>Feature sequence01 <1 560 gene locus_tag LOCUS_00010 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966761.1:flavodoxin family protein 1388 1897 gene locus_tag LOCUS_00020 1388 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2500 2075 gene locus_tag LOCUS_00030 2500 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4731 2749 gene locus_tag LOCUS_00040 4731 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5201 5551 gene locus_tag LOCUS_00050 5201 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5581 5976 gene locus_tag LOCUS_00060 5581 5976 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759735.1 protein_id gnl|my_center|LOCUS_00060 6036 6809 gene locus_tag LOCUS_00070 6036 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6868 7542 gene locus_tag LOCUS_00080 6868 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8798 7599 gene locus_tag LOCUS_00090 8798 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8940 9833 gene locus_tag LOCUS_00100 8940 9833 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074572.1 protein_id gnl|my_center|LOCUS_00100 11518 9836 gene locus_tag LOCUS_00110 11518 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11695 12504 gene locus_tag LOCUS_00120 11695 12504 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287979.1 protein_id gnl|my_center|LOCUS_00120 13066 12638 gene locus_tag LOCUS_00130 13066 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13711 13112 gene locus_tag LOCUS_00140 13711 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14792 13845 gene locus_tag LOCUS_00150 14792 13845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15312 15605 gene locus_tag LOCUS_00160 15312 15605 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878325.1 protein_id gnl|my_center|LOCUS_00160 15842 16576 gene locus_tag LOCUS_00170 15842 16576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17164 16607 gene locus_tag LOCUS_00180 17164 16607 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_00180 17438 18907 gene locus_tag LOCUS_00190 gene xylB 17438 18907 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_00190 18973 19626 gene locus_tag LOCUS_00200 18973 19626 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_00200 19683 21167 gene locus_tag LOCUS_00210 19683 21167 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_00210 21630 21842 gene locus_tag LOCUS_00220 21630 21842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22137 22349 gene locus_tag LOCUS_00230 22137 22349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22372 23721 gene locus_tag LOCUS_00240 22372 23721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23839 24873 gene locus_tag LOCUS_00250 gene gmd 23839 24873 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_00250 25279 26424 gene locus_tag LOCUS_00260 25279 26424 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 protein_id gnl|my_center|LOCUS_00260 26809 27744 gene locus_tag LOCUS_00270 26809 27744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28972 27773 gene locus_tag LOCUS_00280 28972 27773 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810375.1 protein_id gnl|my_center|LOCUS_00280 29666 28953 gene locus_tag LOCUS_00290 gene bioD 29666 28953 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_00290 30627 29659 gene locus_tag LOCUS_00300 gene bioB 30627 29659 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_00300 31283 30735 gene locus_tag LOCUS_00310 31283 30735 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_00310 32335 31325 gene locus_tag LOCUS_00320 32335 31325 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_00320 32568 33971 gene locus_tag LOCUS_00330 32568 33971 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_00330 35841 33943 gene locus_tag LOCUS_00340 35841 33943 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_00340 36030 37526 gene locus_tag LOCUS_00350 gene abfB 36030 37526 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_00350 37537 38703 gene locus_tag LOCUS_00360 37537 38703 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967203.1 protein_id gnl|my_center|LOCUS_00360 39784 38903 gene locus_tag LOCUS_00370 39784 38903 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680498.1 protein_id gnl|my_center|LOCUS_00370 39954 39793 gene locus_tag LOCUS_00380 39954 39793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40211 41374 gene locus_tag LOCUS_00390 40211 41374 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965281.1 protein_id gnl|my_center|LOCUS_00390 41362 42213 gene locus_tag LOCUS_00400 41362 42213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42233 43081 gene locus_tag LOCUS_00410 42233 43081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43422 43078 gene locus_tag LOCUS_00420 43422 43078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43575 43802 gene locus_tag LOCUS_00430 43575 43802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 43799 44155 gene locus_tag LOCUS_00440 43799 44155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 44115 44699 gene locus_tag LOCUS_00450 44115 44699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965276.1 protein_id gnl|my_center|LOCUS_00450 44789 45466 gene locus_tag LOCUS_00460 44789 45466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 45463 45954 gene locus_tag LOCUS_00470 45463 45954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 45971 50344 gene locus_tag LOCUS_00480 45971 50344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 50371 50787 gene locus_tag LOCUS_00490 50371 50787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 50801 51886 gene locus_tag LOCUS_00500 50801 51886 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_00500 51883 52935 gene locus_tag LOCUS_00510 gene hisC 51883 52935 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_00510 53041 53892 gene locus_tag LOCUS_00520 53041 53892 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680113.1 protein_id gnl|my_center|LOCUS_00520 53907 54695 gene locus_tag LOCUS_00530 53907 54695 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_00530 54695 55573 gene locus_tag LOCUS_00540 gene hslO 54695 55573 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_00540 56142 55654 gene locus_tag LOCUS_00550 56142 55654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 56322 57644 gene locus_tag LOCUS_00560 gene glnA 56322 57644 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_00560 57872 58411 gene locus_tag LOCUS_00570 57872 58411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58458 59330 gene locus_tag LOCUS_00580 gene dapF 58458 59330 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_00580 59318 60538 gene locus_tag LOCUS_00590 59318 60538 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_00590 60567 61625 gene locus_tag LOCUS_00600 60567 61625 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_00600 61930 62112 gene locus_tag LOCUS_00610 61930 62112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 62152 63903 gene locus_tag LOCUS_00620 gene aspS 62152 63903 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_00620 64027 65511 gene locus_tag LOCUS_00630 64027 65511 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_00630 65523 67013 gene locus_tag LOCUS_00640 65523 67013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 67051 67344 gene locus_tag LOCUS_00650 gene gatC 67051 67344 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_00650 67430 68977 gene locus_tag LOCUS_00660 gene gatA 67430 68977 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_00660 68974 70401 gene locus_tag LOCUS_00670 gene gatB 68974 70401 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_00670 71182 70442 gene locus_tag LOCUS_00680 71182 70442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71391 71891 gene locus_tag LOCUS_00690 71391 71891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 72036 73490 gene locus_tag LOCUS_00700 gene guaB 72036 73490 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_00700 73516 76113 gene locus_tag LOCUS_00710 73516 76113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 76125 76832 gene locus_tag LOCUS_00720 76125 76832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 76884 78065 gene locus_tag LOCUS_00730 76884 78065 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_00730 78147 79670 gene locus_tag LOCUS_00740 78147 79670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 79667 82207 gene locus_tag LOCUS_00750 79667 82207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 82246 83925 gene locus_tag LOCUS_00760 82246 83925 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_00760 83986 84831 gene locus_tag LOCUS_00770 83986 84831 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948004.1 protein_id gnl|my_center|LOCUS_00770 84834 86309 gene locus_tag LOCUS_00780 84834 86309 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891898.1 protein_id gnl|my_center|LOCUS_00780 86874 86521 gene locus_tag LOCUS_00790 86874 86521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87035 87640 gene locus_tag LOCUS_00800 87035 87640 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771615.1 protein_id gnl|my_center|LOCUS_00800 88405 87644 gene locus_tag LOCUS_00810 88405 87644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 88711 90105 gene locus_tag LOCUS_00820 88711 90105 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_00820 90262 90465 gene locus_tag LOCUS_00830 90262 90465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 90492 91112 gene locus_tag LOCUS_00840 90492 91112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 91384 91707 gene locus_tag LOCUS_00850 91384 91707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 91825 94140 gene locus_tag LOCUS_00860 91825 94140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 94308 95684 gene locus_tag LOCUS_00870 94308 95684 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_00870 95781 96866 gene locus_tag LOCUS_00880 95781 96866 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_00880 96894 98774 gene locus_tag LOCUS_00890 96894 98774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 98777 100549 gene locus_tag LOCUS_00900 98777 100549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 100907 102142 gene locus_tag LOCUS_00910 gene tyrS 100907 102142 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812508.1 protein_id gnl|my_center|LOCUS_00910 102275 103180 gene locus_tag LOCUS_00920 102275 103180 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_00920 104002 103196 gene locus_tag LOCUS_00930 104002 103196 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_00930 104822 104520 gene locus_tag LOCUS_00940 104822 104520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 105089 105382 gene locus_tag LOCUS_00950 105089 105382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 105723 105938 gene locus_tag LOCUS_00960 105723 105938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 105904 107448 gene locus_tag LOCUS_00970 105904 107448 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_00970 107471 107740 gene locus_tag LOCUS_00980 107471 107740 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966115.1 protein_id gnl|my_center|LOCUS_00980 107972 109033 gene locus_tag LOCUS_00990 107972 109033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 109020 109766 gene locus_tag LOCUS_01000 109020 109766 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 protein_id gnl|my_center|LOCUS_01000 109763 113287 gene locus_tag LOCUS_01010 gene addB 109763 113287 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_01010 113332 113991 gene locus_tag LOCUS_01020 113332 113991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 114004 114597 gene locus_tag LOCUS_01030 114004 114597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 114607 115347 gene locus_tag LOCUS_01040 114607 115347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 115460 116938 gene locus_tag LOCUS_01050 115460 116938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 117120 120950 gene locus_tag LOCUS_01060 gene addA 117120 120950 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948198.1 protein_id gnl|my_center|LOCUS_01060 121571 120990 gene locus_tag LOCUS_01070 gene thiT 121571 120990 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990555.1 protein_id gnl|my_center|LOCUS_01070 121853 123400 gene locus_tag LOCUS_01080 121853 123400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 123439 126201 gene locus_tag LOCUS_01090 123439 126201 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_01090 126198 126890 gene locus_tag LOCUS_01100 126198 126890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 127484 126855 gene locus_tag LOCUS_01110 127484 126855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 127668 127925 gene locus_tag LOCUS_01120 127668 127925 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_01120 127927 128277 gene locus_tag LOCUS_01130 127927 128277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 128492 132025 gene locus_tag LOCUS_01140 128492 132025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 132103 133077 gene locus_tag LOCUS_01150 132103 133077 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_01150 133116 133619 gene locus_tag LOCUS_01160 gene greA 133116 133619 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818750.1 protein_id gnl|my_center|LOCUS_01160 133630 135129 gene locus_tag LOCUS_01170 133630 135129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 135132 135962 gene locus_tag LOCUS_01180 135132 135962 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257991.1 protein_id gnl|my_center|LOCUS_01180 136046 136261 gene locus_tag LOCUS_01190 136046 136261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 136726 138306 gene locus_tag LOCUS_01200 136726 138306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 138279 138524 gene locus_tag LOCUS_01210 138279 138524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 138531 139385 gene locus_tag LOCUS_01220 138531 139385 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183603351.1 protein_id gnl|my_center|LOCUS_01220 139459 140559 gene locus_tag LOCUS_01230 139459 140559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 140593 141144 gene locus_tag LOCUS_01240 140593 141144 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 protein_id gnl|my_center|LOCUS_01240 141267 142613 gene locus_tag LOCUS_01250 141267 142613 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_01250 143590 142679 gene locus_tag LOCUS_01260 143590 142679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 143694 143888 gene locus_tag LOCUS_01270 143694 143888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 144945 143890 gene locus_tag LOCUS_01280 144945 143890 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920590.1 protein_id gnl|my_center|LOCUS_01280 145290 149837 gene locus_tag LOCUS_01290 gene gltB 145290 149837 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_01290 149856 151349 gene locus_tag LOCUS_01300 149856 151349 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_01300 151608 151916 gene locus_tag LOCUS_01310 151608 151916 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_01310 151932 153167 gene locus_tag LOCUS_01320 151932 153167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 154018 153233 gene locus_tag LOCUS_01330 154018 153233 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460597.1 protein_id gnl|my_center|LOCUS_01330 154031 154234 gene locus_tag LOCUS_01340 154031 154234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 155073 154240 gene locus_tag LOCUS_01350 155073 154240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 155980 155066 gene locus_tag LOCUS_01360 155980 155066 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_01360 156833 156072 gene locus_tag LOCUS_01370 156833 156072 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796158.1 protein_id gnl|my_center|LOCUS_01370 157076 158197 gene locus_tag LOCUS_01380 157076 158197 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_01380 158273 160216 gene locus_tag LOCUS_01390 158273 160216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 160284 160886 gene locus_tag LOCUS_01400 160284 160886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 161920 160910 gene locus_tag LOCUS_01410 gene asnA 161920 160910 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_01410 162096 163535 gene locus_tag LOCUS_01420 162096 163535 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_01420 163616 164368 gene locus_tag LOCUS_01430 163616 164368 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943941.1 protein_id gnl|my_center|LOCUS_01430 164638 164862 gene locus_tag LOCUS_01440 164638 164862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 164974 167625 gene locus_tag LOCUS_01450 164974 167625 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289116.1 protein_id gnl|my_center|LOCUS_01450 167835 169148 gene locus_tag LOCUS_01460 167835 169148 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_01460 169229 169606 gene locus_tag LOCUS_01470 169229 169606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 169913 170236 gene locus_tag LOCUS_01480 169913 170236 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_01480 170233 171135 gene locus_tag LOCUS_01490 170233 171135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 171200 172165 gene locus_tag LOCUS_01500 171200 172165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 173124 172267 gene locus_tag LOCUS_01510 173124 172267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 173423 175555 gene locus_tag LOCUS_01520 173423 175555 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_01520 176102 178840 gene locus_tag LOCUS_01530 176102 178840 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_01530 178861 180225 gene locus_tag LOCUS_01540 178861 180225 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_01540 180212 180364 gene locus_tag LOCUS_01550 180212 180364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 180366 181781 gene locus_tag LOCUS_01560 180366 181781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 181881 182204 gene locus_tag LOCUS_01570 gene spoIIAA 181881 182204 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_01570 182201 182695 gene locus_tag LOCUS_01580 gene spoIIAB 182201 182695 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_01580 182699 183466 gene locus_tag LOCUS_01590 gene sigF 182699 183466 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393005.1 protein_id gnl|my_center|LOCUS_01590 183568 184764 gene locus_tag LOCUS_01600 183568 184764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 185176 185649 gene locus_tag LOCUS_01610 185176 185649 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363192.1 protein_id gnl|my_center|LOCUS_01610 185775 187544 gene locus_tag LOCUS_01620 185775 187544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_01620 187544 189481 gene locus_tag LOCUS_01630 187544 189481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_01630 189465 189647 gene locus_tag LOCUS_01640 189465 189647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 189912 190643 gene locus_tag LOCUS_01650 189912 190643 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_01650 190857 191345 gene locus_tag LOCUS_01660 190857 191345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 191361 191858 gene locus_tag LOCUS_01670 gene tsaE 191361 191858 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_01670 191855 192547 gene locus_tag LOCUS_01680 gene tsaB 191855 192547 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_01680 192609 193067 gene locus_tag LOCUS_01690 gene rimI 192609 193067 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_01690 193164 193412 gene locus_tag LOCUS_01700 193164 193412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 193500 194414 gene locus_tag LOCUS_01710 193500 194414 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_01710 194476 195057 gene locus_tag LOCUS_01720 194476 195057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 195068 196093 gene locus_tag LOCUS_01730 gene tsaD 195068 196093 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_01730 196178 196930 gene locus_tag LOCUS_01740 gene ispD 196178 196930 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_01740 197045 197131 gene locus_tag LOCUS_t00010 197045 197131 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 197191 197281 gene locus_tag LOCUS_t00020 197191 197281 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 1202 315 gene locus_tag LOCUS_01750 1202 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1418 1582 gene locus_tag LOCUS_01760 1418 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 1890 1714 gene locus_tag LOCUS_01770 1890 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2171 3295 gene locus_tag LOCUS_01780 2171 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 3683 3435 gene locus_tag LOCUS_01790 3683 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 3707 4135 gene locus_tag LOCUS_01800 3707 4135 CDS product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266191.1 protein_id gnl|my_center|LOCUS_01800 4805 4413 gene locus_tag LOCUS_01810 4805 4413 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_01810 7256 4908 gene locus_tag LOCUS_01820 7256 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 7492 7337 gene locus_tag LOCUS_01830 7492 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 7656 7444 gene locus_tag LOCUS_01840 7656 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 8134 7643 gene locus_tag LOCUS_01850 8134 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 9238 8369 gene locus_tag LOCUS_01860 9238 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 10764 9235 gene locus_tag LOCUS_01870 10764 9235 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_01870 11457 10771 gene locus_tag LOCUS_01880 11457 10771 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_01880 12913 11552 gene locus_tag LOCUS_01890 12913 11552 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_01890 14092 13199 gene locus_tag LOCUS_01900 gene trxB 14092 13199 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_01900 15072 14140 gene locus_tag LOCUS_01910 15072 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 17091 15088 gene locus_tag LOCUS_01920 17091 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 17369 17941 gene locus_tag LOCUS_01930 17369 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 18122 17955 gene locus_tag LOCUS_01940 18122 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 19086 18466 gene locus_tag LOCUS_01950 19086 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 21850 19079 gene locus_tag LOCUS_01960 21850 19079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 22261 22061 gene locus_tag LOCUS_01970 22261 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 24055 22343 gene locus_tag LOCUS_01980 24055 22343 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_01980 25177 24152 gene locus_tag LOCUS_01990 25177 24152 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262593.1 protein_id gnl|my_center|LOCUS_01990 25394 25242 gene locus_tag LOCUS_02000 25394 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 26156 25827 gene locus_tag LOCUS_02010 26156 25827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 27736 26702 gene locus_tag LOCUS_02020 27736 26702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 28532 27777 gene locus_tag LOCUS_02030 28532 27777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 29212 28538 gene locus_tag LOCUS_02040 29212 28538 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_02040 29985 29230 gene locus_tag LOCUS_02050 29985 29230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 31324 29999 gene locus_tag LOCUS_02060 31324 29999 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 protein_id gnl|my_center|LOCUS_02060 32221 31361 gene locus_tag LOCUS_02070 32221 31361 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 protein_id gnl|my_center|LOCUS_02070 33228 32359 gene locus_tag LOCUS_02080 33228 32359 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_02080 34145 33345 gene locus_tag LOCUS_02090 34145 33345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 34581 34153 gene locus_tag LOCUS_02100 34581 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 35107 34538 gene locus_tag LOCUS_02110 35107 34538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 36124 35141 gene locus_tag LOCUS_02120 36124 35141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 37979 36192 gene locus_tag LOCUS_02130 gene rlmD 37979 36192 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_02130 39216 38065 gene locus_tag LOCUS_02140 39216 38065 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_02140 40248 39307 gene locus_tag LOCUS_02150 40248 39307 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_02150 41603 40248 gene locus_tag LOCUS_02160 41603 40248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 44972 41697 gene locus_tag LOCUS_02170 44972 41697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 46719 44965 gene locus_tag LOCUS_02180 46719 44965 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_02180 47206 49584 gene locus_tag LOCUS_02190 47206 49584 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_02190 49609 50310 gene locus_tag LOCUS_02200 49609 50310 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_02200 50310 51737 gene locus_tag LOCUS_02210 50310 51737 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_02210 52272 51691 gene locus_tag LOCUS_02220 52272 51691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 52724 52305 gene locus_tag LOCUS_02230 52724 52305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 54075 53323 gene locus_tag LOCUS_02240 54075 53323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 54300 55196 gene locus_tag LOCUS_02250 54300 55196 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_02250 56869 55331 gene locus_tag LOCUS_02260 gene nagZ 56869 55331 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_02260 58038 56896 gene locus_tag LOCUS_02270 58038 56896 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_02270 59306 58116 gene locus_tag LOCUS_02280 gene anmK 59306 58116 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_02280 60208 59303 gene locus_tag LOCUS_02290 gene murQ 60208 59303 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261744.1 protein_id gnl|my_center|LOCUS_02290 60927 60238 gene locus_tag LOCUS_02300 60927 60238 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222498.1 protein_id gnl|my_center|LOCUS_02300 62007 61021 gene locus_tag LOCUS_02310 62007 61021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 63079 62213 gene locus_tag LOCUS_02320 63079 62213 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_02320 64002 63094 gene locus_tag LOCUS_02330 64002 63094 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994448.1 protein_id gnl|my_center|LOCUS_02330 65477 64107 gene locus_tag LOCUS_02340 65477 64107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 66484 65636 gene locus_tag LOCUS_02350 66484 65636 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_02350 67667 66486 gene locus_tag LOCUS_02360 67667 66486 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_02360 70397 67791 gene locus_tag LOCUS_02370 gene gyrA 70397 67791 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_02370 72490 70418 gene locus_tag LOCUS_02380 gene gyrB 72490 70418 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855339.1 protein_id gnl|my_center|LOCUS_02380 73608 72487 gene locus_tag LOCUS_02390 gene recF 73608 72487 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_02390 73823 73605 gene locus_tag LOCUS_02400 73823 73605 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480037.1 protein_id gnl|my_center|LOCUS_02400 75071 73962 gene locus_tag LOCUS_02410 gene dnaN 75071 73962 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_02410 76687 75329 gene locus_tag LOCUS_02420 gene dnaA 76687 75329 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_02420 77431 77784 gene locus_tag LOCUS_02430 gene rnpA 77431 77784 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_02430 78053 79390 gene locus_tag LOCUS_02440 78053 79390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 79421 80053 gene locus_tag LOCUS_02450 79421 80053 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_02450 80214 81635 gene locus_tag LOCUS_02460 gene mnmE 80214 81635 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_02460 81685 83628 gene locus_tag LOCUS_02470 gene mnmG 81685 83628 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_02470 83699 84433 gene locus_tag LOCUS_02480 gene rsmG 83699 84433 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 protein_id gnl|my_center|LOCUS_02480 84603 85553 gene locus_tag LOCUS_02490 84603 85553 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811712.1 protein_id gnl|my_center|LOCUS_02490 85613 86257 gene locus_tag LOCUS_02500 85613 86257 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869549.1 protein_id gnl|my_center|LOCUS_02500 86976 86497 gene locus_tag LOCUS_02510 86976 86497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 87443 88222 gene locus_tag LOCUS_02520 87443 88222 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_02520 88294 89199 gene locus_tag LOCUS_02530 88294 89199 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_02530 89241 89759 gene locus_tag LOCUS_02540 89241 89759 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393987.1 protein_id gnl|my_center|LOCUS_02540 89799 90848 gene locus_tag LOCUS_02550 89799 90848 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 protein_id gnl|my_center|LOCUS_02550 90971 92254 gene locus_tag LOCUS_02560 gene serS 90971 92254 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_02560 92336 93244 gene locus_tag LOCUS_02570 92336 93244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 93300 93372 gene locus_tag LOCUS_t00030 93300 93372 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 93469 93918 gene locus_tag LOCUS_02580 93469 93918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 93962 95134 gene locus_tag LOCUS_02590 93962 95134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 95164 97077 gene locus_tag LOCUS_02600 95164 97077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 97101 97721 gene locus_tag LOCUS_02610 97101 97721 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_02610 97780 98370 gene locus_tag LOCUS_02620 97780 98370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 98430 100214 gene locus_tag LOCUS_02630 98430 100214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 100208 102178 gene locus_tag LOCUS_02640 100208 102178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 102175 105390 gene locus_tag LOCUS_02650 102175 105390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 105452 106129 gene locus_tag LOCUS_02660 gene rhgT 105452 106129 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233825.1 protein_id gnl|my_center|LOCUS_02660 106200 107960 gene locus_tag LOCUS_02670 106200 107960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_02670 108221 111526 gene locus_tag LOCUS_02680 108221 111526 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_02680 111757 112242 gene locus_tag LOCUS_02690 111757 112242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 112417 113526 gene locus_tag LOCUS_02700 112417 113526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 114935 113592 gene locus_tag LOCUS_02710 114935 113592 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068584.1 protein_id gnl|my_center|LOCUS_02710 115097 115942 gene locus_tag LOCUS_02720 115097 115942 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_02720 116212 116493 gene locus_tag LOCUS_02730 116212 116493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 116543 117097 gene locus_tag LOCUS_02740 116543 117097 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906104.1 protein_id gnl|my_center|LOCUS_02740 117250 119253 gene locus_tag LOCUS_02750 117250 119253 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_02750 119966 119334 gene locus_tag LOCUS_02760 119966 119334 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365791.1 protein_id gnl|my_center|LOCUS_02760 121102 119987 gene locus_tag LOCUS_02770 121102 119987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 121352 123025 gene locus_tag LOCUS_02780 121352 123025 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_02780 123208 124842 gene locus_tag LOCUS_02790 123208 124842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 124891 125691 gene locus_tag LOCUS_02800 124891 125691 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_02800 125704 127071 gene locus_tag LOCUS_02810 125704 127071 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_02810 127158 128162 gene locus_tag LOCUS_02820 127158 128162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 128233 129627 gene locus_tag LOCUS_02830 128233 129627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 129765 130037 gene locus_tag LOCUS_02840 129765 130037 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_02840 130167 130406 gene locus_tag LOCUS_02850 130167 130406 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048379.1 protein_id gnl|my_center|LOCUS_02850 130466 130753 gene locus_tag LOCUS_02860 130466 130753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 130759 131226 gene locus_tag LOCUS_02870 130759 131226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 131243 131554 gene locus_tag LOCUS_02880 131243 131554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 131679 131879 gene locus_tag LOCUS_02890 131679 131879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 131888 133078 gene locus_tag LOCUS_02900 131888 133078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 133158 133571 gene locus_tag LOCUS_02910 133158 133571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 133643 134512 gene locus_tag LOCUS_02920 133643 134512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 134505 135269 gene locus_tag LOCUS_02930 134505 135269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 135333 135965 gene locus_tag LOCUS_02940 135333 135965 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_02940 136018 136716 gene locus_tag LOCUS_02950 136018 136716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 136878 138044 gene locus_tag LOCUS_02960 136878 138044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 138233 139321 gene locus_tag LOCUS_02970 138233 139321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 139377 140039 gene locus_tag LOCUS_02980 139377 140039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 140269 140673 gene locus_tag LOCUS_02990 140269 140673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 140729 141577 gene locus_tag LOCUS_03000 140729 141577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 141574 142395 gene locus_tag LOCUS_03010 141574 142395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 142396 143040 gene locus_tag LOCUS_03020 142396 143040 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_03020 143037 143705 gene locus_tag LOCUS_03030 143037 143705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 143807 144022 gene locus_tag LOCUS_03040 143807 144022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 144243 145709 gene locus_tag LOCUS_03050 gene tilS 144243 145709 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_03050 145740 146261 gene locus_tag LOCUS_03060 gene hpt 145740 146261 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582585.1 protein_id gnl|my_center|LOCUS_03060 146273 148087 gene locus_tag LOCUS_03070 gene ftsH 146273 148087 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_03070 148369 150483 gene locus_tag LOCUS_03080 gene malZ 148369 150483 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818979.1 protein_id gnl|my_center|LOCUS_03080 150662 151810 gene locus_tag LOCUS_03090 150662 151810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 151803 152456 gene locus_tag LOCUS_03100 151803 152456 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_03100 152488 153999 gene locus_tag LOCUS_03110 152488 153999 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_03110 153989 154822 gene locus_tag LOCUS_03120 153989 154822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 154988 156505 gene locus_tag LOCUS_03130 154988 156505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 156998 157624 gene locus_tag LOCUS_03140 156998 157624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03140 157576 158358 gene locus_tag LOCUS_03150 157576 158358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 158531 158361 gene locus_tag LOCUS_03160 158531 158361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 158709 159041 gene locus_tag LOCUS_03170 158709 159041 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 protein_id gnl|my_center|LOCUS_03170 159168 161225 gene locus_tag LOCUS_03180 159168 161225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 161227 161682 gene locus_tag LOCUS_03190 161227 161682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 161906 161989 gene locus_tag LOCUS_t00040 161906 161989 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 162029 162114 gene locus_tag LOCUS_t00050 162029 162114 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 162808 169068 gene locus_tag LOCUS_03200 162808 169068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 169926 169147 gene locus_tag LOCUS_03210 169926 169147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 170305 169976 gene locus_tag LOCUS_03220 170305 169976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 170535 171023 gene locus_tag LOCUS_03230 170535 171023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 171149 172309 gene locus_tag LOCUS_03240 gene rmgQ 171149 172309 CDS product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 protein_id gnl|my_center|LOCUS_03240 172434 172793 gene locus_tag LOCUS_03250 172434 172793 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244448.1 protein_id gnl|my_center|LOCUS_03250 173013 173471 gene locus_tag LOCUS_03260 173013 173471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 173634 175760 gene locus_tag LOCUS_03270 173634 175760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 176199 176693 gene locus_tag LOCUS_03280 176199 176693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 176690 176983 gene locus_tag LOCUS_03290 176690 176983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 177127 177267 gene locus_tag LOCUS_03300 177127 177267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 177332 177577 gene locus_tag LOCUS_03310 177332 177577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 179472 177634 gene locus_tag LOCUS_03320 179472 177634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_03320 181322 179469 gene locus_tag LOCUS_03330 181322 179469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_03330 182072 181422 gene locus_tag LOCUS_03340 182072 181422 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 protein_id gnl|my_center|LOCUS_03340 182779 182081 gene locus_tag LOCUS_03350 182779 182081 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_03350 184574 183351 gene locus_tag LOCUS_03360 184574 183351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 185768 184647 gene locus_tag LOCUS_03370 185768 184647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 185986 185801 gene locus_tag LOCUS_03380 185986 185801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence03 73 252 gene locus_tag LOCUS_03390 73 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 316 939 gene locus_tag LOCUS_03400 316 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 1077 2465 gene locus_tag LOCUS_03410 1077 2465 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_03410 2550 5612 gene locus_tag LOCUS_03420 2550 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 5696 7381 gene locus_tag LOCUS_03430 5696 7381 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_03430 7488 10154 gene locus_tag LOCUS_03440 gene alaS 7488 10154 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_03440 10315 10491 gene locus_tag LOCUS_03450 gene rpsU 10315 10491 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_03450 10634 11794 gene locus_tag LOCUS_03460 10634 11794 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965363.1 protein_id gnl|my_center|LOCUS_03460 11852 12703 gene locus_tag LOCUS_03470 11852 12703 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_03470 12781 13536 gene locus_tag LOCUS_03480 12781 13536 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_03480 13584 14153 gene locus_tag LOCUS_03490 gene scpB 13584 14153 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_03490 14226 15788 gene locus_tag LOCUS_03500 14226 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 15935 17365 gene locus_tag LOCUS_03510 15935 17365 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_03510 17384 18175 gene locus_tag LOCUS_03520 17384 18175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 18238 18600 gene locus_tag LOCUS_03530 18238 18600 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_03530 18659 19810 gene locus_tag LOCUS_03540 18659 19810 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_03540 19869 21296 gene locus_tag LOCUS_03550 19869 21296 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_03550 21670 23238 gene locus_tag LOCUS_03560 21670 23238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 23397 24113 gene locus_tag LOCUS_03570 23397 24113 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249459.1 protein_id gnl|my_center|LOCUS_03570 24152 25717 gene locus_tag LOCUS_03580 24152 25717 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_03580 25723 25953 gene locus_tag LOCUS_03590 25723 25953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 25955 27547 gene locus_tag LOCUS_03600 25955 27547 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_03600 27568 28605 gene locus_tag LOCUS_03610 27568 28605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 28619 29194 gene locus_tag LOCUS_03620 28619 29194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 29295 29104 gene locus_tag LOCUS_03630 29295 29104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 29583 30146 gene locus_tag LOCUS_03640 29583 30146 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 protein_id gnl|my_center|LOCUS_03640 30230 31156 gene locus_tag LOCUS_03650 30230 31156 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_03650 31260 32447 gene locus_tag LOCUS_03660 31260 32447 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_03660 32584 33279 gene locus_tag LOCUS_03670 gene cmk 32584 33279 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640590.1 protein_id gnl|my_center|LOCUS_03670 33263 34147 gene locus_tag LOCUS_03680 33263 34147 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_03680 34128 35258 gene locus_tag LOCUS_03690 gene rpsA 34128 35258 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_03690 35325 36104 gene locus_tag LOCUS_03700 gene cheR 35325 36104 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582884.1 protein_id gnl|my_center|LOCUS_03700 37344 36241 gene locus_tag LOCUS_03710 37344 36241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 37811 39154 gene locus_tag LOCUS_03720 gene rsxC 37811 39154 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_03720 39151 40107 gene locus_tag LOCUS_03730 39151 40107 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_03730 40097 40735 gene locus_tag LOCUS_03740 40097 40735 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_03740 40728 41456 gene locus_tag LOCUS_03750 40728 41456 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_03750 41457 42062 gene locus_tag LOCUS_03760 gene rsxA 41457 42062 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_03760 42226 43023 gene locus_tag LOCUS_03770 42226 43023 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_03770 43141 44235 gene locus_tag LOCUS_03780 43141 44235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 45072 44248 gene locus_tag LOCUS_03790 45072 44248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 45618 46265 gene locus_tag LOCUS_03800 45618 46265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 46369 47664 gene locus_tag LOCUS_03810 46369 47664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 47704 48870 gene locus_tag LOCUS_03820 47704 48870 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_03820 48899 50383 gene locus_tag LOCUS_03830 gene thrC 48899 50383 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_03830 50512 52116 gene locus_tag LOCUS_03840 gene pckA 50512 52116 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_03840 52335 52991 gene locus_tag LOCUS_03850 gene deoC 52335 52991 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_03850 53076 54866 gene locus_tag LOCUS_03860 53076 54866 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_03860 56105 54951 gene locus_tag LOCUS_03870 56105 54951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 56494 58458 gene locus_tag LOCUS_03880 56494 58458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 58471 59316 gene locus_tag LOCUS_03890 58471 59316 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_03890 59690 60733 gene locus_tag LOCUS_03900 gene pheS 59690 60733 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458978.1 protein_id gnl|my_center|LOCUS_03900 60790 63210 gene locus_tag LOCUS_03910 gene pheT 60790 63210 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_03910 63281 64708 gene locus_tag LOCUS_03920 63281 64708 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_03920 64722 65753 gene locus_tag LOCUS_03930 gene queA 64722 65753 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_03930 65872 67737 gene locus_tag LOCUS_03940 65872 67737 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_03940 67737 68144 gene locus_tag LOCUS_03950 67737 68144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 68173 68736 gene locus_tag LOCUS_03960 68173 68736 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460983.1 protein_id gnl|my_center|LOCUS_03960 69851 68751 gene locus_tag LOCUS_03970 gene tyrA 69851 68751 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_03970 70768 69920 gene locus_tag LOCUS_03980 70768 69920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 70980 71990 gene locus_tag LOCUS_03990 70980 71990 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803841.1 protein_id gnl|my_center|LOCUS_03990 72012 73166 gene locus_tag LOCUS_04000 72012 73166 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_04000 73290 74174 gene locus_tag LOCUS_04010 73290 74174 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_04010 74310 76403 gene locus_tag LOCUS_04020 gene fusA 74310 76403 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_04020 77065 79479 gene locus_tag LOCUS_04030 gene leuS 77065 79479 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_04030 79630 80172 gene locus_tag LOCUS_04040 79630 80172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 80197 80682 gene locus_tag LOCUS_04050 80197 80682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 80998 80726 gene locus_tag LOCUS_04060 80998 80726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 81566 81090 gene locus_tag LOCUS_04070 81566 81090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 82018 81788 gene locus_tag LOCUS_04080 82018 81788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 82156 83370 gene locus_tag LOCUS_04090 82156 83370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 83376 88676 gene locus_tag LOCUS_04100 83376 88676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 88777 90951 gene locus_tag LOCUS_04110 88777 90951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 91062 91970 gene locus_tag LOCUS_04120 91062 91970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 92321 92758 gene locus_tag LOCUS_04130 92321 92758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 92910 94349 gene locus_tag LOCUS_04140 92910 94349 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_04140 94336 95031 gene locus_tag LOCUS_04150 94336 95031 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_04150 95028 96248 gene locus_tag LOCUS_04160 95028 96248 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_04160 96317 96967 gene locus_tag LOCUS_04170 96317 96967 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_04170 97070 97678 gene locus_tag LOCUS_04180 97070 97678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 97746 99266 gene locus_tag LOCUS_04190 97746 99266 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_04190 99263 100429 gene locus_tag LOCUS_04200 gene alr 99263 100429 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_04200 100524 100865 gene locus_tag LOCUS_04210 100524 100865 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_04210 100973 102364 gene locus_tag LOCUS_04220 100973 102364 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_04220 102438 103166 gene locus_tag LOCUS_04230 102438 103166 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_04230 103179 104141 gene locus_tag LOCUS_04240 103179 104141 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_04240 104145 105740 gene locus_tag LOCUS_04250 104145 105740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 105973 106233 gene locus_tag LOCUS_04260 105973 106233 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054876196.1 protein_id gnl|my_center|LOCUS_04260 106233 106499 gene locus_tag LOCUS_04270 106233 106499 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812414.1 protein_id gnl|my_center|LOCUS_04270 106793 107503 gene locus_tag LOCUS_04280 gene tepA 106793 107503 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_04280 107610 107897 gene locus_tag LOCUS_04290 107610 107897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 107928 110123 gene locus_tag LOCUS_04300 107928 110123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 110156 111064 gene locus_tag LOCUS_04310 110156 111064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 111086 112933 gene locus_tag LOCUS_04320 111086 112933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 112956 114503 gene locus_tag LOCUS_04330 gene pelF 112956 114503 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_04330 114530 116038 gene locus_tag LOCUS_04340 gene pelG 114530 116038 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964053.1 protein_id gnl|my_center|LOCUS_04340 116042 116428 gene locus_tag LOCUS_04350 116042 116428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 116425 117627 gene locus_tag LOCUS_04360 116425 117627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 117662 118417 gene locus_tag LOCUS_04370 117662 118417 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_04370 118460 119776 gene locus_tag LOCUS_04380 118460 119776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 119808 122264 gene locus_tag LOCUS_04390 119808 122264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 122261 124012 gene locus_tag LOCUS_04400 122261 124012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 124021 125046 gene locus_tag LOCUS_04410 124021 125046 CDS product stealth conserved region 3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207631.1 protein_id gnl|my_center|LOCUS_04410 125056 126597 gene locus_tag LOCUS_04420 125056 126597 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_04420 126615 127826 gene locus_tag LOCUS_04430 126615 127826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 129051 127867 gene locus_tag LOCUS_04440 129051 127867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 129239 130591 gene locus_tag LOCUS_04450 129239 130591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 130733 131074 gene locus_tag LOCUS_04460 130733 131074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 131138 131581 gene locus_tag LOCUS_04470 131138 131581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 131731 133497 gene locus_tag LOCUS_04480 131731 133497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014601368.1 protein_id gnl|my_center|LOCUS_04480 133535 133966 gene locus_tag LOCUS_04490 133535 133966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 134048 134869 gene locus_tag LOCUS_04500 134048 134869 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_04500 134896 135111 gene locus_tag LOCUS_04510 134896 135111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 135108 135587 gene locus_tag LOCUS_04520 135108 135587 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_04520 135590 135817 gene locus_tag LOCUS_04530 135590 135817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 135853 137055 gene locus_tag LOCUS_04540 135853 137055 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_04540 137270 138517 gene locus_tag LOCUS_04550 gene tyrS 137270 138517 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_04550 138567 138851 gene locus_tag LOCUS_04560 138567 138851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 138856 139047 gene locus_tag LOCUS_04570 138856 139047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 139303 139605 gene locus_tag LOCUS_04580 139303 139605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 139713 140153 gene locus_tag LOCUS_04590 139713 140153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 140247 141563 gene locus_tag LOCUS_04600 140247 141563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 141697 143037 gene locus_tag LOCUS_04610 141697 143037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 143197 146349 gene locus_tag LOCUS_04620 143197 146349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 146451 147932 gene locus_tag LOCUS_04630 gene spoIVA 146451 147932 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_04630 148071 150419 gene locus_tag LOCUS_04640 148071 150419 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178939948.1 protein_id gnl|my_center|LOCUS_04640 150472 151236 gene locus_tag LOCUS_04650 150472 151236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_04650 151411 152070 gene locus_tag LOCUS_04660 151411 152070 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_04660 152067 153302 gene locus_tag LOCUS_04670 152067 153302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 153441 154277 gene locus_tag LOCUS_04680 153441 154277 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_04680 154379 154837 gene locus_tag LOCUS_04690 154379 154837 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_04690 154834 156267 gene locus_tag LOCUS_04700 154834 156267 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460449.1 protein_id gnl|my_center|LOCUS_04700 156273 158009 gene locus_tag LOCUS_04710 156273 158009 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 protein_id gnl|my_center|LOCUS_04710 158152 159141 gene locus_tag LOCUS_04720 158152 159141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 159161 160663 gene locus_tag LOCUS_04730 159161 160663 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_04730 160688 161659 gene locus_tag LOCUS_04740 160688 161659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 161817 161987 gene locus_tag LOCUS_04750 161817 161987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 161989 163020 gene locus_tag LOCUS_04760 161989 163020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 163290 165479 gene locus_tag LOCUS_04770 gene nrdD 163290 165479 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_04770 165743 166300 gene locus_tag LOCUS_04780 gene nrdG 165743 166300 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_04780 166374 166886 gene locus_tag LOCUS_04790 166374 166886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 166938 167447 gene locus_tag LOCUS_04800 166938 167447 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701992.1 protein_id gnl|my_center|LOCUS_04800 167591 169009 gene locus_tag LOCUS_04810 167591 169009 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_04810 169144 170013 gene locus_tag LOCUS_04820 169144 170013 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_04820 170020 171720 gene locus_tag LOCUS_04830 170020 171720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 172039 172386 gene locus_tag LOCUS_04840 172039 172386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 172383 172562 gene locus_tag LOCUS_04850 172383 172562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 172671 174368 gene locus_tag LOCUS_04860 gene pdcA 172671 174368 CDS product c-di-GMP phosphodiesterase PdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902545.1 protein_id gnl|my_center|LOCUS_04860 174921 174580 gene locus_tag LOCUS_04870 174921 174580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 175091 174921 gene locus_tag LOCUS_04880 175091 174921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 176742 175201 gene locus_tag LOCUS_04890 176742 175201 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965254.1 protein_id gnl|my_center|LOCUS_04890 177026 176847 gene locus_tag LOCUS_04900 177026 176847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 177318 177683 gene locus_tag LOCUS_04910 177318 177683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 177680 178402 gene locus_tag LOCUS_04920 177680 178402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence04 119 871 gene locus_tag LOCUS_04930 119 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 2000 1152 gene locus_tag LOCUS_04940 2000 1152 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_04940 3471 2122 gene locus_tag LOCUS_04950 3471 2122 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_04950 5038 3680 gene locus_tag LOCUS_04960 5038 3680 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814289.1 protein_id gnl|my_center|LOCUS_04960 5324 5785 gene locus_tag LOCUS_04970 5324 5785 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_04970 5955 7304 gene locus_tag LOCUS_04980 5955 7304 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_04980 7403 8710 gene locus_tag LOCUS_04990 7403 8710 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_04990 10917 8869 gene locus_tag LOCUS_05000 10917 8869 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_05000 11503 10973 gene locus_tag LOCUS_05010 11503 10973 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390781.1 protein_id gnl|my_center|LOCUS_05010 12376 11564 gene locus_tag LOCUS_05020 12376 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 12627 13397 gene locus_tag LOCUS_05030 12627 13397 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963754.1 protein_id gnl|my_center|LOCUS_05030 14852 13476 gene locus_tag LOCUS_05040 14852 13476 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_05040 15189 16598 gene locus_tag LOCUS_05050 gene rhaB 15189 16598 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243094.1 protein_id gnl|my_center|LOCUS_05050 16620 17876 gene locus_tag LOCUS_05060 gene rhaA 16620 17876 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_05060 17929 18789 gene locus_tag LOCUS_05070 gene rhaD 17929 18789 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209103.1 protein_id gnl|my_center|LOCUS_05070 18802 19275 gene locus_tag LOCUS_05080 18802 19275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 19334 20683 gene locus_tag LOCUS_05090 19334 20683 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_05090 20798 21940 gene locus_tag LOCUS_05100 20798 21940 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390161.1 protein_id gnl|my_center|LOCUS_05100 22523 21867 gene locus_tag LOCUS_05110 22523 21867 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_05110 22644 25127 gene locus_tag LOCUS_05120 22644 25127 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_05120 25270 25704 gene locus_tag LOCUS_05130 25270 25704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 25744 27504 gene locus_tag LOCUS_05140 25744 27504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_05140 27504 29336 gene locus_tag LOCUS_05150 27504 29336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_05150 29350 29949 gene locus_tag LOCUS_05160 29350 29949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 30040 30672 gene locus_tag LOCUS_05170 30040 30672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 30699 31598 gene locus_tag LOCUS_05180 30699 31598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262272.1 protein_id gnl|my_center|LOCUS_05180 31579 32364 gene locus_tag LOCUS_05190 31579 32364 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 protein_id gnl|my_center|LOCUS_05190 32518 33033 gene locus_tag LOCUS_05200 32518 33033 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422477.1 protein_id gnl|my_center|LOCUS_05200 33180 34562 gene locus_tag LOCUS_05210 33180 34562 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966858.1 protein_id gnl|my_center|LOCUS_05210 34576 35121 gene locus_tag LOCUS_05220 34576 35121 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895379.1 protein_id gnl|my_center|LOCUS_05220 35180 35653 gene locus_tag LOCUS_05230 35180 35653 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680818.1 protein_id gnl|my_center|LOCUS_05230 35828 37120 gene locus_tag LOCUS_05240 35828 37120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 37217 38794 gene locus_tag LOCUS_05250 37217 38794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 38851 39867 gene locus_tag LOCUS_05260 38851 39867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 39854 40171 gene locus_tag LOCUS_05270 39854 40171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 40245 41087 gene locus_tag LOCUS_05280 40245 41087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 41227 42105 gene locus_tag LOCUS_05290 41227 42105 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_05290 42134 42571 gene locus_tag LOCUS_05300 42134 42571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 43509 42652 gene locus_tag LOCUS_05310 43509 42652 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965896.1 protein_id gnl|my_center|LOCUS_05310 43741 44601 gene locus_tag LOCUS_05320 gene kduI 43741 44601 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 protein_id gnl|my_center|LOCUS_05320 44629 45435 gene locus_tag LOCUS_05330 44629 45435 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_05330 45521 46156 gene locus_tag LOCUS_05340 45521 46156 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 protein_id gnl|my_center|LOCUS_05340 46279 47238 gene locus_tag LOCUS_05350 46279 47238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 47331 48362 gene locus_tag LOCUS_05360 47331 48362 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_05360 48459 48544 gene locus_tag LOCUS_t00060 48459 48544 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48705 49808 gene locus_tag LOCUS_05370 48705 49808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 49798 49941 gene locus_tag LOCUS_05380 49798 49941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 49981 50493 gene locus_tag LOCUS_05390 49981 50493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 50645 51061 gene locus_tag LOCUS_05400 50645 51061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 51222 51791 gene locus_tag LOCUS_05410 51222 51791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 52888 51926 gene locus_tag LOCUS_05420 52888 51926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 53428 52973 gene locus_tag LOCUS_05430 53428 52973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 54150 53503 gene locus_tag LOCUS_05440 54150 53503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 55303 54128 gene locus_tag LOCUS_05450 55303 54128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 55533 56018 gene locus_tag LOCUS_05460 55533 56018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272655.1 protein_id gnl|my_center|LOCUS_05460 57332 56061 gene locus_tag LOCUS_05470 57332 56061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 57937 57545 gene locus_tag LOCUS_05480 57937 57545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 58210 58782 gene locus_tag LOCUS_05490 58210 58782 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134795.1 protein_id gnl|my_center|LOCUS_05490 58825 59517 gene locus_tag LOCUS_05500 58825 59517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615312.1 protein_id gnl|my_center|LOCUS_05500 59529 60677 gene locus_tag LOCUS_05510 59529 60677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493179.1 protein_id gnl|my_center|LOCUS_05510 60838 60999 gene locus_tag LOCUS_05520 60838 60999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 61093 63423 gene locus_tag LOCUS_05530 61093 63423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_05530 63580 64161 gene locus_tag LOCUS_05540 63580 64161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 64228 66459 gene locus_tag LOCUS_05550 64228 66459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_05550 66574 68106 gene locus_tag LOCUS_05560 66574 68106 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_05560 68103 68774 gene locus_tag LOCUS_05570 68103 68774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 68803 70854 gene locus_tag LOCUS_05580 68803 70854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 70946 71488 gene locus_tag LOCUS_05590 70946 71488 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_05590 71649 71574 gene locus_tag LOCUS_t00070 71649 71574 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 71706 73502 gene locus_tag LOCUS_05600 71706 73502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 73590 74141 gene locus_tag LOCUS_05610 73590 74141 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_05610 74484 76445 gene locus_tag LOCUS_05620 74484 76445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 76471 77136 gene locus_tag LOCUS_05630 76471 77136 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963693.1 protein_id gnl|my_center|LOCUS_05630 77133 78143 gene locus_tag LOCUS_05640 77133 78143 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_05640 78215 78973 gene locus_tag LOCUS_05650 78215 78973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860752.1 protein_id gnl|my_center|LOCUS_05650 78960 80924 gene locus_tag LOCUS_05660 78960 80924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860751.1 protein_id gnl|my_center|LOCUS_05660 81061 82263 gene locus_tag LOCUS_05670 81061 82263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 82349 82432 gene locus_tag LOCUS_t00080 82349 82432 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 82510 83823 gene locus_tag LOCUS_05680 82510 83823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_05680 83825 84532 gene locus_tag LOCUS_05690 83825 84532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 84591 85490 gene locus_tag LOCUS_05700 84591 85490 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142502.1 protein_id gnl|my_center|LOCUS_05700 85622 86626 gene locus_tag LOCUS_05710 85622 86626 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_05710 86641 88413 gene locus_tag LOCUS_05720 gene dnaG 86641 88413 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_05720 88469 89581 gene locus_tag LOCUS_05730 gene rpoD 88469 89581 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_05730 89578 90363 gene locus_tag LOCUS_05740 89578 90363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 90492 92153 gene locus_tag LOCUS_05750 90492 92153 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_05750 93106 92195 gene locus_tag LOCUS_05760 93106 92195 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555352.1 protein_id gnl|my_center|LOCUS_05760 93090 94685 gene locus_tag LOCUS_05770 93090 94685 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_05770 94711 96189 gene locus_tag LOCUS_05780 94711 96189 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055010987.1 protein_id gnl|my_center|LOCUS_05780 96236 97201 gene locus_tag LOCUS_05790 96236 97201 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_05790 97849 98661 gene locus_tag LOCUS_05800 97849 98661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 98830 99000 gene locus_tag LOCUS_05810 98830 99000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 99061 99978 gene locus_tag LOCUS_05820 99061 99978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_05820 100930 100040 gene locus_tag LOCUS_05830 100930 100040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 101206 101820 gene locus_tag LOCUS_05840 101206 101820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 101979 103046 gene locus_tag LOCUS_05850 101979 103046 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_05850 103074 104006 gene locus_tag LOCUS_05860 103074 104006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 104003 104758 gene locus_tag LOCUS_05870 104003 104758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 104788 105912 gene locus_tag LOCUS_05880 104788 105912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 106067 106762 gene locus_tag LOCUS_05890 106067 106762 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_05890 106762 108849 gene locus_tag LOCUS_05900 106762 108849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 109141 110004 gene locus_tag LOCUS_05910 109141 110004 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_05910 110873 110436 gene locus_tag LOCUS_05920 110873 110436 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_05920 111960 111049 gene locus_tag LOCUS_05930 gene pyrB 111960 111049 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_05930 112568 112029 gene locus_tag LOCUS_05940 112568 112029 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_05940 112816 113190 gene locus_tag LOCUS_05950 112816 113190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 113678 113262 gene locus_tag LOCUS_05960 113678 113262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 113925 115220 gene locus_tag LOCUS_05970 113925 115220 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_05970 115222 115803 gene locus_tag LOCUS_05980 gene folE 115222 115803 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459178.1 protein_id gnl|my_center|LOCUS_05980 115793 116278 gene locus_tag LOCUS_05990 115793 116278 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_05990 116356 117171 gene locus_tag LOCUS_06000 gene folP 116356 117171 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_06000 117171 118049 gene locus_tag LOCUS_06010 gene folK 117171 118049 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_06010 118534 118007 gene locus_tag LOCUS_06020 118534 118007 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_06020 118957 118547 gene locus_tag LOCUS_06030 118957 118547 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948150.1 protein_id gnl|my_center|LOCUS_06030 119029 120078 gene locus_tag LOCUS_06040 119029 120078 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_06040 120234 120683 gene locus_tag LOCUS_06050 120234 120683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 121616 120687 gene locus_tag LOCUS_06060 121616 120687 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578518.1 protein_id gnl|my_center|LOCUS_06060 122705 121698 gene locus_tag LOCUS_06070 122705 121698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 122830 123954 gene locus_tag LOCUS_06080 gene pheA 122830 123954 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_06080 124073 125380 gene locus_tag LOCUS_06090 124073 125380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_06090 125449 126993 gene locus_tag LOCUS_06100 125449 126993 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_06100 127001 129124 gene locus_tag LOCUS_06110 127001 129124 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_06110 129121 129723 gene locus_tag LOCUS_06120 129121 129723 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_06120 129716 130387 gene locus_tag LOCUS_06130 129716 130387 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_06130 130495 130788 gene locus_tag LOCUS_06140 130495 130788 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679244.1 protein_id gnl|my_center|LOCUS_06140 130778 131092 gene locus_tag LOCUS_06150 130778 131092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 131235 131498 gene locus_tag LOCUS_06160 131235 131498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 131539 132330 gene locus_tag LOCUS_06170 131539 132330 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_06170 132337 133053 gene locus_tag LOCUS_06180 132337 133053 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_06180 133235 135151 gene locus_tag LOCUS_06190 133235 135151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680888.1 protein_id gnl|my_center|LOCUS_06190 135144 136967 gene locus_tag LOCUS_06200 135144 136967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_06200 138023 136986 gene locus_tag LOCUS_06210 138023 136986 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 protein_id gnl|my_center|LOCUS_06210 138288 138470 gene locus_tag LOCUS_06220 138288 138470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 138415 139365 gene locus_tag LOCUS_06230 138415 139365 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_06230 139378 140304 gene locus_tag LOCUS_06240 139378 140304 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_06240 140388 142175 gene locus_tag LOCUS_06250 140388 142175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 142396 143448 gene locus_tag LOCUS_06260 gene yesR 142396 143448 CDS product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 protein_id gnl|my_center|LOCUS_06260 143496 145682 gene locus_tag LOCUS_06270 gene gnpA 143496 145682 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_06270 146607 145687 gene locus_tag LOCUS_06280 146607 145687 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_06280 148260 146623 gene locus_tag LOCUS_06290 148260 146623 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_06290 148541 149926 gene locus_tag LOCUS_06300 148541 149926 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_06300 149959 150903 gene locus_tag LOCUS_06310 149959 150903 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363043.1 protein_id gnl|my_center|LOCUS_06310 150984 151769 gene locus_tag LOCUS_06320 150984 151769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 151785 153578 gene locus_tag LOCUS_06330 151785 153578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_06330 153575 155344 gene locus_tag LOCUS_06340 153575 155344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350502.1 protein_id gnl|my_center|LOCUS_06340 155575 158205 gene locus_tag LOCUS_06350 gene ppdK 155575 158205 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_06350 158696 160012 gene locus_tag LOCUS_06360 158696 160012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 <161031 160515 gene locus_tag LOCUS_06370 <161031 160515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000037684.1:metallophosphoesterase >Feature sequence05 1959 109 gene locus_tag LOCUS_06380 1959 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2187 3338 gene locus_tag LOCUS_06390 2187 3338 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948019.1 protein_id gnl|my_center|LOCUS_06390 3427 3942 gene locus_tag LOCUS_06400 3427 3942 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357273.1 protein_id gnl|my_center|LOCUS_06400 5278 3944 gene locus_tag LOCUS_06410 5278 3944 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_06410 6253 5291 gene locus_tag LOCUS_06420 6253 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 6646 7431 gene locus_tag LOCUS_06430 6646 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 8772 7456 gene locus_tag LOCUS_06440 8772 7456 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_06440 9467 8769 gene locus_tag LOCUS_06450 9467 8769 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_06450 11515 9701 gene locus_tag LOCUS_06460 11515 9701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_06460 13305 11512 gene locus_tag LOCUS_06470 13305 11512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_06470 14203 13481 gene locus_tag LOCUS_06480 14203 13481 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948429.1 protein_id gnl|my_center|LOCUS_06480 14427 14212 gene locus_tag LOCUS_06490 14427 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 15678 14440 gene locus_tag LOCUS_06500 gene glyA 15678 14440 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_06500 15837 16772 gene locus_tag LOCUS_06510 15837 16772 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674458.1 protein_id gnl|my_center|LOCUS_06510 16930 17616 gene locus_tag LOCUS_06520 16930 17616 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713769.1 protein_id gnl|my_center|LOCUS_06520 17627 18622 gene locus_tag LOCUS_06530 17627 18622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 19061 18630 gene locus_tag LOCUS_06540 19061 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 20147 19119 gene locus_tag LOCUS_06550 20147 19119 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_06550 22027 20213 gene locus_tag LOCUS_06560 22027 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 23064 22066 gene locus_tag LOCUS_06570 23064 22066 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_06570 23692 23138 gene locus_tag LOCUS_06580 23692 23138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 24181 23792 gene locus_tag LOCUS_06590 24181 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 25006 24308 gene locus_tag LOCUS_06600 25006 24308 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_06600 25846 25019 gene locus_tag LOCUS_06610 25846 25019 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_06610 26226 25855 gene locus_tag LOCUS_06620 26226 25855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_06620 27783 26440 gene locus_tag LOCUS_06630 27783 26440 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_06630 29202 27823 gene locus_tag LOCUS_06640 29202 27823 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_06640 31393 29303 gene locus_tag LOCUS_06650 gene pnp 31393 29303 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06650 31920 31654 gene locus_tag LOCUS_06660 gene rpsO 31920 31654 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111957.1 protein_id gnl|my_center|LOCUS_06660 33691 32096 gene locus_tag LOCUS_06670 33691 32096 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994209.1 protein_id gnl|my_center|LOCUS_06670 35070 33712 gene locus_tag LOCUS_06680 35070 33712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 35401 36345 gene locus_tag LOCUS_06690 35401 36345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 37224 36340 gene locus_tag LOCUS_06700 37224 36340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_06700 37924 37178 gene locus_tag LOCUS_06710 37924 37178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_06710 40734 37924 gene locus_tag LOCUS_06720 40734 37924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 42872 40734 gene locus_tag LOCUS_06730 42872 40734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 43966 42872 gene locus_tag LOCUS_06740 43966 42872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 44979 44068 gene locus_tag LOCUS_06750 44979 44068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 45502 45122 gene locus_tag LOCUS_06760 45502 45122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 47120 45609 gene locus_tag LOCUS_06770 47120 45609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 48232 47225 gene locus_tag LOCUS_06780 48232 47225 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_06780 49133 48225 gene locus_tag LOCUS_06790 49133 48225 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_06790 51769 49172 gene locus_tag LOCUS_06800 51769 49172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 52459 51806 gene locus_tag LOCUS_06810 52459 51806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06810 53976 52477 gene locus_tag LOCUS_06820 53976 52477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06820 54902 53994 gene locus_tag LOCUS_06830 54902 53994 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_06830 55842 54904 gene locus_tag LOCUS_06840 55842 54904 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_06840 58817 55854 gene locus_tag LOCUS_06850 58817 55854 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_06850 59137 59982 gene locus_tag LOCUS_06860 59137 59982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 60449 60129 gene locus_tag LOCUS_06870 60449 60129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 62509 60536 gene locus_tag LOCUS_06880 gene thrS 62509 60536 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_06880 62790 62506 gene locus_tag LOCUS_06890 62790 62506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 63687 63169 gene locus_tag LOCUS_06900 63687 63169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 64640 63927 gene locus_tag LOCUS_06910 64640 63927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 65609 64776 gene locus_tag LOCUS_06920 65609 64776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 66477 65827 gene locus_tag LOCUS_06930 66477 65827 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678955.1 protein_id gnl|my_center|LOCUS_06930 67120 66542 gene locus_tag LOCUS_06940 67120 66542 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 protein_id gnl|my_center|LOCUS_06940 68109 67219 gene locus_tag LOCUS_06950 68109 67219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 69227 68247 gene locus_tag LOCUS_06960 69227 68247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 71240 69495 gene locus_tag LOCUS_06970 71240 69495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_06970 71481 71224 gene locus_tag LOCUS_06980 71481 71224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06980 72990 71497 gene locus_tag LOCUS_06990 72990 71497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679750.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06990 73656 73081 gene locus_tag LOCUS_07000 73656 73081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 77908 73685 gene locus_tag LOCUS_07010 77908 73685 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272590.1 protein_id gnl|my_center|LOCUS_07010 80223 78079 gene locus_tag LOCUS_07020 80223 78079 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_07020 82189 80330 gene locus_tag LOCUS_07030 82189 80330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 83387 82218 gene locus_tag LOCUS_07040 83387 82218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 84940 83411 gene locus_tag LOCUS_07050 84940 83411 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_07050 87041 84993 gene locus_tag LOCUS_07060 87041 84993 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964908.1 protein_id gnl|my_center|LOCUS_07060 88483 87074 gene locus_tag LOCUS_07070 88483 87074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 88673 88518 gene locus_tag LOCUS_07080 88673 88518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 91664 88710 gene locus_tag LOCUS_07090 91664 88710 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_07090 95062 91697 gene locus_tag LOCUS_07100 95062 91697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 96251 95178 gene locus_tag LOCUS_07110 gene uxuA 96251 95178 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_07110 98257 96395 gene locus_tag LOCUS_07120 98257 96395 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229046.1 protein_id gnl|my_center|LOCUS_07120 99208 98315 gene locus_tag LOCUS_07130 99208 98315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 101461 99740 gene locus_tag LOCUS_07140 101461 99740 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_07140 102933 101485 gene locus_tag LOCUS_07150 gene glgA 102933 101485 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_07150 103558 103043 gene locus_tag LOCUS_07160 103558 103043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 103899 104876 gene locus_tag LOCUS_07170 gene holA 103899 104876 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 protein_id gnl|my_center|LOCUS_07170 105849 104860 gene locus_tag LOCUS_07180 105849 104860 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_07180 106945 105851 gene locus_tag LOCUS_07190 106945 105851 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_07190 108548 106986 gene locus_tag LOCUS_07200 108548 106986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_07200 109963 108704 gene locus_tag LOCUS_07210 109963 108704 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_07210 110247 110840 gene locus_tag LOCUS_07220 110247 110840 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_07220 111394 110846 gene locus_tag LOCUS_07230 111394 110846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 112116 111574 gene locus_tag LOCUS_07240 112116 111574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 114440 112113 gene locus_tag LOCUS_07250 114440 112113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 115419 114454 gene locus_tag LOCUS_07260 115419 114454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 116893 115433 gene locus_tag LOCUS_07270 116893 115433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 117610 116906 gene locus_tag LOCUS_07280 117610 116906 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_07280 118297 117680 gene locus_tag LOCUS_07290 118297 117680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 118841 118410 gene locus_tag LOCUS_07300 118841 118410 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_07300 120341 118947 gene locus_tag LOCUS_07310 120341 118947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 121543 120338 gene locus_tag LOCUS_07320 121543 120338 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_07320 122454 121558 gene locus_tag LOCUS_07330 gene argB 122454 121558 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_07330 123705 122482 gene locus_tag LOCUS_07340 gene argJ 123705 122482 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 protein_id gnl|my_center|LOCUS_07340 124187 123726 gene locus_tag LOCUS_07350 124187 123726 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_07350 125078 124227 gene locus_tag LOCUS_07360 125078 124227 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_07360 125924 125082 gene locus_tag LOCUS_07370 125924 125082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 126499 125948 gene locus_tag LOCUS_07380 126499 125948 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_07380 126828 126903 gene locus_tag LOCUS_t00090 126828 126903 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 128640 126907 gene locus_tag LOCUS_07390 128640 126907 CDS product DUF6044 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245165.1 protein_id gnl|my_center|LOCUS_07390 129787 128729 gene locus_tag LOCUS_07400 gene argC 129787 128729 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_07400 130092 131315 gene locus_tag LOCUS_07410 130092 131315 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_07410 131325 131588 gene locus_tag LOCUS_07420 131325 131588 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_07420 132300 132157 gene locus_tag LOCUS_07430 132300 132157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 132440 132297 gene locus_tag LOCUS_07440 132440 132297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 133025 132621 gene locus_tag LOCUS_07450 133025 132621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 134884 133145 gene locus_tag LOCUS_07460 134884 133145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 136972 134993 gene locus_tag LOCUS_07470 136972 134993 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226188.1 protein_id gnl|my_center|LOCUS_07470 137174 138097 gene locus_tag LOCUS_07480 137174 138097 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_07480 138966 138130 gene locus_tag LOCUS_07490 138966 138130 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 protein_id gnl|my_center|LOCUS_07490 139183 139689 gene locus_tag LOCUS_07500 139183 139689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 140049 139693 gene locus_tag LOCUS_07510 gene spoVAE 140049 139693 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_07510 141095 140148 gene locus_tag LOCUS_07520 141095 140148 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_07520 141777 141277 gene locus_tag LOCUS_07530 gene thrB 141777 141277 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939791.1 protein_id gnl|my_center|LOCUS_07530 142331 141957 gene locus_tag LOCUS_07540 142331 141957 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_07540 142673 142428 gene locus_tag LOCUS_07550 142673 142428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 144338 142758 gene locus_tag LOCUS_07560 144338 142758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 145400 144417 gene locus_tag LOCUS_07570 145400 144417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942807.1 protein_id gnl|my_center|LOCUS_07570 145765 145517 gene locus_tag LOCUS_07580 145765 145517 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809987.1 protein_id gnl|my_center|LOCUS_07580 146789 145872 gene locus_tag LOCUS_07590 146789 145872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 149428 147074 gene locus_tag LOCUS_07600 gene yicI 149428 147074 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964400.1 protein_id gnl|my_center|LOCUS_07600 151245 149752 gene locus_tag LOCUS_07610 151245 149752 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_07610 151719 151252 gene locus_tag LOCUS_07620 151719 151252 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287575.1 protein_id gnl|my_center|LOCUS_07620 152994 151924 gene locus_tag LOCUS_07630 gene spoVAD 152994 151924 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_07630 154125 153082 gene locus_tag LOCUS_07640 154125 153082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 155200 154115 gene locus_tag LOCUS_07650 gene trpS 155200 154115 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence06 76 151 gene locus_tag LOCUS_t00100 76 151 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 469 260 gene locus_tag LOCUS_07660 469 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 626 886 gene locus_tag LOCUS_07670 626 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2018 999 gene locus_tag LOCUS_07680 2018 999 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_07680 3085 2015 gene locus_tag LOCUS_07690 3085 2015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_07690 4223 3102 gene locus_tag LOCUS_07700 4223 3102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082547.1 protein_id gnl|my_center|LOCUS_07700 5353 4223 gene locus_tag LOCUS_07710 5353 4223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972421.1 protein_id gnl|my_center|LOCUS_07710 7567 5480 gene locus_tag LOCUS_07720 7567 5480 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582700.1 protein_id gnl|my_center|LOCUS_07720 7938 9560 gene locus_tag LOCUS_07730 7938 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 9578 12859 gene locus_tag LOCUS_07740 9578 12859 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085775.1 protein_id gnl|my_center|LOCUS_07740 12873 14585 gene locus_tag LOCUS_07750 12873 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 14693 15490 gene locus_tag LOCUS_07760 14693 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 15487 16677 gene locus_tag LOCUS_07770 15487 16677 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_07770 16713 17708 gene locus_tag LOCUS_07780 gene iolC 16713 17708 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068622.1 protein_id gnl|my_center|LOCUS_07780 17722 19650 gene locus_tag LOCUS_07790 gene iolD 17722 19650 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_07790 19717 20625 gene locus_tag LOCUS_07800 gene iolE 19717 20625 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_07800 20647 21660 gene locus_tag LOCUS_07810 gene iolG 20647 21660 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_07810 21674 22444 gene locus_tag LOCUS_07820 21674 22444 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_07820 22476 23417 gene locus_tag LOCUS_07830 22476 23417 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_07830 23773 23558 gene locus_tag LOCUS_07840 23773 23558 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355647.1 protein_id gnl|my_center|LOCUS_07840 24042 24722 gene locus_tag LOCUS_07850 24042 24722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 24846 25421 gene locus_tag LOCUS_07860 24846 25421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 25418 25558 gene locus_tag LOCUS_07870 25418 25558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 25551 26459 gene locus_tag LOCUS_07880 25551 26459 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_07880 26456 27040 gene locus_tag LOCUS_07890 26456 27040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 27095 28180 gene locus_tag LOCUS_07900 27095 28180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 28359 28661 gene locus_tag LOCUS_07910 28359 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 28805 29167 gene locus_tag LOCUS_07920 28805 29167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 29256 32156 gene locus_tag LOCUS_07930 29256 32156 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_07930 32269 34854 gene locus_tag LOCUS_07940 gene clpB 32269 34854 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_07940 34871 35044 gene locus_tag LOCUS_07950 34871 35044 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_07950 35037 36332 gene locus_tag LOCUS_07960 35037 36332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 36473 37555 gene locus_tag LOCUS_07970 36473 37555 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_07970 37674 38045 gene locus_tag LOCUS_07980 37674 38045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 38090 39520 gene locus_tag LOCUS_07990 38090 39520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 39536 40615 gene locus_tag LOCUS_08000 39536 40615 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870462.1 protein_id gnl|my_center|LOCUS_08000 40677 41480 gene locus_tag LOCUS_08010 40677 41480 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_08010 41494 42513 gene locus_tag LOCUS_08020 41494 42513 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_08020 42543 42935 gene locus_tag LOCUS_08030 42543 42935 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_08030 42968 45100 gene locus_tag LOCUS_08040 42968 45100 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_08040 45104 45622 gene locus_tag LOCUS_08050 45104 45622 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_08050 45635 47437 gene locus_tag LOCUS_08060 45635 47437 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963447.1 protein_id gnl|my_center|LOCUS_08060 47577 48845 gene locus_tag LOCUS_08070 47577 48845 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679977.1 protein_id gnl|my_center|LOCUS_08070 48903 49676 gene locus_tag LOCUS_08080 48903 49676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 49843 50745 gene locus_tag LOCUS_08090 49843 50745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 50752 51633 gene locus_tag LOCUS_08100 50752 51633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 51633 52253 gene locus_tag LOCUS_08110 51633 52253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08110 52265 53977 gene locus_tag LOCUS_08120 52265 53977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 54220 54657 gene locus_tag LOCUS_08130 54220 54657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 54709 55764 gene locus_tag LOCUS_08140 54709 55764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 55791 56873 gene locus_tag LOCUS_08150 55791 56873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 57573 56890 gene locus_tag LOCUS_08160 57573 56890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 58142 57570 gene locus_tag LOCUS_08170 58142 57570 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 protein_id gnl|my_center|LOCUS_08170 58452 59915 gene locus_tag LOCUS_08180 58452 59915 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460986.1 protein_id gnl|my_center|LOCUS_08180 59976 61277 gene locus_tag LOCUS_08190 59976 61277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 61672 62088 gene locus_tag LOCUS_08200 61672 62088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 62200 63498 gene locus_tag LOCUS_08210 62200 63498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 63526 64236 gene locus_tag LOCUS_08220 63526 64236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 64282 66408 gene locus_tag LOCUS_08230 64282 66408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 66479 67885 gene locus_tag LOCUS_08240 66479 67885 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_08240 67888 69279 gene locus_tag LOCUS_08250 67888 69279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 70680 69418 gene locus_tag LOCUS_08260 70680 69418 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_08260 70979 72622 gene locus_tag LOCUS_08270 gene pdcA 70979 72622 CDS product c-di-GMP phosphodiesterase PdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902545.1 protein_id gnl|my_center|LOCUS_08270 72756 73325 gene locus_tag LOCUS_08280 72756 73325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 73345 74742 gene locus_tag LOCUS_08290 73345 74742 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_08290 74788 75927 gene locus_tag LOCUS_08300 74788 75927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 75952 77607 gene locus_tag LOCUS_08310 75952 77607 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_08310 77748 80825 gene locus_tag LOCUS_08320 77748 80825 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_08320 80875 80951 gene locus_tag LOCUS_t00110 80875 80951 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 81255 81860 gene locus_tag LOCUS_08330 81255 81860 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_08330 81899 82732 gene locus_tag LOCUS_08340 81899 82732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 82776 83018 gene locus_tag LOCUS_08350 82776 83018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 83232 83657 gene locus_tag LOCUS_08360 83232 83657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809316.1 protein_id gnl|my_center|LOCUS_08360 83636 83854 gene locus_tag LOCUS_08370 83636 83854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943656.1 protein_id gnl|my_center|LOCUS_08370 84083 85189 gene locus_tag LOCUS_08380 84083 85189 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_08380 85314 86069 gene locus_tag LOCUS_08390 85314 86069 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072245.1 protein_id gnl|my_center|LOCUS_08390 86082 86960 gene locus_tag LOCUS_08400 86082 86960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 87060 87245 gene locus_tag LOCUS_08410 87060 87245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 87151 88344 gene locus_tag LOCUS_08420 gene rlmD 87151 88344 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 protein_id gnl|my_center|LOCUS_08420 88555 89658 gene locus_tag LOCUS_08430 88555 89658 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_08430 89901 90047 gene locus_tag LOCUS_08440 89901 90047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 90070 90855 gene locus_tag LOCUS_08450 90070 90855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 90864 92363 gene locus_tag LOCUS_08460 90864 92363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 92426 94030 gene locus_tag LOCUS_08470 92426 94030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 94099 95361 gene locus_tag LOCUS_08480 94099 95361 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854514.1 protein_id gnl|my_center|LOCUS_08480 95629 96165 gene locus_tag LOCUS_08490 95629 96165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 96167 97189 gene locus_tag LOCUS_08500 gene ansA 96167 97189 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_08500 97319 97627 gene locus_tag LOCUS_08510 gene trxA 97319 97627 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_08510 97838 98989 gene locus_tag LOCUS_08520 97838 98989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 98976 99902 gene locus_tag LOCUS_08530 98976 99902 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858561.1 protein_id gnl|my_center|LOCUS_08530 100215 101507 gene locus_tag LOCUS_08540 100215 101507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 102333 101563 gene locus_tag LOCUS_08550 102333 101563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 103064 102330 gene locus_tag LOCUS_08560 103064 102330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994320.1 protein_id gnl|my_center|LOCUS_08560 103817 103071 gene locus_tag LOCUS_08570 103817 103071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138603.1 protein_id gnl|my_center|LOCUS_08570 104018 104722 gene locus_tag LOCUS_08580 104018 104722 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_08580 104724 106118 gene locus_tag LOCUS_08590 104724 106118 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399787.1 protein_id gnl|my_center|LOCUS_08590 106215 107207 gene locus_tag LOCUS_08600 106215 107207 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244946.1 protein_id gnl|my_center|LOCUS_08600 107215 108204 gene locus_tag LOCUS_08610 107215 108204 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259696.1 protein_id gnl|my_center|LOCUS_08610 108209 110188 gene locus_tag LOCUS_08620 108209 110188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 110213 110395 gene locus_tag LOCUS_08630 110213 110395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 110529 111341 gene locus_tag LOCUS_08640 110529 111341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 111488 111802 gene locus_tag LOCUS_08650 111488 111802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 111777 112547 gene locus_tag LOCUS_08660 111777 112547 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294261.1 protein_id gnl|my_center|LOCUS_08660 112549 113022 gene locus_tag LOCUS_08670 112549 113022 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_08670 113136 113792 gene locus_tag LOCUS_08680 113136 113792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 113888 114118 gene locus_tag LOCUS_08690 113888 114118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_08690 114243 114473 gene locus_tag LOCUS_08700 114243 114473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 114565 116364 gene locus_tag LOCUS_08710 114565 116364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 116464 119469 gene locus_tag LOCUS_08720 116464 119469 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259688.1 protein_id gnl|my_center|LOCUS_08720 119472 120383 gene locus_tag LOCUS_08730 119472 120383 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259689.1 protein_id gnl|my_center|LOCUS_08730 120398 121291 gene locus_tag LOCUS_08740 120398 121291 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_08740 121306 123348 gene locus_tag LOCUS_08750 121306 123348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259691.1 protein_id gnl|my_center|LOCUS_08750 123338 125770 gene locus_tag LOCUS_08760 123338 125770 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259692.1 protein_id gnl|my_center|LOCUS_08760 125763 126722 gene locus_tag LOCUS_08770 125763 126722 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259693.1 protein_id gnl|my_center|LOCUS_08770 126716 127660 gene locus_tag LOCUS_08780 126716 127660 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909515.1 protein_id gnl|my_center|LOCUS_08780 127834 128160 gene locus_tag LOCUS_08790 127834 128160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 128195 129235 gene locus_tag LOCUS_08800 128195 129235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 129261 132449 gene locus_tag LOCUS_08810 129261 132449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582531.1 protein_id gnl|my_center|LOCUS_08810 132538 135222 gene locus_tag LOCUS_08820 132538 135222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 135302 136054 gene locus_tag LOCUS_08830 135302 136054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 136146 137480 gene locus_tag LOCUS_08840 136146 137480 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_08840 137701 138990 gene locus_tag LOCUS_08850 137701 138990 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_08850 138987 139910 gene locus_tag LOCUS_08860 138987 139910 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_08860 140333 139932 gene locus_tag LOCUS_08870 140333 139932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 140564 141232 gene locus_tag LOCUS_08880 140564 141232 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_08880 142968 141271 gene locus_tag LOCUS_08890 142968 141271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 143581 144084 gene locus_tag LOCUS_08900 143581 144084 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_08900 144175 144996 gene locus_tag LOCUS_08910 144175 144996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 145056 145583 gene locus_tag LOCUS_08920 145056 145583 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 protein_id gnl|my_center|LOCUS_08920 145685 147991 gene locus_tag LOCUS_08930 145685 147991 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence07 1779 190 gene locus_tag LOCUS_08940 1779 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2415 1933 gene locus_tag LOCUS_08950 2415 1933 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_08950 4211 2487 gene locus_tag LOCUS_08960 4211 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5256 4273 gene locus_tag LOCUS_08970 5256 4273 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_08970 5702 5274 gene locus_tag LOCUS_08980 5702 5274 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_08980 6827 5727 gene locus_tag LOCUS_08990 6827 5727 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_08990 7055 7501 gene locus_tag LOCUS_09000 7055 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7572 7958 gene locus_tag LOCUS_09010 7572 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 8486 8013 gene locus_tag LOCUS_09020 8486 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 8636 11203 gene locus_tag LOCUS_09030 8636 11203 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925071.1 protein_id gnl|my_center|LOCUS_09030 11200 12816 gene locus_tag LOCUS_09040 11200 12816 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_09040 12830 13327 gene locus_tag LOCUS_09050 gene ilvN 12830 13327 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_09050 13694 14197 gene locus_tag LOCUS_09060 gene ilvN 13694 14197 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_09060 14325 15344 gene locus_tag LOCUS_09070 gene ilvC 14325 15344 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_09070 15611 16222 gene locus_tag LOCUS_09080 15611 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 16481 16996 gene locus_tag LOCUS_09090 16481 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 17016 18215 gene locus_tag LOCUS_09100 17016 18215 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_09100 18269 18979 gene locus_tag LOCUS_09110 18269 18979 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_09110 19036 21357 gene locus_tag LOCUS_09120 19036 21357 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_09120 21536 22795 gene locus_tag LOCUS_09130 gene leuC 21536 22795 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_09130 22862 23353 gene locus_tag LOCUS_09140 gene leuD 22862 23353 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_09140 23406 24809 gene locus_tag LOCUS_09150 23406 24809 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_09150 24806 25414 gene locus_tag LOCUS_09160 gene ruvA 24806 25414 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_09160 25426 26418 gene locus_tag LOCUS_09170 gene ruvB 25426 26418 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_09170 26516 26917 gene locus_tag LOCUS_09180 26516 26917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 26988 29231 gene locus_tag LOCUS_09190 26988 29231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 29333 29785 gene locus_tag LOCUS_09200 29333 29785 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_09200 30860 29805 gene locus_tag LOCUS_09210 30860 29805 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_09210 31088 30897 gene locus_tag LOCUS_09220 31088 30897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 31082 31411 gene locus_tag LOCUS_09230 31082 31411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 31399 32358 gene locus_tag LOCUS_09240 31399 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 32348 32764 gene locus_tag LOCUS_09250 32348 32764 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_09250 32811 32978 gene locus_tag LOCUS_09260 32811 32978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 33012 33560 gene locus_tag LOCUS_09270 33012 33560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 33916 33731 gene locus_tag LOCUS_09280 gene rpmB 33916 33731 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_09280 34118 34477 gene locus_tag LOCUS_09290 34118 34477 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_09290 34491 36155 gene locus_tag LOCUS_09300 34491 36155 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_09300 36246 38300 gene locus_tag LOCUS_09310 gene recG 36246 38300 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_09310 38349 39938 gene locus_tag LOCUS_09320 38349 39938 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_09320 39964 40830 gene locus_tag LOCUS_09330 39964 40830 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_09330 40853 42781 gene locus_tag LOCUS_09340 gene gyrB 40853 42781 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_09340 42824 45067 gene locus_tag LOCUS_09350 gene gyrA 42824 45067 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 protein_id gnl|my_center|LOCUS_09350 45101 45670 gene locus_tag LOCUS_09360 gene rsmD 45101 45670 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910569.1 protein_id gnl|my_center|LOCUS_09360 45692 46207 gene locus_tag LOCUS_09370 gene coaD 45692 46207 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_09370 46191 46793 gene locus_tag LOCUS_09380 46191 46793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 46862 48355 gene locus_tag LOCUS_09390 46862 48355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 49287 48310 gene locus_tag LOCUS_09400 gene ylbJ 49287 48310 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273082.1 protein_id gnl|my_center|LOCUS_09400 49393 50097 gene locus_tag LOCUS_09410 49393 50097 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229226.1 protein_id gnl|my_center|LOCUS_09410 50087 50758 gene locus_tag LOCUS_09420 50087 50758 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_09420 50780 51547 gene locus_tag LOCUS_09430 50780 51547 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083383.1 protein_id gnl|my_center|LOCUS_09430 51552 52136 gene locus_tag LOCUS_09440 51552 52136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 52182 53312 gene locus_tag LOCUS_09450 52182 53312 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_09450 53337 53510 gene locus_tag LOCUS_09460 53337 53510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 53514 53939 gene locus_tag LOCUS_09470 53514 53939 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016827.1 protein_id gnl|my_center|LOCUS_09470 54240 54785 gene locus_tag LOCUS_09480 gene recU 54240 54785 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_09480 54939 56051 gene locus_tag LOCUS_09490 54939 56051 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_09490 56089 56760 gene locus_tag LOCUS_09500 gene hisG 56089 56760 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_09500 56797 58086 gene locus_tag LOCUS_09510 gene hisD 56797 58086 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_09510 58113 58355 gene locus_tag LOCUS_09520 58113 58355 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809228.1 protein_id gnl|my_center|LOCUS_09520 58430 59017 gene locus_tag LOCUS_09530 gene hisB 58430 59017 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_09530 59052 60338 gene locus_tag LOCUS_09540 59052 60338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 60460 61761 gene locus_tag LOCUS_09550 60460 61761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 62023 65253 gene locus_tag LOCUS_09560 62023 65253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 65346 66014 gene locus_tag LOCUS_09570 65346 66014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 66369 66025 gene locus_tag LOCUS_09580 66369 66025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 66570 68801 gene locus_tag LOCUS_09590 66570 68801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 68845 70749 gene locus_tag LOCUS_09600 68845 70749 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_09600 70858 71694 gene locus_tag LOCUS_09610 70858 71694 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_09610 71691 73073 gene locus_tag LOCUS_09620 gene rng 71691 73073 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_09620 73091 73645 gene locus_tag LOCUS_09630 73091 73645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 74397 73822 gene locus_tag LOCUS_09640 74397 73822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 75977 74508 gene locus_tag LOCUS_09650 75977 74508 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027392.1 protein_id gnl|my_center|LOCUS_09650 76630 76178 gene locus_tag LOCUS_09660 gene dtd 76630 76178 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_09660 77978 76602 gene locus_tag LOCUS_09670 77978 76602 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_09670 78653 78051 gene locus_tag LOCUS_09680 78653 78051 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_09680 78811 79530 gene locus_tag LOCUS_09690 78811 79530 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_09690 79551 80633 gene locus_tag LOCUS_09700 79551 80633 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_09700 81483 80665 gene locus_tag LOCUS_09710 81483 80665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023557.1 protein_id gnl|my_center|LOCUS_09710 81926 81519 gene locus_tag LOCUS_09720 81926 81519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 83485 82070 gene locus_tag LOCUS_09730 83485 82070 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_09730 83753 84592 gene locus_tag LOCUS_09740 83753 84592 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366218.1 protein_id gnl|my_center|LOCUS_09740 84712 85329 gene locus_tag LOCUS_09750 gene lexA 84712 85329 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_09750 85446 85664 gene locus_tag LOCUS_09760 85446 85664 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948188.1 protein_id gnl|my_center|LOCUS_09760 86079 85879 gene locus_tag LOCUS_09770 86079 85879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 87575 86199 gene locus_tag LOCUS_09780 87575 86199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 88008 87592 gene locus_tag LOCUS_09790 gene rsfS 88008 87592 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_09790 88614 88024 gene locus_tag LOCUS_09800 gene yqeK 88614 88024 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_09800 88949 88653 gene locus_tag LOCUS_09810 gene yhbY 88949 88653 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_09810 90275 88983 gene locus_tag LOCUS_09820 gene obgE 90275 88983 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_09820 90624 90340 gene locus_tag LOCUS_09830 gene rpmA 90624 90340 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289452.1 protein_id gnl|my_center|LOCUS_09830 90903 90628 gene locus_tag LOCUS_09840 90903 90628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 91265 90957 gene locus_tag LOCUS_09850 gene rplU 91265 90957 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_09850 92093 91470 gene locus_tag LOCUS_09860 92093 91470 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_09860 93116 92202 gene locus_tag LOCUS_09870 93116 92202 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_09870 93667 93125 gene locus_tag LOCUS_09880 gene lspA 93667 93125 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922145.1 protein_id gnl|my_center|LOCUS_09880 94769 93660 gene locus_tag LOCUS_09890 gene aroB 94769 93660 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_09890 95367 94846 gene locus_tag LOCUS_09900 95367 94846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 96074 95379 gene locus_tag LOCUS_09910 96074 95379 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_09910 97322 96153 gene locus_tag LOCUS_09920 97322 96153 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_09920 98194 97517 gene locus_tag LOCUS_09930 98194 97517 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552750.1 protein_id gnl|my_center|LOCUS_09930 99669 98260 gene locus_tag LOCUS_09940 99669 98260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 100171 99752 gene locus_tag LOCUS_09950 100171 99752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_09950 101227 100241 gene locus_tag LOCUS_09960 101227 100241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 101606 101211 gene locus_tag LOCUS_09970 101606 101211 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_09970 102732 101620 gene locus_tag LOCUS_09980 gene rodA 102732 101620 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_09980 103048 102764 gene locus_tag LOCUS_09990 gene minE 103048 102764 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 protein_id gnl|my_center|LOCUS_09990 103881 103060 gene locus_tag LOCUS_10000 gene minD 103881 103060 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_10000 104618 103926 gene locus_tag LOCUS_10010 104618 103926 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428479.1 protein_id gnl|my_center|LOCUS_10010 107516 104631 gene locus_tag LOCUS_10020 107516 104631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 108027 107509 gene locus_tag LOCUS_10030 108027 107509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 108908 108045 gene locus_tag LOCUS_10040 108908 108045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 109915 108905 gene locus_tag LOCUS_10050 109915 108905 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_10050 110708 109995 gene locus_tag LOCUS_10060 gene radC 110708 109995 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706793.1 protein_id gnl|my_center|LOCUS_10060 111010 110771 gene locus_tag LOCUS_10070 111010 110771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 112471 111170 gene locus_tag LOCUS_10080 112471 111170 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_10080 113463 112492 gene locus_tag LOCUS_10090 gene miaA 113463 112492 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965140.1 protein_id gnl|my_center|LOCUS_10090 115514 113460 gene locus_tag LOCUS_10100 gene mutL 115514 113460 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516269.1 protein_id gnl|my_center|LOCUS_10100 118434 115744 gene locus_tag LOCUS_10110 gene mutS 118434 115744 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_10110 120816 118648 gene locus_tag LOCUS_10120 120816 118648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 123085 120971 gene locus_tag LOCUS_10130 123085 120971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 125468 123249 gene locus_tag LOCUS_10140 125468 123249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 127489 125465 gene locus_tag LOCUS_10150 127489 125465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 129108 127585 gene locus_tag LOCUS_10160 129108 127585 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679112.1 protein_id gnl|my_center|LOCUS_10160 130630 129152 gene locus_tag LOCUS_10170 gene miaB 130630 129152 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_10170 131872 130643 gene locus_tag LOCUS_10180 gene pepT 131872 130643 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_10180 133432 131978 gene locus_tag LOCUS_10190 133432 131978 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_10190 134600 133494 gene locus_tag LOCUS_10200 134600 133494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 136095 134563 gene locus_tag LOCUS_10210 136095 134563 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_10210 136802 136137 gene locus_tag LOCUS_10220 136802 136137 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_10220 137010 136861 gene locus_tag LOCUS_10230 137010 136861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 137644 139974 gene locus_tag LOCUS_10240 137644 139974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 140065 140232 gene locus_tag LOCUS_10250 140065 140232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 140232 140486 gene locus_tag LOCUS_10260 gene cotJB 140232 140486 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_10260 140487 141062 gene locus_tag LOCUS_10270 140487 141062 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_10270 141528 142019 gene locus_tag LOCUS_10280 141528 142019 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_10280 142010 142777 gene locus_tag LOCUS_10290 142010 142777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 142765 143688 gene locus_tag LOCUS_10300 142765 143688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207717.1 protein_id gnl|my_center|LOCUS_10300 143796 144440 gene locus_tag LOCUS_10310 143796 144440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 144453 145184 gene locus_tag LOCUS_10320 144453 145184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 145220 145393 gene locus_tag LOCUS_10330 145220 145393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence08 95 5761 gene locus_tag LOCUS_10340 95 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6153 5863 gene locus_tag LOCUS_10350 6153 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 6372 6653 gene locus_tag LOCUS_10360 6372 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 9497 6768 gene locus_tag LOCUS_10370 9497 6768 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_10370 9669 10313 gene locus_tag LOCUS_10380 9669 10313 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_10380 10454 11806 gene locus_tag LOCUS_10390 gene mgtE 10454 11806 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_10390 11823 12665 gene locus_tag LOCUS_10400 11823 12665 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_10400 12724 13392 gene locus_tag LOCUS_10410 12724 13392 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814547.1 protein_id gnl|my_center|LOCUS_10410 13424 14425 gene locus_tag LOCUS_10420 13424 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836887.1 protein_id gnl|my_center|LOCUS_10420 14749 15036 gene locus_tag LOCUS_10430 gene groES 14749 15036 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_10430 15083 16705 gene locus_tag LOCUS_10440 gene groL 15083 16705 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_10440 16997 17170 gene locus_tag LOCUS_10450 16997 17170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 17177 18001 gene locus_tag LOCUS_10460 17177 18001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 18008 18928 gene locus_tag LOCUS_10470 18008 18928 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 protein_id gnl|my_center|LOCUS_10470 18978 19892 gene locus_tag LOCUS_10480 18978 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 19849 20673 gene locus_tag LOCUS_10490 19849 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 20890 21351 gene locus_tag LOCUS_10500 20890 21351 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_10500 21428 22150 gene locus_tag LOCUS_10510 21428 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 22172 23872 gene locus_tag LOCUS_10520 22172 23872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012914013.1 protein_id gnl|my_center|LOCUS_10520 23951 27382 gene locus_tag LOCUS_10530 23951 27382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 27691 28371 gene locus_tag LOCUS_10540 27691 28371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 28420 30207 gene locus_tag LOCUS_10550 28420 30207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 30174 30788 gene locus_tag LOCUS_10560 30174 30788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 30785 31168 gene locus_tag LOCUS_10570 30785 31168 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_10570 31205 32974 gene locus_tag LOCUS_10580 31205 32974 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 protein_id gnl|my_center|LOCUS_10580 32988 33419 gene locus_tag LOCUS_10590 32988 33419 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_10590 33437 33805 gene locus_tag LOCUS_10600 33437 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_10600 33826 33978 gene locus_tag LOCUS_10610 33826 33978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 33996 34427 gene locus_tag LOCUS_10620 33996 34427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 34482 34796 gene locus_tag LOCUS_10630 34482 34796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 34812 35462 gene locus_tag LOCUS_10640 34812 35462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 35513 36604 gene locus_tag LOCUS_10650 35513 36604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 36715 37512 gene locus_tag LOCUS_10660 36715 37512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 37529 37900 gene locus_tag LOCUS_10670 37529 37900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 38059 40122 gene locus_tag LOCUS_10680 38059 40122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 40091 41812 gene locus_tag LOCUS_10690 40091 41812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 41833 42837 gene locus_tag LOCUS_10700 41833 42837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 42866 44800 gene locus_tag LOCUS_10710 42866 44800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 45005 45895 gene locus_tag LOCUS_10720 45005 45895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 45962 46222 gene locus_tag LOCUS_10730 45962 46222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 46364 46642 gene locus_tag LOCUS_10740 46364 46642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 47077 47541 gene locus_tag LOCUS_10750 47077 47541 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_10750 47645 48916 gene locus_tag LOCUS_10760 gene nusA 47645 48916 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460395.1 protein_id gnl|my_center|LOCUS_10760 48925 49197 gene locus_tag LOCUS_10770 48925 49197 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_10770 49184 49549 gene locus_tag LOCUS_10780 49184 49549 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286523.1 protein_id gnl|my_center|LOCUS_10780 49536 52634 gene locus_tag LOCUS_10790 49536 52634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 52669 53067 gene locus_tag LOCUS_10800 gene rbfA 52669 53067 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_10800 53045 54001 gene locus_tag LOCUS_10810 53045 54001 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_10810 54032 54928 gene locus_tag LOCUS_10820 gene truB 54032 54928 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_10820 54989 55909 gene locus_tag LOCUS_10830 54989 55909 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_10830 55946 57592 gene locus_tag LOCUS_10840 55946 57592 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_10840 57938 58984 gene locus_tag LOCUS_10850 57938 58984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 59310 59867 gene locus_tag LOCUS_10860 gene infC 59310 59867 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_10860 59930 60127 gene locus_tag LOCUS_10870 gene rpmI 59930 60127 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_10870 60153 60509 gene locus_tag LOCUS_10880 gene rplT 60153 60509 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_10880 60639 61418 gene locus_tag LOCUS_10890 60639 61418 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_10890 61524 61596 gene locus_tag LOCUS_t00120 61524 61596 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 62504 61719 gene locus_tag LOCUS_10900 62504 61719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 62609 62538 gene locus_tag LOCUS_t00130 62609 62538 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 63816 62752 gene locus_tag LOCUS_10910 63816 62752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083206.1 protein_id gnl|my_center|LOCUS_10910 65316 63856 gene locus_tag LOCUS_10920 65316 63856 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_10920 65411 65632 gene locus_tag LOCUS_10930 65411 65632 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_10930 65625 66641 gene locus_tag LOCUS_10940 65625 66641 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074343.1 protein_id gnl|my_center|LOCUS_10940 68284 66638 gene locus_tag LOCUS_10950 68284 66638 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074344.1 protein_id gnl|my_center|LOCUS_10950 68503 69129 gene locus_tag LOCUS_10960 68503 69129 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220164.1 protein_id gnl|my_center|LOCUS_10960 69175 71409 gene locus_tag LOCUS_10970 69175 71409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 72058 71396 gene locus_tag LOCUS_10980 72058 71396 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_10980 74105 72093 gene locus_tag LOCUS_10990 74105 72093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 74344 75387 gene locus_tag LOCUS_11000 74344 75387 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235612.1 protein_id gnl|my_center|LOCUS_11000 76220 75393 gene locus_tag LOCUS_11010 76220 75393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 78381 76213 gene locus_tag LOCUS_11020 78381 76213 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_11020 78673 79116 gene locus_tag LOCUS_11030 78673 79116 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964547.1 protein_id gnl|my_center|LOCUS_11030 79208 80425 gene locus_tag LOCUS_11040 79208 80425 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_11040 80495 81814 gene locus_tag LOCUS_11050 80495 81814 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_11050 81833 82072 gene locus_tag LOCUS_11060 81833 82072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 82291 83625 gene locus_tag LOCUS_11070 82291 83625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 83652 84749 gene locus_tag LOCUS_11080 83652 84749 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_11080 84809 86203 gene locus_tag LOCUS_11090 84809 86203 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_11090 86223 88037 gene locus_tag LOCUS_11100 86223 88037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 89465 88026 gene locus_tag LOCUS_11110 89465 88026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 89706 89633 gene locus_tag LOCUS_t00140 89706 89633 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 89946 91547 gene locus_tag LOCUS_11120 89946 91547 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_11120 91694 92497 gene locus_tag LOCUS_11130 91694 92497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 92579 93427 gene locus_tag LOCUS_11140 92579 93427 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_11140 93554 94048 gene locus_tag LOCUS_11150 gene dfrA 93554 94048 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_11150 94171 95202 gene locus_tag LOCUS_11160 94171 95202 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_11160 95261 96337 gene locus_tag LOCUS_11170 95261 96337 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_11170 96533 98680 gene locus_tag LOCUS_11180 gene htpG 96533 98680 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_11180 98785 99960 gene locus_tag LOCUS_11190 98785 99960 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_11190 100052 101797 gene locus_tag LOCUS_11200 100052 101797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 103897 101813 gene locus_tag LOCUS_11210 103897 101813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 105510 104068 gene locus_tag LOCUS_11220 gene sleC 105510 104068 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_11220 105647 106036 gene locus_tag LOCUS_11230 105647 106036 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_11230 106033 106734 gene locus_tag LOCUS_11240 106033 106734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_11240 106728 107621 gene locus_tag LOCUS_11250 106728 107621 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262156.1 protein_id gnl|my_center|LOCUS_11250 107833 107932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 108011 108868 gene locus_tag LOCUS_11260 108011 108868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 109011 112583 gene locus_tag LOCUS_11270 109011 112583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 112607 113884 gene locus_tag LOCUS_11280 112607 113884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 113894 114748 gene locus_tag LOCUS_11290 113894 114748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 114848 116020 gene locus_tag LOCUS_11300 114848 116020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 116101 117525 gene locus_tag LOCUS_11310 gene purF 116101 117525 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_11310 117562 119013 gene locus_tag LOCUS_11320 gene purB 117562 119013 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_11320 119006 119149 gene locus_tag LOCUS_11330 119006 119149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 119177 120583 gene locus_tag LOCUS_11340 119177 120583 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_11340 121915 120587 gene locus_tag LOCUS_11350 121915 120587 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_11350 122595 121912 gene locus_tag LOCUS_11360 122595 121912 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_11360 122764 123480 gene locus_tag LOCUS_11370 122764 123480 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_11370 123473 124168 gene locus_tag LOCUS_11380 123473 124168 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_11380 124158 124319 gene locus_tag LOCUS_11390 124158 124319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 124366 126219 gene locus_tag LOCUS_11400 124366 126219 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_11400 126461 128218 gene locus_tag LOCUS_11410 126461 128218 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_11410 128222 129757 gene locus_tag LOCUS_11420 128222 129757 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068837.1 protein_id gnl|my_center|LOCUS_11420 129803 131065 gene locus_tag LOCUS_11430 129803 131065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 131124 132110 gene locus_tag LOCUS_11440 131124 132110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 132157 132312 gene locus_tag LOCUS_11450 132157 132312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence09 385 1155 gene locus_tag LOCUS_11460 gene hag 385 1155 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_11460 1326 1715 gene locus_tag LOCUS_11470 1326 1715 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948264.1 protein_id gnl|my_center|LOCUS_11470 1749 2147 gene locus_tag LOCUS_11480 1749 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 4607 2184 gene locus_tag LOCUS_11490 4607 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 4751 4981 gene locus_tag LOCUS_11500 4751 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 5031 6200 gene locus_tag LOCUS_11510 5031 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6239 6907 gene locus_tag LOCUS_11520 6239 6907 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860384.1 protein_id gnl|my_center|LOCUS_11520 6897 8099 gene locus_tag LOCUS_11530 6897 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 8194 8829 gene locus_tag LOCUS_11540 gene nth 8194 8829 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_11540 8952 10094 gene locus_tag LOCUS_11550 8952 10094 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_11550 10184 11488 gene locus_tag LOCUS_11560 10184 11488 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986425.1 protein_id gnl|my_center|LOCUS_11560 11518 11811 gene locus_tag LOCUS_11570 11518 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 11896 13116 gene locus_tag LOCUS_11580 gene yqfD 11896 13116 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_11580 13113 14135 gene locus_tag LOCUS_11590 13113 14135 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_11590 14122 15327 gene locus_tag LOCUS_11600 14122 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 15311 15826 gene locus_tag LOCUS_11610 gene ybeY 15311 15826 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_11610 15830 17434 gene locus_tag LOCUS_11620 15830 17434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 17542 18234 gene locus_tag LOCUS_11630 17542 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 18285 19526 gene locus_tag LOCUS_11640 18285 19526 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_11640 19530 21206 gene locus_tag LOCUS_11650 19530 21206 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_11650 21305 22171 gene locus_tag LOCUS_11660 gene proB 21305 22171 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_11660 22214 22432 gene locus_tag LOCUS_11670 22214 22432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 22446 22985 gene locus_tag LOCUS_11680 22446 22985 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_11680 23015 24262 gene locus_tag LOCUS_11690 23015 24262 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_11690 24313 25233 gene locus_tag LOCUS_11700 24313 25233 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 protein_id gnl|my_center|LOCUS_11700 25355 25906 gene locus_tag LOCUS_11710 25355 25906 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_11710 26037 27497 gene locus_tag LOCUS_11720 gene gltX 26037 27497 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_11720 27484 29487 gene locus_tag LOCUS_11730 gene pcrA 27484 29487 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 protein_id gnl|my_center|LOCUS_11730 29837 29499 gene locus_tag LOCUS_11740 29837 29499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 30047 31420 gene locus_tag LOCUS_11750 30047 31420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 32781 31417 gene locus_tag LOCUS_11760 32781 31417 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_11760 32965 34845 gene locus_tag LOCUS_11770 32965 34845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 34881 35468 gene locus_tag LOCUS_11780 34881 35468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 35543 35704 gene locus_tag LOCUS_11790 35543 35704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 35668 35847 gene locus_tag LOCUS_11800 35668 35847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 36741 35962 gene locus_tag LOCUS_11810 36741 35962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 37216 36734 gene locus_tag LOCUS_11820 37216 36734 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_11820 37677 37231 gene locus_tag LOCUS_11830 37677 37231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 37965 39014 gene locus_tag LOCUS_11840 37965 39014 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368569.1 protein_id gnl|my_center|LOCUS_11840 39589 39170 gene locus_tag LOCUS_11850 39589 39170 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_11850 40806 39676 gene locus_tag LOCUS_11860 gene aroC 40806 39676 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_11860 41417 41770 gene locus_tag LOCUS_11870 41417 41770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 41932 42417 gene locus_tag LOCUS_11880 41932 42417 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282554.1 protein_id gnl|my_center|LOCUS_11880 42454 43050 gene locus_tag LOCUS_11890 42454 43050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 43105 44634 gene locus_tag LOCUS_11900 43105 44634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 45106 45999 gene locus_tag LOCUS_11910 45106 45999 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682246.1 protein_id gnl|my_center|LOCUS_11910 46135 47217 gene locus_tag LOCUS_11920 46135 47217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 47221 48357 gene locus_tag LOCUS_11930 gene tgt 47221 48357 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_11930 48467 48820 gene locus_tag LOCUS_11940 gene yajC 48467 48820 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073008.1 protein_id gnl|my_center|LOCUS_11940 48955 50040 gene locus_tag LOCUS_11950 gene leuB 48955 50040 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940244.1 protein_id gnl|my_center|LOCUS_11950 50177 51847 gene locus_tag LOCUS_11960 gene ilvD 50177 51847 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_11960 51909 53591 gene locus_tag LOCUS_11970 gene ilvB 51909 53591 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_11970 53604 55013 gene locus_tag LOCUS_11980 53604 55013 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_11980 55116 56198 gene locus_tag LOCUS_11990 gene serC 55116 56198 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_11990 56210 57391 gene locus_tag LOCUS_12000 56210 57391 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_12000 57494 58456 gene locus_tag LOCUS_12010 57494 58456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 58477 58977 gene locus_tag LOCUS_12020 58477 58977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 58943 59137 gene locus_tag LOCUS_12030 58943 59137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 59431 59147 gene locus_tag LOCUS_12040 59431 59147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 59648 60883 gene locus_tag LOCUS_12050 59648 60883 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_12050 60939 63215 gene locus_tag LOCUS_12060 gene glgB 60939 63215 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_12060 63217 64107 gene locus_tag LOCUS_12070 63217 64107 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_12070 64204 64276 gene locus_tag LOCUS_t00150 64204 64276 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 65186 64371 gene locus_tag LOCUS_12080 65186 64371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229090.1 protein_id gnl|my_center|LOCUS_12080 66024 65170 gene locus_tag LOCUS_12090 66024 65170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_12090 66140 67630 gene locus_tag LOCUS_12100 gene argH 66140 67630 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_12100 67703 68791 gene locus_tag LOCUS_12110 gene asd 67703 68791 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_12110 68816 70552 gene locus_tag LOCUS_12120 68816 70552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 70592 71935 gene locus_tag LOCUS_12130 70592 71935 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_12130 71940 74051 gene locus_tag LOCUS_12140 71940 74051 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_12140 74102 74779 gene locus_tag LOCUS_12150 74102 74779 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_12150 74928 77135 gene locus_tag LOCUS_12160 74928 77135 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_12160 77139 78161 gene locus_tag LOCUS_12170 77139 78161 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530527.1 protein_id gnl|my_center|LOCUS_12170 78176 79501 gene locus_tag LOCUS_12180 78176 79501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 79724 81247 gene locus_tag LOCUS_12190 79724 81247 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582688.1 protein_id gnl|my_center|LOCUS_12190 81275 81961 gene locus_tag LOCUS_12200 81275 81961 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057487.1 protein_id gnl|my_center|LOCUS_12200 82014 84953 gene locus_tag LOCUS_12210 82014 84953 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_12210 84971 85936 gene locus_tag LOCUS_12220 84971 85936 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_12220 85936 86814 gene locus_tag LOCUS_12230 85936 86814 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_12230 86869 88362 gene locus_tag LOCUS_12240 86869 88362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12240 88355 88987 gene locus_tag LOCUS_12250 88355 88987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 89000 91363 gene locus_tag LOCUS_12260 89000 91363 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 protein_id gnl|my_center|LOCUS_12260 91364 92296 gene locus_tag LOCUS_12270 91364 92296 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_12270 92314 93306 gene locus_tag LOCUS_12280 92314 93306 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_12280 93359 95263 gene locus_tag LOCUS_12290 93359 95263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 95360 96976 gene locus_tag LOCUS_12300 95360 96976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 97153 98175 gene locus_tag LOCUS_12310 97153 98175 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_12310 98386 99399 gene locus_tag LOCUS_12320 98386 99399 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964143.1 protein_id gnl|my_center|LOCUS_12320 99472 100698 gene locus_tag LOCUS_12330 99472 100698 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_12330 100695 101867 gene locus_tag LOCUS_12340 100695 101867 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_12340 101920 102972 gene locus_tag LOCUS_12350 101920 102972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 102985 104118 gene locus_tag LOCUS_12360 102985 104118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 104111 106414 gene locus_tag LOCUS_12370 104111 106414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 106584 107090 gene locus_tag LOCUS_12380 106584 107090 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053228394.1 protein_id gnl|my_center|LOCUS_12380 107087 108472 gene locus_tag LOCUS_12390 107087 108472 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_12390 111796 108500 gene locus_tag LOCUS_12400 111796 108500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 112073 112765 gene locus_tag LOCUS_12410 112073 112765 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_12410 112815 113825 gene locus_tag LOCUS_12420 112815 113825 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_12420 114902 114351 gene locus_tag LOCUS_12430 114902 114351 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_12430 115245 115027 gene locus_tag LOCUS_12440 115245 115027 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_12440 115669 116490 gene locus_tag LOCUS_12450 115669 116490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 118585 116579 gene locus_tag LOCUS_12460 118585 116579 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986325.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence10 1935 541 gene locus_tag LOCUS_12470 1935 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2263 3651 gene locus_tag LOCUS_12480 2263 3651 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_12480 3792 5558 gene locus_tag LOCUS_12490 3792 5558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 protein_id gnl|my_center|LOCUS_12490 5562 7343 gene locus_tag LOCUS_12500 5562 7343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732216.1 protein_id gnl|my_center|LOCUS_12500 7359 9473 gene locus_tag LOCUS_12510 7359 9473 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_12510 11205 9517 gene locus_tag LOCUS_12520 gene pdcB 11205 9517 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_12520 11407 13212 gene locus_tag LOCUS_12530 11407 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 14216 13350 gene locus_tag LOCUS_12540 14216 13350 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680535.1 protein_id gnl|my_center|LOCUS_12540 14600 14830 gene locus_tag LOCUS_12550 gene acpP 14600 14830 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_12550 14830 15768 gene locus_tag LOCUS_12560 gene fabK 14830 15768 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_12560 15761 16675 gene locus_tag LOCUS_12570 gene fabD 15761 16675 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_12570 16779 17537 gene locus_tag LOCUS_12580 gene fabG 16779 17537 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_12580 17557 18792 gene locus_tag LOCUS_12590 gene fabF 17557 18792 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_12590 18809 19237 gene locus_tag LOCUS_12600 gene fabZ 18809 19237 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356286.1 protein_id gnl|my_center|LOCUS_12600 19327 21129 gene locus_tag LOCUS_12610 19327 21129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 21181 22143 gene locus_tag LOCUS_12620 21181 22143 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_12620 22191 22628 gene locus_tag LOCUS_12630 22191 22628 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455488.1 protein_id gnl|my_center|LOCUS_12630 22632 24191 gene locus_tag LOCUS_12640 gene cls 22632 24191 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_12640 24289 24849 gene locus_tag LOCUS_12650 24289 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 24846 25724 gene locus_tag LOCUS_12660 24846 25724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 26475 25765 gene locus_tag LOCUS_12670 26475 25765 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462080.1 protein_id gnl|my_center|LOCUS_12670 27202 26465 gene locus_tag LOCUS_12680 27202 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 27122 27523 gene locus_tag LOCUS_12690 27122 27523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 28580 27669 gene locus_tag LOCUS_12700 28580 27669 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_12700 29008 29211 gene locus_tag LOCUS_12710 29008 29211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 29222 29434 gene locus_tag LOCUS_12720 29222 29434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 29431 29820 gene locus_tag LOCUS_12730 29431 29820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 30099 31112 gene locus_tag LOCUS_12740 30099 31112 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964535.1 protein_id gnl|my_center|LOCUS_12740 31109 32014 gene locus_tag LOCUS_12750 31109 32014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040412236.1 protein_id gnl|my_center|LOCUS_12750 32028 32768 gene locus_tag LOCUS_12760 32028 32768 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217650.1 protein_id gnl|my_center|LOCUS_12760 32744 33028 gene locus_tag LOCUS_12770 32744 33028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 33000 33518 gene locus_tag LOCUS_12780 33000 33518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 33526 34200 gene locus_tag LOCUS_12790 33526 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 34197 35105 gene locus_tag LOCUS_12800 34197 35105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 35120 35428 gene locus_tag LOCUS_12810 35120 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 35443 35847 gene locus_tag LOCUS_12820 35443 35847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 35855 36265 gene locus_tag LOCUS_12830 35855 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 36258 37004 gene locus_tag LOCUS_12840 36258 37004 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217650.1 protein_id gnl|my_center|LOCUS_12840 37170 37997 gene locus_tag LOCUS_12850 37170 37997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 37987 38238 gene locus_tag LOCUS_12860 37987 38238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12860 38310 38570 gene locus_tag LOCUS_12870 38310 38570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 38554 39051 gene locus_tag LOCUS_12880 38554 39051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 39066 39668 gene locus_tag LOCUS_12890 39066 39668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 39711 40469 gene locus_tag LOCUS_12900 39711 40469 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385472.1 protein_id gnl|my_center|LOCUS_12900 40466 40636 gene locus_tag LOCUS_12910 40466 40636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 40640 41125 gene locus_tag LOCUS_12920 40640 41125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 41115 42062 gene locus_tag LOCUS_12930 41115 42062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 42085 42354 gene locus_tag LOCUS_12940 42085 42354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 42347 42523 gene locus_tag LOCUS_12950 42347 42523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 42483 42980 gene locus_tag LOCUS_12960 42483 42980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 43169 43606 gene locus_tag LOCUS_12970 43169 43606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 43914 44270 gene locus_tag LOCUS_12980 43914 44270 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988332.1 protein_id gnl|my_center|LOCUS_12980 44271 44741 gene locus_tag LOCUS_12990 44271 44741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 44725 46386 gene locus_tag LOCUS_13000 44725 46386 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286533.1 protein_id gnl|my_center|LOCUS_13000 46405 47562 gene locus_tag LOCUS_13010 46405 47562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 47559 48491 gene locus_tag LOCUS_13020 47559 48491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 48499 49902 gene locus_tag LOCUS_13030 48499 49902 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286525.1 protein_id gnl|my_center|LOCUS_13030 49959 50300 gene locus_tag LOCUS_13040 49959 50300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 50284 50628 gene locus_tag LOCUS_13050 50284 50628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 50615 51025 gene locus_tag LOCUS_13060 50615 51025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 51025 51339 gene locus_tag LOCUS_13070 51025 51339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 51346 52080 gene locus_tag LOCUS_13080 51346 52080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 52139 52528 gene locus_tag LOCUS_13090 52139 52528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 52612 52794 gene locus_tag LOCUS_13100 52612 52794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 52801 55941 gene locus_tag LOCUS_13110 52801 55941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 55946 56815 gene locus_tag LOCUS_13120 55946 56815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 56827 57924 gene locus_tag LOCUS_13130 56827 57924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 57942 59003 gene locus_tag LOCUS_13140 57942 59003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 59006 60844 gene locus_tag LOCUS_13150 59006 60844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 61198 62475 gene locus_tag LOCUS_13160 61198 62475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 62465 62827 gene locus_tag LOCUS_13170 62465 62827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 62824 63042 gene locus_tag LOCUS_13180 62824 63042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 63050 63577 gene locus_tag LOCUS_13190 63050 63577 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357842.1 protein_id gnl|my_center|LOCUS_13190 63663 63818 gene locus_tag LOCUS_13200 63663 63818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 63815 65350 gene locus_tag LOCUS_13210 63815 65350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 65512 65637 gene locus_tag LOCUS_13220 65512 65637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 65835 66029 gene locus_tag LOCUS_13230 65835 66029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 66694 66047 gene locus_tag LOCUS_13240 66694 66047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 66820 67065 gene locus_tag LOCUS_13250 66820 67065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 67116 68153 gene locus_tag LOCUS_13260 67116 68153 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_13260 68582 68899 gene locus_tag LOCUS_13270 gene rpsJ 68582 68899 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_13270 69030 69713 gene locus_tag LOCUS_13280 gene rplC 69030 69713 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_13280 69744 70364 gene locus_tag LOCUS_13290 gene rplD 69744 70364 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_13290 70364 70675 gene locus_tag LOCUS_13300 gene rplW 70364 70675 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_13300 70703 71545 gene locus_tag LOCUS_13310 gene rplB 70703 71545 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_13310 71564 71845 gene locus_tag LOCUS_13320 gene rpsS 71564 71845 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 protein_id gnl|my_center|LOCUS_13320 71953 72342 gene locus_tag LOCUS_13330 gene rplV 71953 72342 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 protein_id gnl|my_center|LOCUS_13330 72359 73018 gene locus_tag LOCUS_13340 gene rpsC 72359 73018 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_13340 73021 73449 gene locus_tag LOCUS_13350 gene rplP 73021 73449 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_13350 73449 73652 gene locus_tag LOCUS_13360 gene rpmC 73449 73652 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008216.1 protein_id gnl|my_center|LOCUS_13360 73679 73936 gene locus_tag LOCUS_13370 gene rpsQ 73679 73936 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_13370 73970 74338 gene locus_tag LOCUS_13380 gene rplN 73970 74338 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_13380 74351 74695 gene locus_tag LOCUS_13390 gene rplX 74351 74695 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_13390 74737 75279 gene locus_tag LOCUS_13400 gene rplE 74737 75279 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_13400 75294 75479 gene locus_tag LOCUS_13410 75294 75479 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357636.1 protein_id gnl|my_center|LOCUS_13410 75744 76145 gene locus_tag LOCUS_13420 gene rpsH 75744 76145 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_13420 76270 76812 gene locus_tag LOCUS_13430 gene rplF 76270 76812 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_13430 76833 77201 gene locus_tag LOCUS_13440 gene rplR 76833 77201 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_13440 77222 77731 gene locus_tag LOCUS_13450 gene rpsE 77222 77731 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_13450 77877 78062 gene locus_tag LOCUS_13460 gene rpmD 77877 78062 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_13460 78082 78519 gene locus_tag LOCUS_13470 gene rplO 78082 78519 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_13470 78519 79832 gene locus_tag LOCUS_13480 gene secY 78519 79832 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_13480 80031 80672 gene locus_tag LOCUS_13490 80031 80672 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_13490 80678 81433 gene locus_tag LOCUS_13500 gene map 80678 81433 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_13500 81454 81732 gene locus_tag LOCUS_13510 81454 81732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 81745 81963 gene locus_tag LOCUS_13520 gene infA 81745 81963 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_13520 82545 82916 gene locus_tag LOCUS_13530 gene rpsM 82545 82916 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_13530 82988 83383 gene locus_tag LOCUS_13540 gene rpsK 82988 83383 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_13540 83591 84184 gene locus_tag LOCUS_13550 gene rpsD 83591 84184 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_13550 84223 85179 gene locus_tag LOCUS_13560 gene rpoA 84223 85179 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_13560 85330 85866 gene locus_tag LOCUS_13570 gene rplQ 85330 85866 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_13570 87001 85949 gene locus_tag LOCUS_13580 87001 85949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 87146 88303 gene locus_tag LOCUS_13590 87146 88303 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_13590 88395 89309 gene locus_tag LOCUS_13600 88395 89309 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_13600 89284 90144 gene locus_tag LOCUS_13610 89284 90144 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_13610 90134 90949 gene locus_tag LOCUS_13620 90134 90949 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_13620 91067 91804 gene locus_tag LOCUS_13630 gene truA 91067 91804 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_13630 92078 92506 gene locus_tag LOCUS_13640 gene rplM 92078 92506 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210132.1 protein_id gnl|my_center|LOCUS_13640 92528 92923 gene locus_tag LOCUS_13650 gene rpsI 92528 92923 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_13650 93061 93183 gene locus_tag LOCUS_13660 93061 93183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 93266 93859 gene locus_tag LOCUS_13670 93266 93859 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678795.1 protein_id gnl|my_center|LOCUS_13670 94003 94971 gene locus_tag LOCUS_13680 94003 94971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 96732 95035 gene locus_tag LOCUS_13690 gene ptsP 96732 95035 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_13690 97732 96830 gene locus_tag LOCUS_13700 gene pfkB 97732 96830 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_13700 98182 97745 gene locus_tag LOCUS_13710 98182 97745 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_13710 98441 99247 gene locus_tag LOCUS_13720 98441 99247 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_13720 99300 100331 gene locus_tag LOCUS_13730 99300 100331 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_13730 100331 100525 gene locus_tag LOCUS_13740 100331 100525 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_13740 100549 101043 gene locus_tag LOCUS_13750 100549 101043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 101405 101665 gene locus_tag LOCUS_13760 101405 101665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 101665 101889 gene locus_tag LOCUS_13770 101665 101889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681036.1 protein_id gnl|my_center|LOCUS_13770 101846 102013 gene locus_tag LOCUS_13780 101846 102013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 102033 102191 gene locus_tag LOCUS_13790 102033 102191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 102206 102562 gene locus_tag LOCUS_13800 102206 102562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 102587 103336 gene locus_tag LOCUS_13810 102587 103336 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_13810 104325 103735 gene locus_tag LOCUS_13820 104325 103735 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459363.1 protein_id gnl|my_center|LOCUS_13820 104623 104847 gene locus_tag LOCUS_13830 104623 104847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 105104 106837 gene locus_tag LOCUS_13840 105104 106837 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079722.1 protein_id gnl|my_center|LOCUS_13840 107158 107811 gene locus_tag LOCUS_13850 107158 107811 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861425.1 protein_id gnl|my_center|LOCUS_13850 107900 108817 gene locus_tag LOCUS_13860 107900 108817 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_13860 108814 109662 gene locus_tag LOCUS_13870 108814 109662 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879376.1 protein_id gnl|my_center|LOCUS_13870 109666 110547 gene locus_tag LOCUS_13880 109666 110547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459749.1 protein_id gnl|my_center|LOCUS_13880 110552 111754 gene locus_tag LOCUS_13890 110552 111754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 111939 113312 gene locus_tag LOCUS_13900 111939 113312 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_13900 113354 113563 gene locus_tag LOCUS_13910 113354 113563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 113781 114551 gene locus_tag LOCUS_13920 113781 114551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 114541 115383 gene locus_tag LOCUS_13930 114541 115383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 115334 116359 gene locus_tag LOCUS_13940 115334 116359 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence11 684 199 gene locus_tag LOCUS_13950 684 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1341 856 gene locus_tag LOCUS_13960 1341 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4577 1650 gene locus_tag LOCUS_13970 4577 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5087 4770 gene locus_tag LOCUS_13980 5087 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6345 5356 gene locus_tag LOCUS_13990 6345 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7449 6715 gene locus_tag LOCUS_14000 7449 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7658 7807 gene locus_tag LOCUS_14010 7658 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7810 8148 gene locus_tag LOCUS_14020 7810 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 8317 8245 gene locus_tag LOCUS_t00160 8317 8245 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12727 8471 gene locus_tag LOCUS_14030 12727 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 13462 12836 gene locus_tag LOCUS_14040 gene sigH 13462 12836 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_14040 14264 13518 gene locus_tag LOCUS_14050 gene rlmB 14264 13518 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_14050 14949 14359 gene locus_tag LOCUS_14060 14949 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 15478 14993 gene locus_tag LOCUS_14070 15478 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 16881 15463 gene locus_tag LOCUS_14080 gene cysS 16881 15463 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_14080 17604 16939 gene locus_tag LOCUS_14090 gene cysE 17604 16939 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_14090 18475 19143 gene locus_tag LOCUS_14100 18475 19143 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_14100 19140 20072 gene locus_tag LOCUS_14110 19140 20072 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_14110 20272 20964 gene locus_tag LOCUS_14120 20272 20964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_14120 20948 23131 gene locus_tag LOCUS_14130 20948 23131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 24192 23629 gene locus_tag LOCUS_14140 gene ispF 24192 23629 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_14140 25975 24329 gene locus_tag LOCUS_14150 25975 24329 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_14150 27040 26201 gene locus_tag LOCUS_14160 gene rfbF 27040 26201 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_14160 27789 27007 gene locus_tag LOCUS_14170 gene rfbF 27789 27007 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107730.1 protein_id gnl|my_center|LOCUS_14170 28935 27829 gene locus_tag LOCUS_14180 28935 27829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 29894 28932 gene locus_tag LOCUS_14190 29894 28932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 31342 29948 gene locus_tag LOCUS_14200 31342 29948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 32480 31314 gene locus_tag LOCUS_14210 32480 31314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 33965 32532 gene locus_tag LOCUS_14220 33965 32532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 34774 33959 gene locus_tag LOCUS_14230 34774 33959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 36030 34771 gene locus_tag LOCUS_14240 36030 34771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 36696 36037 gene locus_tag LOCUS_14250 36696 36037 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082180.1 protein_id gnl|my_center|LOCUS_14250 37562 36693 gene locus_tag LOCUS_14260 37562 36693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 38355 37573 gene locus_tag LOCUS_14270 38355 37573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 39276 38446 gene locus_tag LOCUS_14280 39276 38446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 39653 39916 gene locus_tag LOCUS_14290 39653 39916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 40090 40443 gene locus_tag LOCUS_14300 40090 40443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 40868 42280 gene locus_tag LOCUS_14310 40868 42280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 42267 43076 gene locus_tag LOCUS_14320 42267 43076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 43073 43939 gene locus_tag LOCUS_14330 43073 43939 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_14330 44069 44233 gene locus_tag LOCUS_14340 44069 44233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 44320 45966 gene locus_tag LOCUS_14350 44320 45966 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_14350 47097 48341 gene locus_tag LOCUS_14360 47097 48341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 48341 49141 gene locus_tag LOCUS_14370 48341 49141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 49474 49307 gene locus_tag LOCUS_14380 49474 49307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 50777 51232 gene locus_tag LOCUS_14390 50777 51232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 51192 51389 gene locus_tag LOCUS_14400 51192 51389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 51478 51699 gene locus_tag LOCUS_14410 51478 51699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 51696 52628 gene locus_tag LOCUS_14420 51696 52628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 52641 52997 gene locus_tag LOCUS_14430 52641 52997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964626.1 protein_id gnl|my_center|LOCUS_14430 53051 53251 gene locus_tag LOCUS_14440 53051 53251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 54748 53522 gene locus_tag LOCUS_14450 54748 53522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 57018 54781 gene locus_tag LOCUS_14460 57018 54781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 58638 57130 gene locus_tag LOCUS_14470 58638 57130 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_14470 59086 58817 gene locus_tag LOCUS_14480 59086 58817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 59305 59865 gene locus_tag LOCUS_14490 59305 59865 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949169.1 protein_id gnl|my_center|LOCUS_14490 60309 60605 gene locus_tag LOCUS_14500 60309 60605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 60654 61565 gene locus_tag LOCUS_14510 60654 61565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 61645 62220 gene locus_tag LOCUS_14520 61645 62220 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_14520 63365 62217 gene locus_tag LOCUS_14530 63365 62217 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_14530 65040 63469 gene locus_tag LOCUS_14540 65040 63469 CDS product putative ABC exporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048139.1 protein_id gnl|my_center|LOCUS_14540 65877 65044 gene locus_tag LOCUS_14550 65877 65044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460117.1 protein_id gnl|my_center|LOCUS_14550 67036 65978 gene locus_tag LOCUS_14560 67036 65978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 68027 67332 gene locus_tag LOCUS_14570 68027 67332 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_14570 69489 68230 gene locus_tag LOCUS_14580 gene ytvI 69489 68230 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081388.1 protein_id gnl|my_center|LOCUS_14580 70135 69521 gene locus_tag LOCUS_14590 gene yihA 70135 69521 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 protein_id gnl|my_center|LOCUS_14590 71444 70170 gene locus_tag LOCUS_14600 gene clpX 71444 70170 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_14600 72054 71464 gene locus_tag LOCUS_14610 gene clpP 72054 71464 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_14610 73849 72464 gene locus_tag LOCUS_14620 gene tig 73849 72464 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_14620 74318 75706 gene locus_tag LOCUS_14630 74318 75706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 75809 78373 gene locus_tag LOCUS_14640 75809 78373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 78546 78746 gene locus_tag LOCUS_14650 78546 78746 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_14650 79632 78979 gene locus_tag LOCUS_14660 gene fsa 79632 78979 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_14660 80531 79758 gene locus_tag LOCUS_14670 80531 79758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 81222 80515 gene locus_tag LOCUS_14680 81222 80515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 82368 81292 gene locus_tag LOCUS_14690 gene rseP 82368 81292 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_14690 83517 82369 gene locus_tag LOCUS_14700 83517 82369 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_14700 84363 83524 gene locus_tag LOCUS_14710 84363 83524 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_14710 85087 84368 gene locus_tag LOCUS_14720 gene uppS 85087 84368 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880793.1 protein_id gnl|my_center|LOCUS_14720 85734 85183 gene locus_tag LOCUS_14730 gene frr 85734 85183 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_14730 86463 85768 gene locus_tag LOCUS_14740 gene pyrH 86463 85768 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_14740 87647 86520 gene locus_tag LOCUS_14750 87647 86520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 88750 87671 gene locus_tag LOCUS_14760 88750 87671 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272775.1 protein_id gnl|my_center|LOCUS_14760 88997 90025 gene locus_tag LOCUS_14770 88997 90025 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_14770 90034 90795 gene locus_tag LOCUS_14780 90034 90795 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921670.1 protein_id gnl|my_center|LOCUS_14780 91409 90807 gene locus_tag LOCUS_14790 91409 90807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 92113 91580 gene locus_tag LOCUS_14800 92113 91580 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194850.1 protein_id gnl|my_center|LOCUS_14800 93443 92154 gene locus_tag LOCUS_14810 93443 92154 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_14810 95198 93645 gene locus_tag LOCUS_14820 gene rny 95198 93645 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_14820 95910 95287 gene locus_tag LOCUS_14830 95910 95287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 97010 95907 gene locus_tag LOCUS_14840 gene recA 97010 95907 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_14840 99409 97481 gene locus_tag LOCUS_14850 99409 97481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 100108 99638 gene locus_tag LOCUS_14860 100108 99638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 100858 100124 gene locus_tag LOCUS_14870 gene rgbR 100858 100124 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_14870 102297 100927 gene locus_tag LOCUS_14880 102297 100927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 103051 102314 gene locus_tag LOCUS_14890 103051 102314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 103269 103072 gene locus_tag LOCUS_14900 103269 103072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 105195 103654 gene locus_tag LOCUS_14910 105195 103654 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_14910 106482 105214 gene locus_tag LOCUS_14920 106482 105214 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 protein_id gnl|my_center|LOCUS_14920 108478 106460 gene locus_tag LOCUS_14930 108478 106460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 110013 108484 gene locus_tag LOCUS_14940 110013 108484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 111571 110033 gene locus_tag LOCUS_14950 111571 110033 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence12 5 361 gene locus_tag LOCUS_14960 5 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 336 863 gene locus_tag LOCUS_14970 336 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1033 1899 gene locus_tag LOCUS_14980 1033 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3036 2584 gene locus_tag LOCUS_14990 3036 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3126 3290 gene locus_tag LOCUS_15000 3126 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3371 3703 gene locus_tag LOCUS_15010 3371 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3830 4525 gene locus_tag LOCUS_15020 3830 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4522 4836 gene locus_tag LOCUS_15030 4522 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4799 4939 gene locus_tag LOCUS_15040 4799 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5015 6133 gene locus_tag LOCUS_15050 5015 6133 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_15050 7507 6320 gene locus_tag LOCUS_15060 7507 6320 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_15060 8542 7544 gene locus_tag LOCUS_15070 8542 7544 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_15070 9644 8559 gene locus_tag LOCUS_15080 9644 8559 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048434.1 protein_id gnl|my_center|LOCUS_15080 11293 9911 gene locus_tag LOCUS_15090 gene murC 11293 9911 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_15090 11552 12823 gene locus_tag LOCUS_15100 11552 12823 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_15100 12905 14026 gene locus_tag LOCUS_15110 gene glgD 12905 14026 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_15110 14062 14343 gene locus_tag LOCUS_15120 gene spoVG 14062 14343 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_15120 14496 16586 gene locus_tag LOCUS_15130 14496 16586 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966624.1 protein_id gnl|my_center|LOCUS_15130 16715 17323 gene locus_tag LOCUS_15140 gene pth 16715 17323 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_15140 17295 20846 gene locus_tag LOCUS_15150 gene mfd 17295 20846 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_15150 20893 21513 gene locus_tag LOCUS_15160 20893 21513 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_15160 21801 22829 gene locus_tag LOCUS_15170 21801 22829 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_15170 23113 24075 gene locus_tag LOCUS_15180 23113 24075 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_15180 24072 24935 gene locus_tag LOCUS_15190 24072 24935 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_15190 24960 25934 gene locus_tag LOCUS_15200 24960 25934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 25952 26503 gene locus_tag LOCUS_15210 25952 26503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 26626 28920 gene locus_tag LOCUS_15220 26626 28920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 28982 30880 gene locus_tag LOCUS_15230 28982 30880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 30891 32459 gene locus_tag LOCUS_15240 30891 32459 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_15240 32633 33178 gene locus_tag LOCUS_15250 gene spoVT 32633 33178 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_15250 34488 33208 gene locus_tag LOCUS_15260 34488 33208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 34693 36498 gene locus_tag LOCUS_15270 34693 36498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 36851 40021 gene locus_tag LOCUS_15280 gene ileS 36851 40021 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_15280 40150 42666 gene locus_tag LOCUS_15290 40150 42666 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_15290 42695 44983 gene locus_tag LOCUS_15300 42695 44983 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_15300 45012 45533 gene locus_tag LOCUS_15310 45012 45533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 45782 47008 gene locus_tag LOCUS_15320 45782 47008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 47149 48168 gene locus_tag LOCUS_15330 47149 48168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 48185 49408 gene locus_tag LOCUS_15340 48185 49408 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943599.1 protein_id gnl|my_center|LOCUS_15340 49727 51145 gene locus_tag LOCUS_15350 49727 51145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 51209 52234 gene locus_tag LOCUS_15360 51209 52234 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_15360 52240 53739 gene locus_tag LOCUS_15370 52240 53739 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_15370 54472 53732 gene locus_tag LOCUS_15380 54472 53732 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_15380 54605 55027 gene locus_tag LOCUS_15390 54605 55027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 55240 56511 gene locus_tag LOCUS_15400 55240 56511 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_15400 56588 57394 gene locus_tag LOCUS_15410 gene pyrK 56588 57394 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_15410 57447 57722 gene locus_tag LOCUS_15420 57447 57722 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_15420 57707 58120 gene locus_tag LOCUS_15430 57707 58120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956671.1 protein_id gnl|my_center|LOCUS_15430 58230 59132 gene locus_tag LOCUS_15440 58230 59132 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_15440 59205 60755 gene locus_tag LOCUS_15450 59205 60755 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_15450 61455 60826 gene locus_tag LOCUS_15460 61455 60826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941688.1 protein_id gnl|my_center|LOCUS_15460 62019 61561 gene locus_tag LOCUS_15470 62019 61561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 62863 62021 gene locus_tag LOCUS_15480 gene murI 62863 62021 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_15480 63105 62839 gene locus_tag LOCUS_15490 63105 62839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 63863 63165 gene locus_tag LOCUS_15500 63863 63165 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_15500 64817 63960 gene locus_tag LOCUS_15510 gene ispE 64817 63960 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_15510 65473 64997 gene locus_tag LOCUS_15520 65473 64997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 65681 67003 gene locus_tag LOCUS_15530 65681 67003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 67000 68451 gene locus_tag LOCUS_15540 gene cls 67000 68451 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722636.1 protein_id gnl|my_center|LOCUS_15540 68623 69681 gene locus_tag LOCUS_15550 gene tig 68623 69681 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116489.1 protein_id gnl|my_center|LOCUS_15550 69762 71153 gene locus_tag LOCUS_15560 gene asnS 69762 71153 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_15560 71204 72481 gene locus_tag LOCUS_15570 71204 72481 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947929.1 protein_id gnl|my_center|LOCUS_15570 72519 73877 gene locus_tag LOCUS_15580 gene trkA 72519 73877 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_15580 73915 75369 gene locus_tag LOCUS_15590 73915 75369 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_15590 75456 77270 gene locus_tag LOCUS_15600 75456 77270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 78004 77423 gene locus_tag LOCUS_15610 78004 77423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 78320 78439 gene locus_tag LOCUS_15620 78320 78439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 78423 78680 gene locus_tag LOCUS_15630 gene spoIIID 78423 78680 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_15630 78890 80116 gene locus_tag LOCUS_15640 78890 80116 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_15640 80245 81261 gene locus_tag LOCUS_15650 gene galE 80245 81261 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_15650 81524 81258 gene locus_tag LOCUS_15660 81524 81258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 81602 83224 gene locus_tag LOCUS_15670 81602 83224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 83329 84018 gene locus_tag LOCUS_15680 83329 84018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 84036 84599 gene locus_tag LOCUS_15690 84036 84599 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_15690 85822 84617 gene locus_tag LOCUS_15700 85822 84617 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_15700 85933 87507 gene locus_tag LOCUS_15710 85933 87507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 87639 88931 gene locus_tag LOCUS_15720 87639 88931 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_15720 89348 90547 gene locus_tag LOCUS_15730 gene metK 89348 90547 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_15730 90745 94560 gene locus_tag LOCUS_15740 90745 94560 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_15740 94583 95587 gene locus_tag LOCUS_15750 gene pfkA 94583 95587 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_15750 95703 96506 gene locus_tag LOCUS_15760 95703 96506 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_15760 96760 97569 gene locus_tag LOCUS_15770 gene proC 96760 97569 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_15770 97696 98772 gene locus_tag LOCUS_15780 97696 98772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 98940 99461 gene locus_tag LOCUS_15790 98940 99461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 99531 100466 gene locus_tag LOCUS_15800 99531 100466 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_15800 100583 101575 gene locus_tag LOCUS_15810 gene argF 100583 101575 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_15810 101604 102443 gene locus_tag LOCUS_15820 101604 102443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 102440 102811 gene locus_tag LOCUS_15830 102440 102811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 102795 103562 gene locus_tag LOCUS_15840 102795 103562 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_15840 103635 104612 gene locus_tag LOCUS_15850 gene dusB 103635 104612 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_15850 104699 105745 gene locus_tag LOCUS_15860 104699 105745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 105732 105998 gene locus_tag LOCUS_15870 105732 105998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 105958 106449 gene locus_tag LOCUS_15880 gene greA 105958 106449 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_15880 106540 108045 gene locus_tag LOCUS_15890 gene lysS 106540 108045 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence13 1718 237 gene locus_tag LOCUS_15900 1718 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2333 1740 gene locus_tag LOCUS_15910 2333 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3743 2478 gene locus_tag LOCUS_15920 3743 2478 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_15920 6009 3736 gene locus_tag LOCUS_15930 6009 3736 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068658.1 protein_id gnl|my_center|LOCUS_15930 8189 6144 gene locus_tag LOCUS_15940 8189 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 8357 9481 gene locus_tag LOCUS_15950 8357 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 10221 9538 gene locus_tag LOCUS_15960 10221 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 10883 10239 gene locus_tag LOCUS_15970 10883 10239 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_15970 11632 10868 gene locus_tag LOCUS_15980 11632 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 11912 11634 gene locus_tag LOCUS_15990 11912 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 12761 13198 gene locus_tag LOCUS_16000 12761 13198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 15171 13246 gene locus_tag LOCUS_16010 15171 13246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 16358 15225 gene locus_tag LOCUS_16020 16358 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 17621 16362 gene locus_tag LOCUS_16030 17621 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 18327 17647 gene locus_tag LOCUS_16040 18327 17647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187071.1 protein_id gnl|my_center|LOCUS_16040 20681 18351 gene locus_tag LOCUS_16050 20681 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 21420 20917 gene locus_tag LOCUS_16060 21420 20917 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_16060 22305 21493 gene locus_tag LOCUS_16070 22305 21493 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_16070 23103 22441 gene locus_tag LOCUS_16080 23103 22441 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_16080 24103 23093 gene locus_tag LOCUS_16090 24103 23093 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_16090 25081 24128 gene locus_tag LOCUS_16100 gene cysK 25081 24128 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_16100 25456 26850 gene locus_tag LOCUS_16110 gene aroA 25456 26850 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229519.1 protein_id gnl|my_center|LOCUS_16110 26912 27853 gene locus_tag LOCUS_16120 gene arcC 26912 27853 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680441.1 protein_id gnl|my_center|LOCUS_16120 28346 27861 gene locus_tag LOCUS_16130 28346 27861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 29132 28395 gene locus_tag LOCUS_16140 gene truA 29132 28395 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_16140 29267 29593 gene locus_tag LOCUS_16150 29267 29593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 29931 29599 gene locus_tag LOCUS_16160 29931 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 30296 29883 gene locus_tag LOCUS_16170 30296 29883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 31955 30309 gene locus_tag LOCUS_16180 31955 30309 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_16180 32470 32021 gene locus_tag LOCUS_16190 32470 32021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 33573 32749 gene locus_tag LOCUS_16200 33573 32749 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478981.1 protein_id gnl|my_center|LOCUS_16200 35346 33706 gene locus_tag LOCUS_16210 gene tndX 35346 33706 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_16210 35681 35433 gene locus_tag LOCUS_16220 35681 35433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 35901 35719 gene locus_tag LOCUS_16230 35901 35719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 37686 36367 gene locus_tag LOCUS_16240 37686 36367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 39111 37858 gene locus_tag LOCUS_16250 39111 37858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 39650 40456 gene locus_tag LOCUS_16260 39650 40456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 40721 40518 gene locus_tag LOCUS_16270 40721 40518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 40826 41347 gene locus_tag LOCUS_16280 40826 41347 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485423.1 protein_id gnl|my_center|LOCUS_16280 42931 41447 gene locus_tag LOCUS_16290 42931 41447 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 protein_id gnl|my_center|LOCUS_16290 44946 42925 gene locus_tag LOCUS_16300 44946 42925 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_16300 45196 44939 gene locus_tag LOCUS_16310 45196 44939 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_16310 45576 45331 gene locus_tag LOCUS_16320 45576 45331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 46342 48771 gene locus_tag LOCUS_16330 46342 48771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 50836 48788 gene locus_tag LOCUS_16340 50836 48788 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262517.1 protein_id gnl|my_center|LOCUS_16340 51065 52063 gene locus_tag LOCUS_16350 51065 52063 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584091.1 protein_id gnl|my_center|LOCUS_16350 53815 52154 gene locus_tag LOCUS_16360 53815 52154 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 protein_id gnl|my_center|LOCUS_16360 55063 53858 gene locus_tag LOCUS_16370 55063 53858 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_16370 55317 55078 gene locus_tag LOCUS_16380 55317 55078 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_16380 55709 56620 gene locus_tag LOCUS_16390 55709 56620 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810616.1 protein_id gnl|my_center|LOCUS_16390 56709 57443 gene locus_tag LOCUS_16400 56709 57443 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_16400 57762 57448 gene locus_tag LOCUS_16410 57762 57448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 57925 57755 gene locus_tag LOCUS_16420 57925 57755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 58335 58087 gene locus_tag LOCUS_16430 58335 58087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 59149 58406 gene locus_tag LOCUS_16440 59149 58406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 59332 60879 gene locus_tag LOCUS_16450 59332 60879 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 protein_id gnl|my_center|LOCUS_16450 62606 60915 gene locus_tag LOCUS_16460 62606 60915 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_16460 64531 62633 gene locus_tag LOCUS_16470 64531 62633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 65197 64580 gene locus_tag LOCUS_16480 65197 64580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 67018 65336 gene locus_tag LOCUS_16490 67018 65336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 68162 67200 gene locus_tag LOCUS_16500 68162 67200 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_16500 69638 68178 gene locus_tag LOCUS_16510 69638 68178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 71539 69704 gene locus_tag LOCUS_16520 71539 69704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 73447 71729 gene locus_tag LOCUS_16530 73447 71729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 75588 73519 gene locus_tag LOCUS_16540 75588 73519 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_16540 78103 75665 gene locus_tag LOCUS_16550 78103 75665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 79175 78348 gene locus_tag LOCUS_16560 79175 78348 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_16560 80540 79260 gene locus_tag LOCUS_16570 80540 79260 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 protein_id gnl|my_center|LOCUS_16570 82224 80692 gene locus_tag LOCUS_16580 82224 80692 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_16580 83942 82221 gene locus_tag LOCUS_16590 83942 82221 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922389.1 protein_id gnl|my_center|LOCUS_16590 84049 84846 gene locus_tag LOCUS_16600 84049 84846 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014612372.1 protein_id gnl|my_center|LOCUS_16600 86071 84887 gene locus_tag LOCUS_16610 86071 84887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 87130 86264 gene locus_tag LOCUS_16620 87130 86264 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_16620 87323 88219 gene locus_tag LOCUS_16630 87323 88219 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_16630 88742 88305 gene locus_tag LOCUS_16640 88742 88305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 89703 88855 gene locus_tag LOCUS_16650 89703 88855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 89901 90962 gene locus_tag LOCUS_16660 89901 90962 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898981.1 protein_id gnl|my_center|LOCUS_16660 91856 90966 gene locus_tag LOCUS_16670 91856 90966 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948489.1 protein_id gnl|my_center|LOCUS_16670 92581 91871 gene locus_tag LOCUS_16680 92581 91871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 93315 92617 gene locus_tag LOCUS_16690 93315 92617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 93574 93278 gene locus_tag LOCUS_16700 93574 93278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 94459 93701 gene locus_tag LOCUS_16710 94459 93701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 95253 94474 gene locus_tag LOCUS_16720 95253 94474 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566050.1 protein_id gnl|my_center|LOCUS_16720 96754 95393 gene locus_tag LOCUS_16730 96754 95393 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_16730 97218 96832 gene locus_tag LOCUS_16740 97218 96832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 98087 97317 gene locus_tag LOCUS_16750 98087 97317 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027810.1 protein_id gnl|my_center|LOCUS_16750 99056 98199 gene locus_tag LOCUS_16760 99056 98199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 100016 99159 gene locus_tag LOCUS_16770 100016 99159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_16770 101952 99988 gene locus_tag LOCUS_16780 101952 99988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 103194 102031 gene locus_tag LOCUS_16790 103194 102031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 103570 103208 gene locus_tag LOCUS_16800 103570 103208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 104454 103678 gene locus_tag LOCUS_16810 104454 103678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 105980 104451 gene locus_tag LOCUS_16820 105980 104451 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963849.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence14 182 33 gene locus_tag LOCUS_16830 182 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 418 1164 gene locus_tag LOCUS_16840 418 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1248 1421 gene locus_tag LOCUS_16850 1248 1421 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815177.1 protein_id gnl|my_center|LOCUS_16850 1491 1766 gene locus_tag LOCUS_16860 1491 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1775 2293 gene locus_tag LOCUS_16870 1775 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2308 4257 gene locus_tag LOCUS_16880 2308 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 4425 7040 gene locus_tag LOCUS_16890 4425 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7054 8742 gene locus_tag LOCUS_16900 7054 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 8996 9457 gene locus_tag LOCUS_16910 8996 9457 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943666.1 protein_id gnl|my_center|LOCUS_16910 9459 9677 gene locus_tag LOCUS_16920 gene csrA 9459 9677 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_16920 9784 10218 gene locus_tag LOCUS_16930 9784 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 10240 11877 gene locus_tag LOCUS_16940 10240 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 11916 12290 gene locus_tag LOCUS_16950 gene fliS 11916 12290 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_16950 12303 12779 gene locus_tag LOCUS_16960 12303 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 13029 14513 gene locus_tag LOCUS_16970 13029 14513 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_16970 14801 16306 gene locus_tag LOCUS_16980 14801 16306 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_16980 16416 18662 gene locus_tag LOCUS_16990 16416 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 18876 20366 gene locus_tag LOCUS_17000 18876 20366 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_17000 20456 21322 gene locus_tag LOCUS_17010 20456 21322 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202928.1 protein_id gnl|my_center|LOCUS_17010 21354 23099 gene locus_tag LOCUS_17020 21354 23099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 23133 24755 gene locus_tag LOCUS_17030 23133 24755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 24752 25648 gene locus_tag LOCUS_17040 24752 25648 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_17040 25681 27477 gene locus_tag LOCUS_17050 gene ilvB 25681 27477 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_17050 27503 28477 gene locus_tag LOCUS_17060 27503 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 28480 29556 gene locus_tag LOCUS_17070 28480 29556 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986974.1 protein_id gnl|my_center|LOCUS_17070 29570 30388 gene locus_tag LOCUS_17080 29570 30388 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963753.1 protein_id gnl|my_center|LOCUS_17080 30427 31410 gene locus_tag LOCUS_17090 30427 31410 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_17090 31438 32430 gene locus_tag LOCUS_17100 31438 32430 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_17100 32450 33775 gene locus_tag LOCUS_17110 32450 33775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 33794 34531 gene locus_tag LOCUS_17120 33794 34531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17120 34528 34779 gene locus_tag LOCUS_17130 34528 34779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 34791 36293 gene locus_tag LOCUS_17140 34791 36293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 36312 37832 gene locus_tag LOCUS_17150 36312 37832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 37844 39157 gene locus_tag LOCUS_17160 37844 39157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 39282 40325 gene locus_tag LOCUS_17170 39282 40325 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795358.1 protein_id gnl|my_center|LOCUS_17170 40405 42627 gene locus_tag LOCUS_17180 40405 42627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 42628 42798 gene locus_tag LOCUS_17190 42628 42798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 42870 43373 gene locus_tag LOCUS_17200 42870 43373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 43433 43855 gene locus_tag LOCUS_17210 43433 43855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 44051 45043 gene locus_tag LOCUS_17220 44051 45043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 45059 45262 gene locus_tag LOCUS_17230 45059 45262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 45252 45794 gene locus_tag LOCUS_17240 45252 45794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 45987 46769 gene locus_tag LOCUS_17250 gene rfbF 45987 46769 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107730.1 protein_id gnl|my_center|LOCUS_17250 46796 47572 gene locus_tag LOCUS_17260 gene rfbF 46796 47572 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_17260 47600 48925 gene locus_tag LOCUS_17270 gene rfbH 47600 48925 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_17270 48927 50006 gene locus_tag LOCUS_17280 gene rfbG 48927 50006 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_17280 50124 50414 gene locus_tag LOCUS_17290 gene rpsF 50124 50414 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_17290 50438 50902 gene locus_tag LOCUS_17300 50438 50902 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_17300 50930 51193 gene locus_tag LOCUS_17310 gene rpsR 50930 51193 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_17310 52398 51340 gene locus_tag LOCUS_17320 gene ccpA 52398 51340 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 protein_id gnl|my_center|LOCUS_17320 52750 54891 gene locus_tag LOCUS_17330 52750 54891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 54995 57925 gene locus_tag LOCUS_17340 54995 57925 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_17340 57938 58840 gene locus_tag LOCUS_17350 57938 58840 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_17350 58853 59740 gene locus_tag LOCUS_17360 58853 59740 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_17360 59788 61329 gene locus_tag LOCUS_17370 59788 61329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 61326 61955 gene locus_tag LOCUS_17380 61326 61955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17380 61965 64577 gene locus_tag LOCUS_17390 61965 64577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 64577 65494 gene locus_tag LOCUS_17400 64577 65494 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_17400 65484 66515 gene locus_tag LOCUS_17410 65484 66515 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_17410 66629 68275 gene locus_tag LOCUS_17420 66629 68275 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_17420 68477 70222 gene locus_tag LOCUS_17430 68477 70222 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189855.1 protein_id gnl|my_center|LOCUS_17430 70364 72415 gene locus_tag LOCUS_17440 70364 72415 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_17440 72445 72897 gene locus_tag LOCUS_17450 gene rplI 72445 72897 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_17450 72902 74254 gene locus_tag LOCUS_17460 gene dnaB 72902 74254 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_17460 74320 75123 gene locus_tag LOCUS_17470 74320 75123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 75314 75499 gene locus_tag LOCUS_17480 75314 75499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 75504 75878 gene locus_tag LOCUS_17490 75504 75878 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_17490 76142 76648 gene locus_tag LOCUS_17500 76142 76648 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074508.1 protein_id gnl|my_center|LOCUS_17500 77916 76723 gene locus_tag LOCUS_17510 77916 76723 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067278.1 protein_id gnl|my_center|LOCUS_17510 78038 80170 gene locus_tag LOCUS_17520 78038 80170 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_17520 80171 81619 gene locus_tag LOCUS_17530 80171 81619 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_17530 81680 81832 gene locus_tag LOCUS_17540 81680 81832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 82024 82443 gene locus_tag LOCUS_17550 82024 82443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 82692 85247 gene locus_tag LOCUS_17560 82692 85247 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_17560 85250 86185 gene locus_tag LOCUS_17570 85250 86185 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680147.1 protein_id gnl|my_center|LOCUS_17570 87086 86400 gene locus_tag LOCUS_17580 87086 86400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 87317 87126 gene locus_tag LOCUS_17590 87317 87126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 88472 87348 gene locus_tag LOCUS_17600 88472 87348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 88762 88992 gene locus_tag LOCUS_17610 88762 88992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 89012 89938 gene locus_tag LOCUS_17620 89012 89938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 89935 90261 gene locus_tag LOCUS_17630 89935 90261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 90694 91263 gene locus_tag LOCUS_17640 90694 91263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 91253 91984 gene locus_tag LOCUS_17650 91253 91984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 92074 93435 gene locus_tag LOCUS_17660 92074 93435 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_17660 93564 94424 gene locus_tag LOCUS_17670 93564 94424 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410378.1 protein_id gnl|my_center|LOCUS_17670 94434 94718 gene locus_tag LOCUS_17680 94434 94718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 94805 96502 gene locus_tag LOCUS_17690 94805 96502 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_17690 96854 96684 gene locus_tag LOCUS_17700 96854 96684 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_17700 97731 96967 gene locus_tag LOCUS_17710 gene pflA 97731 96967 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721912.1 protein_id gnl|my_center|LOCUS_17710 98107 97865 gene locus_tag LOCUS_17720 98107 97865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 98389 98186 gene locus_tag LOCUS_17730 98389 98186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 100507 98468 gene locus_tag LOCUS_17740 gene pflB 100507 98468 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_17740 100951 101142 gene locus_tag LOCUS_17750 100951 101142 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_17750 101994 101269 gene locus_tag LOCUS_17760 101994 101269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 102493 102729 gene locus_tag LOCUS_17770 102493 102729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence15 15 800 gene locus_tag LOCUS_17780 15 800 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_17780 816 1877 gene locus_tag LOCUS_17790 816 1877 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_17790 3276 2071 gene locus_tag LOCUS_17800 3276 2071 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_17800 3514 3329 gene locus_tag LOCUS_17810 3514 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3462 3950 gene locus_tag LOCUS_17820 gene ybaK 3462 3950 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_17820 4015 5289 gene locus_tag LOCUS_17830 4015 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 6223 5291 gene locus_tag LOCUS_17840 6223 5291 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058303659.1 protein_id gnl|my_center|LOCUS_17840 6652 9621 gene locus_tag LOCUS_17850 6652 9621 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259688.1 protein_id gnl|my_center|LOCUS_17850 9678 10586 gene locus_tag LOCUS_17860 9678 10586 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259689.1 protein_id gnl|my_center|LOCUS_17860 10597 11472 gene locus_tag LOCUS_17870 10597 11472 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_17870 11494 13545 gene locus_tag LOCUS_17880 11494 13545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259691.1 protein_id gnl|my_center|LOCUS_17880 13535 15736 gene locus_tag LOCUS_17890 13535 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 15768 16817 gene locus_tag LOCUS_17900 15768 16817 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259693.1 protein_id gnl|my_center|LOCUS_17900 16747 17754 gene locus_tag LOCUS_17910 16747 17754 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909515.1 protein_id gnl|my_center|LOCUS_17910 17963 19519 gene locus_tag LOCUS_17920 17963 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 19612 21642 gene locus_tag LOCUS_17930 19612 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 22027 23031 gene locus_tag LOCUS_17940 22027 23031 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_17940 23065 25311 gene locus_tag LOCUS_17950 23065 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 25358 25606 gene locus_tag LOCUS_17960 25358 25606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 25715 28339 gene locus_tag LOCUS_17970 25715 28339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 28336 31506 gene locus_tag LOCUS_17980 28336 31506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 31463 32149 gene locus_tag LOCUS_17990 31463 32149 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_17990 32224 32508 gene locus_tag LOCUS_18000 32224 32508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18000 32426 32611 gene locus_tag LOCUS_18010 32426 32611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18010 32696 33163 gene locus_tag LOCUS_18020 32696 33163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18020 33221 34708 gene locus_tag LOCUS_18030 33221 34708 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939558.1 protein_id gnl|my_center|LOCUS_18030 34701 35618 gene locus_tag LOCUS_18040 34701 35618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18040 35670 37520 gene locus_tag LOCUS_18050 35670 37520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 38113 38733 gene locus_tag LOCUS_18060 38113 38733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 38693 39625 gene locus_tag LOCUS_18070 38693 39625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 39823 40746 gene locus_tag LOCUS_18080 gene ptb 39823 40746 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_18080 40777 41844 gene locus_tag LOCUS_18090 gene buk 40777 41844 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_18090 41845 43230 gene locus_tag LOCUS_18100 41845 43230 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_18100 43273 43920 gene locus_tag LOCUS_18110 43273 43920 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_18110 44060 45040 gene locus_tag LOCUS_18120 44060 45040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 45812 45102 gene locus_tag LOCUS_18130 45812 45102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 47491 46082 gene locus_tag LOCUS_18140 gene uxaC 47491 46082 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_18140 48531 47524 gene locus_tag LOCUS_18150 gene ccpA 48531 47524 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564050.1 protein_id gnl|my_center|LOCUS_18150 48734 50194 gene locus_tag LOCUS_18160 48734 50194 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_18160 50179 51732 gene locus_tag LOCUS_18170 50179 51732 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_18170 51758 53866 gene locus_tag LOCUS_18180 51758 53866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 53984 54820 gene locus_tag LOCUS_18190 53984 54820 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285996.1 protein_id gnl|my_center|LOCUS_18190 56442 54868 gene locus_tag LOCUS_18200 56442 54868 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_18200 56822 57544 gene locus_tag LOCUS_18210 56822 57544 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_18210 57531 59009 gene locus_tag LOCUS_18220 57531 59009 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948726.1 protein_id gnl|my_center|LOCUS_18220 59127 59885 gene locus_tag LOCUS_18230 59127 59885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 59950 60603 gene locus_tag LOCUS_18240 59950 60603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 60805 61494 gene locus_tag LOCUS_18250 60805 61494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 62750 61623 gene locus_tag LOCUS_18260 62750 61623 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966644.1 protein_id gnl|my_center|LOCUS_18260 62945 64630 gene locus_tag LOCUS_18270 62945 64630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 64632 66251 gene locus_tag LOCUS_18280 64632 66251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 66346 67212 gene locus_tag LOCUS_18290 66346 67212 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942148.1 protein_id gnl|my_center|LOCUS_18290 67306 69054 gene locus_tag LOCUS_18300 67306 69054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 69063 70844 gene locus_tag LOCUS_18310 69063 70844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 70951 72213 gene locus_tag LOCUS_18320 70951 72213 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_18320 72241 73539 gene locus_tag LOCUS_18330 72241 73539 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_18330 73562 73987 gene locus_tag LOCUS_18340 73562 73987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 74177 74650 gene locus_tag LOCUS_18350 74177 74650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 74647 75531 gene locus_tag LOCUS_18360 74647 75531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 75540 76199 gene locus_tag LOCUS_18370 75540 76199 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391446.1 protein_id gnl|my_center|LOCUS_18370 76214 76684 gene locus_tag LOCUS_18380 76214 76684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 76849 78111 gene locus_tag LOCUS_18390 76849 78111 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202263.1 protein_id gnl|my_center|LOCUS_18390 78131 79186 gene locus_tag LOCUS_18400 78131 79186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 80146 80640 gene locus_tag LOCUS_18410 80146 80640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18410 80651 81577 gene locus_tag LOCUS_18420 80651 81577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 82399 83169 gene locus_tag LOCUS_18430 82399 83169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 83203 84555 gene locus_tag LOCUS_18440 83203 84555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 85322 86092 gene locus_tag LOCUS_18450 85322 86092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 86127 87941 gene locus_tag LOCUS_18460 86127 87941 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_18460 87952 88116 gene locus_tag LOCUS_18470 87952 88116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 88129 89256 gene locus_tag LOCUS_18480 88129 89256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 89259 89669 gene locus_tag LOCUS_18490 89259 89669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 89694 91091 gene locus_tag LOCUS_18500 89694 91091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 91232 92275 gene locus_tag LOCUS_18510 91232 92275 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_18510 92272 93402 gene locus_tag LOCUS_18520 92272 93402 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_18520 93620 94651 gene locus_tag LOCUS_18530 93620 94651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 94690 94893 gene locus_tag LOCUS_18540 94690 94893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 94959 97202 gene locus_tag LOCUS_18550 94959 97202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 97528 98514 gene locus_tag LOCUS_18560 97528 98514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 99256 98897 gene locus_tag LOCUS_18570 99256 98897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 99734 99390 gene locus_tag LOCUS_18580 99734 99390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 100351 99998 gene locus_tag LOCUS_18590 100351 99998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence16 244 1155 gene locus_tag LOCUS_18600 244 1155 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964546.1 protein_id gnl|my_center|LOCUS_18600 1248 2036 gene locus_tag LOCUS_18610 1248 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2087 3979 gene locus_tag LOCUS_18620 2087 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4022 4636 gene locus_tag LOCUS_18630 gene hisH 4022 4636 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_18630 4641 5402 gene locus_tag LOCUS_18640 gene hisF 4641 5402 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_18640 5427 6113 gene locus_tag LOCUS_18650 5427 6113 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432519.1 protein_id gnl|my_center|LOCUS_18650 6277 7254 gene locus_tag LOCUS_18660 6277 7254 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_18660 7274 8635 gene locus_tag LOCUS_18670 7274 8635 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_18670 8639 9688 gene locus_tag LOCUS_18680 8639 9688 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_18680 9755 9837 gene locus_tag LOCUS_t00170 9755 9837 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10014 10547 gene locus_tag LOCUS_18690 10014 10547 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_18690 11760 10585 gene locus_tag LOCUS_18700 11760 10585 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_18700 12563 11796 gene locus_tag LOCUS_18710 12563 11796 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_18710 12666 13682 gene locus_tag LOCUS_18720 12666 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 13932 15212 gene locus_tag LOCUS_18730 13932 15212 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_18730 15209 15529 gene locus_tag LOCUS_18740 15209 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 15545 18241 gene locus_tag LOCUS_18750 gene polA 15545 18241 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_18750 18228 18848 gene locus_tag LOCUS_18760 gene coaE 18228 18848 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027337.1 protein_id gnl|my_center|LOCUS_18760 18836 21022 gene locus_tag LOCUS_18770 18836 21022 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949018.1 protein_id gnl|my_center|LOCUS_18770 21019 21816 gene locus_tag LOCUS_18780 21019 21816 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_18780 21834 22106 gene locus_tag LOCUS_18790 21834 22106 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_18790 22120 23484 gene locus_tag LOCUS_18800 22120 23484 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_18800 24727 23492 gene locus_tag LOCUS_18810 24727 23492 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_18810 25037 26038 gene locus_tag LOCUS_18820 gene pta 25037 26038 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_18820 26071 27270 gene locus_tag LOCUS_18830 26071 27270 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438096.1 protein_id gnl|my_center|LOCUS_18830 27433 28578 gene locus_tag LOCUS_18840 27433 28578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 28666 29535 gene locus_tag LOCUS_18850 28666 29535 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479988.1 protein_id gnl|my_center|LOCUS_18850 29787 30644 gene locus_tag LOCUS_18860 29787 30644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 30631 32052 gene locus_tag LOCUS_18870 30631 32052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879506.1 protein_id gnl|my_center|LOCUS_18870 32049 32822 gene locus_tag LOCUS_18880 32049 32822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 33372 34862 gene locus_tag LOCUS_18890 gene trpE 33372 34862 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_18890 34846 36561 gene locus_tag LOCUS_18900 gene trpD 34846 36561 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858662.1 protein_id gnl|my_center|LOCUS_18900 36570 37364 gene locus_tag LOCUS_18910 gene trpC 36570 37364 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_18910 37377 37976 gene locus_tag LOCUS_18920 37377 37976 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592587.1 protein_id gnl|my_center|LOCUS_18920 38098 39282 gene locus_tag LOCUS_18930 gene trpB 38098 39282 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_18930 39314 40129 gene locus_tag LOCUS_18940 gene trpA 39314 40129 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_18940 40187 41383 gene locus_tag LOCUS_18950 40187 41383 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964735.1 protein_id gnl|my_center|LOCUS_18950 41550 42449 gene locus_tag LOCUS_18960 41550 42449 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814503.1 protein_id gnl|my_center|LOCUS_18960 42526 43296 gene locus_tag LOCUS_18970 42526 43296 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_18970 43308 44048 gene locus_tag LOCUS_18980 43308 44048 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_18980 44066 44776 gene locus_tag LOCUS_18990 44066 44776 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_18990 44902 46116 gene locus_tag LOCUS_19000 44902 46116 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_19000 46129 47271 gene locus_tag LOCUS_19010 46129 47271 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_19010 48166 47366 gene locus_tag LOCUS_19020 48166 47366 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_19020 48412 49359 gene locus_tag LOCUS_19030 48412 49359 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_19030 49369 50346 gene locus_tag LOCUS_19040 49369 50346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_19040 50415 50852 gene locus_tag LOCUS_19050 50415 50852 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 protein_id gnl|my_center|LOCUS_19050 50863 51354 gene locus_tag LOCUS_19060 50863 51354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 51456 51980 gene locus_tag LOCUS_19070 51456 51980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 51983 52162 gene locus_tag LOCUS_19080 gene rpmF 51983 52162 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_19080 52301 53680 gene locus_tag LOCUS_19090 52301 53680 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_19090 55785 53737 gene locus_tag LOCUS_19100 55785 53737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 56028 57431 gene locus_tag LOCUS_19110 56028 57431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 57639 58649 gene locus_tag LOCUS_19120 gene plsX 57639 58649 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_19120 58672 58902 gene locus_tag LOCUS_19130 gene acpP 58672 58902 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_19130 59035 59748 gene locus_tag LOCUS_19140 gene rnc 59035 59748 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_19140 59729 63289 gene locus_tag LOCUS_19150 gene smc 59729 63289 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861158.1 protein_id gnl|my_center|LOCUS_19150 63328 64293 gene locus_tag LOCUS_19160 63328 64293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 64370 65593 gene locus_tag LOCUS_19170 gene ilvA 64370 65593 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_19170 65616 66521 gene locus_tag LOCUS_19180 65616 66521 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_19180 66629 66991 gene locus_tag LOCUS_19190 66629 66991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 67059 68426 gene locus_tag LOCUS_19200 gene ffh 67059 68426 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_19200 68542 68787 gene locus_tag LOCUS_19210 gene rpsP 68542 68787 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_19210 68812 69039 gene locus_tag LOCUS_19220 68812 69039 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_19220 69192 69698 gene locus_tag LOCUS_19230 gene rimM 69192 69698 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_19230 69695 71125 gene locus_tag LOCUS_19240 69695 71125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 71221 71568 gene locus_tag LOCUS_19250 gene rplS 71221 71568 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_19250 71664 72245 gene locus_tag LOCUS_19260 gene lepB 71664 72245 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425129.1 protein_id gnl|my_center|LOCUS_19260 72294 73088 gene locus_tag LOCUS_19270 gene ylqF 72294 73088 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_19270 73107 73652 gene locus_tag LOCUS_19280 gene lepB 73107 73652 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_19280 73670 74440 gene locus_tag LOCUS_19290 73670 74440 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_19290 74444 76297 gene locus_tag LOCUS_19300 74444 76297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 76301 76585 gene locus_tag LOCUS_19310 76301 76585 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_19310 76606 76971 gene locus_tag LOCUS_19320 76606 76971 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_19320 76984 77871 gene locus_tag LOCUS_19330 gene pgeF 76984 77871 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_19330 77902 78594 gene locus_tag LOCUS_19340 77902 78594 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_19340 78613 81324 gene locus_tag LOCUS_19350 78613 81324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 82520 81321 gene locus_tag LOCUS_19360 82520 81321 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_19360 82679 84025 gene locus_tag LOCUS_19370 82679 84025 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_19370 84046 85386 gene locus_tag LOCUS_19380 gene der 84046 85386 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_19380 85391 86062 gene locus_tag LOCUS_19390 gene plsY 85391 86062 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258974.1 protein_id gnl|my_center|LOCUS_19390 86187 87191 gene locus_tag LOCUS_19400 86187 87191 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_19400 87216 88190 gene locus_tag LOCUS_19410 87216 88190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 88316 89959 gene locus_tag LOCUS_19420 88316 89959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 89981 90130 gene locus_tag LOCUS_19430 89981 90130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 90965 90108 gene locus_tag LOCUS_19440 gene metF 90965 90108 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_19440 92095 91076 gene locus_tag LOCUS_19450 92095 91076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 92269 94008 gene locus_tag LOCUS_19460 92269 94008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 94062 95135 gene locus_tag LOCUS_19470 94062 95135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 95148 96869 gene locus_tag LOCUS_19480 95148 96869 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence17 199 2379 gene locus_tag LOCUS_19490 199 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2490 3419 gene locus_tag LOCUS_19500 2490 3419 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_19500 3532 3909 gene locus_tag LOCUS_19510 3532 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 4118 5029 gene locus_tag LOCUS_19520 4118 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 5013 5834 gene locus_tag LOCUS_19530 5013 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5845 6603 gene locus_tag LOCUS_19540 5845 6603 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 protein_id gnl|my_center|LOCUS_19540 6651 8174 gene locus_tag LOCUS_19550 6651 8174 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575762.1 protein_id gnl|my_center|LOCUS_19550 8190 9251 gene locus_tag LOCUS_19560 8190 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 9260 10045 gene locus_tag LOCUS_19570 9260 10045 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_19570 10035 11183 gene locus_tag LOCUS_19580 10035 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 11201 12535 gene locus_tag LOCUS_19590 11201 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 12584 13858 gene locus_tag LOCUS_19600 12584 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 13855 14910 gene locus_tag LOCUS_19610 13855 14910 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_19610 15008 17185 gene locus_tag LOCUS_19620 15008 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 17211 18386 gene locus_tag LOCUS_19630 17211 18386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 18563 20434 gene locus_tag LOCUS_19640 18563 20434 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_19640 20566 20877 gene locus_tag LOCUS_19650 20566 20877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 21107 22474 gene locus_tag LOCUS_19660 21107 22474 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_19660 22467 23096 gene locus_tag LOCUS_19670 22467 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 23127 24305 gene locus_tag LOCUS_19680 23127 24305 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_19680 24394 24792 gene locus_tag LOCUS_19690 24394 24792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 24806 25960 gene locus_tag LOCUS_19700 24806 25960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 26319 26065 gene locus_tag LOCUS_19710 26319 26065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 26767 26411 gene locus_tag LOCUS_19720 26767 26411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 27302 27604 gene locus_tag LOCUS_19730 27302 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 27801 29006 gene locus_tag LOCUS_19740 gene pseC 27801 29006 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_19740 29104 30039 gene locus_tag LOCUS_19750 29104 30039 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_19750 30041 30577 gene locus_tag LOCUS_19760 30041 30577 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102425.1 protein_id gnl|my_center|LOCUS_19760 30574 31512 gene locus_tag LOCUS_19770 30574 31512 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_19770 31496 33139 gene locus_tag LOCUS_19780 31496 33139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 33770 33120 gene locus_tag LOCUS_19790 33770 33120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 34512 33775 gene locus_tag LOCUS_19800 34512 33775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 34659 36230 gene locus_tag LOCUS_19810 34659 36230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 36227 37966 gene locus_tag LOCUS_19820 36227 37966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_19820 37999 38691 gene locus_tag LOCUS_19830 gene pseF 37999 38691 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_19830 38705 40339 gene locus_tag LOCUS_19840 38705 40339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 40336 41364 gene locus_tag LOCUS_19850 gene pseG 40336 41364 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 protein_id gnl|my_center|LOCUS_19850 41333 42928 gene locus_tag LOCUS_19860 41333 42928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 42950 43903 gene locus_tag LOCUS_19870 42950 43903 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_19870 43973 45094 gene locus_tag LOCUS_19880 gene rffA 43973 45094 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_19880 45098 46177 gene locus_tag LOCUS_19890 45098 46177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 46238 46993 gene locus_tag LOCUS_19900 46238 46993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 48290 47073 gene locus_tag LOCUS_19910 48290 47073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 48578 51907 gene locus_tag LOCUS_19920 48578 51907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 52058 53140 gene locus_tag LOCUS_19930 gene rfbB 52058 53140 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_19930 53273 54142 gene locus_tag LOCUS_19940 gene rfbA 53273 54142 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_19940 54132 55385 gene locus_tag LOCUS_19950 54132 55385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 55466 56017 gene locus_tag LOCUS_19960 gene rfbC 55466 56017 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_19960 56035 57021 gene locus_tag LOCUS_19970 56035 57021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_19970 57043 58416 gene locus_tag LOCUS_19980 57043 58416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_19980 58499 60556 gene locus_tag LOCUS_19990 58499 60556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 63058 60602 gene locus_tag LOCUS_20000 63058 60602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 63248 64969 gene locus_tag LOCUS_20010 63248 64969 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_20010 65100 66452 gene locus_tag LOCUS_20020 65100 66452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 66474 67451 gene locus_tag LOCUS_20030 66474 67451 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_20030 67517 68944 gene locus_tag LOCUS_20040 67517 68944 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_20040 68962 70173 gene locus_tag LOCUS_20050 68962 70173 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966327.1 protein_id gnl|my_center|LOCUS_20050 70354 71406 gene locus_tag LOCUS_20060 70354 71406 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706053.1 protein_id gnl|my_center|LOCUS_20060 71391 73217 gene locus_tag LOCUS_20070 gene glmS 71391 73217 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_20070 73324 74727 gene locus_tag LOCUS_20080 73324 74727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 74826 75128 gene locus_tag LOCUS_20090 74826 75128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 75522 77054 gene locus_tag LOCUS_20100 75522 77054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 77212 77433 gene locus_tag LOCUS_20110 77212 77433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20110 77458 79473 gene locus_tag LOCUS_20120 77458 79473 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906546.1 protein_id gnl|my_center|LOCUS_20120 79503 80279 gene locus_tag LOCUS_20130 79503 80279 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404186.1 protein_id gnl|my_center|LOCUS_20130 80307 81038 gene locus_tag LOCUS_20140 80307 81038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 81059 81310 gene locus_tag LOCUS_20150 81059 81310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_20150 81375 83093 gene locus_tag LOCUS_20160 81375 83093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 83203 84039 gene locus_tag LOCUS_20170 83203 84039 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321472.1 protein_id gnl|my_center|LOCUS_20170 84089 86146 gene locus_tag LOCUS_20180 84089 86146 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 protein_id gnl|my_center|LOCUS_20180 86240 87217 gene locus_tag LOCUS_20190 gene pdaA 86240 87217 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_20190 87401 88942 gene locus_tag LOCUS_20200 gene guaA 87401 88942 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence18 830 156 gene locus_tag LOCUS_20210 830 156 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_20210 1233 2738 gene locus_tag LOCUS_20220 1233 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2803 4803 gene locus_tag LOCUS_20230 2803 4803 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272794.1 protein_id gnl|my_center|LOCUS_20230 7325 4869 gene locus_tag LOCUS_20240 7325 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 7693 7322 gene locus_tag LOCUS_20250 7693 7322 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_20250 7814 8149 gene locus_tag LOCUS_20260 7814 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 9451 8093 gene locus_tag LOCUS_20270 9451 8093 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949126.1 protein_id gnl|my_center|LOCUS_20270 10107 9448 gene locus_tag LOCUS_20280 10107 9448 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_20280 10951 10220 gene locus_tag LOCUS_20290 10951 10220 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405369.1 protein_id gnl|my_center|LOCUS_20290 11683 10958 gene locus_tag LOCUS_20300 11683 10958 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949125.1 protein_id gnl|my_center|LOCUS_20300 12388 11687 gene locus_tag LOCUS_20310 12388 11687 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986262.1 protein_id gnl|my_center|LOCUS_20310 12808 14073 gene locus_tag LOCUS_20320 gene hisS 12808 14073 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_20320 14106 15878 gene locus_tag LOCUS_20330 gene aspS 14106 15878 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_20330 15875 16582 gene locus_tag LOCUS_20340 15875 16582 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_20340 16627 17400 gene locus_tag LOCUS_20350 16627 17400 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_20350 17672 17771 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17984 19822 gene locus_tag LOCUS_20360 17984 19822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_20360 19825 21708 gene locus_tag LOCUS_20370 19825 21708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_20370 21977 22516 gene locus_tag LOCUS_20380 21977 22516 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_20380 22702 25749 gene locus_tag LOCUS_20390 22702 25749 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 protein_id gnl|my_center|LOCUS_20390 25760 27439 gene locus_tag LOCUS_20400 25760 27439 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_20400 27426 28640 gene locus_tag LOCUS_20410 27426 28640 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691244.1 protein_id gnl|my_center|LOCUS_20410 28661 32392 gene locus_tag LOCUS_20420 28661 32392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 32379 33710 gene locus_tag LOCUS_20430 32379 33710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 33883 34056 gene locus_tag LOCUS_20440 33883 34056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 34065 34262 gene locus_tag LOCUS_20450 34065 34262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 34348 34827 gene locus_tag LOCUS_20460 34348 34827 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_20460 34824 35066 gene locus_tag LOCUS_20470 34824 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 35072 35290 gene locus_tag LOCUS_20480 35072 35290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 36592 35315 gene locus_tag LOCUS_20490 36592 35315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 39258 36664 gene locus_tag LOCUS_20500 39258 36664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 39559 40281 gene locus_tag LOCUS_20510 39559 40281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 40308 42206 gene locus_tag LOCUS_20520 40308 42206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_20520 42196 43962 gene locus_tag LOCUS_20530 42196 43962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_20530 44221 44784 gene locus_tag LOCUS_20540 44221 44784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 44793 45371 gene locus_tag LOCUS_20550 44793 45371 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_20550 45579 47546 gene locus_tag LOCUS_20560 45579 47546 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_20560 47626 48480 gene locus_tag LOCUS_20570 47626 48480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 49797 48598 gene locus_tag LOCUS_20580 49797 48598 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_20580 49943 50476 gene locus_tag LOCUS_20590 49943 50476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 50473 51339 gene locus_tag LOCUS_20600 50473 51339 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_20600 51362 52327 gene locus_tag LOCUS_20610 gene pstC 51362 52327 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_20610 52359 53222 gene locus_tag LOCUS_20620 gene pstA 52359 53222 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_20620 53307 54068 gene locus_tag LOCUS_20630 gene pstB 53307 54068 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_20630 54962 54090 gene locus_tag LOCUS_20640 54962 54090 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_20640 56274 54955 gene locus_tag LOCUS_20650 56274 54955 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_20650 56399 56776 gene locus_tag LOCUS_20660 56399 56776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 56871 57014 gene locus_tag LOCUS_20670 gene scfA 56871 57014 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_20670 57094 58509 gene locus_tag LOCUS_20680 gene scfB 57094 58509 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_20680 58529 60760 gene locus_tag LOCUS_20690 58529 60760 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_20690 60992 61858 gene locus_tag LOCUS_20700 60992 61858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 61867 63264 gene locus_tag LOCUS_20710 61867 63264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 63227 64711 gene locus_tag LOCUS_20720 63227 64711 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_20720 64727 67045 gene locus_tag LOCUS_20730 gene priA 64727 67045 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965028.1 protein_id gnl|my_center|LOCUS_20730 67071 67559 gene locus_tag LOCUS_20740 gene def 67071 67559 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_20740 67556 68512 gene locus_tag LOCUS_20750 gene fmt 67556 68512 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_20750 68567 69265 gene locus_tag LOCUS_20760 68567 69265 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_20760 69268 70665 gene locus_tag LOCUS_20770 gene rsmB 69268 70665 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733095.1 protein_id gnl|my_center|LOCUS_20770 70804 71859 gene locus_tag LOCUS_20780 gene rlmN 70804 71859 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_20780 72636 71887 gene locus_tag LOCUS_20790 72636 71887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 72932 72657 gene locus_tag LOCUS_20800 72932 72657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 73734 72994 gene locus_tag LOCUS_20810 73734 72994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 74075 73764 gene locus_tag LOCUS_20820 74075 73764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 74407 74072 gene locus_tag LOCUS_20830 74407 74072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 76183 74468 gene locus_tag LOCUS_20840 76183 74468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 77993 76221 gene locus_tag LOCUS_20850 77993 76221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 78918 77986 gene locus_tag LOCUS_20860 78918 77986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 79962 78922 gene locus_tag LOCUS_20870 79962 78922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 80240 79986 gene locus_tag LOCUS_20880 80240 79986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence19 197 1519 gene locus_tag LOCUS_20890 197 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2268 1516 gene locus_tag LOCUS_20900 2268 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2367 2639 gene locus_tag LOCUS_20910 2367 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3557 2835 gene locus_tag LOCUS_20920 3557 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 6142 3662 gene locus_tag LOCUS_20930 6142 3662 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108570.1 protein_id gnl|my_center|LOCUS_20930 7254 6310 gene locus_tag LOCUS_20940 7254 6310 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_20940 8096 7254 gene locus_tag LOCUS_20950 8096 7254 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_20950 8920 8213 gene locus_tag LOCUS_20960 8920 8213 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_20960 10623 9019 gene locus_tag LOCUS_20970 10623 9019 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_20970 12194 10698 gene locus_tag LOCUS_20980 gene araA 12194 10698 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_20980 13306 12191 gene locus_tag LOCUS_20990 gene araR 13306 12191 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_20990 13895 13434 gene locus_tag LOCUS_21000 13895 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 14496 13972 gene locus_tag LOCUS_21010 14496 13972 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135550050.1 protein_id gnl|my_center|LOCUS_21010 14554 16377 gene locus_tag LOCUS_21020 14554 16377 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_21020 16838 16401 gene locus_tag LOCUS_21030 16838 16401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 18027 16849 gene locus_tag LOCUS_21040 18027 16849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 protein_id gnl|my_center|LOCUS_21040 18800 18024 gene locus_tag LOCUS_21050 18800 18024 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398469.1 protein_id gnl|my_center|LOCUS_21050 19390 18905 gene locus_tag LOCUS_21060 19390 18905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 19662 19456 gene locus_tag LOCUS_21070 19662 19456 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263444.1 protein_id gnl|my_center|LOCUS_21070 20160 19792 gene locus_tag LOCUS_21080 20160 19792 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280524.1 protein_id gnl|my_center|LOCUS_21080 20615 20196 gene locus_tag LOCUS_21090 20615 20196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 23395 20612 gene locus_tag LOCUS_21100 23395 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 24818 23469 gene locus_tag LOCUS_21110 24818 23469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 26120 24978 gene locus_tag LOCUS_21120 gene fucO 26120 24978 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_21120 26378 26172 gene locus_tag LOCUS_21130 26378 26172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 27197 26733 gene locus_tag LOCUS_21140 gene nifU 27197 26733 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_21140 28380 27172 gene locus_tag LOCUS_21150 gene nifS 28380 27172 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_21150 28902 28426 gene locus_tag LOCUS_21160 28902 28426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722799.1 protein_id gnl|my_center|LOCUS_21160 29840 28905 gene locus_tag LOCUS_21170 29840 28905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 30664 29837 gene locus_tag LOCUS_21180 30664 29837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774227.1 protein_id gnl|my_center|LOCUS_21180 31638 30712 gene locus_tag LOCUS_21190 gene cysK 31638 30712 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_21190 32874 31663 gene locus_tag LOCUS_21200 32874 31663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 33851 32889 gene locus_tag LOCUS_21210 gene cysK 33851 32889 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_21210 35068 33872 gene locus_tag LOCUS_21220 35068 33872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 36231 35089 gene locus_tag LOCUS_21230 36231 35089 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 protein_id gnl|my_center|LOCUS_21230 37587 36379 gene locus_tag LOCUS_21240 37587 36379 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_21240 38752 37601 gene locus_tag LOCUS_21250 38752 37601 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_21250 38925 39356 gene locus_tag LOCUS_21260 38925 39356 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_21260 40273 39353 gene locus_tag LOCUS_21270 40273 39353 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813143.1 protein_id gnl|my_center|LOCUS_21270 41849 40587 gene locus_tag LOCUS_21280 41849 40587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 43479 41821 gene locus_tag LOCUS_21290 43479 41821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 44113 43460 gene locus_tag LOCUS_21300 44113 43460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 44431 44207 gene locus_tag LOCUS_21310 44431 44207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 44642 44899 gene locus_tag LOCUS_21320 44642 44899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 45736 45209 gene locus_tag LOCUS_21330 45736 45209 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_21330 46419 45733 gene locus_tag LOCUS_21340 46419 45733 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_21340 48659 46491 gene locus_tag LOCUS_21350 48659 46491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 49227 48967 gene locus_tag LOCUS_21360 49227 48967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 49498 49313 gene locus_tag LOCUS_21370 49498 49313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815107.1 protein_id gnl|my_center|LOCUS_21370 49717 50460 gene locus_tag LOCUS_21380 49717 50460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 50465 51445 gene locus_tag LOCUS_21390 50465 51445 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_21390 51533 52804 gene locus_tag LOCUS_21400 51533 52804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 52985 52806 gene locus_tag LOCUS_21410 52985 52806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 53920 53006 gene locus_tag LOCUS_21420 gene rsmI 53920 53006 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_21420 56465 53973 gene locus_tag LOCUS_21430 56465 53973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 57150 56440 gene locus_tag LOCUS_21440 57150 56440 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454617.1 protein_id gnl|my_center|LOCUS_21440 58117 57380 gene locus_tag LOCUS_21450 58117 57380 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_21450 59456 58095 gene locus_tag LOCUS_21460 59456 58095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 60691 59606 gene locus_tag LOCUS_21470 60691 59606 CDS product glycosyltransferase family 52 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922741.1 protein_id gnl|my_center|LOCUS_21470 61967 60684 gene locus_tag LOCUS_21480 61967 60684 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942610.1 protein_id gnl|my_center|LOCUS_21480 63047 62004 gene locus_tag LOCUS_21490 63047 62004 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_21490 63401 64807 gene locus_tag LOCUS_21500 63401 64807 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243929.1 protein_id gnl|my_center|LOCUS_21500 64791 65417 gene locus_tag LOCUS_21510 64791 65417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 65414 66070 gene locus_tag LOCUS_21520 65414 66070 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_21520 66073 66327 gene locus_tag LOCUS_21530 66073 66327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 66324 67094 gene locus_tag LOCUS_21540 66324 67094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 67117 68181 gene locus_tag LOCUS_21550 67117 68181 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900067.1 protein_id gnl|my_center|LOCUS_21550 69279 68194 gene locus_tag LOCUS_21560 69279 68194 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_21560 69830 69390 gene locus_tag LOCUS_21570 69830 69390 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_21570 70485 69895 gene locus_tag LOCUS_21580 70485 69895 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_21580 71917 70490 gene locus_tag LOCUS_21590 gene pyk 71917 70490 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_21590 73423 71948 gene locus_tag LOCUS_21600 73423 71948 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 protein_id gnl|my_center|LOCUS_21600 74026 73466 gene locus_tag LOCUS_21610 74026 73466 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_21610 75949 74054 gene locus_tag LOCUS_21620 75949 74054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 76456 76142 gene locus_tag LOCUS_21630 76456 76142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 76715 76641 gene locus_tag LOCUS_t00180 76715 76641 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 76827 76753 gene locus_tag LOCUS_t00190 76827 76753 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence20 4859 3894 gene locus_tag LOCUS_21640 4859 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5613 4849 gene locus_tag LOCUS_21650 5613 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 6804 5863 gene locus_tag LOCUS_21660 gene tsf 6804 5863 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_21660 7602 6844 gene locus_tag LOCUS_21670 gene rpsB 7602 6844 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 protein_id gnl|my_center|LOCUS_21670 8407 7772 gene locus_tag LOCUS_21680 8407 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 9391 8432 gene locus_tag LOCUS_21690 9391 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 9711 9406 gene locus_tag LOCUS_21700 9711 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 11348 9759 gene locus_tag LOCUS_21710 11348 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 12179 11406 gene locus_tag LOCUS_21720 gene whiG 12179 11406 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_21720 12496 12206 gene locus_tag LOCUS_21730 12496 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 13013 12516 gene locus_tag LOCUS_21740 13013 12516 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_21740 13688 13065 gene locus_tag LOCUS_21750 13688 13065 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_21750 14260 13772 gene locus_tag LOCUS_21760 14260 13772 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_21760 16388 14280 gene locus_tag LOCUS_21770 16388 14280 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965518.1 protein_id gnl|my_center|LOCUS_21770 17501 16419 gene locus_tag LOCUS_21780 17501 16419 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868672.1 protein_id gnl|my_center|LOCUS_21780 18241 17498 gene locus_tag LOCUS_21790 18241 17498 CDS product flagellar brake domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986947.1 protein_id gnl|my_center|LOCUS_21790 19141 18263 gene locus_tag LOCUS_21800 19141 18263 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460747.1 protein_id gnl|my_center|LOCUS_21800 20442 19192 gene locus_tag LOCUS_21810 gene flhF 20442 19192 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_21810 22487 20442 gene locus_tag LOCUS_21820 gene flhA 22487 20442 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_21820 23624 22515 gene locus_tag LOCUS_21830 gene flhB 23624 22515 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_21830 24403 23621 gene locus_tag LOCUS_21840 gene fliR 24403 23621 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405298.1 protein_id gnl|my_center|LOCUS_21840 24691 24419 gene locus_tag LOCUS_21850 gene fliQ 24691 24419 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_21850 25571 24711 gene locus_tag LOCUS_21860 25571 24711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 25968 25558 gene locus_tag LOCUS_21870 25968 25558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 26330 25968 gene locus_tag LOCUS_21880 gene cheY 26330 25968 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_21880 27725 26346 gene locus_tag LOCUS_21890 gene fliY 27725 26346 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460753.1 protein_id gnl|my_center|LOCUS_21890 28709 27729 gene locus_tag LOCUS_21900 gene fliM 28709 27729 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870065.1 protein_id gnl|my_center|LOCUS_21900 29299 28751 gene locus_tag LOCUS_21910 29299 28751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 30194 29361 gene locus_tag LOCUS_21920 30194 29361 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809827.1 protein_id gnl|my_center|LOCUS_21920 30997 30194 gene locus_tag LOCUS_21930 30997 30194 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_21930 31215 31030 gene locus_tag LOCUS_21940 31215 31030 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556881.1 protein_id gnl|my_center|LOCUS_21940 33243 31351 gene locus_tag LOCUS_21950 33243 31351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 33728 33324 gene locus_tag LOCUS_21960 33728 33324 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392299.1 protein_id gnl|my_center|LOCUS_21960 34665 33781 gene locus_tag LOCUS_21970 34665 33781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 36146 34722 gene locus_tag LOCUS_21980 36146 34722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 37107 36235 gene locus_tag LOCUS_21990 37107 36235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 37584 37126 gene locus_tag LOCUS_22000 37584 37126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 38930 37614 gene locus_tag LOCUS_22010 gene fliI 38930 37614 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_22010 39772 38942 gene locus_tag LOCUS_22020 39772 38942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 40784 39765 gene locus_tag LOCUS_22030 gene fliG 40784 39765 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_22030 42398 40800 gene locus_tag LOCUS_22040 gene fliF 42398 40800 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106531.1 protein_id gnl|my_center|LOCUS_22040 42798 42463 gene locus_tag LOCUS_22050 42798 42463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 43364 42915 gene locus_tag LOCUS_22060 gene flgC 43364 42915 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_22060 43792 43403 gene locus_tag LOCUS_22070 gene flgB 43792 43403 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_22070 44862 44074 gene locus_tag LOCUS_22080 gene codY 44862 44074 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965092.1 protein_id gnl|my_center|LOCUS_22080 47015 44943 gene locus_tag LOCUS_22090 gene topA 47015 44943 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_22090 47584 47186 gene locus_tag LOCUS_22100 47584 47186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 47876 47803 gene locus_tag LOCUS_t00200 47876 47803 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 52719 48028 gene locus_tag LOCUS_22110 gene polC 52719 48028 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_22110 53804 52752 gene locus_tag LOCUS_22120 gene ispG 53804 52752 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_22120 55104 54109 gene locus_tag LOCUS_22130 gene dprA 55104 54109 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_22130 56692 55142 gene locus_tag LOCUS_22140 56692 55142 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_22140 57990 56911 gene locus_tag LOCUS_22150 57990 56911 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944641.1 protein_id gnl|my_center|LOCUS_22150 59102 58011 gene locus_tag LOCUS_22160 59102 58011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 61064 59232 gene locus_tag LOCUS_22170 61064 59232 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_22170 62026 61391 gene locus_tag LOCUS_22180 gene sigK 62026 61391 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_22180 63314 62139 gene locus_tag LOCUS_22190 gene hemW 63314 62139 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_22190 65118 63304 gene locus_tag LOCUS_22200 gene lepA 65118 63304 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_22200 65713 65564 gene locus_tag LOCUS_22210 65713 65564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 66947 65661 gene locus_tag LOCUS_22220 66947 65661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 67961 67041 gene locus_tag LOCUS_22230 gene gpr 67961 67041 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_22230 69951 68068 gene locus_tag LOCUS_22240 69951 68068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 70306 70569 gene locus_tag LOCUS_22250 gene rpsT 70306 70569 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_22250 71614 70703 gene locus_tag LOCUS_22260 71614 70703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 72616 71627 gene locus_tag LOCUS_22270 72616 71627 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_22270 73648 72899 gene locus_tag LOCUS_22280 gene tpiA 73648 72899 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_22280 74084 73620 gene locus_tag LOCUS_22290 74084 73620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 75430 74201 gene locus_tag LOCUS_22300 75430 74201 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence21 169 624 gene locus_tag LOCUS_22310 169 624 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 protein_id gnl|my_center|LOCUS_22310 692 1186 gene locus_tag LOCUS_22320 692 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1170 2039 gene locus_tag LOCUS_22330 1170 2039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262479.1 protein_id gnl|my_center|LOCUS_22330 2085 2777 gene locus_tag LOCUS_22340 2085 2777 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262478.1 protein_id gnl|my_center|LOCUS_22340 3363 2857 gene locus_tag LOCUS_22350 3363 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 4292 3561 gene locus_tag LOCUS_22360 4292 3561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_22360 5037 4294 gene locus_tag LOCUS_22370 5037 4294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681925.1 protein_id gnl|my_center|LOCUS_22370 5605 4997 gene locus_tag LOCUS_22380 5605 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 6536 5751 gene locus_tag LOCUS_22390 6536 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 7410 6529 gene locus_tag LOCUS_22400 7410 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 8990 7533 gene locus_tag LOCUS_22410 8990 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 9756 9031 gene locus_tag LOCUS_22420 9756 9031 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148833.1 protein_id gnl|my_center|LOCUS_22420 10243 9977 gene locus_tag LOCUS_22430 gene yoeB 10243 9977 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_22430 10508 10236 gene locus_tag LOCUS_22440 10508 10236 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_22440 13637 10908 gene locus_tag LOCUS_22450 13637 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 14317 13634 gene locus_tag LOCUS_22460 14317 13634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963847.1 protein_id gnl|my_center|LOCUS_22460 15462 14458 gene locus_tag LOCUS_22470 15462 14458 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963846.1 protein_id gnl|my_center|LOCUS_22470 16130 15459 gene locus_tag LOCUS_22480 16130 15459 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963845.1 protein_id gnl|my_center|LOCUS_22480 16582 16127 gene locus_tag LOCUS_22490 16582 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 16892 17218 gene locus_tag LOCUS_22500 16892 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 18964 17768 gene locus_tag LOCUS_22510 18964 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 19389 19204 gene locus_tag LOCUS_22520 19389 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 19457 19759 gene locus_tag LOCUS_22530 19457 19759 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_22530 19759 20094 gene locus_tag LOCUS_22540 19759 20094 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113282.1 protein_id gnl|my_center|LOCUS_22540 22408 20153 gene locus_tag LOCUS_22550 22408 20153 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964842.1 protein_id gnl|my_center|LOCUS_22550 23109 22408 gene locus_tag LOCUS_22560 23109 22408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964843.1 protein_id gnl|my_center|LOCUS_22560 23848 23219 gene locus_tag LOCUS_22570 23848 23219 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679289.1 protein_id gnl|my_center|LOCUS_22570 24021 24263 gene locus_tag LOCUS_22580 24021 24263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 24851 24351 gene locus_tag LOCUS_22590 24851 24351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812934.1 protein_id gnl|my_center|LOCUS_22590 25717 24872 gene locus_tag LOCUS_22600 25717 24872 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446856.1 protein_id gnl|my_center|LOCUS_22600 26210 25812 gene locus_tag LOCUS_22610 26210 25812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 26872 26207 gene locus_tag LOCUS_22620 26872 26207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 27335 28123 gene locus_tag LOCUS_22630 gene erm(A) 27335 28123 CDS product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072201.1 protein_id gnl|my_center|LOCUS_22630 28184 28822 gene locus_tag LOCUS_22640 28184 28822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 29544 28837 gene locus_tag LOCUS_22650 29544 28837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680349.1 protein_id gnl|my_center|LOCUS_22650 31443 29614 gene locus_tag LOCUS_22660 31443 29614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 33658 31607 gene locus_tag LOCUS_22670 33658 31607 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_22670 34212 33697 gene locus_tag LOCUS_22680 34212 33697 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252838.1 protein_id gnl|my_center|LOCUS_22680 34806 34297 gene locus_tag LOCUS_22690 34806 34297 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897047.1 protein_id gnl|my_center|LOCUS_22690 35328 35149 gene locus_tag LOCUS_22700 35328 35149 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_22700 36187 35450 gene locus_tag LOCUS_22710 36187 35450 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286278.1 protein_id gnl|my_center|LOCUS_22710 37389 36184 gene locus_tag LOCUS_22720 37389 36184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 40063 37736 gene locus_tag LOCUS_22730 40063 37736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 41279 40128 gene locus_tag LOCUS_22740 41279 40128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 41514 42365 gene locus_tag LOCUS_22750 41514 42365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 42381 43064 gene locus_tag LOCUS_22760 42381 43064 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_22760 45158 43134 gene locus_tag LOCUS_22770 45158 43134 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097213.1 protein_id gnl|my_center|LOCUS_22770 46047 45301 gene locus_tag LOCUS_22780 46047 45301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 46538 46050 gene locus_tag LOCUS_22790 46538 46050 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886834.1 protein_id gnl|my_center|LOCUS_22790 47320 46535 gene locus_tag LOCUS_22800 47320 46535 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_22800 48080 47385 gene locus_tag LOCUS_22810 gene cobC 48080 47385 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_22810 49202 48123 gene locus_tag LOCUS_22820 49202 48123 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_22820 50731 49256 gene locus_tag LOCUS_22830 50731 49256 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_22830 50975 51376 gene locus_tag LOCUS_22840 50975 51376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 51495 51935 gene locus_tag LOCUS_22850 51495 51935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 52640 52386 gene locus_tag LOCUS_22860 52640 52386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 53973 52792 gene locus_tag LOCUS_22870 53973 52792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 54668 54006 gene locus_tag LOCUS_22880 gene regX 54668 54006 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_22880 55461 54688 gene locus_tag LOCUS_22890 55461 54688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_22890 57862 55511 gene locus_tag LOCUS_22900 57862 55511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 protein_id gnl|my_center|LOCUS_22900 59285 57933 gene locus_tag LOCUS_22910 59285 57933 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_22910 61246 59507 gene locus_tag LOCUS_22920 61246 59507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_22920 62972 61248 gene locus_tag LOCUS_22930 62972 61248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_22930 63106 63957 gene locus_tag LOCUS_22940 63106 63957 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895974.1 protein_id gnl|my_center|LOCUS_22940 64387 63917 gene locus_tag LOCUS_22950 64387 63917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 65348 64377 gene locus_tag LOCUS_22960 65348 64377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 65988 65341 gene locus_tag LOCUS_22970 65988 65341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 66964 65960 gene locus_tag LOCUS_22980 66964 65960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22980 68734 67739 gene locus_tag LOCUS_22990 68734 67739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence22 <1 1033 gene locus_tag LOCUS_23000 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002359868.1:sugar ABC transporter substrate-binding protein 1125 2189 gene locus_tag LOCUS_23010 1125 2189 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_23010 2194 2985 gene locus_tag LOCUS_23020 2194 2985 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359839.1 protein_id gnl|my_center|LOCUS_23020 3000 3650 gene locus_tag LOCUS_23030 3000 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23030 3866 5035 gene locus_tag LOCUS_23040 3866 5035 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592948.1 protein_id gnl|my_center|LOCUS_23040 5177 7132 gene locus_tag LOCUS_23050 5177 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 7194 8189 gene locus_tag LOCUS_23060 7194 8189 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_23060 8186 9475 gene locus_tag LOCUS_23070 8186 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 9663 11378 gene locus_tag LOCUS_23080 gene tlpC 9663 11378 CDS product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 protein_id gnl|my_center|LOCUS_23080 11393 12049 gene locus_tag LOCUS_23090 11393 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 13989 12211 gene locus_tag LOCUS_23100 13989 12211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_23100 15754 14003 gene locus_tag LOCUS_23110 15754 14003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_23110 16080 17126 gene locus_tag LOCUS_23120 16080 17126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 17233 18462 gene locus_tag LOCUS_23130 17233 18462 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_23130 18988 20445 gene locus_tag LOCUS_23140 gene proS 18988 20445 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_23140 20557 21414 gene locus_tag LOCUS_23150 20557 21414 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 protein_id gnl|my_center|LOCUS_23150 21470 22447 gene locus_tag LOCUS_23160 21470 22447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 23903 22419 gene locus_tag LOCUS_23170 23903 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 24062 24706 gene locus_tag LOCUS_23180 gene trmB 24062 24706 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_23180 24818 25738 gene locus_tag LOCUS_23190 24818 25738 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 protein_id gnl|my_center|LOCUS_23190 27346 25724 gene locus_tag LOCUS_23200 27346 25724 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_23200 28904 27429 gene locus_tag LOCUS_23210 28904 27429 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015055963.1 protein_id gnl|my_center|LOCUS_23210 29097 31361 gene locus_tag LOCUS_23220 gene ftsH 29097 31361 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_23220 31493 33457 gene locus_tag LOCUS_23230 gene uvrC 31493 33457 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_23230 33544 34488 gene locus_tag LOCUS_23240 gene hprK 33544 34488 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_23240 34569 35507 gene locus_tag LOCUS_23250 34569 35507 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_23250 35520 36458 gene locus_tag LOCUS_23260 gene murB 35520 36458 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_23260 36616 37482 gene locus_tag LOCUS_23270 gene rapZ 36616 37482 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_23270 37500 38474 gene locus_tag LOCUS_23280 gene whiA 37500 38474 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_23280 38392 38655 gene locus_tag LOCUS_23290 38392 38655 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_23290 38666 39556 gene locus_tag LOCUS_23300 38666 39556 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722230.1 protein_id gnl|my_center|LOCUS_23300 39676 40539 gene locus_tag LOCUS_23310 gene fba 39676 40539 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_23310 40630 43194 gene locus_tag LOCUS_23320 40630 43194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 45548 43203 gene locus_tag LOCUS_23330 45548 43203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 45921 45586 gene locus_tag LOCUS_23340 45921 45586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 46090 48708 gene locus_tag LOCUS_23350 46090 48708 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_23350 49076 50521 gene locus_tag LOCUS_23360 49076 50521 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_23360 50554 53520 gene locus_tag LOCUS_23370 50554 53520 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895801.1 protein_id gnl|my_center|LOCUS_23370 53701 54399 gene locus_tag LOCUS_23380 53701 54399 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_23380 54399 55691 gene locus_tag LOCUS_23390 54399 55691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 55760 56107 gene locus_tag LOCUS_23400 55760 56107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 56104 56415 gene locus_tag LOCUS_23410 56104 56415 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_23410 56417 56830 gene locus_tag LOCUS_23420 56417 56830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 56876 59290 gene locus_tag LOCUS_23430 56876 59290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 59331 59738 gene locus_tag LOCUS_23440 59331 59738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 61164 59746 gene locus_tag LOCUS_23450 61164 59746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 61829 61308 gene locus_tag LOCUS_23460 61829 61308 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence23 361 1368 gene locus_tag LOCUS_23470 361 1368 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822608.1 protein_id gnl|my_center|LOCUS_23470 1376 2284 gene locus_tag LOCUS_23480 gene mutM 1376 2284 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_23480 2427 3401 gene locus_tag LOCUS_23490 gene bsh 2427 3401 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_23490 4985 3432 gene locus_tag LOCUS_23500 4985 3432 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_23500 6721 5090 gene locus_tag LOCUS_23510 6721 5090 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_23510 7767 6832 gene locus_tag LOCUS_23520 7767 6832 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_23520 8433 8002 gene locus_tag LOCUS_23530 8433 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 9277 8546 gene locus_tag LOCUS_23540 9277 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 11706 9316 gene locus_tag LOCUS_23550 11706 9316 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966706.1 protein_id gnl|my_center|LOCUS_23550 12208 11678 gene locus_tag LOCUS_23560 12208 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23560 12536 13252 gene locus_tag LOCUS_23570 12536 13252 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861930.1 protein_id gnl|my_center|LOCUS_23570 13242 14684 gene locus_tag LOCUS_23580 13242 14684 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861398.1 protein_id gnl|my_center|LOCUS_23580 14841 15743 gene locus_tag LOCUS_23590 14841 15743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_23590 15939 16952 gene locus_tag LOCUS_23600 15939 16952 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861380.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23600 17714 16923 gene locus_tag LOCUS_23610 17714 16923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_23610 20131 17711 gene locus_tag LOCUS_23620 20131 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 21298 20171 gene locus_tag LOCUS_23630 21298 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 23081 21378 gene locus_tag LOCUS_23640 23081 21378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 23972 23385 gene locus_tag LOCUS_23650 23972 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 25370 24048 gene locus_tag LOCUS_23660 25370 24048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 26082 25372 gene locus_tag LOCUS_23670 26082 25372 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_23670 26359 27147 gene locus_tag LOCUS_23680 26359 27147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 27179 28282 gene locus_tag LOCUS_23690 27179 28282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_23690 28326 29222 gene locus_tag LOCUS_23700 28326 29222 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_23700 29292 30167 gene locus_tag LOCUS_23710 29292 30167 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_23710 30164 31765 gene locus_tag LOCUS_23720 30164 31765 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 protein_id gnl|my_center|LOCUS_23720 31868 32758 gene locus_tag LOCUS_23730 31868 32758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 34515 32890 gene locus_tag LOCUS_23740 34515 32890 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095225.1 protein_id gnl|my_center|LOCUS_23740 36122 34542 gene locus_tag LOCUS_23750 36122 34542 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_23750 37044 36103 gene locus_tag LOCUS_23760 37044 36103 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_23760 37673 37152 gene locus_tag LOCUS_23770 37673 37152 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_23770 37852 39687 gene locus_tag LOCUS_23780 37852 39687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674943.1 protein_id gnl|my_center|LOCUS_23780 39677 41542 gene locus_tag LOCUS_23790 39677 41542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_23790 42543 41494 gene locus_tag LOCUS_23800 42543 41494 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814131.1 protein_id gnl|my_center|LOCUS_23800 44994 42787 gene locus_tag LOCUS_23810 44994 42787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 47210 45084 gene locus_tag LOCUS_23820 47210 45084 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_23820 47835 47269 gene locus_tag LOCUS_23830 47835 47269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 48602 48021 gene locus_tag LOCUS_23840 48602 48021 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_23840 49224 48709 gene locus_tag LOCUS_23850 49224 48709 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 protein_id gnl|my_center|LOCUS_23850 49802 49380 gene locus_tag LOCUS_23860 49802 49380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 49997 50905 gene locus_tag LOCUS_23870 49997 50905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 52151 51018 gene locus_tag LOCUS_23880 52151 51018 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_23880 53374 52442 gene locus_tag LOCUS_23890 53374 52442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 53621 53433 gene locus_tag LOCUS_23900 53621 53433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 54534 53644 gene locus_tag LOCUS_23910 54534 53644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 54904 55056 gene locus_tag LOCUS_23920 54904 55056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 55930 55268 gene locus_tag LOCUS_23930 55930 55268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 56477 56031 gene locus_tag LOCUS_23940 56477 56031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 57325 56567 gene locus_tag LOCUS_23950 57325 56567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 57739 57383 gene locus_tag LOCUS_23960 57739 57383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 58161 57961 gene locus_tag LOCUS_23970 58161 57961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 58360 58088 gene locus_tag LOCUS_23980 58360 58088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 58491 58769 gene locus_tag LOCUS_23990 58491 58769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 59702 58785 gene locus_tag LOCUS_24000 59702 58785 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_24000 59953 60531 gene locus_tag LOCUS_24010 59953 60531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 61502 60720 gene locus_tag LOCUS_24020 61502 60720 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence24 118 996 gene locus_tag LOCUS_24030 118 996 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_24030 1207 1896 gene locus_tag LOCUS_24040 1207 1896 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986505.1 protein_id gnl|my_center|LOCUS_24040 2006 3265 gene locus_tag LOCUS_24050 2006 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3462 4166 gene locus_tag LOCUS_24060 3462 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 6343 4295 gene locus_tag LOCUS_24070 6343 4295 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861587.1 protein_id gnl|my_center|LOCUS_24070 6683 7780 gene locus_tag LOCUS_24080 gene ychF 6683 7780 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_24080 7917 8792 gene locus_tag LOCUS_24090 gene lgt 7917 8792 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_24090 10091 8949 gene locus_tag LOCUS_24100 gene glgD 10091 8949 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_24100 11293 10085 gene locus_tag LOCUS_24110 11293 10085 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_24110 11549 12526 gene locus_tag LOCUS_24120 11549 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 12661 13146 gene locus_tag LOCUS_24130 12661 13146 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771878.1 protein_id gnl|my_center|LOCUS_24130 13203 14048 gene locus_tag LOCUS_24140 13203 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 14315 15274 gene locus_tag LOCUS_24150 14315 15274 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134266418.1 protein_id gnl|my_center|LOCUS_24150 15283 15969 gene locus_tag LOCUS_24160 15283 15969 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964178.1 protein_id gnl|my_center|LOCUS_24160 16093 17028 gene locus_tag LOCUS_24170 16093 17028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 protein_id gnl|my_center|LOCUS_24170 17067 17924 gene locus_tag LOCUS_24180 17067 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 18145 19041 gene locus_tag LOCUS_24190 18145 19041 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966017.1 protein_id gnl|my_center|LOCUS_24190 19387 20166 gene locus_tag LOCUS_24200 19387 20166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 20207 21727 gene locus_tag LOCUS_24210 20207 21727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 23122 21992 gene locus_tag LOCUS_24220 23122 21992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 23609 23367 gene locus_tag LOCUS_24230 23609 23367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 23802 24779 gene locus_tag LOCUS_24240 gene spoIIIAA 23802 24779 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_24240 24772 25290 gene locus_tag LOCUS_24250 24772 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 25365 25559 gene locus_tag LOCUS_24260 gene spoIIIAC 25365 25559 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965391.1 protein_id gnl|my_center|LOCUS_24260 25657 26043 gene locus_tag LOCUS_24270 gene spoIIIAD 25657 26043 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_24270 26089 27141 gene locus_tag LOCUS_24280 26089 27141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 27155 27631 gene locus_tag LOCUS_24290 27155 27631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 27667 28329 gene locus_tag LOCUS_24300 27667 28329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 28396 29148 gene locus_tag LOCUS_24310 28396 29148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 29258 30436 gene locus_tag LOCUS_24320 29258 30436 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_24320 30529 32178 gene locus_tag LOCUS_24330 30529 32178 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_24330 32195 33664 gene locus_tag LOCUS_24340 32195 33664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 33736 34119 gene locus_tag LOCUS_24350 33736 34119 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_24350 34134 34544 gene locus_tag LOCUS_24360 gene nusB 34134 34544 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082311.1 protein_id gnl|my_center|LOCUS_24360 34537 35772 gene locus_tag LOCUS_24370 gene xseA 34537 35772 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_24370 35820 36050 gene locus_tag LOCUS_24380 35820 36050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 36037 36990 gene locus_tag LOCUS_24390 36037 36990 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_24390 37017 38882 gene locus_tag LOCUS_24400 gene dxs 37017 38882 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_24400 38879 39775 gene locus_tag LOCUS_24410 38879 39775 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_24410 39775 40596 gene locus_tag LOCUS_24420 39775 40596 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_24420 40648 41094 gene locus_tag LOCUS_24430 40648 41094 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986439.1 protein_id gnl|my_center|LOCUS_24430 41117 42826 gene locus_tag LOCUS_24440 gene recN 41117 42826 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_24440 42978 46292 gene locus_tag LOCUS_24450 gene carB 42978 46292 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_24450 46405 47757 gene locus_tag LOCUS_24460 gene spoIVB 46405 47757 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_24460 48579 49013 gene locus_tag LOCUS_24470 48579 49013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 49094 51298 gene locus_tag LOCUS_24480 49094 51298 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_24480 51583 52284 gene locus_tag LOCUS_24490 gene cas5c 51583 52284 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_24490 52281 54029 gene locus_tag LOCUS_24500 gene cas8c 52281 54029 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_24500 54026 54913 gene locus_tag LOCUS_24510 gene cas7c 54026 54913 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_24510 54919 55584 gene locus_tag LOCUS_24520 gene cas4 54919 55584 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_24520 55581 56609 gene locus_tag LOCUS_24530 gene cas1c 55581 56609 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922509.1 protein_id gnl|my_center|LOCUS_24530 56614 56904 gene locus_tag LOCUS_24540 gene cas2 56614 56904 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_24540 57075 60968 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctccccttgcgggagcgtgggttgaaat >Feature sequence25 21 734 gene locus_tag LOCUS_24550 21 734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227564.1 protein_id gnl|my_center|LOCUS_24550 906 742 gene locus_tag LOCUS_24560 906 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1968 2189 gene locus_tag LOCUS_24570 1968 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2564 2827 gene locus_tag LOCUS_24580 2564 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2985 3695 gene locus_tag LOCUS_24590 2985 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24590 3897 5303 gene locus_tag LOCUS_24600 3897 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5517 5996 gene locus_tag LOCUS_24610 5517 5996 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_24610 6278 6709 gene locus_tag LOCUS_24620 gene mraZ 6278 6709 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_24620 6724 7659 gene locus_tag LOCUS_24630 gene rsmH 6724 7659 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_24630 7691 8218 gene locus_tag LOCUS_24640 7691 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 8246 10429 gene locus_tag LOCUS_24650 8246 10429 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_24650 10498 12234 gene locus_tag LOCUS_24660 10498 12234 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_24660 12231 13196 gene locus_tag LOCUS_24670 gene mraY 12231 13196 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_24670 13226 14581 gene locus_tag LOCUS_24680 gene murD 13226 14581 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_24680 14600 15775 gene locus_tag LOCUS_24690 gene spoVE 14600 15775 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_24690 15835 17088 gene locus_tag LOCUS_24700 gene murA 15835 17088 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_24700 17081 17809 gene locus_tag LOCUS_24710 17081 17809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 17927 19111 gene locus_tag LOCUS_24720 gene ftsZ 17927 19111 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_24720 19298 20185 gene locus_tag LOCUS_24730 gene spoIIGA 19298 20185 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_24730 20133 20882 gene locus_tag LOCUS_24740 gene sigE 20133 20882 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_24740 21052 21354 gene locus_tag LOCUS_24750 21052 21354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 21368 21922 gene locus_tag LOCUS_24760 21368 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 22002 22526 gene locus_tag LOCUS_24770 22002 22526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 22977 22585 gene locus_tag LOCUS_24780 22977 22585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 23089 22916 gene locus_tag LOCUS_24790 23089 22916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 23414 23638 gene locus_tag LOCUS_24800 23414 23638 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_24800 23697 23867 gene locus_tag LOCUS_24810 23697 23867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 23948 25981 gene locus_tag LOCUS_24820 23948 25981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 26013 28934 gene locus_tag LOCUS_24830 26013 28934 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_24830 28986 29930 gene locus_tag LOCUS_24840 28986 29930 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_24840 29932 30795 gene locus_tag LOCUS_24850 29932 30795 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_24850 30809 32320 gene locus_tag LOCUS_24860 30809 32320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24860 32305 32928 gene locus_tag LOCUS_24870 32305 32928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 32925 35540 gene locus_tag LOCUS_24880 32925 35540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 35544 36488 gene locus_tag LOCUS_24890 35544 36488 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_24890 36500 37357 gene locus_tag LOCUS_24900 36500 37357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24900 37354 37494 gene locus_tag LOCUS_24910 37354 37494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 37799 39073 gene locus_tag LOCUS_24920 37799 39073 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583933.1 protein_id gnl|my_center|LOCUS_24920 39371 40408 gene locus_tag LOCUS_24930 gene ccpA 39371 40408 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219066.1 protein_id gnl|my_center|LOCUS_24930 41195 40416 gene locus_tag LOCUS_24940 gene sigG 41195 40416 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_24940 41416 41649 gene locus_tag LOCUS_24950 41416 41649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 41759 42208 gene locus_tag LOCUS_24960 gene nrdR 41759 42208 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_24960 43541 42333 gene locus_tag LOCUS_24970 gene spoVB 43541 42333 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398529.1 protein_id gnl|my_center|LOCUS_24970 43591 43773 gene locus_tag LOCUS_24980 43591 43773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 43807 44943 gene locus_tag LOCUS_24990 gene nifS 43807 44943 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_24990 44980 45684 gene locus_tag LOCUS_25000 44980 45684 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_25000 45771 46871 gene locus_tag LOCUS_25010 45771 46871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 48672 46831 gene locus_tag LOCUS_25020 gene typA 48672 46831 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_25020 48975 49610 gene locus_tag LOCUS_25030 48975 49610 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_25030 49750 50244 gene locus_tag LOCUS_25040 gene cobO 49750 50244 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812021.1 protein_id gnl|my_center|LOCUS_25040 50584 51468 gene locus_tag LOCUS_25050 gene dapA 50584 51468 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965674.1 protein_id gnl|my_center|LOCUS_25050 51493 52257 gene locus_tag LOCUS_25060 gene dapB 51493 52257 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_25060 52949 52305 gene locus_tag LOCUS_25070 52949 52305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 53094 53885 gene locus_tag LOCUS_25080 53094 53885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 54049 54762 gene locus_tag LOCUS_25090 54049 54762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 54851 55351 gene locus_tag LOCUS_25100 54851 55351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 55767 55456 gene locus_tag LOCUS_25110 55767 55456 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830443.1 protein_id gnl|my_center|LOCUS_25110 56049 56702 gene locus_tag LOCUS_25120 56049 56702 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_25120 56766 57791 gene locus_tag LOCUS_25130 56766 57791 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_25130 58407 57922 gene locus_tag LOCUS_25140 58407 57922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence26 1811 480 gene locus_tag LOCUS_25150 1811 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 4405 1838 gene locus_tag LOCUS_25160 4405 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 5728 4421 gene locus_tag LOCUS_25170 5728 4421 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_25170 7034 5802 gene locus_tag LOCUS_25180 7034 5802 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_25180 7994 7047 gene locus_tag LOCUS_25190 gene ftsX 7994 7047 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_25190 8727 7984 gene locus_tag LOCUS_25200 gene ftsE 8727 7984 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_25200 9824 8739 gene locus_tag LOCUS_25210 9824 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 10221 10024 gene locus_tag LOCUS_25220 10221 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 11181 10339 gene locus_tag LOCUS_25230 11181 10339 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_25230 11925 11215 gene locus_tag LOCUS_25240 11925 11215 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_25240 12998 12000 gene locus_tag LOCUS_25250 12998 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 13387 13314 gene locus_tag LOCUS_t00210 13387 13314 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15655 13544 gene locus_tag LOCUS_25260 15655 13544 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_25260 17020 15842 gene locus_tag LOCUS_25270 17020 15842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 18318 17047 gene locus_tag LOCUS_25280 18318 17047 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_25280 18985 18332 gene locus_tag LOCUS_25290 18985 18332 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288107.1 protein_id gnl|my_center|LOCUS_25290 19387 18989 gene locus_tag LOCUS_25300 19387 18989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 19844 19413 gene locus_tag LOCUS_25310 19844 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 21535 19859 gene locus_tag LOCUS_25320 21535 19859 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_25320 21749 21570 gene locus_tag LOCUS_25330 21749 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 22068 21805 gene locus_tag LOCUS_25340 22068 21805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 22496 22071 gene locus_tag LOCUS_25350 gene ruvX 22496 22071 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_25350 22759 22496 gene locus_tag LOCUS_25360 22759 22496 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_25360 24256 22886 gene locus_tag LOCUS_25370 gene mtaB 24256 22886 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_25370 24380 24613 gene locus_tag LOCUS_25380 24380 24613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 25885 24707 gene locus_tag LOCUS_25390 gene thiI 25885 24707 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_25390 27111 25942 gene locus_tag LOCUS_25400 27111 25942 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_25400 27917 27174 gene locus_tag LOCUS_25410 27917 27174 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230015.1 protein_id gnl|my_center|LOCUS_25410 29016 27937 gene locus_tag LOCUS_25420 29016 27937 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822608.1 protein_id gnl|my_center|LOCUS_25420 29605 29174 gene locus_tag LOCUS_25430 29605 29174 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682066.1 protein_id gnl|my_center|LOCUS_25430 30632 29643 gene locus_tag LOCUS_25440 gene prmA 30632 29643 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990133.1 protein_id gnl|my_center|LOCUS_25440 32208 30670 gene locus_tag LOCUS_25450 32208 30670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 33399 32215 gene locus_tag LOCUS_25460 gene dnaJ 33399 32215 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_25460 33658 33371 gene locus_tag LOCUS_25470 33658 33371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 35468 33582 gene locus_tag LOCUS_25480 gene dnaK 35468 33582 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_25480 36239 35553 gene locus_tag LOCUS_25490 gene grpE 36239 35553 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_25490 37344 36304 gene locus_tag LOCUS_25500 gene hrcA 37344 36304 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_25500 37979 37539 gene locus_tag LOCUS_25510 37979 37539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 39044 38124 gene locus_tag LOCUS_25520 39044 38124 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_25520 40009 39161 gene locus_tag LOCUS_25530 40009 39161 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965720.1 protein_id gnl|my_center|LOCUS_25530 41290 40094 gene locus_tag LOCUS_25540 41290 40094 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811798.1 protein_id gnl|my_center|LOCUS_25540 43130 41637 gene locus_tag LOCUS_25550 gene glpK 43130 41637 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_25550 43562 43149 gene locus_tag LOCUS_25560 43562 43149 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_25560 44999 43629 gene locus_tag LOCUS_25570 44999 43629 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_25570 46510 45086 gene locus_tag LOCUS_25580 46510 45086 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_25580 47766 46897 gene locus_tag LOCUS_25590 47766 46897 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_25590 48905 47826 gene locus_tag LOCUS_25600 gene hflK 48905 47826 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311785.1 protein_id gnl|my_center|LOCUS_25600 49178 50674 gene locus_tag LOCUS_25610 49178 50674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 51151 50714 gene locus_tag LOCUS_25620 51151 50714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_25620 52198 51203 gene locus_tag LOCUS_25630 52198 51203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 53225 52509 gene locus_tag LOCUS_25640 53225 52509 CDS product DUF4272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681656.1 protein_id gnl|my_center|LOCUS_25640 54341 53343 gene locus_tag LOCUS_25650 54341 53343 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_25650 55640 54345 gene locus_tag LOCUS_25660 55640 54345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 57537 55771 gene locus_tag LOCUS_25670 57537 55771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 58487 57720 gene locus_tag LOCUS_25680 58487 57720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence27 1265 519 gene locus_tag LOCUS_25690 1265 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2670 1375 gene locus_tag LOCUS_25700 gene hflX 2670 1375 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_25700 4222 2744 gene locus_tag LOCUS_25710 4222 2744 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_25710 4899 4222 gene locus_tag LOCUS_25720 4899 4222 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_25720 5526 4951 gene locus_tag LOCUS_25730 5526 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 6029 5630 gene locus_tag LOCUS_tm00010 6029 5630 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6593 6123 gene locus_tag LOCUS_25740 gene smpB 6593 6123 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_25740 8902 6680 gene locus_tag LOCUS_25750 gene rnr 8902 6680 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_25750 9227 8988 gene locus_tag LOCUS_25760 gene secG 9227 8988 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556760.1 protein_id gnl|my_center|LOCUS_25760 9665 9312 gene locus_tag LOCUS_25770 9665 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 10951 9668 gene locus_tag LOCUS_25780 10951 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 12437 10944 gene locus_tag LOCUS_25790 12437 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 14325 12439 gene locus_tag LOCUS_25800 14325 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 15422 14325 gene locus_tag LOCUS_25810 15422 14325 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534167.1 protein_id gnl|my_center|LOCUS_25810 18273 15451 gene locus_tag LOCUS_25820 18273 15451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 19740 18475 gene locus_tag LOCUS_25830 19740 18475 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_25830 19987 22650 gene locus_tag LOCUS_25840 19987 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 22753 23706 gene locus_tag LOCUS_25850 22753 23706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534167.1 protein_id gnl|my_center|LOCUS_25850 23721 25244 gene locus_tag LOCUS_25860 23721 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 25244 27397 gene locus_tag LOCUS_25870 25244 27397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 27390 28544 gene locus_tag LOCUS_25880 27390 28544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 28541 28942 gene locus_tag LOCUS_25890 28541 28942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 29433 28996 gene locus_tag LOCUS_25900 29433 28996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 31098 29770 gene locus_tag LOCUS_25910 gene eno 31098 29770 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_25910 32218 31196 gene locus_tag LOCUS_25920 32218 31196 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_25920 32597 32887 gene locus_tag LOCUS_25930 32597 32887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 34529 32985 gene locus_tag LOCUS_25940 gene gpmI 34529 32985 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_25940 34741 34589 gene locus_tag LOCUS_25950 34741 34589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 34747 35907 gene locus_tag LOCUS_25960 34747 35907 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_25960 35937 36362 gene locus_tag LOCUS_25970 35937 36362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 39123 36499 gene locus_tag LOCUS_25980 39123 36499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 40307 39141 gene locus_tag LOCUS_25990 40307 39141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 42010 40331 gene locus_tag LOCUS_26000 42010 40331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 43058 42153 gene locus_tag LOCUS_26010 43058 42153 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_26010 44011 43055 gene locus_tag LOCUS_26020 44011 43055 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_26020 46308 44032 gene locus_tag LOCUS_26030 46308 44032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 47322 46531 gene locus_tag LOCUS_26040 47322 46531 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_26040 50670 47374 gene locus_tag LOCUS_26050 50670 47374 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964141.1 protein_id gnl|my_center|LOCUS_26050 51390 50686 gene locus_tag LOCUS_26060 51390 50686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_26060 51890 51558 gene locus_tag LOCUS_26070 51890 51558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 52319 52029 gene locus_tag LOCUS_26080 52319 52029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 52242 54854 gene locus_tag LOCUS_26090 52242 54854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 55364 54906 gene locus_tag LOCUS_26100 55364 54906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 55632 55504 gene locus_tag LOCUS_26110 55632 55504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 55964 55647 gene locus_tag LOCUS_26120 55964 55647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 56620 56033 gene locus_tag LOCUS_26130 56620 56033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence28 267 148 gene locus_tag LOCUS_26140 267 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1324 320 gene locus_tag LOCUS_26150 gene nirJ2 1324 320 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_26150 1648 1337 gene locus_tag LOCUS_26160 1648 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3212 1638 gene locus_tag LOCUS_26170 3212 1638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938206.1 protein_id gnl|my_center|LOCUS_26170 4081 3209 gene locus_tag LOCUS_26180 4081 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 4451 4639 gene locus_tag LOCUS_26190 4451 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 6474 4636 gene locus_tag LOCUS_26200 6474 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 7074 7472 gene locus_tag LOCUS_26210 7074 7472 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_26210 7494 9131 gene locus_tag LOCUS_26220 7494 9131 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_26220 9152 10705 gene locus_tag LOCUS_26230 9152 10705 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_26230 10718 12442 gene locus_tag LOCUS_26240 gene iorA 10718 12442 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_26240 12526 13098 gene locus_tag LOCUS_26250 12526 13098 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_26250 13125 14423 gene locus_tag LOCUS_26260 13125 14423 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_26260 14492 14923 gene locus_tag LOCUS_26270 14492 14923 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_26270 15747 15142 gene locus_tag LOCUS_26280 15747 15142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 16131 15796 gene locus_tag LOCUS_26290 16131 15796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 16353 17084 gene locus_tag LOCUS_26300 gene nagB 16353 17084 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_26300 17103 18260 gene locus_tag LOCUS_26310 gene nagA 17103 18260 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868992.1 protein_id gnl|my_center|LOCUS_26310 18576 18304 gene locus_tag LOCUS_26320 18576 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 19264 18821 gene locus_tag LOCUS_26330 19264 18821 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965786.1 protein_id gnl|my_center|LOCUS_26330 20276 19377 gene locus_tag LOCUS_26340 20276 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 21288 20224 gene locus_tag LOCUS_26350 21288 20224 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459859.1 protein_id gnl|my_center|LOCUS_26350 21603 22220 gene locus_tag LOCUS_26360 21603 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 22737 22665 gene locus_tag LOCUS_t00220 22737 22665 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22920 25355 gene locus_tag LOCUS_26370 22920 25355 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_26370 25523 26524 gene locus_tag LOCUS_26380 25523 26524 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_26380 26850 26539 gene locus_tag LOCUS_26390 gene rhaM 26850 26539 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379067.1 protein_id gnl|my_center|LOCUS_26390 28318 26924 gene locus_tag LOCUS_26400 28318 26924 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_26400 29043 31436 gene locus_tag LOCUS_26410 29043 31436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 32157 31462 gene locus_tag LOCUS_26420 32157 31462 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_26420 33752 32172 gene locus_tag LOCUS_26430 gene malQ 33752 32172 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_26430 36523 33764 gene locus_tag LOCUS_26440 gene pulA 36523 33764 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167510.1 protein_id gnl|my_center|LOCUS_26440 38805 36520 gene locus_tag LOCUS_26450 gene glgP 38805 36520 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_26450 39931 38942 gene locus_tag LOCUS_26460 39931 38942 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080078.1 protein_id gnl|my_center|LOCUS_26460 40178 40681 gene locus_tag LOCUS_26470 gene tadA 40178 40681 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 protein_id gnl|my_center|LOCUS_26470 41991 40708 gene locus_tag LOCUS_26480 41991 40708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 42561 42058 gene locus_tag LOCUS_26490 42561 42058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 42990 43907 gene locus_tag LOCUS_26500 42990 43907 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_26500 44167 43925 gene locus_tag LOCUS_26510 44167 43925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 45210 44164 gene locus_tag LOCUS_26520 45210 44164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 46463 45375 gene locus_tag LOCUS_26530 46463 45375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 47695 46586 gene locus_tag LOCUS_26540 gene ugpC 47695 46586 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_26540 48644 47922 gene locus_tag LOCUS_26550 48644 47922 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_26550 49146 48661 gene locus_tag LOCUS_26560 49146 48661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 50108 49146 gene locus_tag LOCUS_26570 50108 49146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_26570 52242 50239 gene locus_tag LOCUS_26580 gene metG 52242 50239 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_26580 53453 52761 gene locus_tag LOCUS_26590 53453 52761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 54108 53425 gene locus_tag LOCUS_26600 gene rpe 54108 53425 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264901.1 protein_id gnl|my_center|LOCUS_26600 55064 54264 gene locus_tag LOCUS_26610 55064 54264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 55381 56232 gene locus_tag LOCUS_26620 55381 56232 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902813.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence29 1873 107 gene locus_tag LOCUS_26630 1873 107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229520.1 protein_id gnl|my_center|LOCUS_26630 3803 2013 gene locus_tag LOCUS_26640 3803 2013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080006.1 protein_id gnl|my_center|LOCUS_26640 5442 3838 gene locus_tag LOCUS_26650 5442 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 5640 5837 gene locus_tag LOCUS_26660 5640 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 5737 6222 gene locus_tag LOCUS_26670 5737 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 6699 6205 gene locus_tag LOCUS_26680 6699 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 6853 7128 gene locus_tag LOCUS_26690 6853 7128 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_26690 7207 7575 gene locus_tag LOCUS_26700 7207 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 7654 8307 gene locus_tag LOCUS_26710 7654 8307 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_26710 8304 8792 gene locus_tag LOCUS_26720 8304 8792 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682377.1 protein_id gnl|my_center|LOCUS_26720 8789 9454 gene locus_tag LOCUS_26730 8789 9454 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682375.1 protein_id gnl|my_center|LOCUS_26730 9497 10378 gene locus_tag LOCUS_26740 gene rsmA 9497 10378 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_26740 11241 10375 gene locus_tag LOCUS_26750 11241 10375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485364.1 protein_id gnl|my_center|LOCUS_26750 11954 11283 gene locus_tag LOCUS_26760 11954 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 13018 11954 gene locus_tag LOCUS_26770 13018 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 14359 13151 gene locus_tag LOCUS_26780 14359 13151 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_26780 15018 14347 gene locus_tag LOCUS_26790 15018 14347 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_26790 15224 15003 gene locus_tag LOCUS_26800 15224 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 15296 18346 gene locus_tag LOCUS_26810 15296 18346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 18376 20283 gene locus_tag LOCUS_26820 gene glgB 18376 20283 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257047.1 protein_id gnl|my_center|LOCUS_26820 20637 23693 gene locus_tag LOCUS_26830 20637 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 23683 25053 gene locus_tag LOCUS_26840 23683 25053 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_26840 25241 25717 gene locus_tag LOCUS_26850 25241 25717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 25963 25667 gene locus_tag LOCUS_26860 25963 25667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 26139 26339 gene locus_tag LOCUS_26870 26139 26339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 26558 27061 gene locus_tag LOCUS_26880 26558 27061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 27058 28056 gene locus_tag LOCUS_26890 27058 28056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 28075 29292 gene locus_tag LOCUS_26900 28075 29292 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_26900 29210 30031 gene locus_tag LOCUS_26910 29210 30031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 30028 31365 gene locus_tag LOCUS_26920 30028 31365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 31421 31651 gene locus_tag LOCUS_26930 31421 31651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 31652 33094 gene locus_tag LOCUS_26940 31652 33094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 33290 34045 gene locus_tag LOCUS_26950 33290 34045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 34152 34589 gene locus_tag LOCUS_26960 34152 34589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 34586 35023 gene locus_tag LOCUS_26970 34586 35023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 35026 36162 gene locus_tag LOCUS_26980 35026 36162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 36271 36864 gene locus_tag LOCUS_26990 36271 36864 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_26990 36876 37877 gene locus_tag LOCUS_27000 36876 37877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 37918 38328 gene locus_tag LOCUS_27010 37918 38328 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 protein_id gnl|my_center|LOCUS_27010 38329 39171 gene locus_tag LOCUS_27020 38329 39171 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_27020 39192 39716 gene locus_tag LOCUS_27030 39192 39716 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_27030 39891 39978 gene locus_tag LOCUS_t00230 39891 39978 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 40099 40884 gene locus_tag LOCUS_27040 40099 40884 CDS product DUF4111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100880.1 protein_id gnl|my_center|LOCUS_27040 40899 41531 gene locus_tag LOCUS_27050 40899 41531 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_27050 41711 41992 gene locus_tag LOCUS_27060 41711 41992 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437274.1 protein_id gnl|my_center|LOCUS_27060 42119 42826 gene locus_tag LOCUS_27070 42119 42826 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518847.1 protein_id gnl|my_center|LOCUS_27070 42826 43755 gene locus_tag LOCUS_27080 42826 43755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 43881 44480 gene locus_tag LOCUS_27090 43881 44480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 45096 44581 gene locus_tag LOCUS_27100 45096 44581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 45391 45053 gene locus_tag LOCUS_27110 45391 45053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 46274 45555 gene locus_tag LOCUS_27120 46274 45555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 46865 46278 gene locus_tag LOCUS_27130 46865 46278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 47074 47688 gene locus_tag LOCUS_27140 47074 47688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27140 47616 47960 gene locus_tag LOCUS_27150 47616 47960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 47963 48535 gene locus_tag LOCUS_27160 47963 48535 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772606.1 protein_id gnl|my_center|LOCUS_27160 48710 49621 gene locus_tag LOCUS_27170 48710 49621 CDS product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862008.1 protein_id gnl|my_center|LOCUS_27170 49614 50363 gene locus_tag LOCUS_27180 49614 50363 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922653.1 protein_id gnl|my_center|LOCUS_27180 50579 51760 gene locus_tag LOCUS_27190 50579 51760 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_27190 51969 52166 gene locus_tag LOCUS_27200 51969 52166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence30 189 2756 gene locus_tag LOCUS_27210 gene secA 189 2756 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_27210 2789 3913 gene locus_tag LOCUS_27220 gene prfB 2789 3913 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_27220 4673 3918 gene locus_tag LOCUS_27230 4673 3918 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921851.1 protein_id gnl|my_center|LOCUS_27230 5174 4683 gene locus_tag LOCUS_27240 5174 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 5605 5171 gene locus_tag LOCUS_27250 5605 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 5967 7970 gene locus_tag LOCUS_27260 5967 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 8018 10480 gene locus_tag LOCUS_27270 8018 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 10501 11454 gene locus_tag LOCUS_27280 10501 11454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 13196 11658 gene locus_tag LOCUS_27290 13196 11658 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_27290 13439 13918 gene locus_tag LOCUS_27300 13439 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 14056 14685 gene locus_tag LOCUS_27310 14056 14685 CDS product stage V sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438369.1 protein_id gnl|my_center|LOCUS_27310 15544 14678 gene locus_tag LOCUS_27320 15544 14678 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_27320 16013 15666 gene locus_tag LOCUS_27330 16013 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 16238 17698 gene locus_tag LOCUS_27340 16238 17698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 17842 19254 gene locus_tag LOCUS_27350 17842 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 19416 20462 gene locus_tag LOCUS_27360 19416 20462 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_27360 20520 21005 gene locus_tag LOCUS_27370 gene spoVAC 20520 21005 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_27370 21159 21533 gene locus_tag LOCUS_27380 21159 21533 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080932.1 protein_id gnl|my_center|LOCUS_27380 21530 22432 gene locus_tag LOCUS_27390 21530 22432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_27390 22407 24698 gene locus_tag LOCUS_27400 22407 24698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 24744 25460 gene locus_tag LOCUS_27410 24744 25460 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_27410 25553 26191 gene locus_tag LOCUS_27420 25553 26191 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476110.1 protein_id gnl|my_center|LOCUS_27420 26204 26938 gene locus_tag LOCUS_27430 26204 26938 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398521.1 protein_id gnl|my_center|LOCUS_27430 26955 27782 gene locus_tag LOCUS_27440 gene folD 26955 27782 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_27440 27883 29451 gene locus_tag LOCUS_27450 27883 29451 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_27450 29488 30447 gene locus_tag LOCUS_27460 29488 30447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_27460 30459 31271 gene locus_tag LOCUS_27470 30459 31271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_27470 31290 32942 gene locus_tag LOCUS_27480 gene gsiA 31290 32942 CDS product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097436.1 protein_id gnl|my_center|LOCUS_27480 33145 33672 gene locus_tag LOCUS_27490 33145 33672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 33744 35660 gene locus_tag LOCUS_27500 33744 35660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 35791 35612 gene locus_tag LOCUS_27510 35791 35612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 35974 36801 gene locus_tag LOCUS_27520 35974 36801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 36875 38539 gene locus_tag LOCUS_27530 36875 38539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 38571 40163 gene locus_tag LOCUS_27540 38571 40163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012914013.1 protein_id gnl|my_center|LOCUS_27540 40270 40398 gene locus_tag LOCUS_27550 40270 40398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 40484 43210 gene locus_tag LOCUS_27560 40484 43210 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_27560 43548 43162 gene locus_tag LOCUS_27570 43548 43162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 43903 44847 gene locus_tag LOCUS_27580 43903 44847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 45118 44852 gene locus_tag LOCUS_27590 45118 44852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 45324 45548 gene locus_tag LOCUS_27600 45324 45548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 45593 45976 gene locus_tag LOCUS_27610 45593 45976 CDS product DUF6483 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948615.1 protein_id gnl|my_center|LOCUS_27610 46121 46522 gene locus_tag LOCUS_27620 46121 46522 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_27620 46531 49170 gene locus_tag LOCUS_27630 46531 49170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 49340 49570 gene locus_tag LOCUS_27640 49340 49570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 49551 49862 gene locus_tag LOCUS_27650 49551 49862 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_27650 50028 51026 gene locus_tag LOCUS_27660 50028 51026 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900902.1 protein_id gnl|my_center|LOCUS_27660 51162 51425 gene locus_tag LOCUS_27670 51162 51425 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_27670 51551 52432 gene locus_tag LOCUS_27680 51551 52432 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272245.1 protein_id gnl|my_center|LOCUS_27680 52483 52947 gene locus_tag LOCUS_27690 52483 52947 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence31 1239 310 gene locus_tag LOCUS_27700 1239 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2288 1236 gene locus_tag LOCUS_27710 2288 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2628 2556 gene locus_tag LOCUS_t00240 2628 2556 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3033 2734 gene locus_tag LOCUS_27720 3033 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3467 3033 gene locus_tag LOCUS_27730 3467 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 3777 3451 gene locus_tag LOCUS_27740 3777 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 4432 3974 gene locus_tag LOCUS_27750 4432 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 5360 4635 gene locus_tag LOCUS_27760 5360 4635 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_27760 9175 5996 gene locus_tag LOCUS_27770 9175 5996 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480361.1 protein_id gnl|my_center|LOCUS_27770 10319 9162 gene locus_tag LOCUS_27780 10319 9162 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_27780 12040 10322 gene locus_tag LOCUS_27790 12040 10322 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989902.1 protein_id gnl|my_center|LOCUS_27790 12918 12055 gene locus_tag LOCUS_27800 12918 12055 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 protein_id gnl|my_center|LOCUS_27800 14282 12915 gene locus_tag LOCUS_27810 14282 12915 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_27810 15698 14352 gene locus_tag LOCUS_27820 15698 14352 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_27820 16026 16814 gene locus_tag LOCUS_27830 16026 16814 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_27830 16890 17900 gene locus_tag LOCUS_27840 16890 17900 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_27840 18396 17923 gene locus_tag LOCUS_27850 18396 17923 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458892.1 protein_id gnl|my_center|LOCUS_27850 19294 18434 gene locus_tag LOCUS_27860 19294 18434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 20049 19447 gene locus_tag LOCUS_27870 20049 19447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 21108 20188 gene locus_tag LOCUS_27880 21108 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 22331 21129 gene locus_tag LOCUS_27890 22331 21129 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_27890 22799 22437 gene locus_tag LOCUS_27900 22799 22437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 23615 22878 gene locus_tag LOCUS_27910 23615 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 23893 23968 gene locus_tag LOCUS_t00250 23893 23968 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24523 25269 gene locus_tag LOCUS_27920 24523 25269 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815788.1 protein_id gnl|my_center|LOCUS_27920 25262 25477 gene locus_tag LOCUS_27930 25262 25477 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562727.1 protein_id gnl|my_center|LOCUS_27930 25477 26391 gene locus_tag LOCUS_27940 25477 26391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_27940 26443 27213 gene locus_tag LOCUS_27950 26443 27213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435927.1 protein_id gnl|my_center|LOCUS_27950 27284 27763 gene locus_tag LOCUS_27960 27284 27763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_27960 29466 27733 gene locus_tag LOCUS_27970 29466 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 30660 29560 gene locus_tag LOCUS_27980 gene ytvI 30660 29560 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437952.1 protein_id gnl|my_center|LOCUS_27980 31550 30777 gene locus_tag LOCUS_27990 31550 30777 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_27990 32438 31794 gene locus_tag LOCUS_28000 32438 31794 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_28000 32798 34018 gene locus_tag LOCUS_28010 32798 34018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 35490 34015 gene locus_tag LOCUS_28020 35490 34015 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_28020 36649 35543 gene locus_tag LOCUS_28030 36649 35543 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_28030 37770 36646 gene locus_tag LOCUS_28040 37770 36646 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454156.1 protein_id gnl|my_center|LOCUS_28040 38589 37897 gene locus_tag LOCUS_28050 38589 37897 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_28050 40084 38621 gene locus_tag LOCUS_28060 40084 38621 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023877.1 protein_id gnl|my_center|LOCUS_28060 40207 40899 gene locus_tag LOCUS_28070 gene vanR 40207 40899 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_28070 40892 42124 gene locus_tag LOCUS_28080 40892 42124 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_28080 42262 43341 gene locus_tag LOCUS_28090 gene vanG 42262 43341 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_28090 43329 44090 gene locus_tag LOCUS_28100 43329 44090 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436406.1 protein_id gnl|my_center|LOCUS_28100 44087 46492 gene locus_tag LOCUS_28110 gene vanT 44087 46492 CDS product serine racemase VanT catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893196.1 protein_id gnl|my_center|LOCUS_28110 46589 46999 gene locus_tag LOCUS_28120 46589 46999 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_28120 47125 47664 gene locus_tag LOCUS_28130 47125 47664 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_28130 47862 48179 gene locus_tag LOCUS_28140 47862 48179 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_28140 48182 48409 gene locus_tag LOCUS_28150 48182 48409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 48785 48522 gene locus_tag LOCUS_28160 48785 48522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 49025 48831 gene locus_tag LOCUS_28170 49025 48831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 49366 49040 gene locus_tag LOCUS_28180 49366 49040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 49690 49454 gene locus_tag LOCUS_28190 49690 49454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence32 455 709 gene locus_tag LOCUS_28200 455 709 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_28200 702 842 gene locus_tag LOCUS_28210 702 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1105 2397 gene locus_tag LOCUS_28220 1105 2397 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_28220 2502 2960 gene locus_tag LOCUS_28230 gene mscL 2502 2960 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_28230 3119 4183 gene locus_tag LOCUS_28240 3119 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 4367 6754 gene locus_tag LOCUS_28250 4367 6754 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_28250 6751 7680 gene locus_tag LOCUS_28260 gene pyrF 6751 7680 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_28260 7736 8338 gene locus_tag LOCUS_28270 gene thrH 7736 8338 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_28270 8450 10513 gene locus_tag LOCUS_28280 8450 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 10916 12481 gene locus_tag LOCUS_28290 10916 12481 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906091.1 protein_id gnl|my_center|LOCUS_28290 12570 12812 gene locus_tag LOCUS_28300 12570 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 12782 14197 gene locus_tag LOCUS_28310 12782 14197 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_28310 14297 15817 gene locus_tag LOCUS_28320 14297 15817 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 protein_id gnl|my_center|LOCUS_28320 15817 16701 gene locus_tag LOCUS_28330 15817 16701 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262978.1 protein_id gnl|my_center|LOCUS_28330 16910 17584 gene locus_tag LOCUS_28340 gene pyrE 16910 17584 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_28340 17652 17804 gene locus_tag LOCUS_28350 17652 17804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 17931 18194 gene locus_tag LOCUS_28360 17931 18194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 18247 20289 gene locus_tag LOCUS_28370 18247 20289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 20387 20911 gene locus_tag LOCUS_28380 gene purE 20387 20911 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_28380 20939 21964 gene locus_tag LOCUS_28390 gene purM 20939 21964 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_28390 21958 22605 gene locus_tag LOCUS_28400 gene purN 21958 22605 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_28400 22653 23930 gene locus_tag LOCUS_28410 gene purD 22653 23930 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_28410 23993 24454 gene locus_tag LOCUS_28420 23993 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 24476 25975 gene locus_tag LOCUS_28430 24476 25975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 26087 26455 gene locus_tag LOCUS_28440 26087 26455 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_28440 26471 28912 gene locus_tag LOCUS_28450 26471 28912 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_28450 29051 29464 gene locus_tag LOCUS_28460 29051 29464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 29466 30860 gene locus_tag LOCUS_28470 gene radA 29466 30860 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_28470 30941 31012 gene locus_tag LOCUS_t00260 30941 31012 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 31139 31534 gene locus_tag LOCUS_28480 31139 31534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 33960 31669 gene locus_tag LOCUS_28490 33960 31669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 34170 34637 gene locus_tag LOCUS_28500 34170 34637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 34652 35236 gene locus_tag LOCUS_28510 34652 35236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 35247 39071 gene locus_tag LOCUS_28520 35247 39071 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_28520 39098 40336 gene locus_tag LOCUS_28530 39098 40336 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_28530 40435 41631 gene locus_tag LOCUS_28540 gene carA 40435 41631 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 protein_id gnl|my_center|LOCUS_28540 41624 44866 gene locus_tag LOCUS_28550 gene carB 41624 44866 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_28550 44971 45609 gene locus_tag LOCUS_28560 44971 45609 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889536.1 protein_id gnl|my_center|LOCUS_28560 45606 46274 gene locus_tag LOCUS_28570 45606 46274 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_28570 46782 48548 gene locus_tag LOCUS_28580 gene argS 46782 48548 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_28580 48618 48690 gene locus_tag LOCUS_t00270 48618 48690 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence33 1314 205 gene locus_tag LOCUS_28590 gene ugpC 1314 205 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818931.1 protein_id gnl|my_center|LOCUS_28590 2354 1350 gene locus_tag LOCUS_28600 2354 1350 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_28600 3754 2351 gene locus_tag LOCUS_28610 3754 2351 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_28610 4383 3757 gene locus_tag LOCUS_28620 4383 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 4933 4391 gene locus_tag LOCUS_28630 4933 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 6003 4948 gene locus_tag LOCUS_28640 gene ugpC 6003 4948 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722898.1 protein_id gnl|my_center|LOCUS_28640 6505 5996 gene locus_tag LOCUS_28650 6505 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 7092 6502 gene locus_tag LOCUS_28660 7092 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 9412 7205 gene locus_tag LOCUS_28670 9412 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 10232 9477 gene locus_tag LOCUS_28680 10232 9477 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003517572.1 protein_id gnl|my_center|LOCUS_28680 11437 10385 gene locus_tag LOCUS_28690 11437 10385 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_28690 12025 11450 gene locus_tag LOCUS_28700 12025 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 12814 12224 gene locus_tag LOCUS_28710 12814 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 13133 12894 gene locus_tag LOCUS_28720 13133 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 15337 13133 gene locus_tag LOCUS_28730 15337 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28730 15759 15301 gene locus_tag LOCUS_28740 15759 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 18232 15848 gene locus_tag LOCUS_28750 gene feoB 18232 15848 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_28750 18709 18284 gene locus_tag LOCUS_28760 18709 18284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245685.1 protein_id gnl|my_center|LOCUS_28760 20172 18895 gene locus_tag LOCUS_28770 20172 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 21334 20201 gene locus_tag LOCUS_28780 21334 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 21746 21324 gene locus_tag LOCUS_28790 21746 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 22817 21966 gene locus_tag LOCUS_28800 22817 21966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 23293 22814 gene locus_tag LOCUS_28810 23293 22814 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813613.1 protein_id gnl|my_center|LOCUS_28810 24073 23675 gene locus_tag LOCUS_28820 24073 23675 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454481.1 protein_id gnl|my_center|LOCUS_28820 24549 24070 gene locus_tag LOCUS_28830 24549 24070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 25259 24612 gene locus_tag LOCUS_28840 25259 24612 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263256.1 protein_id gnl|my_center|LOCUS_28840 26228 26007 gene locus_tag LOCUS_28850 26228 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 26565 26302 gene locus_tag LOCUS_28860 26565 26302 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812614.1 protein_id gnl|my_center|LOCUS_28860 27117 26848 gene locus_tag LOCUS_28870 27117 26848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 27917 27513 gene locus_tag LOCUS_28880 27917 27513 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454481.1 protein_id gnl|my_center|LOCUS_28880 28483 27914 gene locus_tag LOCUS_28890 28483 27914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 28820 28476 gene locus_tag LOCUS_28900 28820 28476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 29211 28966 gene locus_tag LOCUS_28910 29211 28966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 30942 29497 gene locus_tag LOCUS_28920 30942 29497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 31790 30939 gene locus_tag LOCUS_28930 31790 30939 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837522.1 protein_id gnl|my_center|LOCUS_28930 32683 31787 gene locus_tag LOCUS_28940 32683 31787 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_28940 34223 32703 gene locus_tag LOCUS_28950 34223 32703 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_28950 36603 34228 gene locus_tag LOCUS_28960 36603 34228 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_28960 39250 36674 gene locus_tag LOCUS_28970 39250 36674 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_28970 40013 39252 gene locus_tag LOCUS_28980 40013 39252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 41466 40015 gene locus_tag LOCUS_28990 41466 40015 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_28990 41598 42764 gene locus_tag LOCUS_29000 41598 42764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 43488 43162 gene locus_tag LOCUS_29010 43488 43162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence34 1942 1268 gene locus_tag LOCUS_29020 1942 1268 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_29020 3227 1932 gene locus_tag LOCUS_29030 3227 1932 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_29030 5659 3920 gene locus_tag LOCUS_29040 5659 3920 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_29040 8054 5856 gene locus_tag LOCUS_29050 8054 5856 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897225.1 protein_id gnl|my_center|LOCUS_29050 8175 8032 gene locus_tag LOCUS_29060 8175 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 9208 8204 gene locus_tag LOCUS_29070 9208 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 9758 9195 gene locus_tag LOCUS_29080 9758 9195 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_29080 11254 9923 gene locus_tag LOCUS_29090 11254 9923 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_29090 12609 11299 gene locus_tag LOCUS_29100 12609 11299 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_29100 13672 12728 gene locus_tag LOCUS_29110 13672 12728 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288197.1 protein_id gnl|my_center|LOCUS_29110 13796 13581 gene locus_tag LOCUS_29120 13796 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 14847 13804 gene locus_tag LOCUS_29130 gene gmd 14847 13804 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_29130 15428 14877 gene locus_tag LOCUS_29140 15428 14877 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_29140 15647 16135 gene locus_tag LOCUS_29150 15647 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 17751 16114 gene locus_tag LOCUS_29160 17751 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 18692 17751 gene locus_tag LOCUS_29170 18692 17751 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210120.1 protein_id gnl|my_center|LOCUS_29170 20553 19021 gene locus_tag LOCUS_29180 20553 19021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 20879 20742 gene locus_tag LOCUS_29190 20879 20742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 21066 21245 gene locus_tag LOCUS_29200 21066 21245 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669524.1 protein_id gnl|my_center|LOCUS_29200 21280 21690 gene locus_tag LOCUS_29210 21280 21690 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 protein_id gnl|my_center|LOCUS_29210 22105 21734 gene locus_tag LOCUS_29220 22105 21734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 22715 22632 gene locus_tag LOCUS_t00280 22715 22632 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24528 23083 gene locus_tag LOCUS_29230 24528 23083 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921306.1 protein_id gnl|my_center|LOCUS_29230 25975 24962 gene locus_tag LOCUS_29240 25975 24962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 26270 25995 gene locus_tag LOCUS_29250 26270 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 26423 26755 gene locus_tag LOCUS_29260 26423 26755 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423377.1 protein_id gnl|my_center|LOCUS_29260 27292 27065 gene locus_tag LOCUS_29270 27292 27065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 28261 27308 gene locus_tag LOCUS_29280 gene xerD 28261 27308 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583825.1 protein_id gnl|my_center|LOCUS_29280 28474 28393 gene locus_tag LOCUS_t00290 28474 28393 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28707 28633 gene locus_tag LOCUS_t00300 28707 28633 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 28804 28732 gene locus_tag LOCUS_t00310 28804 28732 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 28922 28848 gene locus_tag LOCUS_t00320 28922 28848 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29063 28989 gene locus_tag LOCUS_t00330 29063 28989 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29693 29271 gene locus_tag LOCUS_29290 29693 29271 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_29290 30000 29677 gene locus_tag LOCUS_29300 30000 29677 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436543.1 protein_id gnl|my_center|LOCUS_29300 31240 30281 gene locus_tag LOCUS_29310 31240 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676624.1 protein_id gnl|my_center|LOCUS_29310 33024 31336 gene locus_tag LOCUS_29320 33024 31336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 33373 33972 gene locus_tag LOCUS_29330 33373 33972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 33984 34754 gene locus_tag LOCUS_29340 33984 34754 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_29340 34778 36028 gene locus_tag LOCUS_29350 34778 36028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 37861 35996 gene locus_tag LOCUS_29360 37861 35996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 38628 37906 gene locus_tag LOCUS_29370 38628 37906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 39696 39235 gene locus_tag LOCUS_29380 39696 39235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 40043 39651 gene locus_tag LOCUS_29390 40043 39651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 40711 40034 gene locus_tag LOCUS_29400 40711 40034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 41817 40963 gene locus_tag LOCUS_29410 41817 40963 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258500.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence35 1801 62 gene locus_tag LOCUS_29420 1801 62 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_29420 2840 1881 gene locus_tag LOCUS_29430 2840 1881 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_29430 3854 2997 gene locus_tag LOCUS_29440 3854 2997 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_29440 6043 3872 gene locus_tag LOCUS_29450 6043 3872 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 protein_id gnl|my_center|LOCUS_29450 6663 6040 gene locus_tag LOCUS_29460 6663 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 8105 6660 gene locus_tag LOCUS_29470 8105 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 8985 8119 gene locus_tag LOCUS_29480 8985 8119 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_29480 9900 8992 gene locus_tag LOCUS_29490 9900 8992 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_29490 12884 9912 gene locus_tag LOCUS_29500 12884 9912 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_29500 13838 12885 gene locus_tag LOCUS_29510 13838 12885 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966644.1 protein_id gnl|my_center|LOCUS_29510 14255 16492 gene locus_tag LOCUS_29520 14255 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 16508 18514 gene locus_tag LOCUS_29530 16508 18514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 19491 18526 gene locus_tag LOCUS_29540 19491 18526 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810614.1 protein_id gnl|my_center|LOCUS_29540 20393 19572 gene locus_tag LOCUS_29550 20393 19572 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775665.1 protein_id gnl|my_center|LOCUS_29550 21715 20447 gene locus_tag LOCUS_29560 21715 20447 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_29560 22369 21764 gene locus_tag LOCUS_29570 gene pgsA 22369 21764 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_29570 23696 22362 gene locus_tag LOCUS_29580 gene rimO 23696 22362 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_29580 24057 23824 gene locus_tag LOCUS_29590 24057 23824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 24695 24057 gene locus_tag LOCUS_29600 gene gmk 24695 24057 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_29600 25016 24738 gene locus_tag LOCUS_29610 25016 24738 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_29610 25925 25047 gene locus_tag LOCUS_29620 25925 25047 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_29620 26127 27917 gene locus_tag LOCUS_29630 26127 27917 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_29630 29877 28024 gene locus_tag LOCUS_29640 gene recJ 29877 28024 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_29640 32399 30228 gene locus_tag LOCUS_29650 32399 30228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 34380 33145 gene locus_tag LOCUS_29660 34380 33145 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_29660 35968 34445 gene locus_tag LOCUS_29670 35968 34445 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_29670 37126 36038 gene locus_tag LOCUS_29680 gene prfA 37126 36038 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_29680 38093 37194 gene locus_tag LOCUS_29690 gene prmC 38093 37194 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966169.1 protein_id gnl|my_center|LOCUS_29690 39291 38305 gene locus_tag LOCUS_29700 39291 38305 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_29700 39604 39404 gene locus_tag LOCUS_29710 gene rpmE 39604 39404 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_29710 40014 39742 gene locus_tag LOCUS_29720 40014 39742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence36 7061 6582 gene locus_tag LOCUS_29730 7061 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 7630 7082 gene locus_tag LOCUS_29740 7630 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 7927 8754 gene locus_tag LOCUS_29750 7927 8754 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681592.1 protein_id gnl|my_center|LOCUS_29750 8768 9571 gene locus_tag LOCUS_29760 8768 9571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_29760 9573 10373 gene locus_tag LOCUS_29770 9573 10373 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681582.1 protein_id gnl|my_center|LOCUS_29770 10849 10445 gene locus_tag LOCUS_29780 10849 10445 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_29780 11185 13035 gene locus_tag LOCUS_29790 11185 13035 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_29790 13052 14368 gene locus_tag LOCUS_29800 13052 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 14637 14515 gene locus_tag LOCUS_29810 14637 14515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 15746 14868 gene locus_tag LOCUS_29820 gene aguB 15746 14868 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_29820 16864 15743 gene locus_tag LOCUS_29830 16864 15743 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272581.1 protein_id gnl|my_center|LOCUS_29830 17974 16880 gene locus_tag LOCUS_29840 gene aguA 17974 16880 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 protein_id gnl|my_center|LOCUS_29840 19427 18363 gene locus_tag LOCUS_29850 19427 18363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 20856 19591 gene locus_tag LOCUS_29860 gene nspC 20856 19591 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_29860 23028 20920 gene locus_tag LOCUS_29870 23028 20920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 25703 23025 gene locus_tag LOCUS_29880 25703 23025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 26560 25733 gene locus_tag LOCUS_29890 26560 25733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 26781 28154 gene locus_tag LOCUS_29900 26781 28154 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_29900 29420 28143 gene locus_tag LOCUS_29910 29420 28143 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_29910 29646 29512 gene locus_tag LOCUS_29920 29646 29512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 30988 29678 gene locus_tag LOCUS_29930 30988 29678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 32011 31157 gene locus_tag LOCUS_29940 gene speE 32011 31157 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_29940 33484 32024 gene locus_tag LOCUS_29950 33484 32024 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_29950 34341 33583 gene locus_tag LOCUS_29960 gene speD 34341 33583 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence37 <1 1019 gene locus_tag LOCUS_29970 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945405.1:putative DNA binding domain-containing protein 1196 1543 gene locus_tag LOCUS_29980 1196 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1619 2008 gene locus_tag LOCUS_29990 1619 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 2114 3379 gene locus_tag LOCUS_30000 2114 3379 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_30000 3412 3723 gene locus_tag LOCUS_30010 3412 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 4300 3716 gene locus_tag LOCUS_30020 4300 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 5000 4386 gene locus_tag LOCUS_30030 5000 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 5218 5793 gene locus_tag LOCUS_30040 5218 5793 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837391.1 protein_id gnl|my_center|LOCUS_30040 5838 6281 gene locus_tag LOCUS_30050 5838 6281 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_30050 6278 6739 gene locus_tag LOCUS_30060 6278 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 6826 7434 gene locus_tag LOCUS_30070 6826 7434 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_30070 8117 7449 gene locus_tag LOCUS_30080 8117 7449 CDS product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868719.1 protein_id gnl|my_center|LOCUS_30080 8304 8750 gene locus_tag LOCUS_30090 8304 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 8840 10168 gene locus_tag LOCUS_30100 8840 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 10377 13889 gene locus_tag LOCUS_30110 10377 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 13962 14915 gene locus_tag LOCUS_30120 13962 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 14912 15718 gene locus_tag LOCUS_30130 14912 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 15803 16597 gene locus_tag LOCUS_30140 15803 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 16655 18103 gene locus_tag LOCUS_30150 16655 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 18150 18851 gene locus_tag LOCUS_30160 18150 18851 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_30160 18900 19547 gene locus_tag LOCUS_30170 18900 19547 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_30170 19762 21579 gene locus_tag LOCUS_30180 19762 21579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680888.1 protein_id gnl|my_center|LOCUS_30180 21576 23378 gene locus_tag LOCUS_30190 21576 23378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_30190 23841 23491 gene locus_tag LOCUS_30200 23841 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 24121 23825 gene locus_tag LOCUS_30210 24121 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 24409 24909 gene locus_tag LOCUS_30220 24409 24909 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775209.1 protein_id gnl|my_center|LOCUS_30220 24919 26607 gene locus_tag LOCUS_30230 24919 26607 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_30230 26644 27591 gene locus_tag LOCUS_30240 26644 27591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 27618 29438 gene locus_tag LOCUS_30250 gene pepF 27618 29438 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439680.1 protein_id gnl|my_center|LOCUS_30250 29454 31055 gene locus_tag LOCUS_30260 29454 31055 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_30260 31612 31085 gene locus_tag LOCUS_30270 31612 31085 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004139.1 protein_id gnl|my_center|LOCUS_30270 31738 31881 gene locus_tag LOCUS_30280 31738 31881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 31878 32915 gene locus_tag LOCUS_30290 31878 32915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 34092 32923 gene locus_tag LOCUS_30300 34092 32923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 34372 33992 gene locus_tag LOCUS_30310 34372 33992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence38 141 1823 gene locus_tag LOCUS_30320 141 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1852 4779 gene locus_tag LOCUS_30330 1852 4779 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861232.1 protein_id gnl|my_center|LOCUS_30330 6233 4707 gene locus_tag LOCUS_30340 6233 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 8655 6220 gene locus_tag LOCUS_30350 8655 6220 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177619.1 protein_id gnl|my_center|LOCUS_30350 9209 8652 gene locus_tag LOCUS_30360 9209 8652 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_30360 9426 9887 gene locus_tag LOCUS_30370 9426 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 9990 10340 gene locus_tag LOCUS_30380 9990 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 10337 11473 gene locus_tag LOCUS_30390 gene glf 10337 11473 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272506.1 protein_id gnl|my_center|LOCUS_30390 12795 11500 gene locus_tag LOCUS_30400 12795 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 12990 13139 gene locus_tag LOCUS_30410 gene rpmG 12990 13139 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_30410 13181 13387 gene locus_tag LOCUS_30420 13181 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 13403 13921 gene locus_tag LOCUS_30430 gene nusG 13403 13921 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_30430 14097 14525 gene locus_tag LOCUS_30440 gene rplK 14097 14525 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_30440 14528 15217 gene locus_tag LOCUS_30450 gene rplA 14528 15217 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_30450 17134 15344 gene locus_tag LOCUS_30460 17134 15344 CDS product DUF6044 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245165.1 protein_id gnl|my_center|LOCUS_30460 17723 17902 gene locus_tag LOCUS_30470 17723 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 17884 18429 gene locus_tag LOCUS_30480 gene rplJ 17884 18429 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_30480 18477 18854 gene locus_tag LOCUS_30490 gene rplL 18477 18854 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_30490 19045 22983 gene locus_tag LOCUS_30500 gene rpoB 19045 22983 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_30500 23021 26725 gene locus_tag LOCUS_30510 gene rpoC 23021 26725 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_30510 26803 27126 gene locus_tag LOCUS_30520 26803 27126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 27123 27989 gene locus_tag LOCUS_30530 gene rfbD 27123 27989 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_30530 28096 28518 gene locus_tag LOCUS_30540 gene rpsL 28096 28518 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_30540 28706 29176 gene locus_tag LOCUS_30550 gene rpsG 28706 29176 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_30550 29209 31374 gene locus_tag LOCUS_30560 gene fusA 29209 31374 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_30560 31541 32728 gene locus_tag LOCUS_30570 gene tuf 31541 32728 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence39 230 787 gene locus_tag LOCUS_30580 gene efp 230 787 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_30580 941 1831 gene locus_tag LOCUS_30590 941 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 1913 1985 gene locus_tag LOCUS_t00340 1913 1985 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2076 3323 gene locus_tag LOCUS_30600 2076 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 3465 3896 gene locus_tag LOCUS_30610 3465 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 4056 5402 gene locus_tag LOCUS_30620 gene gdhA 4056 5402 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_30620 5848 5501 gene locus_tag LOCUS_30630 5848 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 6064 6348 gene locus_tag LOCUS_30640 6064 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 6471 7442 gene locus_tag LOCUS_30650 6471 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 7477 8988 gene locus_tag LOCUS_30660 7477 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 9242 10750 gene locus_tag LOCUS_30670 9242 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 10835 11500 gene locus_tag LOCUS_30680 10835 11500 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_30680 11487 12227 gene locus_tag LOCUS_30690 gene rluF 11487 12227 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222169.1 protein_id gnl|my_center|LOCUS_30690 12263 14251 gene locus_tag LOCUS_30700 gene ligA 12263 14251 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_30700 14264 15169 gene locus_tag LOCUS_30710 gene metA 14264 15169 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_30710 15195 16802 gene locus_tag LOCUS_30720 15195 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 16956 17195 gene locus_tag LOCUS_30730 16956 17195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 17192 17335 gene locus_tag LOCUS_30740 17192 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 21530 17295 gene locus_tag LOCUS_30750 21530 17295 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_30750 21783 22667 gene locus_tag LOCUS_30760 21783 22667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 22845 23591 gene locus_tag LOCUS_30770 22845 23591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 23679 24098 gene locus_tag LOCUS_30780 23679 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 24246 27161 gene locus_tag LOCUS_30790 24246 27161 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_30790 27532 28065 gene locus_tag LOCUS_30800 27532 28065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 28088 28927 gene locus_tag LOCUS_30810 28088 28927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 29092 30090 gene locus_tag LOCUS_30820 29092 30090 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_30820 30258 30749 gene locus_tag LOCUS_30830 30258 30749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 30869 31771 gene locus_tag LOCUS_30840 gene era 30869 31771 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_30840 31873 32079 gene locus_tag LOCUS_30850 31873 32079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 31994 32644 gene locus_tag LOCUS_30860 gene recO 31994 32644 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487010.1 protein_id gnl|my_center|LOCUS_30860 >Feature sequence40 733 146 gene locus_tag LOCUS_30870 733 146 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027149.1 protein_id gnl|my_center|LOCUS_30870 1450 779 gene locus_tag LOCUS_30880 1450 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 2221 1502 gene locus_tag LOCUS_30890 2221 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3034 2237 gene locus_tag LOCUS_30900 3034 2237 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016498.1 protein_id gnl|my_center|LOCUS_30900 3250 4131 gene locus_tag LOCUS_30910 3250 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 4379 4116 gene locus_tag LOCUS_30920 4379 4116 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_30920 4638 4372 gene locus_tag LOCUS_30930 4638 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 6422 4842 gene locus_tag LOCUS_30940 6422 4842 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_30940 7720 6500 gene locus_tag LOCUS_30950 7720 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 8219 7713 gene locus_tag LOCUS_30960 8219 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 10408 8237 gene locus_tag LOCUS_30970 10408 8237 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_30970 10763 11224 gene locus_tag LOCUS_30980 10763 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 11902 11321 gene locus_tag LOCUS_30990 11902 11321 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809539.1 protein_id gnl|my_center|LOCUS_30990 12384 11899 gene locus_tag LOCUS_31000 12384 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 13170 12400 gene locus_tag LOCUS_31010 13170 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 13760 13203 gene locus_tag LOCUS_31020 13760 13203 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965853.1 protein_id gnl|my_center|LOCUS_31020 14921 13776 gene locus_tag LOCUS_31030 14921 13776 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_31030 15218 15634 gene locus_tag LOCUS_31040 15218 15634 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888119.1 protein_id gnl|my_center|LOCUS_31040 16327 15647 gene locus_tag LOCUS_31050 16327 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 16605 17591 gene locus_tag LOCUS_31060 16605 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 19902 17617 gene locus_tag LOCUS_31070 19902 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 20351 19899 gene locus_tag LOCUS_31080 20351 19899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 21631 20372 gene locus_tag LOCUS_31090 21631 20372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 21826 21665 gene locus_tag LOCUS_31100 21826 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 22295 21795 gene locus_tag LOCUS_31110 22295 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 23438 22464 gene locus_tag LOCUS_31120 23438 22464 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905873.1 protein_id gnl|my_center|LOCUS_31120 24050 23571 gene locus_tag LOCUS_31130 gene rlmH 24050 23571 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_31130 24766 24047 gene locus_tag LOCUS_31140 24766 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 26300 24915 gene locus_tag LOCUS_31150 gene gltA 26300 24915 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_31150 27289 26417 gene locus_tag LOCUS_31160 27289 26417 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_31160 29101 27431 gene locus_tag LOCUS_31170 29101 27431 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_31170 31823 29178 gene locus_tag LOCUS_31180 31823 29178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 31989 31786 gene locus_tag LOCUS_31190 31989 31786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence41 99 683 gene locus_tag LOCUS_31200 99 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 957 2561 gene locus_tag LOCUS_31210 957 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 2617 3378 gene locus_tag LOCUS_31220 2617 3378 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 protein_id gnl|my_center|LOCUS_31220 3450 3617 gene locus_tag LOCUS_31230 3450 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 3685 4818 gene locus_tag LOCUS_31240 3685 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4858 5271 gene locus_tag LOCUS_31250 4858 5271 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438911.1 protein_id gnl|my_center|LOCUS_31250 5291 5812 gene locus_tag LOCUS_31260 5291 5812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365476.1 protein_id gnl|my_center|LOCUS_31260 5832 6356 gene locus_tag LOCUS_31270 5832 6356 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947914.1 protein_id gnl|my_center|LOCUS_31270 7837 6674 gene locus_tag LOCUS_31280 7837 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 8249 9103 gene locus_tag LOCUS_31290 8249 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 10352 10813 gene locus_tag LOCUS_31300 10352 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 10891 11841 gene locus_tag LOCUS_31310 10891 11841 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_31310 11885 12586 gene locus_tag LOCUS_31320 11885 12586 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_31320 12601 13290 gene locus_tag LOCUS_31330 12601 13290 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_31330 13435 15333 gene locus_tag LOCUS_31340 13435 15333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680485.1 protein_id gnl|my_center|LOCUS_31340 15375 17300 gene locus_tag LOCUS_31350 15375 17300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_31350 18105 17305 gene locus_tag LOCUS_31360 18105 17305 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_31360 19195 18395 gene locus_tag LOCUS_31370 19195 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 19299 19871 gene locus_tag LOCUS_31380 19299 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 20072 20227 gene locus_tag LOCUS_31390 20072 20227 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_31390 20316 21752 gene locus_tag LOCUS_31400 20316 21752 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109014.1 protein_id gnl|my_center|LOCUS_31400 21765 23729 gene locus_tag LOCUS_31410 21765 23729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 23771 24862 gene locus_tag LOCUS_31420 23771 24862 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_31420 24862 27249 gene locus_tag LOCUS_31430 24862 27249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 27338 28492 gene locus_tag LOCUS_31440 27338 28492 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_31440 28690 29073 gene locus_tag LOCUS_31450 gene cheY 28690 29073 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_31450 29140 29595 gene locus_tag LOCUS_31460 29140 29595 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_31460 29592 29918 gene locus_tag LOCUS_31470 29592 29918 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_31470 29946 30113 gene locus_tag LOCUS_31480 29946 30113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 30155 30511 gene locus_tag LOCUS_31490 30155 30511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 30703 31791 gene locus_tag LOCUS_31500 30703 31791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence42 811 2643 gene locus_tag LOCUS_31510 811 2643 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583579.1 protein_id gnl|my_center|LOCUS_31510 2612 4108 gene locus_tag LOCUS_31520 2612 4108 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_31520 4105 4884 gene locus_tag LOCUS_31530 4105 4884 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546451.1 protein_id gnl|my_center|LOCUS_31530 4881 7256 gene locus_tag LOCUS_31540 4881 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 7373 7636 gene locus_tag LOCUS_31550 7373 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 8467 7739 gene locus_tag LOCUS_31560 gene efpI 8467 7739 CDS product EF-P-5 aminopentanone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244676.1 protein_id gnl|my_center|LOCUS_31560 8745 9653 gene locus_tag LOCUS_31570 gene trxB 8745 9653 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_31570 9900 11099 gene locus_tag LOCUS_31580 9900 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 11560 12087 gene locus_tag LOCUS_31590 gene raiA 11560 12087 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_31590 12250 13353 gene locus_tag LOCUS_31600 12250 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 13410 14096 gene locus_tag LOCUS_31610 13410 14096 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_31610 14084 15211 gene locus_tag LOCUS_31620 14084 15211 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_31620 15333 16199 gene locus_tag LOCUS_31630 15333 16199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 protein_id gnl|my_center|LOCUS_31630 16395 17633 gene locus_tag LOCUS_31640 16395 17633 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861862.1 protein_id gnl|my_center|LOCUS_31640 17612 18244 gene locus_tag LOCUS_31650 17612 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 18379 18549 gene locus_tag LOCUS_31660 18379 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 18557 19849 gene locus_tag LOCUS_31670 18557 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 21177 19837 gene locus_tag LOCUS_31680 21177 19837 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_31680 21350 22018 gene locus_tag LOCUS_31690 21350 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 22040 22498 gene locus_tag LOCUS_31700 22040 22498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 22514 23125 gene locus_tag LOCUS_31710 22514 23125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 23222 25072 gene locus_tag LOCUS_31720 23222 25072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_31720 25069 26832 gene locus_tag LOCUS_31730 25069 26832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_31730 27153 28337 gene locus_tag LOCUS_31740 27153 28337 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_31740 28444 29268 gene locus_tag LOCUS_31750 28444 29268 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_31750 29326 30165 gene locus_tag LOCUS_31760 29326 30165 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_31760 30201 31367 gene locus_tag LOCUS_31770 30201 31367 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_31770 >Feature sequence43 975 391 gene locus_tag LOCUS_31780 975 391 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 protein_id gnl|my_center|LOCUS_31780 1299 1595 gene locus_tag LOCUS_31790 1299 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1871 3379 gene locus_tag LOCUS_31800 gene fliC 1871 3379 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112503.1 protein_id gnl|my_center|LOCUS_31800 3417 3971 gene locus_tag LOCUS_31810 3417 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 4047 4715 gene locus_tag LOCUS_31820 4047 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 4817 5413 gene locus_tag LOCUS_31830 4817 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 5663 5433 gene locus_tag LOCUS_31840 5663 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373720.1 protein_id gnl|my_center|LOCUS_31840 6130 5660 gene locus_tag LOCUS_31850 6130 5660 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_31850 6366 6127 gene locus_tag LOCUS_31860 6366 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 6723 6382 gene locus_tag LOCUS_31870 6723 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 8051 6945 gene locus_tag LOCUS_31880 8051 6945 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386976.1 protein_id gnl|my_center|LOCUS_31880 8740 8051 gene locus_tag LOCUS_31890 8740 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 9154 8825 gene locus_tag LOCUS_31900 9154 8825 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 protein_id gnl|my_center|LOCUS_31900 9383 10594 gene locus_tag LOCUS_31910 9383 10594 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_31910 10607 11344 gene locus_tag LOCUS_31920 10607 11344 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_31920 12004 11417 gene locus_tag LOCUS_31930 gene trmL 12004 11417 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_31930 13211 12048 gene locus_tag LOCUS_31940 13211 12048 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_31940 13690 13208 gene locus_tag LOCUS_31950 13690 13208 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_31950 14778 13720 gene locus_tag LOCUS_31960 14778 13720 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_31960 16363 14870 gene locus_tag LOCUS_31970 16363 14870 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_31970 16587 17204 gene locus_tag LOCUS_31980 16587 17204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 18881 17307 gene locus_tag LOCUS_31990 gene galT 18881 17307 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_31990 20209 19025 gene locus_tag LOCUS_32000 20209 19025 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704250.1 protein_id gnl|my_center|LOCUS_32000 21283 20396 gene locus_tag LOCUS_32010 21283 20396 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702248.1 protein_id gnl|my_center|LOCUS_32010 22509 21364 gene locus_tag LOCUS_32020 22509 21364 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_32020 24964 22535 gene locus_tag LOCUS_32030 24964 22535 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_32030 25146 27119 gene locus_tag LOCUS_32040 25146 27119 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_32040 29298 27145 gene locus_tag LOCUS_32050 29298 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 29749 29258 gene locus_tag LOCUS_32060 29749 29258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 30045 30971 gene locus_tag LOCUS_32070 30045 30971 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 protein_id gnl|my_center|LOCUS_32070 >Feature sequence44 948 31 gene locus_tag LOCUS_32080 948 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 1200 1817 gene locus_tag LOCUS_32090 1200 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 1798 3117 gene locus_tag LOCUS_32100 1798 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 3581 3802 gene locus_tag LOCUS_32110 3581 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 3802 4776 gene locus_tag LOCUS_32120 3802 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 4794 5174 gene locus_tag LOCUS_32130 4794 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 5270 6874 gene locus_tag LOCUS_32140 gene tndX 5270 6874 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_32140 6959 7570 gene locus_tag LOCUS_32150 6959 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 7898 7647 gene locus_tag LOCUS_32160 7898 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 8054 9358 gene locus_tag LOCUS_32170 8054 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 9333 10643 gene locus_tag LOCUS_32180 9333 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 10695 11294 gene locus_tag LOCUS_32190 10695 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 11383 11455 gene locus_tag LOCUS_t00350 11383 11455 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 12786 11581 gene locus_tag LOCUS_32200 12786 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 13182 13252 gene locus_tag LOCUS_t00360 13182 13252 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13330 13403 gene locus_tag LOCUS_t00370 13330 13403 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13514 13687 gene locus_tag LOCUS_32210 13514 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 13714 14112 gene locus_tag LOCUS_32220 13714 14112 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679681.1 protein_id gnl|my_center|LOCUS_32220 15724 14276 gene locus_tag LOCUS_32230 15724 14276 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811050.1 protein_id gnl|my_center|LOCUS_32230 16436 15846 gene locus_tag LOCUS_32240 gene ytaF 16436 15846 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963457.1 protein_id gnl|my_center|LOCUS_32240 16623 17459 gene locus_tag LOCUS_32250 16623 17459 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_32250 17456 18016 gene locus_tag LOCUS_32260 17456 18016 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393868.1 protein_id gnl|my_center|LOCUS_32260 19232 18162 gene locus_tag LOCUS_32270 19232 18162 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_32270 19465 19229 gene locus_tag LOCUS_32280 19465 19229 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428433.1 protein_id gnl|my_center|LOCUS_32280 19827 20780 gene locus_tag LOCUS_32290 19827 20780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 20891 22747 gene locus_tag LOCUS_32300 20891 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 22786 23748 gene locus_tag LOCUS_32310 22786 23748 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974587.1 protein_id gnl|my_center|LOCUS_32310 24553 23768 gene locus_tag LOCUS_32320 24553 23768 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 protein_id gnl|my_center|LOCUS_32320 24784 25209 gene locus_tag LOCUS_32330 gene gtcA 24784 25209 CDS product cell wall teichoic acid glycosylation protein GtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724105.1 protein_id gnl|my_center|LOCUS_32330 26057 25287 gene locus_tag LOCUS_32340 26057 25287 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32340 26814 26209 gene locus_tag LOCUS_32350 26814 26209 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_32350 27712 27014 gene locus_tag LOCUS_32360 27712 27014 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_32360 28225 27746 gene locus_tag LOCUS_32370 28225 27746 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_32370 29580 28366 gene locus_tag LOCUS_32380 29580 28366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 30296 29811 gene locus_tag LOCUS_32390 30296 29811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence45 2234 426 gene locus_tag LOCUS_32400 2234 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2614 2231 gene locus_tag LOCUS_32410 2614 2231 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723032.1 protein_id gnl|my_center|LOCUS_32410 2789 3052 gene locus_tag LOCUS_32420 2789 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3378 4568 gene locus_tag LOCUS_32430 3378 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 4574 5554 gene locus_tag LOCUS_32440 4574 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 6454 5654 gene locus_tag LOCUS_32450 gene vanY 6454 5654 CDS product D-Ala-D-Ala carboxypeptidase VanY-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368695.1 protein_id gnl|my_center|LOCUS_32450 6689 8185 gene locus_tag LOCUS_32460 6689 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 8464 9090 gene locus_tag LOCUS_32470 8464 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 9100 9318 gene locus_tag LOCUS_32480 9100 9318 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 protein_id gnl|my_center|LOCUS_32480 9377 11173 gene locus_tag LOCUS_32490 9377 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 12650 11289 gene locus_tag LOCUS_32500 12650 11289 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_32500 12843 13028 gene locus_tag LOCUS_32510 12843 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 13069 14811 gene locus_tag LOCUS_32520 13069 14811 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_32520 14828 16213 gene locus_tag LOCUS_32530 14828 16213 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_32530 16510 16665 gene locus_tag LOCUS_32540 16510 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 16862 18157 gene locus_tag LOCUS_32550 gene hisD 16862 18157 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402931.1 protein_id gnl|my_center|LOCUS_32550 18281 20173 gene locus_tag LOCUS_32560 18281 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 20286 20501 gene locus_tag LOCUS_32570 20286 20501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 20410 21114 gene locus_tag LOCUS_32580 20410 21114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 22034 21117 gene locus_tag LOCUS_32590 22034 21117 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_32590 22238 23680 gene locus_tag LOCUS_32600 22238 23680 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_32600 23699 24427 gene locus_tag LOCUS_32610 23699 24427 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_32610 >Feature sequence46 <1 1901 gene locus_tag LOCUS_32620 <1 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000610431.1:excinuclease ABC subunit UvrB 2008 4884 gene locus_tag LOCUS_32630 gene uvrA 2008 4884 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963825.1 protein_id gnl|my_center|LOCUS_32630 5180 6172 gene locus_tag LOCUS_32640 5180 6172 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_32640 6182 6958 gene locus_tag LOCUS_32650 6182 6958 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965439.1 protein_id gnl|my_center|LOCUS_32650 7011 7826 gene locus_tag LOCUS_32660 gene flgG 7011 7826 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_32660 7884 8282 gene locus_tag LOCUS_32670 7884 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 8374 10647 gene locus_tag LOCUS_32680 8374 10647 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_32680 10694 11425 gene locus_tag LOCUS_32690 10694 11425 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_32690 11455 11865 gene locus_tag LOCUS_32700 11455 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 11878 12294 gene locus_tag LOCUS_32710 11878 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 12348 13439 gene locus_tag LOCUS_32720 12348 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 13469 14365 gene locus_tag LOCUS_32730 gene cdaA 13469 14365 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_32730 14343 15653 gene locus_tag LOCUS_32740 14343 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 15656 17005 gene locus_tag LOCUS_32750 gene glmM 15656 17005 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_32750 17210 17473 gene locus_tag LOCUS_32760 17210 17473 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949584.1 protein_id gnl|my_center|LOCUS_32760 18097 18747 gene locus_tag LOCUS_32770 18097 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 18785 19159 gene locus_tag LOCUS_32780 18785 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 19502 20455 gene locus_tag LOCUS_32790 19502 20455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 20452 21768 gene locus_tag LOCUS_32800 20452 21768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 23055 21901 gene locus_tag LOCUS_32810 23055 21901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence47 346 522 gene locus_tag LOCUS_32820 346 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 610 2115 gene locus_tag LOCUS_32830 610 2115 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047851.1 protein_id gnl|my_center|LOCUS_32830 2369 2193 gene locus_tag LOCUS_32840 2369 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 2574 3059 gene locus_tag LOCUS_32850 2574 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3764 3051 gene locus_tag LOCUS_32860 3764 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3912 3721 gene locus_tag LOCUS_32870 3912 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 4334 3924 gene locus_tag LOCUS_32880 4334 3924 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019670.1 protein_id gnl|my_center|LOCUS_32880 6136 4376 gene locus_tag LOCUS_32890 gene thrS 6136 4376 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_32890 6997 6485 gene locus_tag LOCUS_32900 6997 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 7212 7673 gene locus_tag LOCUS_32910 7212 7673 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_32910 7670 8383 gene locus_tag LOCUS_32920 7670 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 8420 9115 gene locus_tag LOCUS_32930 8420 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 9179 10393 gene locus_tag LOCUS_32940 9179 10393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810601.1 protein_id gnl|my_center|LOCUS_32940 10989 10456 gene locus_tag LOCUS_32950 10989 10456 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_32950 12095 11070 gene locus_tag LOCUS_32960 12095 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 13144 12164 gene locus_tag LOCUS_32970 13144 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 14201 13239 gene locus_tag LOCUS_32980 14201 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 15255 14296 gene locus_tag LOCUS_32990 15255 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 16372 15320 gene locus_tag LOCUS_33000 16372 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 17374 16634 gene locus_tag LOCUS_33010 17374 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 17591 17355 gene locus_tag LOCUS_33020 17591 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 19446 17581 gene locus_tag LOCUS_33030 19446 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 19574 19449 gene locus_tag LOCUS_33040 19574 19449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 20200 19673 gene locus_tag LOCUS_33050 20200 19673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 20815 20375 gene locus_tag LOCUS_33060 20815 20375 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348730.1 protein_id gnl|my_center|LOCUS_33060 22014 20917 gene locus_tag LOCUS_33070 22014 20917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 22386 22081 gene locus_tag LOCUS_33080 22386 22081 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861913.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence48 1429 368 gene locus_tag LOCUS_33090 1429 368 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592702.1 protein_id gnl|my_center|LOCUS_33090 2064 1627 gene locus_tag LOCUS_33100 2064 1627 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_33100 2462 2094 gene locus_tag LOCUS_33110 2462 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 5548 2510 gene locus_tag LOCUS_33120 5548 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 6310 5561 gene locus_tag LOCUS_33130 6310 5561 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679577.1 protein_id gnl|my_center|LOCUS_33130 6939 6379 gene locus_tag LOCUS_33140 6939 6379 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_33140 7293 6973 gene locus_tag LOCUS_33150 7293 6973 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_33150 7447 8238 gene locus_tag LOCUS_33160 7447 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 8256 9065 gene locus_tag LOCUS_33170 8256 9065 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_33170 9016 9915 gene locus_tag LOCUS_33180 9016 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_33180 11250 10258 gene locus_tag LOCUS_33190 11250 10258 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_33190 12212 11301 gene locus_tag LOCUS_33200 12212 11301 CDS product DUF1861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933050.1 protein_id gnl|my_center|LOCUS_33200 13308 12226 gene locus_tag LOCUS_33210 13308 12226 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989598.1 protein_id gnl|my_center|LOCUS_33210 15325 13364 gene locus_tag LOCUS_33220 15325 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 16037 15426 gene locus_tag LOCUS_33230 16037 15426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 16922 16071 gene locus_tag LOCUS_33240 16922 16071 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_33240 17870 16944 gene locus_tag LOCUS_33250 17870 16944 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_33250 19174 17888 gene locus_tag LOCUS_33260 19174 17888 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061827.1 protein_id gnl|my_center|LOCUS_33260 19683 19495 gene locus_tag LOCUS_33270 19683 19495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 >Feature sequence49 303 1367 gene locus_tag LOCUS_33280 303 1367 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_33280 1463 1897 gene locus_tag LOCUS_33290 gene rpiB 1463 1897 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_33290 1899 2528 gene locus_tag LOCUS_33300 gene upp 1899 2528 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048712.1 protein_id gnl|my_center|LOCUS_33300 2548 3030 gene locus_tag LOCUS_33310 2548 3030 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_33310 3100 4314 gene locus_tag LOCUS_33320 3100 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 4876 4394 gene locus_tag LOCUS_33330 4876 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 5476 4928 gene locus_tag LOCUS_33340 5476 4928 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_33340 5595 5858 gene locus_tag LOCUS_33350 5595 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 5815 6288 gene locus_tag LOCUS_33360 5815 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 6343 7080 gene locus_tag LOCUS_33370 gene atpB 6343 7080 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 protein_id gnl|my_center|LOCUS_33370 7111 7365 gene locus_tag LOCUS_33380 7111 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 7406 7948 gene locus_tag LOCUS_33390 gene atpF 7406 7948 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_33390 7936 8490 gene locus_tag LOCUS_33400 gene atpH 7936 8490 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393858.1 protein_id gnl|my_center|LOCUS_33400 8519 10042 gene locus_tag LOCUS_33410 gene atpA 8519 10042 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_33410 10069 10932 gene locus_tag LOCUS_33420 gene atpG 10069 10932 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_33420 10957 12351 gene locus_tag LOCUS_33430 gene atpD 10957 12351 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_33430 12368 12772 gene locus_tag LOCUS_33440 12368 12772 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_33440 12844 13239 gene locus_tag LOCUS_33450 12844 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 13286 15811 gene locus_tag LOCUS_33460 13286 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 16353 15808 gene locus_tag LOCUS_33470 16353 15808 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_33470 16901 16527 gene locus_tag LOCUS_33480 16901 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 17280 17477 gene locus_tag LOCUS_33490 17280 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 17521 18321 gene locus_tag LOCUS_33500 17521 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence50 122 709 gene locus_tag LOCUS_33510 122 709 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_33510 922 1296 gene locus_tag LOCUS_33520 922 1296 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165225.1 protein_id gnl|my_center|LOCUS_33520 1560 2129 gene locus_tag LOCUS_33530 1560 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 2192 3394 gene locus_tag LOCUS_33540 2192 3394 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_33540 3491 4474 gene locus_tag LOCUS_33550 3491 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 4538 6067 gene locus_tag LOCUS_33560 4538 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 6770 6198 gene locus_tag LOCUS_33570 6770 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 7023 7598 gene locus_tag LOCUS_33580 7023 7598 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224180.1 protein_id gnl|my_center|LOCUS_33580 7698 8432 gene locus_tag LOCUS_33590 7698 8432 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_33590 8429 9712 gene locus_tag LOCUS_33600 8429 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 9786 10544 gene locus_tag LOCUS_33610 9786 10544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_33610 10546 12912 gene locus_tag LOCUS_33620 10546 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 13007 13822 gene locus_tag LOCUS_33630 13007 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 13896 15596 gene locus_tag LOCUS_33640 13896 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 15778 15957 gene locus_tag LOCUS_33650 15778 15957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 16414 17439 gene locus_tag LOCUS_33660 16414 17439 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_33660 17491 17634 gene locus_tag LOCUS_33670 17491 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 17953 18132 gene locus_tag LOCUS_33680 17953 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence51 1603 707 gene locus_tag LOCUS_33690 gene epsE 1603 707 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_33690 2769 1600 gene locus_tag LOCUS_33700 2769 1600 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_33700 3619 2966 gene locus_tag LOCUS_33710 3619 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 5006 3693 gene locus_tag LOCUS_33720 5006 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 5815 5003 gene locus_tag LOCUS_33730 5815 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 6096 6416 gene locus_tag LOCUS_33740 6096 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 9364 6515 gene locus_tag LOCUS_33750 9364 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 10566 9475 gene locus_tag LOCUS_33760 10566 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 12572 10665 gene locus_tag LOCUS_33770 12572 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 13670 12639 gene locus_tag LOCUS_33780 13670 12639 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_33780 14276 13683 gene locus_tag LOCUS_33790 14276 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 14681 14484 gene locus_tag LOCUS_33800 14681 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 15220 14990 gene locus_tag LOCUS_33810 15220 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence52 187 1551 gene locus_tag LOCUS_33820 187 1551 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_33820 3100 1532 gene locus_tag LOCUS_33830 gene cls 3100 1532 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_33830 3602 3189 gene locus_tag LOCUS_33840 3602 3189 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_33840 3806 3678 gene locus_tag LOCUS_33850 3806 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 4330 3845 gene locus_tag LOCUS_33860 4330 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 4863 4327 gene locus_tag LOCUS_33870 4863 4327 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860885.1 protein_id gnl|my_center|LOCUS_33870 5249 5112 gene locus_tag LOCUS_33880 5249 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 5696 5289 gene locus_tag LOCUS_33890 5696 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 5971 5693 gene locus_tag LOCUS_33900 5971 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 6378 5974 gene locus_tag LOCUS_33910 6378 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33910 7096 6407 gene locus_tag LOCUS_33920 7096 6407 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254163.1 protein_id gnl|my_center|LOCUS_33920 8171 7134 gene locus_tag LOCUS_33930 8171 7134 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705392.1 protein_id gnl|my_center|LOCUS_33930 8432 8208 gene locus_tag LOCUS_33940 8432 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 10268 8790 gene locus_tag LOCUS_33950 gene rlmD 10268 8790 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_33950 10545 10273 gene locus_tag LOCUS_33960 10545 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 12948 10606 gene locus_tag LOCUS_33970 gene pcrA 12948 10606 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_33970 13729 12965 gene locus_tag LOCUS_33980 13729 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 <14736 13929 gene locus_tag LOCUS_33990 <14736 13929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003132414.1:SPFH domain-containing protein >Feature sequence53 378 148 gene locus_tag LOCUS_34000 378 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 2386 392 gene locus_tag LOCUS_34010 2386 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3315 2632 gene locus_tag LOCUS_34020 3315 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 3961 3305 gene locus_tag LOCUS_34030 3961 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 4857 3976 gene locus_tag LOCUS_34040 gene pmtA 4857 3976 CDS product phenol-soluble modulin export ABC transporter ATP-binding protein PmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830432.1 protein_id gnl|my_center|LOCUS_34040 5286 4912 gene locus_tag LOCUS_34050 5286 4912 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566897.1 protein_id gnl|my_center|LOCUS_34050 5558 5316 gene locus_tag LOCUS_34060 5558 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 5512 6594 gene locus_tag LOCUS_34070 5512 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 7024 6656 gene locus_tag LOCUS_34080 7024 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 7335 7021 gene locus_tag LOCUS_34090 7335 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 7655 7867 gene locus_tag LOCUS_34100 7655 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 7907 8140 gene locus_tag LOCUS_34110 7907 8140 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_34110 8187 10595 gene locus_tag LOCUS_34120 8187 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 12198 10981 gene locus_tag LOCUS_34130 12198 10981 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34130 12587 12192 gene locus_tag LOCUS_34140 12587 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34140 >Feature sequence54 169 363 gene locus_tag LOCUS_34150 169 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 317 1240 gene locus_tag LOCUS_34160 317 1240 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 protein_id gnl|my_center|LOCUS_34160 1309 3924 gene locus_tag LOCUS_34170 1309 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 4888 3854 gene locus_tag LOCUS_34180 4888 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 5439 4885 gene locus_tag LOCUS_34190 5439 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 7828 5513 gene locus_tag LOCUS_34200 7828 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 8370 7993 gene locus_tag LOCUS_34210 8370 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 9650 8592 gene locus_tag LOCUS_34220 9650 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 10055 10444 gene locus_tag LOCUS_34230 10055 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence55 75 148 gene locus_tag LOCUS_t00380 75 148 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 226 301 gene locus_tag LOCUS_t00390 226 301 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 378 1748 gene locus_tag LOCUS_34240 378 1748 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_34240 1849 2745 gene locus_tag LOCUS_34250 1849 2745 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_34250 2914 4077 gene locus_tag LOCUS_34260 2914 4077 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 protein_id gnl|my_center|LOCUS_34260 7713 4096 gene locus_tag LOCUS_34270 gene nifJ 7713 4096 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881427.1 protein_id gnl|my_center|LOCUS_34270 8707 7790 gene locus_tag LOCUS_34280 8707 7790 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_34280 9463 8732 gene locus_tag LOCUS_34290 9463 8732 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_34290 >Feature sequence56 407 317 gene locus_tag LOCUS_t00400 407 317 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 592 1665 gene locus_tag LOCUS_34300 592 1665 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_34300 1672 3270 gene locus_tag LOCUS_34310 gene dnaX 1672 3270 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963452.1 protein_id gnl|my_center|LOCUS_34310 3332 3676 gene locus_tag LOCUS_34320 3332 3676 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_34320 3676 4272 gene locus_tag LOCUS_34330 gene recR 3676 4272 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_34330 4291 5343 gene locus_tag LOCUS_34340 4291 5343 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_34340 5449 6768 gene locus_tag LOCUS_34350 5449 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 6861 8057 gene locus_tag LOCUS_34360 6861 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 8086 8598 gene locus_tag LOCUS_34370 8086 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 >Feature sequence57 535 1383 gene locus_tag LOCUS_34380 535 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 1751 1503 gene locus_tag LOCUS_34390 1751 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 2072 2929 gene locus_tag LOCUS_34400 2072 2929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_34400 2922 4913 gene locus_tag LOCUS_34410 2922 4913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837281.1 protein_id gnl|my_center|LOCUS_34410 5080 6156 gene locus_tag LOCUS_34420 gene mnmA 5080 6156 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_34420 6245 6775 gene locus_tag LOCUS_34430 6245 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964816.1 protein_id gnl|my_center|LOCUS_34430 7605 6787 gene locus_tag LOCUS_34440 7605 6787 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_34440 >Feature sequence58 161 1636 gene locus_tag LOCUS_34450 161 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 1970 2045 gene locus_tag LOCUS_t00410 1970 2045 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2203 2613 gene locus_tag LOCUS_34460 2203 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 2586 2783 gene locus_tag LOCUS_34470 2586 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 2923 3198 gene locus_tag LOCUS_34480 2923 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3235 3666 gene locus_tag LOCUS_34490 3235 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3861 4016 gene locus_tag LOCUS_34500 3861 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 4149 5339 gene locus_tag LOCUS_34510 4149 5339 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_34510 5299 6423 gene locus_tag LOCUS_34520 5299 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 6444 7055 gene locus_tag LOCUS_34530 6444 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 7033 7509 gene locus_tag LOCUS_34540 7033 7509 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_34540 >Feature sequence59 347 174 gene locus_tag LOCUS_34550 347 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 2059 554 gene locus_tag LOCUS_34560 2059 554 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_34560 4614 2080 gene locus_tag LOCUS_34570 4614 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 5548 4604 gene locus_tag LOCUS_34580 5548 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 6560 5607 gene locus_tag LOCUS_34590 6560 5607 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 protein_id gnl|my_center|LOCUS_34590 >Feature sequence60 1047 79 gene locus_tag LOCUS_34600 1047 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 1954 1079 gene locus_tag LOCUS_34610 1954 1079 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_34610 2483 1971 gene locus_tag LOCUS_34620 2483 1971 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_34620 3099 2524 gene locus_tag LOCUS_34630 3099 2524 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_34630 4939 3101 gene locus_tag LOCUS_34640 4939 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence61 267 2003 gene locus_tag LOCUS_34650 267 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 2979 2098 gene locus_tag LOCUS_34660 2979 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 3853 2993 gene locus_tag LOCUS_34670 3853 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 4020 4766 gene locus_tag LOCUS_34680 gene cwlD 4020 4766 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence62 149 220 gene locus_tag LOCUS_t00420 149 220 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 368 499 gene locus_tag LOCUS_34690 368 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 757 987 gene locus_tag LOCUS_34700 757 987 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_34700 984 1409 gene locus_tag LOCUS_34710 984 1409 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_34710 1625 3043 gene locus_tag LOCUS_34720 1625 3043 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993891.1 protein_id gnl|my_center|LOCUS_34720 3109 3330 gene locus_tag LOCUS_34730 3109 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 3489 3560 gene locus_tag LOCUS_t00430 3489 3560 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3601 3673 gene locus_tag LOCUS_t00440 3601 3673 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4501 3773 gene locus_tag LOCUS_34740 4501 3773 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence63 183 1622 gene locus_tag LOCUS_34750 183 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 1633 2457 gene locus_tag LOCUS_34760 1633 2457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134212093.1 protein_id gnl|my_center|LOCUS_34760 >Feature sequence64 165 1169 gene locus_tag LOCUS_34770 165 1169 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 protein_id gnl|my_center|LOCUS_34770 1228 2373 gene locus_tag LOCUS_34780 1228 2373 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179093.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence65 915 292 gene locus_tag LOCUS_34790 915 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 2598 1273 gene locus_tag LOCUS_34800 2598 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 >Feature sequence66 580 368 gene locus_tag LOCUS_34810 580 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 1144 650 gene locus_tag LOCUS_34820 1144 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820