112451 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013447579.1 protein_id gnl|my_center|LOCUS_09200 112555 112836 gene locus_tag LOCUS_09210 112555 112836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 113166 113375 gene locus_tag LOCUS_09220 113166 113375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 113397 113687 gene locus_tag LOCUS_09230 113397 113687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 113691 114008 gene locus_tag LOCUS_09240 113691 114008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 114114 114317 gene locus_tag LOCUS_09250 114114 114317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 114511 114299 gene locus_tag LOCUS_09260 114511 114299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 114426 114665 gene locus_tag LOCUS_09270 114426 114665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 114775 114626 gene locus_tag LOCUS_09280 114775 114626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 116569 115751 gene locus_tag LOCUS_09290 116569 115751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 117145 117002 gene locus_tag LOCUS_09300 117145 117002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 117685 117299 gene locus_tag LOCUS_09310 117685 117299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 117922 117686 gene locus_tag LOCUS_09320 117922 117686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 118199 117912 gene locus_tag LOCUS_09330 118199 117912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 118403 118206 gene locus_tag LOCUS_09340 118403 118206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 119544 119960 gene locus_tag LOCUS_09350 119544 119960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 120027 120791 gene locus_tag LOCUS_09360 120027 120791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 121071 121442 gene locus_tag LOCUS_09370 121071 121442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 121617 121907 gene locus_tag LOCUS_09380 121617 121907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 122205 122336 gene locus_tag LOCUS_09390 122205 122336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 122829 123488 gene locus_tag LOCUS_09400 122829 123488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09400 123835 124047 gene locus_tag LOCUS_09410 gene rpmE 123835 124047 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095846.1 protein_id gnl|my_center|LOCUS_09410 124555 124349 gene locus_tag LOCUS_09420 124555 124349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 125215 124706 gene locus_tag LOCUS_09430 125215 124706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 125394 125912 gene locus_tag LOCUS_09440 125394 125912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 126153 126527 gene locus_tag LOCUS_09450 126153 126527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 127423 127088 gene locus_tag LOCUS_09460 127423 127088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09460 127960 127562 gene locus_tag LOCUS_09470 127960 127562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09470 128242 128120 gene locus_tag LOCUS_09480 128242 128120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09480 128698 128312 gene locus_tag LOCUS_09490 128698 128312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09490 129678 129427 gene locus_tag LOCUS_09500 129678 129427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 130628 129678 gene locus_tag LOCUS_09510 130628 129678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 130937 131722 gene locus_tag LOCUS_09520 130937 131722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09520 131744 132046 gene locus_tag LOCUS_09530 131744 132046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09530 132098 133111 gene locus_tag LOCUS_09540 132098 133111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09540 133244 133549 gene locus_tag LOCUS_09550 133244 133549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 133930 134961 gene locus_tag LOCUS_09560 133930 134961 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658369.1 protein_id gnl|my_center|LOCUS_09560 135155 135325 gene locus_tag LOCUS_09570 135155 135325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 135800 136033 gene locus_tag LOCUS_09580 135800 136033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 136588 136725 gene locus_tag LOCUS_09590 136588 136725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 136897 137280 gene locus_tag LOCUS_09600 136897 137280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 137555 137388 gene locus_tag LOCUS_09610 137555 137388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 138035 137874 gene locus_tag LOCUS_09620 138035 137874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 138090 138773 gene locus_tag LOCUS_09630 138090 138773 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928025.1 protein_id gnl|my_center|LOCUS_09630 138941 139180 gene locus_tag LOCUS_09640 138941 139180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 139187 139387 gene locus_tag LOCUS_09650 139187 139387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 139387 139851 gene locus_tag LOCUS_09660 139387 139851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 139889 140152 gene locus_tag LOCUS_09670 gene rpsR 139889 140152 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583715.1 protein_id gnl|my_center|LOCUS_09670 140511 140810 gene locus_tag LOCUS_09680 140511 140810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09680 141066 141386 gene locus_tag LOCUS_09690 141066 141386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09690 141501 141962 gene locus_tag LOCUS_09700 141501 141962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09700 142277 142576 gene locus_tag LOCUS_09710 142277 142576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09710 142580 142903 gene locus_tag LOCUS_09720 142580 142903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09720 142913 143809 gene locus_tag LOCUS_09730 142913 143809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09730 143834 144010 gene locus_tag LOCUS_09740 143834 144010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 144188 144370 gene locus_tag LOCUS_09750 144188 144370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 144590 144865 gene locus_tag LOCUS_09760 144590 144865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 145104 145307 gene locus_tag LOCUS_09770 145104 145307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 145586 146059 gene locus_tag LOCUS_09780 145586 146059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 146485 146105 gene locus_tag LOCUS_09790 146485 146105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 147065 146931 gene locus_tag LOCUS_09800 147065 146931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 147499 147876 gene locus_tag LOCUS_09810 147499 147876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09810 148185 148379 gene locus_tag LOCUS_09820 148185 148379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 148410 148577 gene locus_tag LOCUS_09830 148410 148577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 148644 149027 gene locus_tag LOCUS_09840 148644 149027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 149369 149578 gene locus_tag LOCUS_09850 149369 149578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 150082 150324 gene locus_tag LOCUS_09860 150082 150324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 150707 150408 gene locus_tag LOCUS_09870 150707 150408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 150939 150757 gene locus_tag LOCUS_09880 150939 150757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 151978 152469 gene locus_tag LOCUS_09890 151978 152469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 152485 153111 gene locus_tag LOCUS_09900 152485 153111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 153205 153597 gene locus_tag LOCUS_09910 153205 153597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 153948 154877 gene locus_tag LOCUS_09920 153948 154877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 154902 155201 gene locus_tag LOCUS_09930 154902 155201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 155627 155929 gene locus_tag LOCUS_09940 155627 155929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09940 156279 156145 gene locus_tag LOCUS_09950 156279 156145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 156767 156895 gene locus_tag LOCUS_09960 156767 156895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 157470 158180 gene locus_tag LOCUS_09970 157470 158180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 158181 158354 gene locus_tag LOCUS_09980 158181 158354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 159600 159683 gene locus_tag LOCUS_t00270 159600 159683 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 159987 160196 gene locus_tag LOCUS_09990 159987 160196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 161023 160838 gene locus_tag LOCUS_10000 161023 160838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 161648 161481 gene locus_tag LOCUS_10010 161648 161481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 162584 162381 gene locus_tag LOCUS_10020 162584 162381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 163133 162744 gene locus_tag LOCUS_10030 163133 162744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 163428 163847 gene locus_tag LOCUS_10040 163428 163847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 163950 164099 gene locus_tag LOCUS_10050 163950 164099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 164241 164459 gene locus_tag LOCUS_10060 164241 164459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 164748 165104 gene locus_tag LOCUS_10070 164748 165104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 165384 165536 gene locus_tag LOCUS_10080 165384 165536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 165720 166337 gene locus_tag LOCUS_10090 165720 166337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 166563 166739 gene locus_tag LOCUS_10100 166563 166739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 167857 168183 gene locus_tag LOCUS_10110 167857 168183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 168464 168943 gene locus_tag LOCUS_10120 168464 168943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 168973 169801 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attttggtgtgataatgtatattagtagactttaac 170279 170058 gene locus_tag LOCUS_10130 170279 170058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 170956 171096 gene locus_tag LOCUS_10140 170956 171096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence04 150 941 gene locus_tag LOCUS_10150 150 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1070 1486 gene locus_tag LOCUS_10160 1070 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1479 2729 gene locus_tag LOCUS_10170 1479 2729 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_10170 2760 4190 gene locus_tag LOCUS_10180 2760 4190 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989955.1 protein_id gnl|my_center|LOCUS_10180 4309 5373 gene locus_tag LOCUS_10190 4309 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5477 6094 gene locus_tag LOCUS_10200 5477 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 6254 7135 gene locus_tag LOCUS_10210 6254 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 7138 7494 gene locus_tag LOCUS_10220 7138 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 7482 7871 gene locus_tag LOCUS_10230 7482 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7877 8218 gene locus_tag LOCUS_10240 7877 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 8208 8636 gene locus_tag LOCUS_10250 8208 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 8672 9262 gene locus_tag LOCUS_10260 8672 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 9297 9902 gene locus_tag LOCUS_10270 9297 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9975 13304 gene locus_tag LOCUS_10280 9975 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 13318 14184 gene locus_tag LOCUS_10290 13318 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 14187 15290 gene locus_tag LOCUS_10300 14187 15290 CDS product siphovirus ReqiPepy6 Gp37-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714199.1 protein_id gnl|my_center|LOCUS_10300 15290 17629 gene locus_tag LOCUS_10310 15290 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 17645 20026 gene locus_tag LOCUS_10320 17645 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 20052 20453 gene locus_tag LOCUS_10330 20052 20453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 20542 21009 gene locus_tag LOCUS_10340 20542 21009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 20975 21679 gene locus_tag LOCUS_10350 20975 21679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 21693 21959 gene locus_tag LOCUS_10360 21693 21959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 22857 22231 gene locus_tag LOCUS_10370 22857 22231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 23017 23463 gene locus_tag LOCUS_10380 23017 23463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 23396 23755 gene locus_tag LOCUS_10390 23396 23755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 23771 24355 gene locus_tag LOCUS_10400 23771 24355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 24348 24746 gene locus_tag LOCUS_10410 24348 24746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 24763 24993 gene locus_tag LOCUS_10420 24763 24993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 24974 25234 gene locus_tag LOCUS_10430 24974 25234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 25586 25341 gene locus_tag LOCUS_10440 25586 25341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 25770 26492 gene locus_tag LOCUS_10450 25770 26492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 26650 27372 gene locus_tag LOCUS_10460 26650 27372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 27530 27766 gene locus_tag LOCUS_10470 27530 27766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 27869 28210 gene locus_tag LOCUS_10480 27869 28210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 28225 28887 gene locus_tag LOCUS_10490 28225 28887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 28983 29357 gene locus_tag LOCUS_10500 28983 29357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 29362 29727 gene locus_tag LOCUS_10510 29362 29727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 29753 29911 gene locus_tag LOCUS_10520 29753 29911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 29932 30153 gene locus_tag LOCUS_10530 29932 30153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 30173 30391 gene locus_tag LOCUS_10540 30173 30391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 30376 30837 gene locus_tag LOCUS_10550 30376 30837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 30824 31075 gene locus_tag LOCUS_10560 30824 31075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 31080 31325 gene locus_tag LOCUS_10570 31080 31325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 31345 31752 gene locus_tag LOCUS_10580 31345 31752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 31800 31994 gene locus_tag LOCUS_10590 31800 31994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 32136 32318 gene locus_tag LOCUS_10600 32136 32318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 32456 32851 gene locus_tag LOCUS_10610 32456 32851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 32854 33240 gene locus_tag LOCUS_10620 32854 33240 CDS product endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101765.1 protein_id gnl|my_center|LOCUS_10620 34555 33497 gene locus_tag LOCUS_10630 34555 33497 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016886.1 protein_id gnl|my_center|LOCUS_10630 34628 35464 gene locus_tag LOCUS_10640 34628 35464 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263020.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence05 <1 792 gene locus_tag LOCUS_10650 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011182898.1:chromosomal replication initiator protein DnaA note possible pseudo, internal stop codon 931 1080 gene locus_tag LOCUS_10660 931 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1081 1251 gene locus_tag LOCUS_10670 1081 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1345 1779 gene locus_tag LOCUS_10680 1345 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2116 2328 gene locus_tag LOCUS_10690 2116 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2440 3846 gene locus_tag LOCUS_10700 2440 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10700 4005 4271 gene locus_tag LOCUS_10710 4005 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10710 4564 4749 gene locus_tag LOCUS_10720 4564 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 4816 4983 gene locus_tag LOCUS_10730 4816 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 5467 5309 gene locus_tag LOCUS_10740 5467 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 6193 6387 gene locus_tag LOCUS_10750 gene rpmF 6193 6387 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008362864.1 protein_id gnl|my_center|LOCUS_10750 6534 6388 gene locus_tag LOCUS_10760 6534 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 7107 6550 gene locus_tag LOCUS_10770 7107 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7043 7267 gene locus_tag LOCUS_10780 7043 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 7776 8075 gene locus_tag LOCUS_10790 7776 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8298 9656 gene locus_tag LOCUS_10800 8298 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 9721 10023 gene locus_tag LOCUS_10810 9721 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 10024 10485 gene locus_tag LOCUS_10820 gene ybeY 10024 10485 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_10820 11402 10482 gene locus_tag LOCUS_10830 11402 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10830 12278 11511 gene locus_tag LOCUS_10840 12278 11511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10840 12441 12614 gene locus_tag LOCUS_10850 12441 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10850 12672 12833 gene locus_tag LOCUS_10860 12672 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10860 12999 13412 gene locus_tag LOCUS_10870 12999 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10870 13768 13917 gene locus_tag LOCUS_10880 13768 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 13969 14592 gene locus_tag LOCUS_10890 13969 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10890 14934 14740 gene locus_tag LOCUS_10900 14934 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 14912 15106 gene locus_tag LOCUS_10910 14912 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 15158 15385 gene locus_tag LOCUS_10920 15158 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 15382 15711 gene locus_tag LOCUS_10930 15382 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 15745 16005 gene locus_tag LOCUS_10940 15745 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 16096 16743 gene locus_tag LOCUS_10950 16096 16743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 16869 17261 gene locus_tag LOCUS_10960 16869 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 17481 17669 gene locus_tag LOCUS_10970 17481 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 17760 18266 gene locus_tag LOCUS_10980 17760 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 18435 18599 gene locus_tag LOCUS_10990 18435 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 19307 19026 gene locus_tag LOCUS_11000 gene rpmA 19307 19026 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008362816.1 protein_id gnl|my_center|LOCUS_11000 19624 19325 gene locus_tag LOCUS_11010 gene rplU 19624 19325 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166743.1 protein_id gnl|my_center|LOCUS_11010 19880 20980 gene locus_tag LOCUS_11020 19880 20980 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166639.1 protein_id gnl|my_center|LOCUS_11020 21390 21647 gene locus_tag LOCUS_11030 21390 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11030 21678 21869 gene locus_tag LOCUS_11040 21678 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 22189 22341 gene locus_tag LOCUS_11050 22189 22341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11050 22543 22848 gene locus_tag LOCUS_11060 22543 22848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11060 22906 23286 gene locus_tag LOCUS_11070 22906 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11070 23296 23793 gene locus_tag LOCUS_11080 23296 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11080 24230 24505 gene locus_tag LOCUS_11090 24230 24505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 24551 25042 gene locus_tag LOCUS_11100 24551 25042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11100 25139 25450 gene locus_tag LOCUS_11110 25139 25450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11110 25467 25853 gene locus_tag LOCUS_11120 25467 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11120 25860 26177 gene locus_tag LOCUS_11130 25860 26177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11130 26202 26495 gene locus_tag LOCUS_11140 26202 26495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11140 26499 27428 gene locus_tag LOCUS_11150 26499 27428 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874663.1 protein_id gnl|my_center|LOCUS_11150 27470 27646 gene locus_tag LOCUS_11160 27470 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11160 27786 27613 gene locus_tag LOCUS_11170 27786 27613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 28175 28474 gene locus_tag LOCUS_11180 28175 28474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11180 28574 28714 gene locus_tag LOCUS_11190 28574 28714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 28820 29068 gene locus_tag LOCUS_11200 28820 29068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 29548 29300 gene locus_tag LOCUS_11210 29548 29300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 29617 29691 gene locus_tag LOCUS_t00280 29617 29691 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 30188 29973 gene locus_tag LOCUS_11220 30188 29973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 31197 30646 gene locus_tag LOCUS_11230 gene frr 31197 30646 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_11230 31696 31202 gene locus_tag LOCUS_11240 31696 31202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11240 32565 32443 gene locus_tag LOCUS_11250 32565 32443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 32916 32746 gene locus_tag LOCUS_11260 32916 32746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 33598 32873 gene locus_tag LOCUS_11270 33598 32873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 33937 34209 gene locus_tag LOCUS_11280 33937 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 34315 34551 gene locus_tag LOCUS_11290 34315 34551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence06 615 776 gene locus_tag LOCUS_11300 615 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 903 1205 gene locus_tag LOCUS_11310 903 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11310 1425 1820 gene locus_tag LOCUS_11320 1425 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11320 2201 2016 gene locus_tag LOCUS_11330 2201 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2558 2319 gene locus_tag LOCUS_11340 2558 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3986 2694 gene locus_tag LOCUS_11350 3986 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4193 4017 gene locus_tag LOCUS_11360 4193 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4542 4354 gene locus_tag LOCUS_11370 4542 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 4854 5222 gene locus_tag LOCUS_11380 4854 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11380 5538 5329 gene locus_tag LOCUS_11390 5538 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 5754 5632 gene locus_tag LOCUS_11400 5754 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence07 591 815 gene locus_tag LOCUS_11410 591 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 909 1376 gene locus_tag LOCUS_11420 909 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1485 1640 gene locus_tag LOCUS_11430 1485 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1668 1883 gene locus_tag LOCUS_11440 1668 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1935 2507 gene locus_tag LOCUS_11450 1935 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2820 3122 gene locus_tag LOCUS_11460 2820 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3235 3065 gene locus_tag LOCUS_11470 3235 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3216 3410 gene locus_tag LOCUS_11480 3216 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 3488 3790 gene locus_tag LOCUS_11490 3488 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3824 4210 gene locus_tag LOCUS_11500 3824 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4310 4900 gene locus_tag LOCUS_11510 4310 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 5036 5317 gene locus_tag LOCUS_11520 5036 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence08 1007 1162 gene locus_tag LOCUS_11530 1007 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1540 1268 gene locus_tag LOCUS_11540 1540 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2005 2169 gene locus_tag LOCUS_11550 2005 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3359 2331 gene locus_tag LOCUS_11560 3359 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence09 416 189 gene locus_tag LOCUS_11570 416 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 892 1035 gene locus_tag LOCUS_11580 892 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1364 1233 gene locus_tag LOCUS_11590 1364 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2075 1857 gene locus_tag LOCUS_11600 2075 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2315 2133 gene locus_tag LOCUS_11610 2315 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2618 2379 gene locus_tag LOCUS_11620 2618 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence10 803 1015 gene locus_tag LOCUS_11630 803 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence11 286 137 gene locus_tag LOCUS_11640 286 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 767 288 gene locus_tag LOCUS_11650 767 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1085 807 gene locus_tag LOCUS_11660 1085 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence12 463 588 gene locus_tag LOCUS_11670 463 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence13 >Feature sequence14 691 796 gene locus_tag LOCUS_r00010 691 796 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence15 142 20 gene locus_tag LOCUS_11680 142 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 646 158 gene locus_tag LOCUS_11690 646 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence16 >Feature sequence17 683 492 gene locus_tag LOCUS_11700 683 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence18 >Feature sequence19 >Feature sequence20 >Feature sequence21 >Feature sequence22 >Feature sequence23 >Feature sequence24 >Feature sequence25