>Feature sequence01 1751 1329 gene locus_tag LOCUS_00010 1751 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3258 1939 gene locus_tag LOCUS_00020 gene dacF 3258 1939 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_00020 3644 3414 gene locus_tag LOCUS_00030 3644 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4024 3674 gene locus_tag LOCUS_00040 4024 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5550 4216 gene locus_tag LOCUS_00050 gene sufB 5550 4216 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074405.1 protein_id gnl|my_center|LOCUS_00050 5992 5573 gene locus_tag LOCUS_00060 gene sufU 5992 5573 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_00060 7198 6002 gene locus_tag LOCUS_00070 7198 6002 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_00070 7901 7203 gene locus_tag LOCUS_00080 7901 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8664 7894 gene locus_tag LOCUS_00090 gene sufC 8664 7894 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356763.1 protein_id gnl|my_center|LOCUS_00090 9932 8796 gene locus_tag LOCUS_00100 9932 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10828 10004 gene locus_tag LOCUS_00110 10828 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10929 11327 gene locus_tag LOCUS_00120 10929 11327 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_00120 12716 11337 gene locus_tag LOCUS_00130 12716 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16562 12798 gene locus_tag LOCUS_00140 16562 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17093 18406 gene locus_tag LOCUS_00150 17093 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19042 18428 gene locus_tag LOCUS_00160 19042 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19805 19029 gene locus_tag LOCUS_00170 gene recX 19805 19029 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263683.1 protein_id gnl|my_center|LOCUS_00170 20032 19838 gene locus_tag LOCUS_00180 20032 19838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20653 20096 gene locus_tag LOCUS_00190 20653 20096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21005 20721 gene locus_tag LOCUS_00200 21005 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22056 21055 gene locus_tag LOCUS_00210 22056 21055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23495 22188 gene locus_tag LOCUS_00220 gene ffh 23495 22188 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_00220 23749 23555 gene locus_tag LOCUS_00230 23749 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24089 23793 gene locus_tag LOCUS_00240 24089 23793 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_00240 25062 24091 gene locus_tag LOCUS_00250 gene ftsY 25062 24091 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_00250 25279 26958 gene locus_tag LOCUS_00260 25279 26958 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811375.1 protein_id gnl|my_center|LOCUS_00260 28427 26967 gene locus_tag LOCUS_00270 28427 26967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29013 28369 gene locus_tag LOCUS_00280 29013 28369 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_00280 29640 29155 gene locus_tag LOCUS_00290 29640 29155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31819 29648 gene locus_tag LOCUS_00300 gene pnp 31819 29648 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297086.1 protein_id gnl|my_center|LOCUS_00300 32153 31887 gene locus_tag LOCUS_00310 gene rpsO 32153 31887 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 protein_id gnl|my_center|LOCUS_00310 32496 32257 gene locus_tag LOCUS_00320 32496 32257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33621 32518 gene locus_tag LOCUS_00330 33621 32518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34486 33635 gene locus_tag LOCUS_00340 gene truB 34486 33635 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 protein_id gnl|my_center|LOCUS_00340 37281 34561 gene locus_tag LOCUS_00350 37281 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38732 37365 gene locus_tag LOCUS_00360 38732 37365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39160 38822 gene locus_tag LOCUS_00370 gene rbfA 39160 38822 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097322.1 protein_id gnl|my_center|LOCUS_00370 41305 39164 gene locus_tag LOCUS_00380 gene infB 41305 39164 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036341.1 protein_id gnl|my_center|LOCUS_00380 41587 41321 gene locus_tag LOCUS_00390 41587 41321 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965106.1 protein_id gnl|my_center|LOCUS_00390 42697 41603 gene locus_tag LOCUS_00400 gene nusA 42697 41603 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965105.1 protein_id gnl|my_center|LOCUS_00400 42951 42700 gene locus_tag LOCUS_00410 42951 42700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 44153 43140 gene locus_tag LOCUS_00420 44153 43140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 44289 45002 gene locus_tag LOCUS_00430 44289 45002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 45004 45828 gene locus_tag LOCUS_00440 45004 45828 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095324.1 protein_id gnl|my_center|LOCUS_00440 47017 45821 gene locus_tag LOCUS_00450 47017 45821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 47421 47107 gene locus_tag LOCUS_00460 47421 47107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47564 47971 gene locus_tag LOCUS_00470 47564 47971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 48337 47996 gene locus_tag LOCUS_00480 48337 47996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 48401 49504 gene locus_tag LOCUS_00490 gene rodA 48401 49504 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723329.1 protein_id gnl|my_center|LOCUS_00490 50446 49658 gene locus_tag LOCUS_00500 50446 49658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50712 50636 gene locus_tag LOCUS_t00010 50712 50636 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 50806 50730 gene locus_tag LOCUS_t00020 50806 50730 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 51098 51022 gene locus_tag LOCUS_t00030 51098 51022 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 51552 51241 gene locus_tag LOCUS_00510 51552 51241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51879 52988 gene locus_tag LOCUS_00520 gene metK 51879 52988 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_00520 53668 53027 gene locus_tag LOCUS_00530 53668 53027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 53843 53767 gene locus_tag LOCUS_t00040 53843 53767 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 53926 53850 gene locus_tag LOCUS_t00050 53926 53850 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54693 53935 gene locus_tag LOCUS_00540 54693 53935 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_00540 54825 55601 gene locus_tag LOCUS_00550 54825 55601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 55986 55840 gene locus_tag LOCUS_00560 55986 55840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 57137 56190 gene locus_tag LOCUS_00570 57137 56190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 57395 57141 gene locus_tag LOCUS_00580 57395 57141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57663 57397 gene locus_tag LOCUS_00590 57663 57397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 57797 57660 gene locus_tag LOCUS_00600 57797 57660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 59449 57785 gene locus_tag LOCUS_00610 59449 57785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 60169 59453 gene locus_tag LOCUS_00620 60169 59453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 60506 60171 gene locus_tag LOCUS_00630 60506 60171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 60725 60513 gene locus_tag LOCUS_00640 60725 60513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 62617 60734 gene locus_tag LOCUS_00650 62617 60734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 64866 62629 gene locus_tag LOCUS_00660 64866 62629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 69737 64866 gene locus_tag LOCUS_00670 69737 64866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 70807 69746 gene locus_tag LOCUS_00680 70807 69746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 72576 70819 gene locus_tag LOCUS_00690 72576 70819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 73129 72581 gene locus_tag LOCUS_00700 73129 72581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 73488 73138 gene locus_tag LOCUS_00710 73488 73138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 74431 73574 gene locus_tag LOCUS_00720 74431 73574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 75288 74446 gene locus_tag LOCUS_00730 75288 74446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 77072 75372 gene locus_tag LOCUS_00740 77072 75372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 77320 77069 gene locus_tag LOCUS_00750 77320 77069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 79196 77403 gene locus_tag LOCUS_00760 79196 77403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 79624 79193 gene locus_tag LOCUS_00770 79624 79193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 79982 79644 gene locus_tag LOCUS_00780 79982 79644 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047828.1 protein_id gnl|my_center|LOCUS_00780 81064 80615 gene locus_tag LOCUS_00790 81064 80615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 81539 81108 gene locus_tag LOCUS_00800 81539 81108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 82072 81536 gene locus_tag LOCUS_00810 82072 81536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 82215 82084 gene locus_tag LOCUS_00820 82215 82084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 82536 82216 gene locus_tag LOCUS_00830 82536 82216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 82908 82537 gene locus_tag LOCUS_00840 82908 82537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 83154 82915 gene locus_tag LOCUS_00850 83154 82915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 83567 83154 gene locus_tag LOCUS_00860 83567 83154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 83896 83564 gene locus_tag LOCUS_00870 83896 83564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 84153 83908 gene locus_tag LOCUS_00880 84153 83908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 84381 84163 gene locus_tag LOCUS_00890 84381 84163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 84512 84375 gene locus_tag LOCUS_00900 84512 84375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 84833 84516 gene locus_tag LOCUS_00910 84833 84516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 85346 84837 gene locus_tag LOCUS_00920 85346 84837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 85657 85343 gene locus_tag LOCUS_00930 85657 85343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 85869 85660 gene locus_tag LOCUS_00940 85869 85660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 86020 85856 gene locus_tag LOCUS_00950 86020 85856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 86153 85995 gene locus_tag LOCUS_00960 86153 85995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 86686 86150 gene locus_tag LOCUS_00970 86686 86150 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004505.1 protein_id gnl|my_center|LOCUS_00970 86926 86696 gene locus_tag LOCUS_00980 86926 86696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 87547 87137 gene locus_tag LOCUS_00990 87547 87137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 87833 87549 gene locus_tag LOCUS_01000 87833 87549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 88035 87835 gene locus_tag LOCUS_01010 88035 87835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 88484 88032 gene locus_tag LOCUS_01020 88484 88032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 88671 88468 gene locus_tag LOCUS_01030 88671 88468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 89444 88674 gene locus_tag LOCUS_01040 89444 88674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 89655 89416 gene locus_tag LOCUS_01050 89655 89416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 89875 89642 gene locus_tag LOCUS_01060 89875 89642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 90563 89823 gene locus_tag LOCUS_01070 90563 89823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373713.1 protein_id gnl|my_center|LOCUS_01070 90835 90692 gene locus_tag LOCUS_01080 90835 90692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 91026 90832 gene locus_tag LOCUS_01090 91026 90832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 91358 91125 gene locus_tag LOCUS_01100 91358 91125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 91486 91833 gene locus_tag LOCUS_01110 91486 91833 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101778.1 protein_id gnl|my_center|LOCUS_01110 91881 92210 gene locus_tag LOCUS_01120 91881 92210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 92255 92506 gene locus_tag LOCUS_01130 92255 92506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 92632 93837 gene locus_tag LOCUS_01140 92632 93837 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007697.1 protein_id gnl|my_center|LOCUS_01140 93997 93921 gene locus_tag LOCUS_t00060 93997 93921 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 94166 94090 gene locus_tag LOCUS_t00070 94166 94090 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 94939 94280 gene locus_tag LOCUS_01150 94939 94280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 95039 95479 gene locus_tag LOCUS_01160 gene mscL 95039 95479 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267001.1 protein_id gnl|my_center|LOCUS_01160 95652 95577 gene locus_tag LOCUS_t00080 95652 95577 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 95741 95666 gene locus_tag LOCUS_t00090 95741 95666 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 96654 95833 gene locus_tag LOCUS_01170 96654 95833 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680113.1 protein_id gnl|my_center|LOCUS_01170 97763 96693 gene locus_tag LOCUS_01180 97763 96693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 98792 97860 gene locus_tag LOCUS_01190 98792 97860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 100173 98923 gene locus_tag LOCUS_01200 100173 98923 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_01200 100870 100223 gene locus_tag LOCUS_01210 100870 100223 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_01210 101616 100873 gene locus_tag LOCUS_01220 gene fabG 101616 100873 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_01220 103401 101719 gene locus_tag LOCUS_01230 103401 101719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 105490 103511 gene locus_tag LOCUS_01240 105490 103511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 109800 105505 gene locus_tag LOCUS_01250 109800 105505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 110226 109876 gene locus_tag LOCUS_01260 110226 109876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 111328 110213 gene locus_tag LOCUS_01270 gene alr 111328 110213 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_01270 113236 111488 gene locus_tag LOCUS_01280 113236 111488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_01280 113791 113237 gene locus_tag LOCUS_01290 113791 113237 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286467.1 protein_id gnl|my_center|LOCUS_01290 114994 114122 gene locus_tag LOCUS_01300 114994 114122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 116556 115132 gene locus_tag LOCUS_01310 gene gatB 116556 115132 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_01310 117997 116558 gene locus_tag LOCUS_01320 117997 116558 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183059.1 protein_id gnl|my_center|LOCUS_01320 118302 117997 gene locus_tag LOCUS_01330 118302 117997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 119184 118348 gene locus_tag LOCUS_01340 119184 118348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 119891 119196 gene locus_tag LOCUS_01350 119891 119196 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389903.1 protein_id gnl|my_center|LOCUS_01350 120562 119894 gene locus_tag LOCUS_01360 120562 119894 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_01360 121433 120543 gene locus_tag LOCUS_01370 121433 120543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 122460 121444 gene locus_tag LOCUS_01380 122460 121444 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_01380 122891 122475 gene locus_tag LOCUS_01390 122891 122475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 123312 122905 gene locus_tag LOCUS_01400 123312 122905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 124389 123343 gene locus_tag LOCUS_01410 124389 123343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 124761 124399 gene locus_tag LOCUS_01420 124761 124399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 126515 124773 gene locus_tag LOCUS_01430 gene aspS 126515 124773 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_01430 126862 126710 gene locus_tag LOCUS_01440 126862 126710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 128121 126868 gene locus_tag LOCUS_01450 128121 126868 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_01450 128642 128567 gene locus_tag LOCUS_t00100 128642 128567 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 130282 128792 gene locus_tag LOCUS_01460 130282 128792 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897439.1 protein_id gnl|my_center|LOCUS_01460 130453 130377 gene locus_tag LOCUS_t00110 130453 130377 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 130560 130468 gene locus_tag LOCUS_t00120 130560 130468 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 131808 130930 gene locus_tag LOCUS_01470 131808 130930 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_01470 132130 132042 gene locus_tag LOCUS_t00130 132130 132042 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 132207 132132 gene locus_tag LOCUS_t00140 132207 132132 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 132296 132222 gene locus_tag LOCUS_t00150 132296 132222 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 132387 132304 gene locus_tag LOCUS_t00160 132387 132304 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 132467 132392 gene locus_tag LOCUS_t00170 132467 132392 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 132552 132476 gene locus_tag LOCUS_t00180 132552 132476 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 132977 132618 gene locus_tag LOCUS_01480 gene yugI 132977 132618 CDS product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722395.1 protein_id gnl|my_center|LOCUS_01480 133082 133318 gene locus_tag LOCUS_01490 133082 133318 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431159.1 protein_id gnl|my_center|LOCUS_01490 134238 133315 gene locus_tag LOCUS_01500 134238 133315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 135850 134297 gene locus_tag LOCUS_01510 gene rny 135850 134297 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050913.1 protein_id gnl|my_center|LOCUS_01510 136983 135970 gene locus_tag LOCUS_01520 gene dacB 136983 135970 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252614.1 protein_id gnl|my_center|LOCUS_01520 138895 137036 gene locus_tag LOCUS_01530 gene htpG 138895 137036 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_01530 139547 138999 gene locus_tag LOCUS_01540 139547 138999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 140235 139597 gene locus_tag LOCUS_01550 140235 139597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 140440 140219 gene locus_tag LOCUS_01560 140440 140219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 141488 140577 gene locus_tag LOCUS_01570 141488 140577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 141680 142492 gene locus_tag LOCUS_01580 141680 142492 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 protein_id gnl|my_center|LOCUS_01580 142662 142528 gene locus_tag LOCUS_01590 142662 142528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 143655 142717 gene locus_tag LOCUS_01600 gene holA 143655 142717 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_01600 145443 143677 gene locus_tag LOCUS_01610 145443 143677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360293.1 protein_id gnl|my_center|LOCUS_01610 147146 145440 gene locus_tag LOCUS_01620 147146 145440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 protein_id gnl|my_center|LOCUS_01620 147771 147193 gene locus_tag LOCUS_01630 147771 147193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 148002 147799 gene locus_tag LOCUS_01640 148002 147799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 148488 148015 gene locus_tag LOCUS_01650 gene infC 148488 148015 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 protein_id gnl|my_center|LOCUS_01650 149666 148761 gene locus_tag LOCUS_01660 149666 148761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 150309 149689 gene locus_tag LOCUS_01670 gene rpe 150309 149689 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 protein_id gnl|my_center|LOCUS_01670 151156 150314 gene locus_tag LOCUS_01680 gene rsgA 151156 150314 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287379.1 protein_id gnl|my_center|LOCUS_01680 152895 151156 gene locus_tag LOCUS_01690 gene pknB 152895 151156 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_01690 153635 152898 gene locus_tag LOCUS_01700 153635 152898 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_01700 154668 153637 gene locus_tag LOCUS_01710 gene rlmN 154668 153637 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293986.1 protein_id gnl|my_center|LOCUS_01710 155298 154774 gene locus_tag LOCUS_01720 155298 154774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_01720 155935 156099 gene locus_tag LOCUS_01730 155935 156099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 157515 156475 gene locus_tag LOCUS_01740 157515 156475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 158843 157908 gene locus_tag LOCUS_01750 gene fmt 158843 157908 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_01750 159922 158879 gene locus_tag LOCUS_01760 gene rseP 159922 158879 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_01760 160705 159932 gene locus_tag LOCUS_01770 160705 159932 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640734.1 protein_id gnl|my_center|LOCUS_01770 161371 161123 gene locus_tag LOCUS_01780 161371 161123 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_01780 161646 161374 gene locus_tag LOCUS_01790 gene rpsP 161646 161374 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_01790 162265 161747 gene locus_tag LOCUS_01800 gene cotE 162265 161747 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 protein_id gnl|my_center|LOCUS_01800 164789 162330 gene locus_tag LOCUS_01810 164789 162330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 165078 164791 gene locus_tag LOCUS_01820 165078 164791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 165975 165082 gene locus_tag LOCUS_01830 165975 165082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 166524 166123 gene locus_tag LOCUS_01840 166524 166123 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546034.1 protein_id gnl|my_center|LOCUS_01840 166831 166505 gene locus_tag LOCUS_01850 166831 166505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 167724 166831 gene locus_tag LOCUS_01860 167724 166831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 168471 167746 gene locus_tag LOCUS_01870 168471 167746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 169162 168527 gene locus_tag LOCUS_01880 gene trmB 169162 168527 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_01880 169247 169543 gene locus_tag LOCUS_01890 169247 169543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 170874 169570 gene locus_tag LOCUS_01900 170874 169570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 172598 170964 gene locus_tag LOCUS_01910 172598 170964 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284028.1 protein_id gnl|my_center|LOCUS_01910 172777 172604 gene locus_tag LOCUS_01920 172777 172604 CDS product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621751.1 protein_id gnl|my_center|LOCUS_01920 173823 172876 gene locus_tag LOCUS_01930 173823 172876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 176424 173890 gene locus_tag LOCUS_01940 gene parC 176424 173890 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 protein_id gnl|my_center|LOCUS_01940 178348 176438 gene locus_tag LOCUS_01950 gene parE 178348 176438 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381887.1 protein_id gnl|my_center|LOCUS_01950 179385 178447 gene locus_tag LOCUS_01960 179385 178447 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_01960 180172 179474 gene locus_tag LOCUS_01970 180172 179474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 180479 180270 gene locus_tag LOCUS_01980 180479 180270 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123317.1 protein_id gnl|my_center|LOCUS_01980 180949 180527 gene locus_tag LOCUS_01990 180949 180527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 181502 181038 gene locus_tag LOCUS_02000 181502 181038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 183750 181798 gene locus_tag LOCUS_02010 gene tkt 183750 181798 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165438795.1 protein_id gnl|my_center|LOCUS_02010 183968 183813 gene locus_tag LOCUS_02020 183968 183813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 184107 184718 gene locus_tag LOCUS_02030 gene lexA 184107 184718 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_02030 184824 185420 gene locus_tag LOCUS_02040 184824 185420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 187510 185465 gene locus_tag LOCUS_02050 187510 185465 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082702.1 protein_id gnl|my_center|LOCUS_02050 188202 187507 gene locus_tag LOCUS_02060 188202 187507 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261916.1 protein_id gnl|my_center|LOCUS_02060 188670 188284 gene locus_tag LOCUS_02070 188670 188284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 189281 188742 gene locus_tag LOCUS_02080 189281 188742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 189914 189321 gene locus_tag LOCUS_02090 189914 189321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 192421 190004 gene locus_tag LOCUS_02100 gene leuS 192421 190004 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475758.1 protein_id gnl|my_center|LOCUS_02100 192777 192421 gene locus_tag LOCUS_02110 192777 192421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 195333 193123 gene locus_tag LOCUS_02120 195333 193123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 196893 195529 gene locus_tag LOCUS_02130 196893 195529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 198047 196905 gene locus_tag LOCUS_02140 198047 196905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 198722 198129 gene locus_tag LOCUS_02150 198722 198129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 199149 198787 gene locus_tag LOCUS_02160 199149 198787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 200015 199425 gene locus_tag LOCUS_02170 200015 199425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 200706 200047 gene locus_tag LOCUS_02180 200706 200047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 202311 200986 gene locus_tag LOCUS_02190 202311 200986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_02190 203200 202301 gene locus_tag LOCUS_02200 203200 202301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_02200 204486 203203 gene locus_tag LOCUS_02210 204486 203203 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_02210 205732 204479 gene locus_tag LOCUS_02220 205732 204479 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772418.1 protein_id gnl|my_center|LOCUS_02220 209217 206128 gene locus_tag LOCUS_02230 209217 206128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 211543 209348 gene locus_tag LOCUS_02240 211543 209348 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990110.1 protein_id gnl|my_center|LOCUS_02240 212543 211620 gene locus_tag LOCUS_02250 212543 211620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 213035 212622 gene locus_tag LOCUS_02260 213035 212622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 213889 213059 gene locus_tag LOCUS_02270 213889 213059 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_02270 214499 213849 gene locus_tag LOCUS_02280 214499 213849 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641231.1 protein_id gnl|my_center|LOCUS_02280 215898 214501 gene locus_tag LOCUS_02290 215898 214501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 216908 215961 gene locus_tag LOCUS_02300 216908 215961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 217434 216901 gene locus_tag LOCUS_02310 217434 216901 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731912.1 protein_id gnl|my_center|LOCUS_02310 217892 217437 gene locus_tag LOCUS_02320 217892 217437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 218910 217963 gene locus_tag LOCUS_02330 218910 217963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 219076 219603 gene locus_tag LOCUS_02340 219076 219603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 220251 219619 gene locus_tag LOCUS_02350 220251 219619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 220987 220388 gene locus_tag LOCUS_02360 220987 220388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440252.1 protein_id gnl|my_center|LOCUS_02360 221385 220984 gene locus_tag LOCUS_02370 221385 220984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 222386 221388 gene locus_tag LOCUS_02380 gene galE 222386 221388 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_02380 223030 222428 gene locus_tag LOCUS_02390 223030 222428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 223227 223303 gene locus_tag LOCUS_t00190 223227 223303 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 223930 223691 gene locus_tag LOCUS_02400 223930 223691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 224032 224223 gene locus_tag LOCUS_02410 224032 224223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 225633 224254 gene locus_tag LOCUS_02420 225633 224254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 226025 226918 gene locus_tag LOCUS_02430 gene dapA 226025 226918 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965674.1 protein_id gnl|my_center|LOCUS_02430 227411 227779 gene locus_tag LOCUS_02440 227411 227779 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 protein_id gnl|my_center|LOCUS_02440 227767 228366 gene locus_tag LOCUS_02450 227767 228366 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 protein_id gnl|my_center|LOCUS_02450 228625 228843 gene locus_tag LOCUS_02460 228625 228843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 229215 228838 gene locus_tag LOCUS_02470 229215 228838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 229644 229261 gene locus_tag LOCUS_02480 229644 229261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 230587 229679 gene locus_tag LOCUS_02490 230587 229679 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964732.1 protein_id gnl|my_center|LOCUS_02490 231393 230620 gene locus_tag LOCUS_02500 231393 230620 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986711.1 protein_id gnl|my_center|LOCUS_02500 232746 231424 gene locus_tag LOCUS_02510 gene murC 232746 231424 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101415.1 protein_id gnl|my_center|LOCUS_02510 232834 232920 gene locus_tag LOCUS_t00200 232834 232920 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 233022 233921 gene locus_tag LOCUS_02520 233022 233921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 234716 233934 gene locus_tag LOCUS_02530 234716 233934 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404464.1 protein_id gnl|my_center|LOCUS_02530 235754 234747 gene locus_tag LOCUS_02540 235754 234747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 236313 235747 gene locus_tag LOCUS_02550 gene scpB 236313 235747 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375167.1 protein_id gnl|my_center|LOCUS_02550 237037 236315 gene locus_tag LOCUS_02560 gene scpA 237037 236315 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_02560 237446 237027 gene locus_tag LOCUS_02570 237446 237027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 237528 237833 gene locus_tag LOCUS_02580 237528 237833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 238120 237842 gene locus_tag LOCUS_02590 238120 237842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 239264 238197 gene locus_tag LOCUS_02600 239264 238197 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_02600 240388 239507 gene locus_tag LOCUS_02610 240388 239507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 241360 240473 gene locus_tag LOCUS_02620 241360 240473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence02 2750 1029 gene locus_tag LOCUS_02630 2750 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 3251 2994 gene locus_tag LOCUS_02640 3251 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 4464 3322 gene locus_tag LOCUS_02650 4464 3322 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901929.1 protein_id gnl|my_center|LOCUS_02650 5406 4474 gene locus_tag LOCUS_02660 5406 4474 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_02660 6314 5565 gene locus_tag LOCUS_02670 6314 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6958 6311 gene locus_tag LOCUS_02680 6958 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 7571 7158 gene locus_tag LOCUS_02690 gene rpsI 7571 7158 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_02690 8013 7585 gene locus_tag LOCUS_02700 gene rplM 8013 7585 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_02700 9478 8135 gene locus_tag LOCUS_02710 9478 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 10295 9471 gene locus_tag LOCUS_02720 gene cdaA 10295 9471 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347896.1 protein_id gnl|my_center|LOCUS_02720 10921 10412 gene locus_tag LOCUS_02730 10921 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 11719 10979 gene locus_tag LOCUS_02740 11719 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 11824 12336 gene locus_tag LOCUS_02750 11824 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 12346 12419 gene locus_tag LOCUS_t00210 12346 12419 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12506 12934 gene locus_tag LOCUS_02760 12506 12934 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964388.1 protein_id gnl|my_center|LOCUS_02760 12938 13573 gene locus_tag LOCUS_02770 12938 13573 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_02770 14212 13649 gene locus_tag LOCUS_02780 14212 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 15909 14254 gene locus_tag LOCUS_02790 15909 14254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235856733.1 protein_id gnl|my_center|LOCUS_02790 17093 15912 gene locus_tag LOCUS_02800 17093 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 17561 17121 gene locus_tag LOCUS_02810 17561 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 17763 19142 gene locus_tag LOCUS_02820 17763 19142 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_02820 19718 19164 gene locus_tag LOCUS_02830 19718 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 19795 20739 gene locus_tag LOCUS_02840 gene uvsE 19795 20739 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 protein_id gnl|my_center|LOCUS_02840 20809 20985 gene locus_tag LOCUS_02850 20809 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 22936 21002 gene locus_tag LOCUS_02860 22936 21002 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676339.1 protein_id gnl|my_center|LOCUS_02860 23511 22936 gene locus_tag LOCUS_02870 23511 22936 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233204.1 protein_id gnl|my_center|LOCUS_02870 24503 23598 gene locus_tag LOCUS_02880 gene trxB 24503 23598 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_02880 24817 24503 gene locus_tag LOCUS_02890 gene trxA 24817 24503 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_02890 25782 24895 gene locus_tag LOCUS_02900 25782 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 26855 26025 gene locus_tag LOCUS_02910 26855 26025 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102407668.1 protein_id gnl|my_center|LOCUS_02910 27099 26848 gene locus_tag LOCUS_02920 27099 26848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 27860 27240 gene locus_tag LOCUS_02930 27860 27240 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107864.1 protein_id gnl|my_center|LOCUS_02930 28445 29722 gene locus_tag LOCUS_02940 28445 29722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 30220 29747 gene locus_tag LOCUS_02950 30220 29747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 30704 30264 gene locus_tag LOCUS_02960 gene smpB 30704 30264 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085183.1 protein_id gnl|my_center|LOCUS_02960 32918 30783 gene locus_tag LOCUS_02970 gene rnr 32918 30783 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 protein_id gnl|my_center|LOCUS_02970 33215 33006 gene locus_tag LOCUS_02980 33215 33006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 35170 33278 gene locus_tag LOCUS_02990 35170 33278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 36478 35249 gene locus_tag LOCUS_03000 gene eno 36478 35249 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 protein_id gnl|my_center|LOCUS_03000 36619 37866 gene locus_tag LOCUS_03010 36619 37866 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527081.1 protein_id gnl|my_center|LOCUS_03010 39339 38155 gene locus_tag LOCUS_03020 gene tuf 39339 38155 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_03020 41498 39426 gene locus_tag LOCUS_03030 gene fusA 41498 39426 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724965.1 protein_id gnl|my_center|LOCUS_03030 41981 41514 gene locus_tag LOCUS_03040 gene rpsG 41981 41514 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225784.1 protein_id gnl|my_center|LOCUS_03040 42431 42018 gene locus_tag LOCUS_03050 gene rpsL 42431 42018 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_03050 42808 42575 gene locus_tag LOCUS_03060 gene rpmE 42808 42575 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_03060 43647 42886 gene locus_tag LOCUS_03070 43647 42886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 43953 43819 gene locus_tag LOCUS_03080 43953 43819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 45215 43953 gene locus_tag LOCUS_03090 45215 43953 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732525.1 protein_id gnl|my_center|LOCUS_03090 46123 45269 gene locus_tag LOCUS_03100 46123 45269 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829938.1 protein_id gnl|my_center|LOCUS_03100 47482 46232 gene locus_tag LOCUS_03110 47482 46232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 48023 47529 gene locus_tag LOCUS_03120 48023 47529 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_03120 48626 48096 gene locus_tag LOCUS_03130 gene spoIIR 48626 48096 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 protein_id gnl|my_center|LOCUS_03130 49378 48662 gene locus_tag LOCUS_03140 gene prmC 49378 48662 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440566.1 protein_id gnl|my_center|LOCUS_03140 50165 49380 gene locus_tag LOCUS_03150 50165 49380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03150 50489 50178 gene locus_tag LOCUS_03160 50489 50178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 51598 50543 gene locus_tag LOCUS_03170 gene prfA 51598 50543 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289676.1 protein_id gnl|my_center|LOCUS_03170 52035 51598 gene locus_tag LOCUS_03180 52035 51598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 53675 52047 gene locus_tag LOCUS_03190 gene argS 53675 52047 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_03190 54049 53675 gene locus_tag LOCUS_03200 54049 53675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 54168 56135 gene locus_tag LOCUS_03210 54168 56135 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227540.1 protein_id gnl|my_center|LOCUS_03210 58135 56132 gene locus_tag LOCUS_03220 gene ftsH 58135 56132 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079659.1 protein_id gnl|my_center|LOCUS_03220 59459 58125 gene locus_tag LOCUS_03230 59459 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 60338 59922 gene locus_tag LOCUS_03240 60338 59922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 64032 60400 gene locus_tag LOCUS_03250 gene rpoC 64032 60400 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 protein_id gnl|my_center|LOCUS_03250 67670 64032 gene locus_tag LOCUS_03260 gene rpoB 67670 64032 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_03260 68828 67836 gene locus_tag LOCUS_03270 68828 67836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 69431 68847 gene locus_tag LOCUS_03280 69431 68847 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262218.1 protein_id gnl|my_center|LOCUS_03280 69893 69525 gene locus_tag LOCUS_03290 gene rplL 69893 69525 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_03290 70417 69923 gene locus_tag LOCUS_03300 gene rplJ 70417 69923 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 protein_id gnl|my_center|LOCUS_03300 71323 70625 gene locus_tag LOCUS_03310 gene rplA 71323 70625 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832314.1 protein_id gnl|my_center|LOCUS_03310 71836 71411 gene locus_tag LOCUS_03320 gene rplK 71836 71411 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894933.1 protein_id gnl|my_center|LOCUS_03320 72535 71999 gene locus_tag LOCUS_03330 gene nusG 72535 71999 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726896.1 protein_id gnl|my_center|LOCUS_03330 72755 72537 gene locus_tag LOCUS_03340 72755 72537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 73465 72836 gene locus_tag LOCUS_03350 gene sigH 73465 72836 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966429.1 protein_id gnl|my_center|LOCUS_03350 74179 73475 gene locus_tag LOCUS_03360 gene rlmB 74179 73475 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724085.1 protein_id gnl|my_center|LOCUS_03360 74555 74181 gene locus_tag LOCUS_03370 74555 74181 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_03370 74896 74618 gene locus_tag LOCUS_03380 74896 74618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 75509 75219 gene locus_tag LOCUS_03390 gene yabP 75509 75219 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059104.1 protein_id gnl|my_center|LOCUS_03390 75809 75552 gene locus_tag LOCUS_03400 75809 75552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 78190 75878 gene locus_tag LOCUS_03410 78190 75878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 82769 78180 gene locus_tag LOCUS_03420 82769 78180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 83063 82854 gene locus_tag LOCUS_03430 83063 82854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 83821 83075 gene locus_tag LOCUS_03440 gene prtG 83821 83075 CDS product sporulation-specific protease PrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243478.1 protein_id gnl|my_center|LOCUS_03440 85389 83878 gene locus_tag LOCUS_03450 85389 83878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 86338 85517 gene locus_tag LOCUS_03460 gene rsmA 86338 85517 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_03460 87347 86715 gene locus_tag LOCUS_03470 87347 86715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 88156 87404 gene locus_tag LOCUS_03480 88156 87404 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_03480 88363 88184 gene locus_tag LOCUS_03490 88363 88184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 89005 88493 gene locus_tag LOCUS_03500 gene spoVT 89005 88493 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218365.1 protein_id gnl|my_center|LOCUS_03500 92345 89049 gene locus_tag LOCUS_03510 gene mfd 92345 89049 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287403.1 protein_id gnl|my_center|LOCUS_03510 92936 92355 gene locus_tag LOCUS_03520 gene pth 92936 92355 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722742.1 protein_id gnl|my_center|LOCUS_03520 93660 92926 gene locus_tag LOCUS_03530 93660 92926 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390783.1 protein_id gnl|my_center|LOCUS_03530 94444 93644 gene locus_tag LOCUS_03540 94444 93644 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723490.1 protein_id gnl|my_center|LOCUS_03540 95348 94422 gene locus_tag LOCUS_03550 gene holB 95348 94422 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169577.1 protein_id gnl|my_center|LOCUS_03550 95552 95364 gene locus_tag LOCUS_03560 95552 95364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 96192 95593 gene locus_tag LOCUS_03570 gene recR 96192 95593 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829377.1 protein_id gnl|my_center|LOCUS_03570 96502 96206 gene locus_tag LOCUS_03580 96502 96206 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700666.1 protein_id gnl|my_center|LOCUS_03580 98226 96505 gene locus_tag LOCUS_03590 gene dnaX 98226 96505 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109040.1 protein_id gnl|my_center|LOCUS_03590 98761 98354 gene locus_tag LOCUS_03600 98761 98354 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963450.1 protein_id gnl|my_center|LOCUS_03600 101610 99055 gene locus_tag LOCUS_03610 gene gyrA 101610 99055 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_03610 103551 101623 gene locus_tag LOCUS_03620 gene gyrB 103551 101623 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_03620 104685 103555 gene locus_tag LOCUS_03630 gene recF 104685 103555 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475454.1 protein_id gnl|my_center|LOCUS_03630 105318 104857 gene locus_tag LOCUS_03640 gene comK 105318 104857 CDS product competence transcription factor ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245329.1 protein_id gnl|my_center|LOCUS_03640 106182 105412 gene locus_tag LOCUS_03650 106182 105412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 107324 106203 gene locus_tag LOCUS_03660 gene dnaN 107324 106203 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212527.1 protein_id gnl|my_center|LOCUS_03660 108820 107468 gene locus_tag LOCUS_03670 gene dnaA 108820 107468 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_03670 110105 109164 gene locus_tag LOCUS_03680 110105 109164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 110264 110392 gene locus_tag LOCUS_03690 gene rpmH 110264 110392 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597961.1 protein_id gnl|my_center|LOCUS_03690 110444 110764 gene locus_tag LOCUS_03700 gene rnpA 110444 110764 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_03700 110779 111774 gene locus_tag LOCUS_03710 110779 111774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 111755 112378 gene locus_tag LOCUS_03720 111755 112378 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_03720 112435 113664 gene locus_tag LOCUS_03730 112435 113664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 113671 115014 gene locus_tag LOCUS_03740 gene mnmE 113671 115014 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700790.1 protein_id gnl|my_center|LOCUS_03740 115125 116057 gene locus_tag LOCUS_03750 115125 116057 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_03750 116106 116708 gene locus_tag LOCUS_03760 116106 116708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 116710 118524 gene locus_tag LOCUS_03770 gene mnmG 116710 118524 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355988.1 protein_id gnl|my_center|LOCUS_03770 118517 119218 gene locus_tag LOCUS_03780 gene rsmG 118517 119218 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_03780 119267 120526 gene locus_tag LOCUS_03790 119267 120526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 120589 121035 gene locus_tag LOCUS_03800 gene rpiB 120589 121035 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_03800 121025 121222 gene locus_tag LOCUS_03810 121025 121222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 121233 122153 gene locus_tag LOCUS_03820 gene spoIID 121233 122153 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 protein_id gnl|my_center|LOCUS_03820 122203 122844 gene locus_tag LOCUS_03830 122203 122844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 122859 123830 gene locus_tag LOCUS_03840 122859 123830 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_03840 123886 124596 gene locus_tag LOCUS_03850 123886 124596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 124593 125900 gene locus_tag LOCUS_03860 124593 125900 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721673.1 protein_id gnl|my_center|LOCUS_03860 126051 125926 gene locus_tag LOCUS_03870 126051 125926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 126704 126099 gene locus_tag LOCUS_03880 126704 126099 CDS product accessory gene regulator ArgB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963405.1 protein_id gnl|my_center|LOCUS_03880 127017 127241 gene locus_tag LOCUS_03890 gene cspD 127017 127241 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728273.1 protein_id gnl|my_center|LOCUS_03890 127291 127821 gene locus_tag LOCUS_03900 gene raiA 127291 127821 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 protein_id gnl|my_center|LOCUS_03900 127906 130404 gene locus_tag LOCUS_03910 gene secA 127906 130404 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579368.1 protein_id gnl|my_center|LOCUS_03910 130559 131134 gene locus_tag LOCUS_03920 130559 131134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 131150 131692 gene locus_tag LOCUS_03930 131150 131692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 132121 132441 gene locus_tag LOCUS_03940 132121 132441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03940 132701 133753 gene locus_tag LOCUS_03950 gene prfB 132701 133753 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_03950 133755 134681 gene locus_tag LOCUS_03960 133755 134681 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354953.1 protein_id gnl|my_center|LOCUS_03960 134668 135366 gene locus_tag LOCUS_03970 gene ftsE 134668 135366 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_03970 135353 136252 gene locus_tag LOCUS_03980 gene ftsX 135353 136252 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_03980 136252 137433 gene locus_tag LOCUS_03990 136252 137433 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726096.1 protein_id gnl|my_center|LOCUS_03990 137845 138696 gene locus_tag LOCUS_04000 137845 138696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 138671 141346 gene locus_tag LOCUS_04010 138671 141346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 141615 142835 gene locus_tag LOCUS_04020 gene pepT 141615 142835 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016614.1 protein_id gnl|my_center|LOCUS_04020 142867 143805 gene locus_tag LOCUS_04030 142867 143805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 143882 144352 gene locus_tag LOCUS_04040 143882 144352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 144638 144372 gene locus_tag LOCUS_04050 144638 144372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 144884 146836 gene locus_tag LOCUS_04060 gene uvrB 144884 146836 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_04060 147006 147833 gene locus_tag LOCUS_04070 gene dinD 147006 147833 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_04070 147966 148154 gene locus_tag LOCUS_04080 147966 148154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 148221 148769 gene locus_tag LOCUS_04090 148221 148769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 149194 152007 gene locus_tag LOCUS_04100 gene uvrA 149194 152007 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990003.1 protein_id gnl|my_center|LOCUS_04100 152163 152582 gene locus_tag LOCUS_04110 152163 152582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 152572 152742 gene locus_tag LOCUS_04120 152572 152742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 152825 153262 gene locus_tag LOCUS_04130 152825 153262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 153264 154067 gene locus_tag LOCUS_04140 gene lgt 153264 154067 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 protein_id gnl|my_center|LOCUS_04140 154068 154325 gene locus_tag LOCUS_04150 154068 154325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 154683 154462 gene locus_tag LOCUS_04160 154683 154462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 155540 156249 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttaagtagtatagatttgag 158897 159829 gene locus_tag LOCUS_04170 gene whiA 158897 159829 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438915.1 protein_id gnl|my_center|LOCUS_04170 159920 160714 gene locus_tag LOCUS_04180 159920 160714 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_04180 160695 161582 gene locus_tag LOCUS_04190 160695 161582 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562946.1 protein_id gnl|my_center|LOCUS_04190 161593 162399 gene locus_tag LOCUS_04200 161593 162399 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373073.1 protein_id gnl|my_center|LOCUS_04200 162389 162586 gene locus_tag LOCUS_04210 162389 162586 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966985.1 protein_id gnl|my_center|LOCUS_04210 162579 164117 gene locus_tag LOCUS_04220 162579 164117 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_04220 164247 165344 gene locus_tag LOCUS_04230 gene ychF 164247 165344 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831336.1 protein_id gnl|my_center|LOCUS_04230 165362 166195 gene locus_tag LOCUS_04240 165362 166195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 166339 166623 gene locus_tag LOCUS_04250 gene rpsF 166339 166623 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721667.1 protein_id gnl|my_center|LOCUS_04250 166642 167118 gene locus_tag LOCUS_04260 gene ssb 166642 167118 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934760.1 protein_id gnl|my_center|LOCUS_04260 167144 167359 gene locus_tag LOCUS_04270 167144 167359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 167462 167902 gene locus_tag LOCUS_04280 gene rplI 167462 167902 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288372.1 protein_id gnl|my_center|LOCUS_04280 167922 169265 gene locus_tag LOCUS_04290 gene dnaB 167922 169265 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_04290 169268 170746 gene locus_tag LOCUS_04300 169268 170746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 170746 171513 gene locus_tag LOCUS_04310 170746 171513 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 protein_id gnl|my_center|LOCUS_04310 171510 171956 gene locus_tag LOCUS_04320 gene rlmH 171510 171956 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_04320 172017 172730 gene locus_tag LOCUS_04330 172017 172730 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_04330 172750 173496 gene locus_tag LOCUS_04340 172750 173496 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_04340 173512 174162 gene locus_tag LOCUS_04350 173512 174162 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432519.1 protein_id gnl|my_center|LOCUS_04350 174700 174170 gene locus_tag LOCUS_04360 174700 174170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 175173 174760 gene locus_tag LOCUS_04370 175173 174760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 175274 175840 gene locus_tag LOCUS_04380 175274 175840 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944972.1 protein_id gnl|my_center|LOCUS_04380 175854 177095 gene locus_tag LOCUS_04390 175854 177095 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387163.1 protein_id gnl|my_center|LOCUS_04390 177208 177414 gene locus_tag LOCUS_04400 177208 177414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 177475 178446 gene locus_tag LOCUS_04410 gene dusB 177475 178446 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 protein_id gnl|my_center|LOCUS_04410 178581 180275 gene locus_tag LOCUS_04420 178581 180275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 180461 181573 gene locus_tag LOCUS_04430 180461 181573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 181459 181558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 181596 184622 gene locus_tag LOCUS_04440 181596 184622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 184698 186941 gene locus_tag LOCUS_04450 184698 186941 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880827.1 protein_id gnl|my_center|LOCUS_04450 187075 188472 gene locus_tag LOCUS_04460 187075 188472 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_04460 188516 189022 gene locus_tag LOCUS_04470 188516 189022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 189087 189464 gene locus_tag LOCUS_04480 189087 189464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 190059 189478 gene locus_tag LOCUS_04490 gene clpP 190059 189478 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049162.1 protein_id gnl|my_center|LOCUS_04490 190169 191827 gene locus_tag LOCUS_04500 190169 191827 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_04500 191860 192864 gene locus_tag LOCUS_04510 gene gap 191860 192864 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 protein_id gnl|my_center|LOCUS_04510 192941 194242 gene locus_tag LOCUS_04520 192941 194242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 194296 195480 gene locus_tag LOCUS_04530 194296 195480 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357094.1 protein_id gnl|my_center|LOCUS_04530 195489 196475 gene locus_tag LOCUS_04540 195489 196475 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 protein_id gnl|my_center|LOCUS_04540 196472 197746 gene locus_tag LOCUS_04550 196472 197746 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675474.1 protein_id gnl|my_center|LOCUS_04550 197697 198404 gene locus_tag LOCUS_04560 gene tpiA 197697 198404 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_04560 198499 199026 gene locus_tag LOCUS_04570 198499 199026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 199147 199944 gene locus_tag LOCUS_04580 gene spo0A 199147 199944 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_04580 200018 200689 gene locus_tag LOCUS_04590 200018 200689 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 protein_id gnl|my_center|LOCUS_04590 201022 201324 gene locus_tag LOCUS_04600 gene rpsJ 201022 201324 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129973.1 protein_id gnl|my_center|LOCUS_04600 201341 202084 gene locus_tag LOCUS_04610 gene rplC 201341 202084 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_04610 202138 202764 gene locus_tag LOCUS_04620 gene rplD 202138 202764 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166912.1 protein_id gnl|my_center|LOCUS_04620 202764 203036 gene locus_tag LOCUS_04630 202764 203036 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129966.1 protein_id gnl|my_center|LOCUS_04630 203054 203881 gene locus_tag LOCUS_04640 gene rplB 203054 203881 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985472.1 protein_id gnl|my_center|LOCUS_04640 203901 204173 gene locus_tag LOCUS_04650 gene rpsS 203901 204173 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183024.1 protein_id gnl|my_center|LOCUS_04650 204193 204525 gene locus_tag LOCUS_04660 gene rplV 204193 204525 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_04660 204544 205221 gene locus_tag LOCUS_04670 gene rpsC 204544 205221 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_04670 205199 205630 gene locus_tag LOCUS_04680 gene rplP 205199 205630 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183027.1 protein_id gnl|my_center|LOCUS_04680 205620 205811 gene locus_tag LOCUS_04690 gene rpmC 205620 205811 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_04690 205823 206080 gene locus_tag LOCUS_04700 gene rpsQ 205823 206080 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 protein_id gnl|my_center|LOCUS_04700 206112 206480 gene locus_tag LOCUS_04710 gene rplN 206112 206480 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_04710 206503 206805 gene locus_tag LOCUS_04720 gene rplX 206503 206805 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567544.1 protein_id gnl|my_center|LOCUS_04720 206819 207358 gene locus_tag LOCUS_04730 gene rplE 206819 207358 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 protein_id gnl|my_center|LOCUS_04730 207377 207562 gene locus_tag LOCUS_04740 gene rpsN 207377 207562 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 protein_id gnl|my_center|LOCUS_04740 207590 207988 gene locus_tag LOCUS_04750 gene rpsH 207590 207988 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055710.1 protein_id gnl|my_center|LOCUS_04750 208010 208549 gene locus_tag LOCUS_04760 gene rplF 208010 208549 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288677.1 protein_id gnl|my_center|LOCUS_04760 208571 208933 gene locus_tag LOCUS_04770 gene rplR 208571 208933 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_04770 208946 209455 gene locus_tag LOCUS_04780 gene rpsE 208946 209455 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356219.1 protein_id gnl|my_center|LOCUS_04780 209455 209898 gene locus_tag LOCUS_04790 gene rplO 209455 209898 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 protein_id gnl|my_center|LOCUS_04790 209900 211171 gene locus_tag LOCUS_04800 gene secY 209900 211171 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_04800 211171 211827 gene locus_tag LOCUS_04810 211171 211827 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081793.1 protein_id gnl|my_center|LOCUS_04810 211860 212078 gene locus_tag LOCUS_04820 gene infA 211860 212078 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_04820 212225 212590 gene locus_tag LOCUS_04830 gene rpsM 212225 212590 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_04830 212610 212993 gene locus_tag LOCUS_04840 gene rpsK 212610 212993 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_04840 213018 213968 gene locus_tag LOCUS_04850 213018 213968 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641267.1 protein_id gnl|my_center|LOCUS_04850 213986 214330 gene locus_tag LOCUS_04860 gene rplQ 213986 214330 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701337.1 protein_id gnl|my_center|LOCUS_04860 214572 215474 gene locus_tag LOCUS_04870 214572 215474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 216374 215511 gene locus_tag LOCUS_04880 216374 215511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 216465 217211 gene locus_tag LOCUS_04890 216465 217211 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_04890 217212 217670 gene locus_tag LOCUS_04900 217212 217670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 217744 218475 gene locus_tag LOCUS_04910 gene truA 217744 218475 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477893.1 protein_id gnl|my_center|LOCUS_04910 218714 218508 gene locus_tag LOCUS_04920 218714 218508 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381996.1 protein_id gnl|my_center|LOCUS_04920 218821 219831 gene locus_tag LOCUS_04930 218821 219831 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_04930 219879 220355 gene locus_tag LOCUS_04940 219879 220355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 220413 221672 gene locus_tag LOCUS_04950 220413 221672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 221752 222291 gene locus_tag LOCUS_04960 221752 222291 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830384.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence03 134 2164 gene locus_tag LOCUS_04970 134 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 2216 3277 gene locus_tag LOCUS_04980 2216 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 3298 4347 gene locus_tag LOCUS_04990 3298 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4435 5073 gene locus_tag LOCUS_05000 4435 5073 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_05000 5076 5801 gene locus_tag LOCUS_05010 5076 5801 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166692.1 protein_id gnl|my_center|LOCUS_05010 5803 6288 gene locus_tag LOCUS_05020 gene rimM 5803 6288 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 protein_id gnl|my_center|LOCUS_05020 6285 7505 gene locus_tag LOCUS_05030 6285 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 7646 7984 gene locus_tag LOCUS_05040 gene rplS 7646 7984 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728425.1 protein_id gnl|my_center|LOCUS_05040 8024 8548 gene locus_tag LOCUS_05050 gene lepB 8024 8548 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 protein_id gnl|my_center|LOCUS_05050 8720 9748 gene locus_tag LOCUS_05060 8720 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 9865 10371 gene locus_tag LOCUS_05070 9865 10371 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_05070 10405 10866 gene locus_tag LOCUS_05080 10405 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 10904 11485 gene locus_tag LOCUS_05090 10904 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 11549 11932 gene locus_tag LOCUS_05100 11549 11932 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_05100 12256 12810 gene locus_tag LOCUS_05110 12256 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05110 12797 13012 gene locus_tag LOCUS_05120 12797 13012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05120 13005 13754 gene locus_tag LOCUS_05130 13005 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 13825 14394 gene locus_tag LOCUS_05140 13825 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 14573 15070 gene locus_tag LOCUS_05150 14573 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 15131 15988 gene locus_tag LOCUS_05160 gene ylqF 15131 15988 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_05160 15997 16629 gene locus_tag LOCUS_05170 gene rnhB 15997 16629 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 protein_id gnl|my_center|LOCUS_05170 16647 18674 gene locus_tag LOCUS_05180 gene topA 16647 18674 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_05180 18737 19102 gene locus_tag LOCUS_05190 18737 19102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 19314 19814 gene locus_tag LOCUS_05200 19314 19814 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027625.1 protein_id gnl|my_center|LOCUS_05200 19937 19861 gene locus_tag LOCUS_t00220 19937 19861 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20007 20756 gene locus_tag LOCUS_05210 20007 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 20772 21986 gene locus_tag LOCUS_05220 20772 21986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 21987 22613 gene locus_tag LOCUS_05230 21987 22613 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785742.1 protein_id gnl|my_center|LOCUS_05230 22626 23219 gene locus_tag LOCUS_05240 22626 23219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 23219 24820 gene locus_tag LOCUS_05250 23219 24820 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_05250 24935 26113 gene locus_tag LOCUS_05260 24935 26113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 26103 27191 gene locus_tag LOCUS_05270 26103 27191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 27279 27572 gene locus_tag LOCUS_05280 27279 27572 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_05280 27562 29601 gene locus_tag LOCUS_05290 27562 29601 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965539.1 protein_id gnl|my_center|LOCUS_05290 29722 29649 gene locus_tag LOCUS_t00230 29722 29649 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 29894 30790 gene locus_tag LOCUS_05300 29894 30790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 30812 31645 gene locus_tag LOCUS_05310 30812 31645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 31688 32233 gene locus_tag LOCUS_05320 31688 32233 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_05320 32248 33012 gene locus_tag LOCUS_05330 32248 33012 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_05330 33027 34112 gene locus_tag LOCUS_05340 33027 34112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 34140 34631 gene locus_tag LOCUS_05350 34140 34631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 34741 36507 gene locus_tag LOCUS_05360 34741 36507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_05360 36500 38218 gene locus_tag LOCUS_05370 36500 38218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_05370 38276 38800 gene locus_tag LOCUS_05380 38276 38800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 38862 39833 gene locus_tag LOCUS_05390 38862 39833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 39814 40626 gene locus_tag LOCUS_05400 39814 40626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 40708 41259 gene locus_tag LOCUS_05410 gene ruvA 40708 41259 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271489.1 protein_id gnl|my_center|LOCUS_05410 41274 42278 gene locus_tag LOCUS_05420 gene ruvB 41274 42278 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_05420 42271 43158 gene locus_tag LOCUS_05430 42271 43158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 43230 44252 gene locus_tag LOCUS_05440 gene queA 43230 44252 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 protein_id gnl|my_center|LOCUS_05440 44309 44428 gene locus_tag LOCUS_05450 44309 44428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 44438 44683 gene locus_tag LOCUS_05460 44438 44683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 44734 45852 gene locus_tag LOCUS_05470 gene tgt 44734 45852 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723534.1 protein_id gnl|my_center|LOCUS_05470 46221 45853 gene locus_tag LOCUS_05480 46221 45853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 46295 46939 gene locus_tag LOCUS_05490 46295 46939 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455123.1 protein_id gnl|my_center|LOCUS_05490 47017 47784 gene locus_tag LOCUS_05500 47017 47784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 47801 49306 gene locus_tag LOCUS_05510 gene lysS 47801 49306 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905307.1 protein_id gnl|my_center|LOCUS_05510 49403 50152 gene locus_tag LOCUS_05520 49403 50152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 50145 50330 gene locus_tag LOCUS_05530 50145 50330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 51580 50327 gene locus_tag LOCUS_05540 gene spoVB 51580 50327 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198280.1 protein_id gnl|my_center|LOCUS_05540 51486 51686 gene locus_tag LOCUS_05550 51486 51686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 51703 52029 gene locus_tag LOCUS_05560 51703 52029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 52143 54317 gene locus_tag LOCUS_05570 gene secDF 52143 54317 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119070.1 protein_id gnl|my_center|LOCUS_05570 54334 56496 gene locus_tag LOCUS_05580 54334 56496 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_05580 56496 56942 gene locus_tag LOCUS_05590 gene dtd 56496 56942 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640695.1 protein_id gnl|my_center|LOCUS_05590 56942 58003 gene locus_tag LOCUS_05600 56942 58003 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793108.1 protein_id gnl|my_center|LOCUS_05600 58402 58956 gene locus_tag LOCUS_05610 58402 58956 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016918.1 protein_id gnl|my_center|LOCUS_05610 59006 60730 gene locus_tag LOCUS_05620 59006 60730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 60820 61056 gene locus_tag LOCUS_05630 60820 61056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 61253 61873 gene locus_tag LOCUS_05640 61253 61873 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_05640 61887 63242 gene locus_tag LOCUS_05650 gene hisS 61887 63242 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590826.1 protein_id gnl|my_center|LOCUS_05650 63235 63798 gene locus_tag LOCUS_05660 63235 63798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 63795 65096 gene locus_tag LOCUS_05670 gene aspS 63795 65096 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_05670 65121 65687 gene locus_tag LOCUS_05680 65121 65687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 65826 66476 gene locus_tag LOCUS_05690 65826 66476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 66804 67439 gene locus_tag LOCUS_05700 66804 67439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 67470 68147 gene locus_tag LOCUS_05710 67470 68147 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 protein_id gnl|my_center|LOCUS_05710 68211 69563 gene locus_tag LOCUS_05720 68211 69563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 70799 69582 gene locus_tag LOCUS_05730 70799 69582 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102729.1 protein_id gnl|my_center|LOCUS_05730 70882 71388 gene locus_tag LOCUS_05740 70882 71388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 71482 71985 gene locus_tag LOCUS_05750 71482 71985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 71990 72874 gene locus_tag LOCUS_05760 gene xerD 71990 72874 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_05760 72962 74830 gene locus_tag LOCUS_05770 72962 74830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 74851 75465 gene locus_tag LOCUS_05780 74851 75465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 75516 76178 gene locus_tag LOCUS_05790 75516 76178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 76330 77229 gene locus_tag LOCUS_05800 76330 77229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 77658 78803 gene locus_tag LOCUS_05810 77658 78803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 78796 79215 gene locus_tag LOCUS_05820 78796 79215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 79297 80058 gene locus_tag LOCUS_05830 gene zupT 79297 80058 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811500.1 protein_id gnl|my_center|LOCUS_05830 80154 81245 gene locus_tag LOCUS_05840 80154 81245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 81249 82061 gene locus_tag LOCUS_05850 81249 82061 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902813.1 protein_id gnl|my_center|LOCUS_05850 82204 83808 gene locus_tag LOCUS_05860 82204 83808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_05860 83808 84371 gene locus_tag LOCUS_05870 83808 84371 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434301.1 protein_id gnl|my_center|LOCUS_05870 84371 84868 gene locus_tag LOCUS_05880 84371 84868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 84973 85374 gene locus_tag LOCUS_05890 84973 85374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 86811 86044 gene locus_tag LOCUS_05900 86811 86044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 87553 86921 gene locus_tag LOCUS_05910 87553 86921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 87649 87792 gene locus_tag LOCUS_05920 87649 87792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 87833 88234 gene locus_tag LOCUS_05930 87833 88234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 88788 88231 gene locus_tag LOCUS_05940 88788 88231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 89838 88849 gene locus_tag LOCUS_05950 gene spoIVB 89838 88849 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_05950 90835 89933 gene locus_tag LOCUS_05960 90835 89933 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_05960 91241 90837 gene locus_tag LOCUS_05970 91241 90837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 91468 91247 gene locus_tag LOCUS_05980 91468 91247 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383143.1 protein_id gnl|my_center|LOCUS_05980 91761 91477 gene locus_tag LOCUS_05990 91761 91477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 93022 91751 gene locus_tag LOCUS_06000 gene xseA 93022 91751 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246103.1 protein_id gnl|my_center|LOCUS_06000 93809 93105 gene locus_tag LOCUS_06010 93809 93105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 93904 94680 gene locus_tag LOCUS_06020 93904 94680 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_06020 95886 95056 gene locus_tag LOCUS_06030 95886 95056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 96481 95909 gene locus_tag LOCUS_06040 96481 95909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 97172 96522 gene locus_tag LOCUS_06050 97172 96522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 97606 97208 gene locus_tag LOCUS_06060 gene nusB 97606 97208 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_06060 98495 97623 gene locus_tag LOCUS_06070 98495 97623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 101060 98505 gene locus_tag LOCUS_06080 gene mutS 101060 98505 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 protein_id gnl|my_center|LOCUS_06080 103559 101124 gene locus_tag LOCUS_06090 103559 101124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 103988 103713 gene locus_tag LOCUS_06100 103988 103713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 103954 104559 gene locus_tag LOCUS_06110 103954 104559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 106358 104556 gene locus_tag LOCUS_06120 106358 104556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 106920 106363 gene locus_tag LOCUS_06130 106920 106363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 107024 108343 gene locus_tag LOCUS_06140 107024 108343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 108945 108364 gene locus_tag LOCUS_06150 108945 108364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 109811 109023 gene locus_tag LOCUS_06160 109811 109023 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861982.1 protein_id gnl|my_center|LOCUS_06160 111681 109828 gene locus_tag LOCUS_06170 111681 109828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 111801 112184 gene locus_tag LOCUS_06180 111801 112184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 112890 112219 gene locus_tag LOCUS_06190 112890 112219 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475993.1 protein_id gnl|my_center|LOCUS_06190 113971 112883 gene locus_tag LOCUS_06200 gene rpoD 113971 112883 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_06200 115710 113971 gene locus_tag LOCUS_06210 gene dnaG 115710 113971 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528223.1 protein_id gnl|my_center|LOCUS_06210 117493 115799 gene locus_tag LOCUS_06220 117493 115799 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_06220 117817 117560 gene locus_tag LOCUS_06230 117817 117560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 120483 117955 gene locus_tag LOCUS_06240 gene valS 120483 117955 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_06240 121228 120485 gene locus_tag LOCUS_06250 121228 120485 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_06250 122558 121524 gene locus_tag LOCUS_06260 122558 121524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 123732 122806 gene locus_tag LOCUS_06270 123732 122806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 124480 123725 gene locus_tag LOCUS_06280 124480 123725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 126863 124530 gene locus_tag LOCUS_06290 gene lon 126863 124530 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 protein_id gnl|my_center|LOCUS_06290 127576 127010 gene locus_tag LOCUS_06300 127576 127010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 128258 127647 gene locus_tag LOCUS_06310 128258 127647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 129563 128298 gene locus_tag LOCUS_06320 gene tig 129563 128298 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105215.1 protein_id gnl|my_center|LOCUS_06320 130855 129662 gene locus_tag LOCUS_06330 130855 129662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 131390 130920 gene locus_tag LOCUS_06340 gene greA 131390 130920 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475971.1 protein_id gnl|my_center|LOCUS_06340 131597 131448 gene locus_tag LOCUS_06350 131597 131448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 132801 131590 gene locus_tag LOCUS_06360 132801 131590 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830748.1 protein_id gnl|my_center|LOCUS_06360 133609 132791 gene locus_tag LOCUS_06370 133609 132791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 134204 133602 gene locus_tag LOCUS_06380 134204 133602 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229800.1 protein_id gnl|my_center|LOCUS_06380 134607 134308 gene locus_tag LOCUS_06390 134607 134308 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 protein_id gnl|my_center|LOCUS_06390 135032 134607 gene locus_tag LOCUS_06400 gene ruvX 135032 134607 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221192.1 protein_id gnl|my_center|LOCUS_06400 135274 135032 gene locus_tag LOCUS_06410 135274 135032 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719797.1 protein_id gnl|my_center|LOCUS_06410 136330 135599 gene locus_tag LOCUS_06420 136330 135599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 137863 136742 gene locus_tag LOCUS_06430 gene mltG 137863 136742 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289159.1 protein_id gnl|my_center|LOCUS_06430 140562 137878 gene locus_tag LOCUS_06440 gene alaS 140562 137878 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811755.1 protein_id gnl|my_center|LOCUS_06440 141117 140563 gene locus_tag LOCUS_06450 141117 140563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 143395 141377 gene locus_tag LOCUS_06460 143395 141377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 145261 143513 gene locus_tag LOCUS_06470 145261 143513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 145906 145346 gene locus_tag LOCUS_06480 145906 145346 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836381.1 protein_id gnl|my_center|LOCUS_06480 147447 145972 gene locus_tag LOCUS_06490 147447 145972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 147746 147582 gene locus_tag LOCUS_06500 147746 147582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 150021 147832 gene locus_tag LOCUS_06510 150021 147832 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283312.1 protein_id gnl|my_center|LOCUS_06510 150238 150071 gene locus_tag LOCUS_06520 150238 150071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 151015 150251 gene locus_tag LOCUS_06530 151015 150251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06530 152387 151098 gene locus_tag LOCUS_06540 gene mtaB 152387 151098 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 protein_id gnl|my_center|LOCUS_06540 153032 152424 gene locus_tag LOCUS_06550 153032 152424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 153742 153038 gene locus_tag LOCUS_06560 153742 153038 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183200.1 protein_id gnl|my_center|LOCUS_06560 154362 153742 gene locus_tag LOCUS_06570 154362 153742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 154527 155537 gene locus_tag LOCUS_06580 154527 155537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 156048 155551 gene locus_tag LOCUS_06590 156048 155551 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962499.1 protein_id gnl|my_center|LOCUS_06590 156958 156056 gene locus_tag LOCUS_06600 156958 156056 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966285.1 protein_id gnl|my_center|LOCUS_06600 158344 157016 gene locus_tag LOCUS_06610 158344 157016 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_06610 159386 158430 gene locus_tag LOCUS_06620 159386 158430 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016192.1 protein_id gnl|my_center|LOCUS_06620 160299 159784 gene locus_tag LOCUS_06630 160299 159784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 162139 160592 gene locus_tag LOCUS_06640 gene metG 162139 160592 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_06640 162575 162132 gene locus_tag LOCUS_06650 162575 162132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 162747 162580 gene locus_tag LOCUS_06660 162747 162580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 165386 163056 gene locus_tag LOCUS_06670 165386 163056 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_06670 167738 165474 gene locus_tag LOCUS_06680 167738 165474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 169024 167894 gene locus_tag LOCUS_06690 gene dnaJ 169024 167894 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043938.1 protein_id gnl|my_center|LOCUS_06690 170842 169037 gene locus_tag LOCUS_06700 gene pepF 170842 169037 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 protein_id gnl|my_center|LOCUS_06700 172727 170907 gene locus_tag LOCUS_06710 gene dnaK 172727 170907 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905652.1 protein_id gnl|my_center|LOCUS_06710 173240 172731 gene locus_tag LOCUS_06720 173240 172731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 173797 173240 gene locus_tag LOCUS_06730 gene grpE 173797 173240 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454752.1 protein_id gnl|my_center|LOCUS_06730 174791 173799 gene locus_tag LOCUS_06740 gene hrcA 174791 173799 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_06740 175290 174925 gene locus_tag LOCUS_06750 175290 174925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 176433 175330 gene locus_tag LOCUS_06760 gene hemW 176433 175330 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027377.1 protein_id gnl|my_center|LOCUS_06760 176774 176433 gene locus_tag LOCUS_06770 176774 176433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 178586 176790 gene locus_tag LOCUS_06780 gene lepA 178586 176790 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_06780 179385 178693 gene locus_tag LOCUS_06790 179385 178693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 180381 179404 gene locus_tag LOCUS_06800 gene trpS 180381 179404 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084322456.1 protein_id gnl|my_center|LOCUS_06800 181193 180735 gene locus_tag LOCUS_06810 181193 180735 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927248.1 protein_id gnl|my_center|LOCUS_06810 181588 181262 gene locus_tag LOCUS_06820 181588 181262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 182496 181585 gene locus_tag LOCUS_06830 182496 181585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 183241 182555 gene locus_tag LOCUS_06840 183241 182555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 184880 183297 gene locus_tag LOCUS_06850 184880 183297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 186031 185300 gene locus_tag LOCUS_06860 186031 185300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence04 <1 1904 gene locus_tag LOCUS_06870 <1 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase 2281 3141 gene locus_tag LOCUS_06880 2281 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3233 3982 gene locus_tag LOCUS_06890 3233 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 4054 6921 gene locus_tag LOCUS_06900 gene addB 4054 6921 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861078.1 protein_id gnl|my_center|LOCUS_06900 6914 10339 gene locus_tag LOCUS_06910 gene addA 6914 10339 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948198.1 protein_id gnl|my_center|LOCUS_06910 10351 11589 gene locus_tag LOCUS_06920 10351 11589 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468313.1 protein_id gnl|my_center|LOCUS_06920 11582 12421 gene locus_tag LOCUS_06930 gene folD 11582 12421 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 protein_id gnl|my_center|LOCUS_06930 12424 12702 gene locus_tag LOCUS_06940 12424 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 12937 14871 gene locus_tag LOCUS_06950 12937 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 14956 17124 gene locus_tag LOCUS_06960 gene priA 14956 17124 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666718.1 protein_id gnl|my_center|LOCUS_06960 17319 17450 gene locus_tag LOCUS_06970 17319 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 17527 17973 gene locus_tag LOCUS_06980 17527 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 18174 19166 gene locus_tag LOCUS_06990 gene rpsB 18174 19166 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832557.1 protein_id gnl|my_center|LOCUS_06990 19224 20096 gene locus_tag LOCUS_07000 gene tsf 19224 20096 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356760.1 protein_id gnl|my_center|LOCUS_07000 20099 20686 gene locus_tag LOCUS_07010 20099 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 20778 22037 gene locus_tag LOCUS_07020 20778 22037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 22214 22759 gene locus_tag LOCUS_07030 gene frr 22214 22759 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_07030 22830 23492 gene locus_tag LOCUS_07040 22830 23492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 23603 24910 gene locus_tag LOCUS_07050 23603 24910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 25887 24940 gene locus_tag LOCUS_07060 25887 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 26227 27276 gene locus_tag LOCUS_07070 gene pheS 26227 27276 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830082.1 protein_id gnl|my_center|LOCUS_07070 27276 29645 gene locus_tag LOCUS_07080 gene pheT 27276 29645 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498183.1 protein_id gnl|my_center|LOCUS_07080 29851 29642 gene locus_tag LOCUS_07090 gene sspI 29851 29642 CDS product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 protein_id gnl|my_center|LOCUS_07090 29960 30625 gene locus_tag LOCUS_07100 29960 30625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 30720 33299 gene locus_tag LOCUS_07110 gene polA 30720 33299 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 protein_id gnl|my_center|LOCUS_07110 33318 34127 gene locus_tag LOCUS_07120 gene mutM 33318 34127 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114480.1 protein_id gnl|my_center|LOCUS_07120 34200 34346 gene locus_tag LOCUS_07130 34200 34346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 34463 34888 gene locus_tag LOCUS_07140 34463 34888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 34977 35053 gene locus_tag LOCUS_t00240 34977 35053 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 35059 35143 gene locus_tag LOCUS_t00250 35059 35143 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35295 36050 gene locus_tag LOCUS_07150 35295 36050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 36121 36918 gene locus_tag LOCUS_07160 36121 36918 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 protein_id gnl|my_center|LOCUS_07160 36995 38845 gene locus_tag LOCUS_07170 36995 38845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 38842 39540 gene locus_tag LOCUS_07180 38842 39540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 39628 40161 gene locus_tag LOCUS_07190 39628 40161 CDS product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859193.1 protein_id gnl|my_center|LOCUS_07190 40172 40900 gene locus_tag LOCUS_07200 40172 40900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 40897 42090 gene locus_tag LOCUS_07210 40897 42090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 42087 42695 gene locus_tag LOCUS_07220 42087 42695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 42695 43591 gene locus_tag LOCUS_07230 42695 43591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 43664 44764 gene locus_tag LOCUS_07240 43664 44764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 44776 45105 gene locus_tag LOCUS_07250 44776 45105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 45179 45255 gene locus_tag LOCUS_t00260 45179 45255 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 45322 45397 gene locus_tag LOCUS_t00270 45322 45397 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 45513 45830 gene locus_tag LOCUS_07260 45513 45830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 45870 46469 gene locus_tag LOCUS_07270 45870 46469 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_07270 46528 47073 gene locus_tag LOCUS_07280 46528 47073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 47075 47539 gene locus_tag LOCUS_07290 47075 47539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 47625 49787 gene locus_tag LOCUS_07300 47625 49787 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370122.1 protein_id gnl|my_center|LOCUS_07300 50372 49794 gene locus_tag LOCUS_07310 50372 49794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 50534 50866 gene locus_tag LOCUS_07320 50534 50866 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889116.1 protein_id gnl|my_center|LOCUS_07320 50859 52289 gene locus_tag LOCUS_07330 50859 52289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 52363 52863 gene locus_tag LOCUS_07340 52363 52863 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166592.1 protein_id gnl|my_center|LOCUS_07340 52860 53651 gene locus_tag LOCUS_07350 52860 53651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 53654 53989 gene locus_tag LOCUS_07360 53654 53989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 54075 55043 gene locus_tag LOCUS_07370 54075 55043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 55085 56134 gene locus_tag LOCUS_07380 gene mnmA 55085 56134 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830892.1 protein_id gnl|my_center|LOCUS_07380 56632 57192 gene locus_tag LOCUS_07390 56632 57192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 57715 57218 gene locus_tag LOCUS_07400 57715 57218 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_07400 57801 58514 gene locus_tag LOCUS_07410 57801 58514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 58537 59142 gene locus_tag LOCUS_07420 gene phoE 58537 59142 CDS product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 protein_id gnl|my_center|LOCUS_07420 59126 59650 gene locus_tag LOCUS_07430 59126 59650 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_07430 59670 60056 gene locus_tag LOCUS_07440 59670 60056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 60836 60090 gene locus_tag LOCUS_07450 60836 60090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 60939 61616 gene locus_tag LOCUS_07460 60939 61616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 61698 61973 gene locus_tag LOCUS_07470 61698 61973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 62142 62468 gene locus_tag LOCUS_07480 62142 62468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 62544 63146 gene locus_tag LOCUS_07490 62544 63146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 63166 64077 gene locus_tag LOCUS_07500 63166 64077 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931418.1 protein_id gnl|my_center|LOCUS_07500 64175 64438 gene locus_tag LOCUS_07510 64175 64438 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067116.1 protein_id gnl|my_center|LOCUS_07510 64541 65398 gene locus_tag LOCUS_07520 64541 65398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 65434 66348 gene locus_tag LOCUS_07530 65434 66348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 66449 67627 gene locus_tag LOCUS_07540 66449 67627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 67624 68061 gene locus_tag LOCUS_07550 67624 68061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 68124 68285 gene locus_tag LOCUS_07560 68124 68285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 69375 68305 gene locus_tag LOCUS_07570 69375 68305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 69804 70142 gene locus_tag LOCUS_07580 69804 70142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 70164 70952 gene locus_tag LOCUS_07590 70164 70952 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_07590 70972 71907 gene locus_tag LOCUS_07600 70972 71907 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_07600 71911 72369 gene locus_tag LOCUS_07610 71911 72369 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_07610 72407 72745 gene locus_tag LOCUS_07620 72407 72745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 72797 73024 gene locus_tag LOCUS_07630 72797 73024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 73512 73439 gene locus_tag LOCUS_t00280 73512 73439 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 73682 74707 gene locus_tag LOCUS_07640 73682 74707 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_07640 74782 75297 gene locus_tag LOCUS_07650 74782 75297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 75306 75872 gene locus_tag LOCUS_07660 75306 75872 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948863.1 protein_id gnl|my_center|LOCUS_07660 76425 75973 gene locus_tag LOCUS_07670 76425 75973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 77919 76483 gene locus_tag LOCUS_07680 gene proS 77919 76483 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_07680 78448 77933 gene locus_tag LOCUS_07690 78448 77933 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_07690 78613 79320 gene locus_tag LOCUS_07700 78613 79320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 79377 80747 gene locus_tag LOCUS_07710 79377 80747 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965427.1 protein_id gnl|my_center|LOCUS_07710 81457 80744 gene locus_tag LOCUS_07720 gene pflA 81457 80744 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_07720 81546 82181 gene locus_tag LOCUS_07730 81546 82181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 82256 82570 gene locus_tag LOCUS_07740 82256 82570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07740 82540 83145 gene locus_tag LOCUS_07750 82540 83145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 84412 83156 gene locus_tag LOCUS_07760 84412 83156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 86740 84506 gene locus_tag LOCUS_07770 gene pflB 86740 84506 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964298.1 protein_id gnl|my_center|LOCUS_07770 89178 86845 gene locus_tag LOCUS_07780 89178 86845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263841.1 protein_id gnl|my_center|LOCUS_07780 89903 89175 gene locus_tag LOCUS_07790 89903 89175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994591.1 protein_id gnl|my_center|LOCUS_07790 90038 91990 gene locus_tag LOCUS_07800 90038 91990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 92134 92421 gene locus_tag LOCUS_07810 92134 92421 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369771.1 protein_id gnl|my_center|LOCUS_07810 93225 93473 gene locus_tag LOCUS_07820 93225 93473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 93490 93768 gene locus_tag LOCUS_07830 93490 93768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 93787 94080 gene locus_tag LOCUS_07840 93787 94080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 94159 94449 gene locus_tag LOCUS_07850 94159 94449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 94463 94759 gene locus_tag LOCUS_07860 94463 94759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 94773 95288 gene locus_tag LOCUS_07870 94773 95288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 95301 95612 gene locus_tag LOCUS_07880 95301 95612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 95641 99336 gene locus_tag LOCUS_07890 95641 99336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 99363 100568 gene locus_tag LOCUS_07900 99363 100568 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_07900 100597 105252 gene locus_tag LOCUS_07910 gene essC 100597 105252 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963368.1 protein_id gnl|my_center|LOCUS_07910 105337 105795 gene locus_tag LOCUS_07920 105337 105795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 105788 106315 gene locus_tag LOCUS_07930 gene trmL 105788 106315 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_07930 106848 107144 gene locus_tag LOCUS_07940 106848 107144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07940 107556 107798 gene locus_tag LOCUS_07950 107556 107798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 108695 107823 gene locus_tag LOCUS_07960 108695 107823 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733831.1 protein_id gnl|my_center|LOCUS_07960 108918 108685 gene locus_tag LOCUS_07970 gene yidD 108918 108685 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_07970 109070 109537 gene locus_tag LOCUS_07980 gene mraZ 109070 109537 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_07980 109538 110464 gene locus_tag LOCUS_07990 gene rsmH 109538 110464 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355891.1 protein_id gnl|my_center|LOCUS_07990 110466 110747 gene locus_tag LOCUS_08000 110466 110747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 110761 112884 gene locus_tag LOCUS_08010 gene pbpB 110761 112884 CDS product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 protein_id gnl|my_center|LOCUS_08010 113054 113560 gene locus_tag LOCUS_08020 113054 113560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 113578 113781 gene locus_tag LOCUS_08030 113578 113781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 113875 116007 gene locus_tag LOCUS_08040 113875 116007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 116257 116946 gene locus_tag LOCUS_08050 116257 116946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 116965 117642 gene locus_tag LOCUS_08060 116965 117642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 117769 118131 gene locus_tag LOCUS_08070 117769 118131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 118154 119770 gene locus_tag LOCUS_08080 118154 119770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 119787 121661 gene locus_tag LOCUS_08090 119787 121661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 121677 123527 gene locus_tag LOCUS_08100 121677 123527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 123561 124007 gene locus_tag LOCUS_08110 123561 124007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 124374 126659 gene locus_tag LOCUS_08120 124374 126659 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948591.1 protein_id gnl|my_center|LOCUS_08120 126785 127312 gene locus_tag LOCUS_08130 gene lepB 126785 127312 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662493.1 protein_id gnl|my_center|LOCUS_08130 127432 131163 gene locus_tag LOCUS_08140 127432 131163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 131254 131649 gene locus_tag LOCUS_08150 131254 131649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 131649 132044 gene locus_tag LOCUS_08160 131649 132044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 132138 133532 gene locus_tag LOCUS_08170 gene pyk 132138 133532 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830831.1 protein_id gnl|my_center|LOCUS_08170 133635 134153 gene locus_tag LOCUS_08180 133635 134153 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_08180 134168 134737 gene locus_tag LOCUS_08190 134168 134737 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_08190 134810 135823 gene locus_tag LOCUS_08200 134810 135823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 135899 136453 gene locus_tag LOCUS_08210 135899 136453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 136434 137339 gene locus_tag LOCUS_08220 136434 137339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 137346 137591 gene locus_tag LOCUS_08230 137346 137591 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438776.1 protein_id gnl|my_center|LOCUS_08230 138091 138753 gene locus_tag LOCUS_08240 138091 138753 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_08240 138750 139769 gene locus_tag LOCUS_08250 138750 139769 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_08250 139858 140625 gene locus_tag LOCUS_08260 139858 140625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_08260 140615 142666 gene locus_tag LOCUS_08270 140615 142666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_08270 142784 143962 gene locus_tag LOCUS_08280 142784 143962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 144238 145077 gene locus_tag LOCUS_08290 gene dinD 144238 145077 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005016674.1 protein_id gnl|my_center|LOCUS_08290 145106 145750 gene locus_tag LOCUS_08300 145106 145750 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 protein_id gnl|my_center|LOCUS_08300 145785 146195 gene locus_tag LOCUS_08310 145785 146195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 146282 147376 gene locus_tag LOCUS_08320 146282 147376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 147460 148260 gene locus_tag LOCUS_08330 147460 148260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 148313 148588 gene locus_tag LOCUS_08340 148313 148588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence05 1285 68 gene locus_tag LOCUS_08350 1285 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2969 1386 gene locus_tag LOCUS_08360 2969 1386 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986363.1 protein_id gnl|my_center|LOCUS_08360 3301 3053 gene locus_tag LOCUS_08370 3301 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 5529 3502 gene locus_tag LOCUS_08380 gene helD 5529 3502 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948433.1 protein_id gnl|my_center|LOCUS_08380 6172 5846 gene locus_tag LOCUS_08390 6172 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6801 6262 gene locus_tag LOCUS_08400 gene cysE 6801 6262 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964006.1 protein_id gnl|my_center|LOCUS_08400 8640 7144 gene locus_tag LOCUS_08410 8640 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 9800 8760 gene locus_tag LOCUS_08420 9800 8760 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_08420 9933 10673 gene locus_tag LOCUS_08430 9933 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 10730 10820 gene locus_tag LOCUS_t00290 10730 10820 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10926 11084 gene locus_tag LOCUS_08440 10926 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 11773 11150 gene locus_tag LOCUS_08450 11773 11150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 13129 11912 gene locus_tag LOCUS_08460 13129 11912 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_08460 14736 13144 gene locus_tag LOCUS_08470 14736 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 15474 14749 gene locus_tag LOCUS_08480 15474 14749 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_08480 16761 15619 gene locus_tag LOCUS_08490 gene ftsW 16761 15619 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787940.1 protein_id gnl|my_center|LOCUS_08490 16880 17062 gene locus_tag LOCUS_08500 16880 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 17121 17669 gene locus_tag LOCUS_08510 gene def 17121 17669 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957056.1 protein_id gnl|my_center|LOCUS_08510 18173 17733 gene locus_tag LOCUS_08520 18173 17733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 18854 18246 gene locus_tag LOCUS_08530 18854 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 21803 18855 gene locus_tag LOCUS_08540 21803 18855 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183129.1 protein_id gnl|my_center|LOCUS_08540 22484 21822 gene locus_tag LOCUS_08550 gene rncS 22484 21822 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_08550 24260 22590 gene locus_tag LOCUS_08560 24260 22590 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048375.1 protein_id gnl|my_center|LOCUS_08560 24887 24303 gene locus_tag LOCUS_08570 24887 24303 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678795.1 protein_id gnl|my_center|LOCUS_08570 27754 24884 gene locus_tag LOCUS_08580 27754 24884 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485290.1 protein_id gnl|my_center|LOCUS_08580 27880 28053 gene locus_tag LOCUS_08590 27880 28053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 29914 28214 gene locus_tag LOCUS_08600 29914 28214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 30445 29984 gene locus_tag LOCUS_08610 30445 29984 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389647.1 protein_id gnl|my_center|LOCUS_08610 30962 30447 gene locus_tag LOCUS_08620 gene nrdG 30962 30447 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_08620 33160 30965 gene locus_tag LOCUS_08630 gene nrdD 33160 30965 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187799.1 protein_id gnl|my_center|LOCUS_08630 33279 33908 gene locus_tag LOCUS_08640 33279 33908 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_08640 35280 33913 gene locus_tag LOCUS_08650 35280 33913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 35882 35358 gene locus_tag LOCUS_08660 35882 35358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 38668 36071 gene locus_tag LOCUS_08670 38668 36071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 38937 38665 gene locus_tag LOCUS_08680 38937 38665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 40757 38988 gene locus_tag LOCUS_08690 gene thrS 40757 38988 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830850.1 protein_id gnl|my_center|LOCUS_08690 41533 40760 gene locus_tag LOCUS_08700 41533 40760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 42720 41797 gene locus_tag LOCUS_08710 gene dnaI 42720 41797 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_08710 43625 42840 gene locus_tag LOCUS_08720 43625 42840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 44932 43637 gene locus_tag LOCUS_08730 gene dnaB 44932 43637 CDS product replication initiation membrane attachment protein DnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229464.1 protein_id gnl|my_center|LOCUS_08730 45049 45978 gene locus_tag LOCUS_08740 45049 45978 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_08740 46285 45989 gene locus_tag LOCUS_08750 46285 45989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 47477 46446 gene locus_tag LOCUS_08760 47477 46446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 47743 47489 gene locus_tag LOCUS_08770 47743 47489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 48274 47861 gene locus_tag LOCUS_08780 48274 47861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 49169 48285 gene locus_tag LOCUS_08790 49169 48285 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_08790 49529 49188 gene locus_tag LOCUS_08800 49529 49188 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242740.1 protein_id gnl|my_center|LOCUS_08800 50242 49622 gene locus_tag LOCUS_08810 50242 49622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 51041 50337 gene locus_tag LOCUS_08820 51041 50337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 51818 51063 gene locus_tag LOCUS_08830 gene map 51818 51063 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_08830 51914 52906 gene locus_tag LOCUS_08840 51914 52906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 53834 52947 gene locus_tag LOCUS_08850 53834 52947 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837699.1 protein_id gnl|my_center|LOCUS_08850 54459 53824 gene locus_tag LOCUS_08860 54459 53824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 55190 54552 gene locus_tag LOCUS_08870 55190 54552 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_08870 55750 55316 gene locus_tag LOCUS_08880 55750 55316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 56164 55916 gene locus_tag LOCUS_08890 56164 55916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 57077 56157 gene locus_tag LOCUS_08900 57077 56157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 58011 57157 gene locus_tag LOCUS_08910 58011 57157 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194812347.1 protein_id gnl|my_center|LOCUS_08910 58787 58272 gene locus_tag LOCUS_08920 58787 58272 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897047.1 protein_id gnl|my_center|LOCUS_08920 59301 58882 gene locus_tag LOCUS_08930 59301 58882 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_08930 59498 59331 gene locus_tag LOCUS_08940 59498 59331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 59839 59636 gene locus_tag LOCUS_08950 59839 59636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_08950 61432 59930 gene locus_tag LOCUS_08960 61432 59930 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_08960 61705 61565 gene locus_tag LOCUS_08970 61705 61565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 62850 61702 gene locus_tag LOCUS_08980 62850 61702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966214.1 protein_id gnl|my_center|LOCUS_08980 64021 62837 gene locus_tag LOCUS_08990 64021 62837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294551.1 protein_id gnl|my_center|LOCUS_08990 64959 64021 gene locus_tag LOCUS_09000 64959 64021 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681918.1 protein_id gnl|my_center|LOCUS_09000 65436 64996 gene locus_tag LOCUS_09010 65436 64996 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816860.1 protein_id gnl|my_center|LOCUS_09010 65742 65560 gene locus_tag LOCUS_09020 65742 65560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 66372 65785 gene locus_tag LOCUS_09030 66372 65785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 66931 66569 gene locus_tag LOCUS_09040 66931 66569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 67680 67519 gene locus_tag LOCUS_09050 67680 67519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 67970 67701 gene locus_tag LOCUS_09060 67970 67701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 68811 67963 gene locus_tag LOCUS_09070 68811 67963 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_09070 70844 69033 gene locus_tag LOCUS_09080 gene glmS 70844 69033 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_09080 71152 71343 gene locus_tag LOCUS_09090 71152 71343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 71336 71584 gene locus_tag LOCUS_09100 71336 71584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 72415 71621 gene locus_tag LOCUS_09110 72415 71621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016724.1 protein_id gnl|my_center|LOCUS_09110 73190 72399 gene locus_tag LOCUS_09120 73190 72399 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774940.1 protein_id gnl|my_center|LOCUS_09120 74173 73190 gene locus_tag LOCUS_09130 74173 73190 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 protein_id gnl|my_center|LOCUS_09130 74520 74191 gene locus_tag LOCUS_09140 74520 74191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09140 74714 74511 gene locus_tag LOCUS_09150 74714 74511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 75326 74742 gene locus_tag LOCUS_09160 75326 74742 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 protein_id gnl|my_center|LOCUS_09160 75935 75342 gene locus_tag LOCUS_09170 75935 75342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 76531 75953 gene locus_tag LOCUS_09180 76531 75953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 77027 76545 gene locus_tag LOCUS_09190 77027 76545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 77818 77030 gene locus_tag LOCUS_09200 77818 77030 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_09200 78441 77992 gene locus_tag LOCUS_09210 78441 77992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 79626 78682 gene locus_tag LOCUS_09220 79626 78682 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_09220 80787 79936 gene locus_tag LOCUS_09230 80787 79936 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194812347.1 protein_id gnl|my_center|LOCUS_09230 82857 80980 gene locus_tag LOCUS_09240 82857 80980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 84841 82919 gene locus_tag LOCUS_09250 gene recG 84841 82919 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000816.1 protein_id gnl|my_center|LOCUS_09250 85137 86585 gene locus_tag LOCUS_09260 gene gerKA 85137 86585 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_09260 86569 87771 gene locus_tag LOCUS_09270 86569 87771 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832881.1 protein_id gnl|my_center|LOCUS_09270 87764 88864 gene locus_tag LOCUS_09280 87764 88864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 89291 88875 gene locus_tag LOCUS_09290 89291 88875 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964672.1 protein_id gnl|my_center|LOCUS_09290 89759 89328 gene locus_tag LOCUS_09300 89759 89328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 90622 89783 gene locus_tag LOCUS_09310 90622 89783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 91530 90631 gene locus_tag LOCUS_09320 91530 90631 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289478.1 protein_id gnl|my_center|LOCUS_09320 92426 91680 gene locus_tag LOCUS_09330 gene fabG 92426 91680 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_09330 93360 92416 gene locus_tag LOCUS_09340 93360 92416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 93534 93608 gene locus_tag LOCUS_t00300 93534 93608 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 93619 93693 gene locus_tag LOCUS_t00310 93619 93693 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 93775 95346 gene locus_tag LOCUS_09350 93775 95346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 95862 95743 gene locus_tag LOCUS_09360 95862 95743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 96324 95899 gene locus_tag LOCUS_09370 96324 95899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 96813 96373 gene locus_tag LOCUS_09380 96813 96373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 97457 96816 gene locus_tag LOCUS_09390 97457 96816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 98623 97514 gene locus_tag LOCUS_09400 98623 97514 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_09400 99383 98802 gene locus_tag LOCUS_09410 99383 98802 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_09410 100247 99423 gene locus_tag LOCUS_09420 100247 99423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 102905 100293 gene locus_tag LOCUS_09430 102905 100293 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_09430 104244 102994 gene locus_tag LOCUS_09440 104244 102994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 105620 104259 gene locus_tag LOCUS_09450 105620 104259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence06 722 27 gene locus_tag LOCUS_09460 722 27 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_09460 1088 729 gene locus_tag LOCUS_09470 1088 729 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430051.1 protein_id gnl|my_center|LOCUS_09470 1638 1207 gene locus_tag LOCUS_09480 1638 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2241 1744 gene locus_tag LOCUS_09490 2241 1744 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_09490 2560 2264 gene locus_tag LOCUS_09500 2560 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09500 3168 2791 gene locus_tag LOCUS_09510 3168 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3624 3220 gene locus_tag LOCUS_09520 3624 3220 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540524.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09520 4028 3777 gene locus_tag LOCUS_09530 4028 3777 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_09530 4660 4043 gene locus_tag LOCUS_09540 4660 4043 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016912.1 protein_id gnl|my_center|LOCUS_09540 5480 4713 gene locus_tag LOCUS_09550 5480 4713 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_09550 7903 5597 gene locus_tag LOCUS_09560 7903 5597 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_09560 8288 7971 gene locus_tag LOCUS_09570 8288 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 9476 8307 gene locus_tag LOCUS_09580 9476 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 11363 9570 gene locus_tag LOCUS_09590 11363 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 12783 11437 gene locus_tag LOCUS_09600 12783 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 13292 12900 gene locus_tag LOCUS_09610 13292 12900 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948529.1 protein_id gnl|my_center|LOCUS_09610 15112 13364 gene locus_tag LOCUS_09620 gene msbA 15112 13364 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649789.1 protein_id gnl|my_center|LOCUS_09620 15608 15132 gene locus_tag LOCUS_09630 15608 15132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 16206 15718 gene locus_tag LOCUS_09640 16206 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 19073 16449 gene locus_tag LOCUS_09650 19073 16449 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_09650 19944 19075 gene locus_tag LOCUS_09660 gene mneP 19944 19075 CDS product manganese transporter MneP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244477.1 protein_id gnl|my_center|LOCUS_09660 20852 20010 gene locus_tag LOCUS_09670 20852 20010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 21307 20855 gene locus_tag LOCUS_09680 21307 20855 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808679.1 protein_id gnl|my_center|LOCUS_09680 22062 21304 gene locus_tag LOCUS_09690 22062 21304 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_09690 22770 22186 gene locus_tag LOCUS_09700 22770 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 24344 22824 gene locus_tag LOCUS_09710 gene gpmI 24344 22824 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_09710 25301 24450 gene locus_tag LOCUS_09720 25301 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 25418 25924 gene locus_tag LOCUS_09730 25418 25924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 25950 26735 gene locus_tag LOCUS_09740 25950 26735 CDS product collagen-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195845.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09740 26744 27835 gene locus_tag LOCUS_09750 26744 27835 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_09750 28463 27843 gene locus_tag LOCUS_09760 28463 27843 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_09760 29090 28464 gene locus_tag LOCUS_09770 29090 28464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 29164 29895 gene locus_tag LOCUS_09780 gene murI 29164 29895 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_09780 30692 30246 gene locus_tag LOCUS_09790 30692 30246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 30867 30613 gene locus_tag LOCUS_09800 30867 30613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 32884 30923 gene locus_tag LOCUS_09810 32884 30923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 33549 32992 gene locus_tag LOCUS_09820 33549 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 34208 33666 gene locus_tag LOCUS_09830 34208 33666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 34789 34223 gene locus_tag LOCUS_09840 34789 34223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 35979 35023 gene locus_tag LOCUS_09850 35979 35023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 37532 36372 gene locus_tag LOCUS_09860 37532 36372 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_09860 38215 37538 gene locus_tag LOCUS_09870 38215 37538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 38974 38231 gene locus_tag LOCUS_09880 38974 38231 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949043.1 protein_id gnl|my_center|LOCUS_09880 39202 38990 gene locus_tag LOCUS_09890 39202 38990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 39357 39229 gene locus_tag LOCUS_09900 39357 39229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 40097 39375 gene locus_tag LOCUS_09910 40097 39375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 40915 40127 gene locus_tag LOCUS_09920 40915 40127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 42607 41021 gene locus_tag LOCUS_09930 42607 41021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 47778 42604 gene locus_tag LOCUS_09940 47778 42604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 47982 49181 gene locus_tag LOCUS_09950 47982 49181 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_09950 49198 49995 gene locus_tag LOCUS_09960 49198 49995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 51024 50029 gene locus_tag LOCUS_09970 51024 50029 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_09970 52186 51071 gene locus_tag LOCUS_09980 52186 51071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 52380 53201 gene locus_tag LOCUS_09990 52380 53201 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965083.1 protein_id gnl|my_center|LOCUS_09990 53215 53952 gene locus_tag LOCUS_10000 53215 53952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 53990 54742 gene locus_tag LOCUS_10010 53990 54742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 55338 54754 gene locus_tag LOCUS_10020 55338 54754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 55584 55357 gene locus_tag LOCUS_10030 55584 55357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 56018 55638 gene locus_tag LOCUS_10040 56018 55638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 56166 56091 gene locus_tag LOCUS_t00320 56166 56091 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 56483 56304 gene locus_tag LOCUS_10050 56483 56304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 57808 56615 gene locus_tag LOCUS_10060 57808 56615 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_10060 58566 57856 gene locus_tag LOCUS_10070 58566 57856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 59741 58893 gene locus_tag LOCUS_10080 gene rsmI 59741 58893 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583798.1 protein_id gnl|my_center|LOCUS_10080 60148 59756 gene locus_tag LOCUS_10090 60148 59756 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 protein_id gnl|my_center|LOCUS_10090 61308 60166 gene locus_tag LOCUS_10100 61308 60166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 61693 61400 gene locus_tag LOCUS_10110 61693 61400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 63960 61855 gene locus_tag LOCUS_10120 gene clpB 63960 61855 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288348.1 protein_id gnl|my_center|LOCUS_10120 64661 64101 gene locus_tag LOCUS_10130 64661 64101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 64812 65159 gene locus_tag LOCUS_10140 64812 65159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10140 66660 65635 gene locus_tag LOCUS_10150 66660 65635 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112551.1 protein_id gnl|my_center|LOCUS_10150 66736 67440 gene locus_tag LOCUS_10160 66736 67440 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094941.1 protein_id gnl|my_center|LOCUS_10160 67506 68333 gene locus_tag LOCUS_10170 67506 68333 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986511.1 protein_id gnl|my_center|LOCUS_10170 68853 68350 gene locus_tag LOCUS_10180 68853 68350 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439611.1 protein_id gnl|my_center|LOCUS_10180 69119 69192 gene locus_tag LOCUS_t00330 69119 69192 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 69374 70408 gene locus_tag LOCUS_10190 69374 70408 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583874.1 protein_id gnl|my_center|LOCUS_10190 70398 70571 gene locus_tag LOCUS_10200 70398 70571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 71587 71036 gene locus_tag LOCUS_10210 71587 71036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 72048 71605 gene locus_tag LOCUS_10220 72048 71605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 72303 73166 gene locus_tag LOCUS_10230 72303 73166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 73220 74278 gene locus_tag LOCUS_10240 73220 74278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 74479 75675 gene locus_tag LOCUS_10250 74479 75675 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_10250 76131 77165 gene locus_tag LOCUS_10260 76131 77165 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583874.1 protein_id gnl|my_center|LOCUS_10260 77155 77328 gene locus_tag LOCUS_10270 77155 77328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 78233 77796 gene locus_tag LOCUS_10280 78233 77796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 78597 78268 gene locus_tag LOCUS_10290 78597 78268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 79162 78602 gene locus_tag LOCUS_10300 79162 78602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 79387 80118 gene locus_tag LOCUS_10310 79387 80118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 80115 80324 gene locus_tag LOCUS_10320 80115 80324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 80321 82027 gene locus_tag LOCUS_10330 80321 82027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 82687 83631 gene locus_tag LOCUS_10340 82687 83631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 85122 83911 gene locus_tag LOCUS_10350 85122 83911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 85327 85112 gene locus_tag LOCUS_10360 85327 85112 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 protein_id gnl|my_center|LOCUS_10360 85789 85337 gene locus_tag LOCUS_10370 85789 85337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 85935 86741 gene locus_tag LOCUS_10380 85935 86741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 86907 88514 gene locus_tag LOCUS_10390 gene pyrG 86907 88514 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_10390 91808 88545 gene locus_tag LOCUS_10400 91808 88545 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964141.1 protein_id gnl|my_center|LOCUS_10400 92511 91810 gene locus_tag LOCUS_10410 92511 91810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_10410 93058 92594 gene locus_tag LOCUS_10420 93058 92594 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_10420 93791 93096 gene locus_tag LOCUS_10430 93791 93096 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421518.1 protein_id gnl|my_center|LOCUS_10430 93858 95060 gene locus_tag LOCUS_10440 93858 95060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 95093 95224 gene locus_tag LOCUS_10450 95093 95224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 95286 95711 gene locus_tag LOCUS_10460 gene cwlJ 95286 95711 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538153.1 protein_id gnl|my_center|LOCUS_10460 96907 95741 gene locus_tag LOCUS_10470 96907 95741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 97381 96983 gene locus_tag LOCUS_10480 97381 96983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 <99000 97412 gene locus_tag LOCUS_10490 <99000 97412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775553.1:recombinase family protein >Feature sequence07 997 104 gene locus_tag LOCUS_10500 997 104 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700854.1 protein_id gnl|my_center|LOCUS_10500 2133 1006 gene locus_tag LOCUS_10510 2133 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2737 2258 gene locus_tag LOCUS_10520 2737 2258 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_10520 3207 2737 gene locus_tag LOCUS_10530 3207 2737 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_10530 3814 3275 gene locus_tag LOCUS_10540 3814 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 4761 3838 gene locus_tag LOCUS_10550 4761 3838 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_10550 5713 4775 gene locus_tag LOCUS_10560 5713 4775 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_10560 7346 5802 gene locus_tag LOCUS_10570 7346 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 9148 7358 gene locus_tag LOCUS_10580 9148 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9367 10992 gene locus_tag LOCUS_10590 9367 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 11768 12304 gene locus_tag LOCUS_10600 11768 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 13446 12301 gene locus_tag LOCUS_10610 13446 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 14404 13433 gene locus_tag LOCUS_10620 14404 13433 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_10620 16611 14392 gene locus_tag LOCUS_10630 16611 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 17902 16634 gene locus_tag LOCUS_10640 17902 16634 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628931.1 protein_id gnl|my_center|LOCUS_10640 19297 17915 gene locus_tag LOCUS_10650 19297 17915 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191652.1 protein_id gnl|my_center|LOCUS_10650 20050 19388 gene locus_tag LOCUS_10660 20050 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 22097 20037 gene locus_tag LOCUS_10670 22097 20037 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986153.1 protein_id gnl|my_center|LOCUS_10670 23056 22214 gene locus_tag LOCUS_10680 23056 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 25122 23059 gene locus_tag LOCUS_10690 25122 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 25604 25134 gene locus_tag LOCUS_10700 25604 25134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 26961 25825 gene locus_tag LOCUS_10710 gene tnpB 26961 25825 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861290.1 protein_id gnl|my_center|LOCUS_10710 29096 27117 gene locus_tag LOCUS_10720 gene ligA 29096 27117 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_10720 29705 29199 gene locus_tag LOCUS_10730 29705 29199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 30776 29742 gene locus_tag LOCUS_10740 gene recA 30776 29742 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283860.1 protein_id gnl|my_center|LOCUS_10740 31545 30916 gene locus_tag LOCUS_10750 gene pgsA 31545 30916 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020863053.1 protein_id gnl|my_center|LOCUS_10750 32035 31556 gene locus_tag LOCUS_10760 32035 31556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 32747 32421 gene locus_tag LOCUS_10770 gene gpsB 32747 32421 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831034.1 protein_id gnl|my_center|LOCUS_10770 33335 33931 gene locus_tag LOCUS_10780 gene recU 33335 33931 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155598.1 protein_id gnl|my_center|LOCUS_10780 33912 36650 gene locus_tag LOCUS_10790 33912 36650 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283090.1 protein_id gnl|my_center|LOCUS_10790 37412 36765 gene locus_tag LOCUS_10800 gene dnaD 37412 36765 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728549.1 protein_id gnl|my_center|LOCUS_10800 38538 37435 gene locus_tag LOCUS_10810 38538 37435 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361540.1 protein_id gnl|my_center|LOCUS_10810 38924 38652 gene locus_tag LOCUS_10820 38924 38652 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_10820 39577 39038 gene locus_tag LOCUS_10830 39577 39038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 41042 39558 gene locus_tag LOCUS_10840 41042 39558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 41308 41039 gene locus_tag LOCUS_10850 41308 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 42327 41473 gene locus_tag LOCUS_10860 gene dinD 42327 41473 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_10860 43260 42418 gene locus_tag LOCUS_10870 gene dinD 43260 42418 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687842.1 protein_id gnl|my_center|LOCUS_10870 45819 43378 gene locus_tag LOCUS_10880 45819 43378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 48887 45927 gene locus_tag LOCUS_10890 48887 45927 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074696.1 protein_id gnl|my_center|LOCUS_10890 49843 48902 gene locus_tag LOCUS_10900 49843 48902 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_10900 52495 49913 gene locus_tag LOCUS_10910 52495 49913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 53621 52509 gene locus_tag LOCUS_10920 gene glf 53621 52509 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057797519.1 protein_id gnl|my_center|LOCUS_10920 54372 53635 gene locus_tag LOCUS_10930 54372 53635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_10930 55199 54387 gene locus_tag LOCUS_10940 55199 54387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_10940 56086 55322 gene locus_tag LOCUS_10950 gene sbnG 56086 55322 CDS product staphyloferrin B biosynthesis citrate synthase SbnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186804.1 protein_id gnl|my_center|LOCUS_10950 56854 56105 gene locus_tag LOCUS_10960 gene kdsB 56854 56105 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_10960 58204 56864 gene locus_tag LOCUS_10970 58204 56864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 59512 58328 gene locus_tag LOCUS_10980 59512 58328 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_10980 60624 59515 gene locus_tag LOCUS_10990 60624 59515 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_10990 61646 60651 gene locus_tag LOCUS_11000 61646 60651 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_11000 65006 61698 gene locus_tag LOCUS_11010 65006 61698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 66370 65402 gene locus_tag LOCUS_11020 66370 65402 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_11020 67308 66367 gene locus_tag LOCUS_11030 67308 66367 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_11030 68390 67308 gene locus_tag LOCUS_11040 68390 67308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 69600 68452 gene locus_tag LOCUS_11050 69600 68452 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_11050 71153 69678 gene locus_tag LOCUS_11060 gene spoIVA 71153 69678 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416519.1 protein_id gnl|my_center|LOCUS_11060 72288 71227 gene locus_tag LOCUS_11070 72288 71227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 72578 72336 gene locus_tag LOCUS_11080 72578 72336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 74469 72631 gene locus_tag LOCUS_11090 74469 72631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 75203 74577 gene locus_tag LOCUS_11100 75203 74577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 76520 75210 gene locus_tag LOCUS_11110 gene engA 76520 75210 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230565.1 protein_id gnl|my_center|LOCUS_11110 77173 76577 gene locus_tag LOCUS_11120 gene yihA 77173 76577 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_11120 78239 77298 gene locus_tag LOCUS_11130 78239 77298 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385747.1 protein_id gnl|my_center|LOCUS_11130 78528 78250 gene locus_tag LOCUS_11140 78528 78250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 79538 78588 gene locus_tag LOCUS_11150 79538 78588 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545149.1 protein_id gnl|my_center|LOCUS_11150 80726 79551 gene locus_tag LOCUS_11160 80726 79551 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989750.1 protein_id gnl|my_center|LOCUS_11160 81033 80830 gene locus_tag LOCUS_11170 81033 80830 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124489.1 protein_id gnl|my_center|LOCUS_11170 82250 81186 gene locus_tag LOCUS_11180 82250 81186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 82643 82272 gene locus_tag LOCUS_11190 82643 82272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 82960 82685 gene locus_tag LOCUS_11200 82960 82685 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722426.1 protein_id gnl|my_center|LOCUS_11200 83608 82997 gene locus_tag LOCUS_11210 83608 82997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 84592 83768 gene locus_tag LOCUS_11220 84592 83768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 84702 84920 gene locus_tag LOCUS_11230 84702 84920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 85469 84945 gene locus_tag LOCUS_11240 85469 84945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 86201 85479 gene locus_tag LOCUS_11250 gene rluB 86201 85479 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_11250 88294 86204 gene locus_tag LOCUS_11260 gene pcrA 88294 86204 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992924.1 protein_id gnl|my_center|LOCUS_11260 90122 88374 gene locus_tag LOCUS_11270 90122 88374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 90235 91233 gene locus_tag LOCUS_11280 90235 91233 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_11280 91237 91986 gene locus_tag LOCUS_11290 91237 91986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_11290 91976 92770 gene locus_tag LOCUS_11300 91976 92770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_11300 93307 92801 gene locus_tag LOCUS_11310 93307 92801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 93530 93318 gene locus_tag LOCUS_11320 93530 93318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 93894 93550 gene locus_tag LOCUS_11330 93894 93550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 94911 93910 gene locus_tag LOCUS_11340 gene tsaD 94911 93910 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414606.1 protein_id gnl|my_center|LOCUS_11340 95290 94916 gene locus_tag LOCUS_11350 95290 94916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 95969 95316 gene locus_tag LOCUS_11360 gene tsaB 95969 95316 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832485.1 protein_id gnl|my_center|LOCUS_11360 96418 95966 gene locus_tag LOCUS_11370 gene tsaE 96418 95966 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_11370 96592 96759 gene locus_tag LOCUS_11380 96592 96759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 96937 96861 gene locus_tag LOCUS_r00010 96937 96861 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 64 percent of the 5S ribosomal RNA >Feature sequence08 118 369 gene locus_tag LOCUS_11390 118 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 369 1079 gene locus_tag LOCUS_11400 369 1079 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614886.1 protein_id gnl|my_center|LOCUS_11400 1080 1532 gene locus_tag LOCUS_11410 1080 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1519 1872 gene locus_tag LOCUS_11420 1519 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1862 2017 gene locus_tag LOCUS_11430 1862 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2042 4072 gene locus_tag LOCUS_11440 2042 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4138 4374 gene locus_tag LOCUS_11450 4138 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4416 6125 gene locus_tag LOCUS_11460 4416 6125 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_11460 6580 6972 gene locus_tag LOCUS_11470 6580 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 7060 8052 gene locus_tag LOCUS_11480 gene mraY 7060 8052 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_11480 8127 8651 gene locus_tag LOCUS_11490 8127 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 8652 9668 gene locus_tag LOCUS_11500 8652 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 9751 10842 gene locus_tag LOCUS_11510 gene spoVE 9751 10842 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_11510 11325 13361 gene locus_tag LOCUS_11520 11325 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 13426 14523 gene locus_tag LOCUS_11530 gene murG 13426 14523 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_11530 14507 15412 gene locus_tag LOCUS_11540 gene murB 14507 15412 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_11540 15415 16083 gene locus_tag LOCUS_11550 gene divIB 15415 16083 CDS product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232178.1 protein_id gnl|my_center|LOCUS_11550 16164 17414 gene locus_tag LOCUS_11560 16164 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 17427 18509 gene locus_tag LOCUS_11570 gene ftsZ 17427 18509 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888984.1 protein_id gnl|my_center|LOCUS_11570 18568 20862 gene locus_tag LOCUS_11580 18568 20862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 21148 20906 gene locus_tag LOCUS_11590 21148 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 21117 21704 gene locus_tag LOCUS_11600 21117 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 21701 22393 gene locus_tag LOCUS_11610 gene sigE 21701 22393 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_11610 22442 23137 gene locus_tag LOCUS_11620 22442 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 23232 23603 gene locus_tag LOCUS_11630 23232 23603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 23603 23824 gene locus_tag LOCUS_11640 23603 23824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 23829 24137 gene locus_tag LOCUS_11650 23829 24137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 24183 24734 gene locus_tag LOCUS_11660 gene rsmD 24183 24734 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_11660 24795 25265 gene locus_tag LOCUS_11670 24795 25265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 25350 26270 gene locus_tag LOCUS_11680 25350 26270 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 protein_id gnl|my_center|LOCUS_11680 26402 27127 gene locus_tag LOCUS_11690 26402 27127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 27131 27307 gene locus_tag LOCUS_11700 27131 27307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11700 27895 27311 gene locus_tag LOCUS_11710 27895 27311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 27996 28475 gene locus_tag LOCUS_11720 27996 28475 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927545.1 protein_id gnl|my_center|LOCUS_11720 28491 28697 gene locus_tag LOCUS_11730 gene rpmF 28491 28697 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_11730 28758 29678 gene locus_tag LOCUS_11740 28758 29678 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_11740 29687 29908 gene locus_tag LOCUS_11750 29687 29908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 30016 30639 gene locus_tag LOCUS_11760 30016 30639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 30801 31517 gene locus_tag LOCUS_11770 30801 31517 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_11770 31737 32516 gene locus_tag LOCUS_11780 31737 32516 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003873.1 protein_id gnl|my_center|LOCUS_11780 32648 33628 gene locus_tag LOCUS_11790 32648 33628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 33625 34428 gene locus_tag LOCUS_11800 33625 34428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_11800 34429 35205 gene locus_tag LOCUS_11810 34429 35205 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681582.1 protein_id gnl|my_center|LOCUS_11810 35745 35224 gene locus_tag LOCUS_11820 gene yfcE 35745 35224 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_11820 35913 36053 gene locus_tag LOCUS_11830 35913 36053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 36559 37212 gene locus_tag LOCUS_11840 36559 37212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 37230 37814 gene locus_tag LOCUS_11850 37230 37814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 37898 38239 gene locus_tag LOCUS_11860 37898 38239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 38232 38612 gene locus_tag LOCUS_11870 38232 38612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 38617 39396 gene locus_tag LOCUS_11880 38617 39396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 39396 40724 gene locus_tag LOCUS_11890 39396 40724 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_11890 40738 41733 gene locus_tag LOCUS_11900 40738 41733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 41733 42437 gene locus_tag LOCUS_11910 41733 42437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 42563 43615 gene locus_tag LOCUS_11920 42563 43615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 43617 43997 gene locus_tag LOCUS_11930 43617 43997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 44069 44806 gene locus_tag LOCUS_11940 44069 44806 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890831.1 protein_id gnl|my_center|LOCUS_11940 44860 47454 gene locus_tag LOCUS_11950 44860 47454 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476159.1 protein_id gnl|my_center|LOCUS_11950 47552 48550 gene locus_tag LOCUS_11960 47552 48550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 48543 49919 gene locus_tag LOCUS_11970 48543 49919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 49989 50483 gene locus_tag LOCUS_11980 49989 50483 CDS product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914716.1 protein_id gnl|my_center|LOCUS_11980 50560 50766 gene locus_tag LOCUS_11990 gene gerE 50560 50766 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_11990 50819 51778 gene locus_tag LOCUS_12000 50819 51778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 51828 51904 gene locus_tag LOCUS_t00340 51828 51904 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52077 52313 gene locus_tag LOCUS_12010 52077 52313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 52310 52468 gene locus_tag LOCUS_12020 52310 52468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 53410 52478 gene locus_tag LOCUS_12030 53410 52478 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355572.1 protein_id gnl|my_center|LOCUS_12030 53551 55581 gene locus_tag LOCUS_12040 53551 55581 CDS product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905094.1 protein_id gnl|my_center|LOCUS_12040 55626 55793 gene locus_tag LOCUS_12050 55626 55793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 55778 55927 gene locus_tag LOCUS_12060 55778 55927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 56155 56355 gene locus_tag LOCUS_12070 56155 56355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 57334 56549 gene locus_tag LOCUS_12080 gene sigG 57334 56549 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_12080 57409 57630 gene locus_tag LOCUS_12090 57409 57630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 57771 58745 gene locus_tag LOCUS_12100 57771 58745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 58756 59220 gene locus_tag LOCUS_12110 gene lspA 58756 59220 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 protein_id gnl|my_center|LOCUS_12110 59449 59574 gene locus_tag LOCUS_12120 59449 59574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 59679 60014 gene locus_tag LOCUS_12130 59679 60014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 60091 60993 gene locus_tag LOCUS_12140 60091 60993 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130995.1 protein_id gnl|my_center|LOCUS_12140 61067 62200 gene locus_tag LOCUS_12150 61067 62200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 62214 63437 gene locus_tag LOCUS_12160 62214 63437 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115768.1 protein_id gnl|my_center|LOCUS_12160 64436 63498 gene locus_tag LOCUS_12170 gene rnhC 64436 63498 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245949.1 protein_id gnl|my_center|LOCUS_12170 64577 65272 gene locus_tag LOCUS_12180 64577 65272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 65284 65793 gene locus_tag LOCUS_12190 65284 65793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 66374 65811 gene locus_tag LOCUS_12200 66374 65811 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926669.1 protein_id gnl|my_center|LOCUS_12200 66464 67861 gene locus_tag LOCUS_12210 66464 67861 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_12210 67897 68601 gene locus_tag LOCUS_12220 gene pyrH 67897 68601 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_12220 68636 68944 gene locus_tag LOCUS_12230 68636 68944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 69007 69894 gene locus_tag LOCUS_12240 gene era 69007 69894 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_12240 69929 70054 gene locus_tag LOCUS_12250 69929 70054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 70035 70766 gene locus_tag LOCUS_12260 gene recO 70035 70766 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_12260 70927 72294 gene locus_tag LOCUS_12270 70927 72294 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_12270 72306 73682 gene locus_tag LOCUS_12280 72306 73682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 74612 74007 gene locus_tag LOCUS_12290 gene rpsD 74612 74007 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703954.1 protein_id gnl|my_center|LOCUS_12290 74891 75019 gene locus_tag LOCUS_12300 74891 75019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 75167 75754 gene locus_tag LOCUS_12310 75167 75754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 75764 76693 gene locus_tag LOCUS_12320 75764 76693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 76773 77654 gene locus_tag LOCUS_12330 76773 77654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 77751 79460 gene locus_tag LOCUS_12340 gene ezrA 77751 79460 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377302.1 protein_id gnl|my_center|LOCUS_12340 79475 80395 gene locus_tag LOCUS_12350 79475 80395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 80474 81316 gene locus_tag LOCUS_12360 80474 81316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 81506 86104 gene locus_tag LOCUS_12370 81506 86104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 86203 87336 gene locus_tag LOCUS_12380 86203 87336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 87362 88444 gene locus_tag LOCUS_12390 87362 88444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence09 1784 888 gene locus_tag LOCUS_12400 gene xerC 1784 888 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 protein_id gnl|my_center|LOCUS_12400 2775 1774 gene locus_tag LOCUS_12410 2775 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3587 2844 gene locus_tag LOCUS_12420 3587 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4099 3665 gene locus_tag LOCUS_12430 4099 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4434 4174 gene locus_tag LOCUS_12440 4434 4174 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_12440 5150 4521 gene locus_tag LOCUS_12450 5150 4521 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290661.1 protein_id gnl|my_center|LOCUS_12450 5678 5178 gene locus_tag LOCUS_12460 5678 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 6345 5653 gene locus_tag LOCUS_12470 6345 5653 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_12470 7189 6323 gene locus_tag LOCUS_12480 7189 6323 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_12480 8331 7594 gene locus_tag LOCUS_12490 8331 7594 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328190.1 protein_id gnl|my_center|LOCUS_12490 8699 8346 gene locus_tag LOCUS_12500 8699 8346 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903552.1 protein_id gnl|my_center|LOCUS_12500 9378 8701 gene locus_tag LOCUS_12510 9378 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 10747 9422 gene locus_tag LOCUS_12520 10747 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 11559 11020 gene locus_tag LOCUS_12530 11559 11020 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_12530 11948 11562 gene locus_tag LOCUS_12540 11948 11562 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_12540 13124 12012 gene locus_tag LOCUS_12550 13124 12012 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_12550 14082 13141 gene locus_tag LOCUS_12560 14082 13141 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_12560 15242 14106 gene locus_tag LOCUS_12570 15242 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 15787 15254 gene locus_tag LOCUS_12580 15787 15254 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881302.1 protein_id gnl|my_center|LOCUS_12580 16238 15912 gene locus_tag LOCUS_12590 16238 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 18693 16324 gene locus_tag LOCUS_12600 18693 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 20438 18690 gene locus_tag LOCUS_12610 20438 18690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_12610 20877 20440 gene locus_tag LOCUS_12620 20877 20440 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363192.1 protein_id gnl|my_center|LOCUS_12620 22330 21005 gene locus_tag LOCUS_12630 22330 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 23207 22419 gene locus_tag LOCUS_12640 gene ucpA 23207 22419 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517460.1 protein_id gnl|my_center|LOCUS_12640 23886 23224 gene locus_tag LOCUS_12650 23886 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 24758 23883 gene locus_tag LOCUS_12660 24758 23883 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_12660 25027 24872 gene locus_tag LOCUS_12670 25027 24872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 26150 25218 gene locus_tag LOCUS_12680 26150 25218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 26500 26162 gene locus_tag LOCUS_12690 26500 26162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12690 27188 26562 gene locus_tag LOCUS_12700 27188 26562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12700 27894 27262 gene locus_tag LOCUS_12710 27894 27262 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655263.1 protein_id gnl|my_center|LOCUS_12710 29163 27898 gene locus_tag LOCUS_12720 gene rlmD 29163 27898 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_12720 29900 29232 gene locus_tag LOCUS_12730 29900 29232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 33359 29958 gene locus_tag LOCUS_12740 gene nifJ 33359 29958 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 protein_id gnl|my_center|LOCUS_12740 33472 34416 gene locus_tag LOCUS_12750 33472 34416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 36247 34433 gene locus_tag LOCUS_12760 gene typA 36247 34433 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722695.1 protein_id gnl|my_center|LOCUS_12760 37588 36359 gene locus_tag LOCUS_12770 37588 36359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 39328 37682 gene locus_tag LOCUS_12780 39328 37682 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823087.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence10 238 56 gene locus_tag LOCUS_12790 238 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1148 279 gene locus_tag LOCUS_12800 gene miaA 1148 279 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_12800 1863 1156 gene locus_tag LOCUS_12810 1863 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2621 1869 gene locus_tag LOCUS_12820 2621 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4450 2672 gene locus_tag LOCUS_12830 gene mutL 4450 2672 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 protein_id gnl|my_center|LOCUS_12830 4705 4983 gene locus_tag LOCUS_12840 4705 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 6345 5065 gene locus_tag LOCUS_12850 6345 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 8293 6704 gene locus_tag LOCUS_12860 8293 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10113 8350 gene locus_tag LOCUS_12870 gene uvrC 10113 8350 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_12870 10478 10152 gene locus_tag LOCUS_12880 gene dagK 10478 10152 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365219.1 protein_id gnl|my_center|LOCUS_12880 10920 10483 gene locus_tag LOCUS_12890 10920 10483 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_12890 11350 10898 gene locus_tag LOCUS_12900 gene ybeY 11350 10898 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230039.1 protein_id gnl|my_center|LOCUS_12900 11964 11347 gene locus_tag LOCUS_12910 11964 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 13150 11978 gene locus_tag LOCUS_12920 13150 11978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 13389 13147 gene locus_tag LOCUS_12930 13389 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 14136 13453 gene locus_tag LOCUS_12940 gene gmk 14136 13453 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388624.1 protein_id gnl|my_center|LOCUS_12940 14368 14174 gene locus_tag LOCUS_12950 14368 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 14487 14759 gene locus_tag LOCUS_12960 14487 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 15545 14778 gene locus_tag LOCUS_12970 15545 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 16134 15568 gene locus_tag LOCUS_12980 16134 15568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 16774 16157 gene locus_tag LOCUS_12990 16774 16157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 16938 16783 gene locus_tag LOCUS_13000 16938 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 18736 16949 gene locus_tag LOCUS_13010 18736 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 22029 18841 gene locus_tag LOCUS_13020 22029 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 23433 22165 gene locus_tag LOCUS_13030 gene obgE 23433 22165 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724114.1 protein_id gnl|my_center|LOCUS_13030 24242 23481 gene locus_tag LOCUS_13040 24242 23481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 24977 24339 gene locus_tag LOCUS_13050 gene trmB 24977 24339 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709822.1 protein_id gnl|my_center|LOCUS_13050 25595 25029 gene locus_tag LOCUS_13060 25595 25029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 26033 25746 gene locus_tag LOCUS_13070 gene rpmA 26033 25746 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700332.1 protein_id gnl|my_center|LOCUS_13070 26350 26048 gene locus_tag LOCUS_13080 26350 26048 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166742.1 protein_id gnl|my_center|LOCUS_13080 26662 26363 gene locus_tag LOCUS_13090 gene rplU 26662 26363 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 protein_id gnl|my_center|LOCUS_13090 27452 26790 gene locus_tag LOCUS_13100 27452 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 28158 27550 gene locus_tag LOCUS_13110 28158 27550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 28661 28176 gene locus_tag LOCUS_13120 28661 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 29434 28658 gene locus_tag LOCUS_13130 29434 28658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 30129 29431 gene locus_tag LOCUS_13140 gene radC 30129 29431 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013377.1 protein_id gnl|my_center|LOCUS_13140 30580 30122 gene locus_tag LOCUS_13150 30580 30122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 31664 30654 gene locus_tag LOCUS_13160 gene yqeH 31664 30654 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990141.1 protein_id gnl|my_center|LOCUS_13160 32178 31657 gene locus_tag LOCUS_13170 32178 31657 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120718959.1 protein_id gnl|my_center|LOCUS_13170 33283 32192 gene locus_tag LOCUS_13180 33283 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 34539 33418 gene locus_tag LOCUS_13190 34539 33418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 34628 35320 gene locus_tag LOCUS_13200 gene sigK 34628 35320 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_13200 36400 35342 gene locus_tag LOCUS_13210 36400 35342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 37177 36485 gene locus_tag LOCUS_13220 37177 36485 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_13220 38412 37222 gene locus_tag LOCUS_13230 38412 37222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence11 1713 40 gene locus_tag LOCUS_13240 1713 40 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_13240 2709 1771 gene locus_tag LOCUS_13250 2709 1771 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_13250 3731 3066 gene locus_tag LOCUS_13260 3731 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4171 4095 gene locus_tag LOCUS_t00350 4171 4095 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4258 4184 gene locus_tag LOCUS_t00360 4258 4184 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5069 4347 gene locus_tag LOCUS_13270 5069 4347 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721237.1 protein_id gnl|my_center|LOCUS_13270 6150 5017 gene locus_tag LOCUS_13280 6150 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6658 6164 gene locus_tag LOCUS_13290 6658 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 7939 6743 gene locus_tag LOCUS_13300 7939 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 8520 7969 gene locus_tag LOCUS_13310 8520 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 9217 8618 gene locus_tag LOCUS_13320 9217 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 9760 9242 gene locus_tag LOCUS_13330 9760 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 10383 9868 gene locus_tag LOCUS_13340 10383 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 11446 10481 gene locus_tag LOCUS_13350 11446 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 11785 11531 gene locus_tag LOCUS_13360 11785 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 13211 11796 gene locus_tag LOCUS_13370 13211 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 14529 13273 gene locus_tag LOCUS_13380 14529 13273 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_13380 15231 14551 gene locus_tag LOCUS_13390 15231 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 15552 15307 gene locus_tag LOCUS_13400 15552 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 16364 15627 gene locus_tag LOCUS_13410 16364 15627 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_13410 17255 16413 gene locus_tag LOCUS_13420 17255 16413 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_13420 17904 17248 gene locus_tag LOCUS_13430 17904 17248 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020862546.1 protein_id gnl|my_center|LOCUS_13430 18619 18074 gene locus_tag LOCUS_13440 18619 18074 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_13440 19589 18630 gene locus_tag LOCUS_13450 19589 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 20275 19730 gene locus_tag LOCUS_13460 20275 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 21138 20347 gene locus_tag LOCUS_13470 21138 20347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence12 3559 77 gene locus_tag LOCUS_13480 3559 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3664 4110 gene locus_tag LOCUS_13490 3664 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5412 4186 gene locus_tag LOCUS_13500 gene tyrS 5412 4186 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186029.1 protein_id gnl|my_center|LOCUS_13500 5882 5409 gene locus_tag LOCUS_13510 5882 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6493 6083 gene locus_tag LOCUS_13520 6493 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 6878 6546 gene locus_tag LOCUS_13530 6878 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 8298 6871 gene locus_tag LOCUS_13540 gene miaB 8298 6871 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_13540 9428 8376 gene locus_tag LOCUS_13550 9428 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 9945 9496 gene locus_tag LOCUS_13560 9945 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 11357 10008 gene locus_tag LOCUS_13570 gene murD 11357 10008 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286638.1 protein_id gnl|my_center|LOCUS_13570 11794 11390 gene locus_tag LOCUS_13580 11794 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 13221 11863 gene locus_tag LOCUS_13590 13221 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 13785 13309 gene locus_tag LOCUS_13600 13785 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 15167 13878 gene locus_tag LOCUS_13610 gene serS 15167 13878 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_13610 15396 15169 gene locus_tag LOCUS_13620 15396 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 15646 15407 gene locus_tag LOCUS_13630 15646 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 16080 15643 gene locus_tag LOCUS_13640 16080 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 17286 16327 gene locus_tag LOCUS_13650 17286 16327 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822608.1 protein_id gnl|my_center|LOCUS_13650 18173 17460 gene locus_tag LOCUS_13660 18173 17460 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533705.1 protein_id gnl|my_center|LOCUS_13660 18467 18246 gene locus_tag LOCUS_13670 18467 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 18571 19044 gene locus_tag LOCUS_13680 18571 19044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 19657 19028 gene locus_tag LOCUS_13690 19657 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence13 438 908 gene locus_tag LOCUS_13700 438 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 962 1849 gene locus_tag LOCUS_13710 962 1849 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_13710 2023 2217 gene locus_tag LOCUS_13720 2023 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2205 2438 gene locus_tag LOCUS_13730 2205 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2791 3768 gene locus_tag LOCUS_13740 2791 3768 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545485.1 protein_id gnl|my_center|LOCUS_13740 3769 4296 gene locus_tag LOCUS_13750 3769 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4391 4708 gene locus_tag LOCUS_13760 4391 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4710 5384 gene locus_tag LOCUS_13770 gene sigF 4710 5384 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_13770 5478 6248 gene locus_tag LOCUS_13780 5478 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6302 6742 gene locus_tag LOCUS_13790 gene spoVAC 6302 6742 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_13790 6745 7740 gene locus_tag LOCUS_13800 gene spoVAD 6745 7740 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 protein_id gnl|my_center|LOCUS_13800 7737 8087 gene locus_tag LOCUS_13810 gene spoVAE 7737 8087 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345915.1 protein_id gnl|my_center|LOCUS_13810 8141 9553 gene locus_tag LOCUS_13820 8141 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 9444 9543 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9760 10683 gene locus_tag LOCUS_13830 9760 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 10730 13624 gene locus_tag LOCUS_13840 10730 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 14846 13728 gene locus_tag LOCUS_13850 14846 13728 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_13850 15659 14871 gene locus_tag LOCUS_13860 15659 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 15991 15737 gene locus_tag LOCUS_13870 15991 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 16064 18106 gene locus_tag LOCUS_13880 16064 18106 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038974.1 protein_id gnl|my_center|LOCUS_13880 18151 18324 gene locus_tag LOCUS_13890 gene rpmG 18151 18324 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114322.1 protein_id gnl|my_center|LOCUS_13890 18383 18940 gene locus_tag LOCUS_13900 gene efp 18383 18940 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699839.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence14 3166 71 gene locus_tag LOCUS_13910 gene ileS 3166 71 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_13910 3743 3150 gene locus_tag LOCUS_13920 3743 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4432 4034 gene locus_tag LOCUS_13930 4432 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 5158 4541 gene locus_tag LOCUS_13940 5158 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 8511 5266 gene locus_tag LOCUS_13950 8511 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence15 1204 197 gene locus_tag LOCUS_13960 gene gpr 1204 197 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_13960 1311 1553 gene locus_tag LOCUS_13970 gene rpsT 1311 1553 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_13970 1604 2545 gene locus_tag LOCUS_13980 1604 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3207 2542 gene locus_tag LOCUS_13990 3207 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990