>Feature sequence01 133 1488 gene locus_tag LOCUS_00010 133 1488 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 protein_id gnl|my_center|LOCUS_00010 1516 3273 gene locus_tag LOCUS_00020 1516 3273 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_00020 5173 3296 gene locus_tag LOCUS_00030 5173 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5291 5665 gene locus_tag LOCUS_00040 5291 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5784 5930 gene locus_tag LOCUS_00050 gene scfA 5784 5930 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_00050 6023 7399 gene locus_tag LOCUS_00060 gene scfB 6023 7399 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_00060 7434 9617 gene locus_tag LOCUS_00070 7434 9617 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_00070 9732 11459 gene locus_tag LOCUS_00080 gene recJ 9732 11459 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_00080 11471 12589 gene locus_tag LOCUS_00090 11471 12589 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139014079.1 protein_id gnl|my_center|LOCUS_00090 13660 12650 gene locus_tag LOCUS_00100 13660 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14024 15502 gene locus_tag LOCUS_00110 14024 15502 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_00110 15499 17775 gene locus_tag LOCUS_00120 gene priA 15499 17775 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_00120 17798 18280 gene locus_tag LOCUS_00130 gene def 17798 18280 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_00130 18285 19262 gene locus_tag LOCUS_00140 gene fmt 18285 19262 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_00140 19324 20034 gene locus_tag LOCUS_00150 19324 20034 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 protein_id gnl|my_center|LOCUS_00150 20035 21405 gene locus_tag LOCUS_00160 gene rsmB 20035 21405 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_00160 21418 22461 gene locus_tag LOCUS_00170 gene rlmN 21418 22461 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_00170 22464 23210 gene locus_tag LOCUS_00180 22464 23210 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_00180 23226 25355 gene locus_tag LOCUS_00190 gene pknB 23226 25355 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_00190 25383 26261 gene locus_tag LOCUS_00200 gene rsgA 25383 26261 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_00200 26289 26555 gene locus_tag LOCUS_00210 26289 26555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26655 27755 gene locus_tag LOCUS_00220 gene ychF 26655 27755 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_00220 27788 28705 gene locus_tag LOCUS_00230 gene lgt 27788 28705 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_00230 29157 28915 gene locus_tag LOCUS_00240 29157 28915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29331 30284 gene locus_tag LOCUS_00250 gene spoIIIAA 29331 30284 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_00250 30269 30787 gene locus_tag LOCUS_00260 30269 30787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30805 30999 gene locus_tag LOCUS_00270 30805 30999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31008 31394 gene locus_tag LOCUS_00280 gene spoIIIAD 31008 31394 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965390.1 protein_id gnl|my_center|LOCUS_00280 31398 32441 gene locus_tag LOCUS_00290 31398 32441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32441 33028 gene locus_tag LOCUS_00300 32441 33028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33021 33614 gene locus_tag LOCUS_00310 33021 33614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33627 34388 gene locus_tag LOCUS_00320 33627 34388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34597 36192 gene locus_tag LOCUS_00330 34597 36192 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_00330 36192 37484 gene locus_tag LOCUS_00340 36192 37484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37563 37943 gene locus_tag LOCUS_00350 37563 37943 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419170.1 protein_id gnl|my_center|LOCUS_00350 37953 38360 gene locus_tag LOCUS_00360 gene nusB 37953 38360 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_00360 38367 39572 gene locus_tag LOCUS_00370 gene xseA 38367 39572 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_00370 39569 39775 gene locus_tag LOCUS_00380 39569 39775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39753 40658 gene locus_tag LOCUS_00390 39753 40658 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_00390 40672 42606 gene locus_tag LOCUS_00400 gene dxs 40672 42606 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_00400 42603 43445 gene locus_tag LOCUS_00410 42603 43445 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_00410 43463 44323 gene locus_tag LOCUS_00420 43463 44323 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_00420 44325 44780 gene locus_tag LOCUS_00430 44325 44780 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_00430 44770 46455 gene locus_tag LOCUS_00440 gene recN 44770 46455 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583410.1 protein_id gnl|my_center|LOCUS_00440 46584 47831 gene locus_tag LOCUS_00450 gene spoIVB 46584 47831 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_00450 47998 48441 gene locus_tag LOCUS_00460 47998 48441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 48622 50955 gene locus_tag LOCUS_00470 48622 50955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 51080 51595 gene locus_tag LOCUS_00480 51080 51595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51912 53357 gene locus_tag LOCUS_00490 gene glgA 51912 53357 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_00490 53636 53442 gene locus_tag LOCUS_00500 53636 53442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 55474 53732 gene locus_tag LOCUS_00510 55474 53732 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_00510 55797 57422 gene locus_tag LOCUS_00520 55797 57422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 57436 58401 gene locus_tag LOCUS_00530 57436 58401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 58729 59844 gene locus_tag LOCUS_00540 58729 59844 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_00540 59805 62189 gene locus_tag LOCUS_00550 59805 62189 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084336.1 protein_id gnl|my_center|LOCUS_00550 62193 63320 gene locus_tag LOCUS_00560 62193 63320 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786824.1 protein_id gnl|my_center|LOCUS_00560 63317 65515 gene locus_tag LOCUS_00570 63317 65515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 65512 69087 gene locus_tag LOCUS_00580 65512 69087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 70242 69205 gene locus_tag LOCUS_00590 70242 69205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 70374 70835 gene locus_tag LOCUS_00600 70374 70835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70838 72205 gene locus_tag LOCUS_00610 70838 72205 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_00610 72282 73160 gene locus_tag LOCUS_00620 72282 73160 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_00620 73194 73460 gene locus_tag LOCUS_00630 gene remA 73194 73460 CDS product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 protein_id gnl|my_center|LOCUS_00630 73450 74082 gene locus_tag LOCUS_00640 gene gmk 73450 74082 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_00640 74085 74318 gene locus_tag LOCUS_00650 74085 74318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 74331 75677 gene locus_tag LOCUS_00660 gene rimO 74331 75677 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_00660 75658 76197 gene locus_tag LOCUS_00670 gene pgsA 75658 76197 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_00670 76199 77458 gene locus_tag LOCUS_00680 76199 77458 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_00680 77534 78904 gene locus_tag LOCUS_00690 77534 78904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79161 80291 gene locus_tag LOCUS_00700 gene recA 79161 80291 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_00700 80291 80914 gene locus_tag LOCUS_00710 80291 80914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 81033 82580 gene locus_tag LOCUS_00720 gene rny 81033 82580 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_00720 82998 84299 gene locus_tag LOCUS_00730 82998 84299 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_00730 84292 84828 gene locus_tag LOCUS_00740 84292 84828 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723131.1 protein_id gnl|my_center|LOCUS_00740 84857 85468 gene locus_tag LOCUS_00750 84857 85468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 85605 86489 gene locus_tag LOCUS_00760 gene xerD 85605 86489 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_00760 87635 86607 gene locus_tag LOCUS_00770 87635 86607 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_00770 89096 87750 gene locus_tag LOCUS_00780 89096 87750 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888874.1 protein_id gnl|my_center|LOCUS_00780 89231 90412 gene locus_tag LOCUS_00790 gene nifS 89231 90412 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_00790 90444 90887 gene locus_tag LOCUS_00800 gene nifU 90444 90887 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_00800 90887 91969 gene locus_tag LOCUS_00810 gene mnmA 90887 91969 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_00810 92061 94652 gene locus_tag LOCUS_00820 92061 94652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 95569 94748 gene locus_tag LOCUS_00830 95569 94748 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_00830 96013 97041 gene locus_tag LOCUS_00840 gene gap 96013 97041 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_00840 97217 98440 gene locus_tag LOCUS_00850 97217 98440 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_00850 98460 99206 gene locus_tag LOCUS_00860 gene tpiA 98460 99206 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_00860 100187 99591 gene locus_tag LOCUS_00870 100187 99591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 100324 100848 gene locus_tag LOCUS_00880 100324 100848 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_00880 101487 100873 gene locus_tag LOCUS_00890 101487 100873 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_00890 101657 102199 gene locus_tag LOCUS_00900 101657 102199 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_00900 102196 102759 gene locus_tag LOCUS_00910 102196 102759 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_00910 102789 103466 gene locus_tag LOCUS_00920 102789 103466 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_00920 103504 104478 gene locus_tag LOCUS_00930 103504 104478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 105595 104435 gene locus_tag LOCUS_00940 105595 104435 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_00940 105826 107370 gene locus_tag LOCUS_00950 gene gpmI 105826 107370 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_00950 107409 111080 gene locus_tag LOCUS_00960 107409 111080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 111241 111609 gene locus_tag LOCUS_00970 gene ytrA 111241 111609 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_00970 111602 112507 gene locus_tag LOCUS_00980 111602 112507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_00980 112479 114665 gene locus_tag LOCUS_00990 112479 114665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 114759 116084 gene locus_tag LOCUS_01000 gene eno 114759 116084 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_01000 116171 116410 gene locus_tag LOCUS_01010 116171 116410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 116593 118725 gene locus_tag LOCUS_01020 gene rnr 116593 118725 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_01020 118729 119193 gene locus_tag LOCUS_01030 gene smpB 118729 119193 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_01030 119253 119591 gene locus_tag LOCUS_tm00010 119253 119591 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 121462 121028 gene locus_tag LOCUS_01040 121462 121028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 121893 121468 gene locus_tag LOCUS_01050 121893 121468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 122048 122620 gene locus_tag LOCUS_01060 122048 122620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 122635 122919 gene locus_tag LOCUS_01070 122635 122919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246457.1 protein_id gnl|my_center|LOCUS_01070 122891 123733 gene locus_tag LOCUS_01080 122891 123733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 123730 123936 gene locus_tag LOCUS_01090 123730 123936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 123969 124202 gene locus_tag LOCUS_01100 123969 124202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 124192 124716 gene locus_tag LOCUS_01110 124192 124716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 124785 125198 gene locus_tag LOCUS_01120 124785 125198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 125188 126366 gene locus_tag LOCUS_01130 125188 126366 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_01130 126380 126925 gene locus_tag LOCUS_01140 126380 126925 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_01140 126941 128914 gene locus_tag LOCUS_01150 126941 128914 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_01150 128928 129497 gene locus_tag LOCUS_01160 128928 129497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 129561 130064 gene locus_tag LOCUS_01170 129561 130064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 130054 132507 gene locus_tag LOCUS_01180 130054 132507 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_01180 132782 133078 gene locus_tag LOCUS_01190 132782 133078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 133059 134414 gene locus_tag LOCUS_01200 133059 134414 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_01200 134484 134831 gene locus_tag LOCUS_01210 134484 134831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 134809 135225 gene locus_tag LOCUS_01220 134809 135225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 135222 135971 gene locus_tag LOCUS_01230 135222 135971 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031270.1 protein_id gnl|my_center|LOCUS_01230 136097 136801 gene locus_tag LOCUS_01240 gene terS 136097 136801 CDS product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861025.1 protein_id gnl|my_center|LOCUS_01240 136767 138134 gene locus_tag LOCUS_01250 136767 138134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 138131 139582 gene locus_tag LOCUS_01260 138131 139582 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989955.1 protein_id gnl|my_center|LOCUS_01260 139587 141485 gene locus_tag LOCUS_01270 139587 141485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 141487 141723 gene locus_tag LOCUS_01280 141487 141723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 141728 142024 gene locus_tag LOCUS_01290 141728 142024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 142119 142736 gene locus_tag LOCUS_01300 142119 142736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 142763 144016 gene locus_tag LOCUS_01310 142763 144016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 144033 144449 gene locus_tag LOCUS_01320 144033 144449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 144415 144855 gene locus_tag LOCUS_01330 144415 144855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 144857 145234 gene locus_tag LOCUS_01340 144857 145234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 145247 145672 gene locus_tag LOCUS_01350 145247 145672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 145677 146243 gene locus_tag LOCUS_01360 145677 146243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 146370 146780 gene locus_tag LOCUS_01370 146370 146780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 146828 147424 gene locus_tag LOCUS_01380 146828 147424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 147396 150200 gene locus_tag LOCUS_01390 147396 150200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 150197 151114 gene locus_tag LOCUS_01400 150197 151114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 151118 152227 gene locus_tag LOCUS_01410 151118 152227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 152231 153208 gene locus_tag LOCUS_01420 152231 153208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 153225 154196 gene locus_tag LOCUS_01430 153225 154196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 154248 154802 gene locus_tag LOCUS_01440 154248 154802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 154792 155046 gene locus_tag LOCUS_01450 154792 155046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 155039 156340 gene locus_tag LOCUS_01460 155039 156340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 156379 156528 gene locus_tag LOCUS_01470 156379 156528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 156532 156969 gene locus_tag LOCUS_01480 156532 156969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 156991 157425 gene locus_tag LOCUS_01490 156991 157425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 157429 158841 gene locus_tag LOCUS_01500 157429 158841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 159202 159534 gene locus_tag LOCUS_01510 159202 159534 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_01510 159655 159891 gene locus_tag LOCUS_01520 159655 159891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 160022 161953 gene locus_tag LOCUS_01530 160022 161953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 161970 163046 gene locus_tag LOCUS_01540 gene hydE 161970 163046 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_01540 163053 164480 gene locus_tag LOCUS_01550 gene hydG 163053 164480 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_01550 164525 165727 gene locus_tag LOCUS_01560 gene hydF 164525 165727 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_01560 165746 166306 gene locus_tag LOCUS_01570 165746 166306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 166308 166985 gene locus_tag LOCUS_01580 166308 166985 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_01580 167011 168477 gene locus_tag LOCUS_01590 167011 168477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 168562 169326 gene locus_tag LOCUS_01600 168562 169326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 >Feature sequence02 2105 243 gene locus_tag LOCUS_01610 2105 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3891 2098 gene locus_tag LOCUS_01620 3891 2098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_01620 4813 3893 gene locus_tag LOCUS_01630 4813 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 6051 4810 gene locus_tag LOCUS_01640 6051 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 6977 6048 gene locus_tag LOCUS_01650 6977 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 8164 7025 gene locus_tag LOCUS_01660 8164 7025 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_01660 9243 8161 gene locus_tag LOCUS_01670 9243 8161 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_01670 10376 9258 gene locus_tag LOCUS_01680 10376 9258 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202690.1 protein_id gnl|my_center|LOCUS_01680 11401 10373 gene locus_tag LOCUS_01690 11401 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12630 11428 gene locus_tag LOCUS_01700 12630 11428 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876001.1 protein_id gnl|my_center|LOCUS_01700 14494 12620 gene locus_tag LOCUS_01710 gene asnB 14494 12620 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_01710 15636 14497 gene locus_tag LOCUS_01720 15636 14497 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_01720 16586 15645 gene locus_tag LOCUS_01730 16586 15645 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021208.1 protein_id gnl|my_center|LOCUS_01730 19289 16677 gene locus_tag LOCUS_01740 19289 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 20436 19366 gene locus_tag LOCUS_01750 20436 19366 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_01750 21553 20453 gene locus_tag LOCUS_01760 21553 20453 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461012.1 protein_id gnl|my_center|LOCUS_01760 21997 21563 gene locus_tag LOCUS_01770 21997 21563 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_01770 23151 21994 gene locus_tag LOCUS_01780 23151 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 24233 23166 gene locus_tag LOCUS_01790 24233 23166 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925971.1 protein_id gnl|my_center|LOCUS_01790 24580 24461 gene locus_tag LOCUS_01800 24580 24461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 25834 24776 gene locus_tag LOCUS_01810 25834 24776 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_01810 27128 25827 gene locus_tag LOCUS_01820 27128 25827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 28638 27145 gene locus_tag LOCUS_01830 28638 27145 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_01830 30655 28628 gene locus_tag LOCUS_01840 30655 28628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 32129 30756 gene locus_tag LOCUS_01850 gene algD 32129 30756 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110461.1 protein_id gnl|my_center|LOCUS_01850 33322 32126 gene locus_tag LOCUS_01860 33322 32126 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_01860 34744 33326 gene locus_tag LOCUS_01870 34744 33326 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_01870 35002 36570 gene locus_tag LOCUS_01880 35002 36570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 36594 37583 gene locus_tag LOCUS_01890 36594 37583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 38472 37588 gene locus_tag LOCUS_01900 38472 37588 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090259.1 protein_id gnl|my_center|LOCUS_01900 39822 38476 gene locus_tag LOCUS_01910 39822 38476 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939555.1 protein_id gnl|my_center|LOCUS_01910 41361 39823 gene locus_tag LOCUS_01920 41361 39823 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_01920 42893 41358 gene locus_tag LOCUS_01930 42893 41358 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_01930 43123 42893 gene locus_tag LOCUS_01940 43123 42893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 44637 43123 gene locus_tag LOCUS_01950 44637 43123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 45607 44639 gene locus_tag LOCUS_01960 45607 44639 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_01960 46636 45641 gene locus_tag LOCUS_01970 46636 45641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 48650 46614 gene locus_tag LOCUS_01980 48650 46614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 49593 48679 gene locus_tag LOCUS_01990 49593 48679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 50015 49593 gene locus_tag LOCUS_02000 50015 49593 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_02000 51607 50012 gene locus_tag LOCUS_02010 51607 50012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 52563 51625 gene locus_tag LOCUS_02020 52563 51625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 53683 52565 gene locus_tag LOCUS_02030 53683 52565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 53919 53686 gene locus_tag LOCUS_02040 53919 53686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 55421 53919 gene locus_tag LOCUS_02050 55421 53919 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_02050 55684 56721 gene locus_tag LOCUS_02060 55684 56721 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_02060 56723 57859 gene locus_tag LOCUS_02070 gene neuC 56723 57859 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_02070 57886 58581 gene locus_tag LOCUS_02080 57886 58581 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_02080 59363 58626 gene locus_tag LOCUS_02090 59363 58626 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_02090 60141 59353 gene locus_tag LOCUS_02100 60141 59353 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460479.1 protein_id gnl|my_center|LOCUS_02100 61008 60166 gene locus_tag LOCUS_02110 61008 60166 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460480.1 protein_id gnl|my_center|LOCUS_02110 62524 61793 gene locus_tag LOCUS_02120 62524 61793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 63173 62514 gene locus_tag LOCUS_02130 63173 62514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 64319 63414 gene locus_tag LOCUS_02140 64319 63414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 64432 65085 gene locus_tag LOCUS_02150 64432 65085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 65461 65670 gene locus_tag LOCUS_02160 65461 65670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 65761 66447 gene locus_tag LOCUS_02170 65761 66447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 66786 67532 gene locus_tag LOCUS_02180 gene azlC 66786 67532 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_02180 67529 67855 gene locus_tag LOCUS_02190 gene azlD 67529 67855 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_02190 69437 67914 gene locus_tag LOCUS_02200 69437 67914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 71362 69611 gene locus_tag LOCUS_02210 71362 69611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_02210 72247 71372 gene locus_tag LOCUS_02220 72247 71372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 73013 72240 gene locus_tag LOCUS_02230 73013 72240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 74133 72994 gene locus_tag LOCUS_02240 74133 72994 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391454.1 protein_id gnl|my_center|LOCUS_02240 75242 74130 gene locus_tag LOCUS_02250 75242 74130 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931322.1 protein_id gnl|my_center|LOCUS_02250 76171 75239 gene locus_tag LOCUS_02260 76171 75239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 77232 76168 gene locus_tag LOCUS_02270 77232 76168 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_02270 78219 77236 gene locus_tag LOCUS_02280 78219 77236 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_02280 79681 78209 gene locus_tag LOCUS_02290 79681 78209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 80307 79678 gene locus_tag LOCUS_02300 80307 79678 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016159216.1 protein_id gnl|my_center|LOCUS_02300 81751 80435 gene locus_tag LOCUS_02310 81751 80435 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_02310 82872 81748 gene locus_tag LOCUS_02320 82872 81748 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 protein_id gnl|my_center|LOCUS_02320 83849 82869 gene locus_tag LOCUS_02330 83849 82869 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_02330 85133 83877 gene locus_tag LOCUS_02340 85133 83877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 85760 85143 gene locus_tag LOCUS_02350 85760 85143 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_02350 86930 85794 gene locus_tag LOCUS_02360 86930 85794 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_02360 88808 86949 gene locus_tag LOCUS_02370 88808 86949 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_02370 90724 88859 gene locus_tag LOCUS_02380 90724 88859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 91379 90717 gene locus_tag LOCUS_02390 91379 90717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 92812 91394 gene locus_tag LOCUS_02400 92812 91394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 93749 92802 gene locus_tag LOCUS_02410 93749 92802 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_02410 94284 93742 gene locus_tag LOCUS_02420 94284 93742 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668728.1 protein_id gnl|my_center|LOCUS_02420 96108 94312 gene locus_tag LOCUS_02430 96108 94312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 97235 96105 gene locus_tag LOCUS_02440 gene rffA 97235 96105 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612049.1 protein_id gnl|my_center|LOCUS_02440 99035 97254 gene locus_tag LOCUS_02450 99035 97254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 100072 98972 gene locus_tag LOCUS_02460 100072 98972 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263349.1 protein_id gnl|my_center|LOCUS_02460 101162 100077 gene locus_tag LOCUS_02470 gene pseG 101162 100077 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 protein_id gnl|my_center|LOCUS_02470 101873 101187 gene locus_tag LOCUS_02480 101873 101187 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061513.1 protein_id gnl|my_center|LOCUS_02480 103075 101870 gene locus_tag LOCUS_02490 103075 101870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 104151 103072 gene locus_tag LOCUS_02500 gene pseI 104151 103072 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_02500 104865 104161 gene locus_tag LOCUS_02510 gene pseF 104865 104161 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_02510 106120 104927 gene locus_tag LOCUS_02520 gene pseC 106120 104927 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_02520 107266 106262 gene locus_tag LOCUS_02530 gene pseB 107266 106262 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 protein_id gnl|my_center|LOCUS_02530 109503 107347 gene locus_tag LOCUS_02540 109503 107347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 110552 109500 gene locus_tag LOCUS_02550 110552 109500 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_02550 112315 110582 gene locus_tag LOCUS_02560 112315 110582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_02560 113382 112315 gene locus_tag LOCUS_02570 113382 112315 CDS product glycosyltransferase family 52 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922741.1 protein_id gnl|my_center|LOCUS_02570 114569 113379 gene locus_tag LOCUS_02580 114569 113379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 115827 114547 gene locus_tag LOCUS_02590 115827 114547 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203010.1 protein_id gnl|my_center|LOCUS_02590 116639 115824 gene locus_tag LOCUS_02600 116639 115824 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125497.1 protein_id gnl|my_center|LOCUS_02600 117743 116643 gene locus_tag LOCUS_02610 117743 116643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 118528 117740 gene locus_tag LOCUS_02620 118528 117740 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_02620 119502 118525 gene locus_tag LOCUS_02630 119502 118525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 120884 119523 gene locus_tag LOCUS_02640 120884 119523 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575762.1 protein_id gnl|my_center|LOCUS_02640 121659 120898 gene locus_tag LOCUS_02650 121659 120898 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 protein_id gnl|my_center|LOCUS_02650 122604 121672 gene locus_tag LOCUS_02660 122604 121672 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_02660 124305 122671 gene locus_tag LOCUS_02670 124305 122671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 125414 124332 gene locus_tag LOCUS_02680 125414 124332 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_02680 126367 125420 gene locus_tag LOCUS_02690 126367 125420 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_02690 127488 126418 gene locus_tag LOCUS_02700 gene gmd 127488 126418 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965479.1 protein_id gnl|my_center|LOCUS_02700 127738 128196 gene locus_tag LOCUS_02710 127738 128196 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_02710 128230 130515 gene locus_tag LOCUS_02720 128230 130515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 131767 130694 gene locus_tag LOCUS_02730 131767 130694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 132239 131757 gene locus_tag LOCUS_02740 132239 131757 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_02740 133913 132603 gene locus_tag LOCUS_02750 133913 132603 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_02750 134111 134833 gene locus_tag LOCUS_02760 134111 134833 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_02760 134846 135778 gene locus_tag LOCUS_02770 134846 135778 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_02770 136736 135882 gene locus_tag LOCUS_02780 gene rfbD 136736 135882 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_02780 138421 136733 gene locus_tag LOCUS_02790 gene leuA 138421 136733 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_02790 138658 138443 gene locus_tag LOCUS_02800 138658 138443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 138911 138648 gene locus_tag LOCUS_02810 138911 138648 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949584.1 protein_id gnl|my_center|LOCUS_02810 140421 139072 gene locus_tag LOCUS_02820 gene glmM 140421 139072 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_02820 141736 140435 gene locus_tag LOCUS_02830 141736 140435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 142595 141714 gene locus_tag LOCUS_02840 gene cdaA 142595 141714 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_02840 143596 142592 gene locus_tag LOCUS_02850 143596 142592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 144020 143622 gene locus_tag LOCUS_02860 144020 143622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 144541 144077 gene locus_tag LOCUS_02870 144541 144077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 145127 144504 gene locus_tag LOCUS_02880 145127 144504 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_02880 147454 145217 gene locus_tag LOCUS_02890 147454 145217 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_02890 147865 147515 gene locus_tag LOCUS_02900 147865 147515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 148759 147941 gene locus_tag LOCUS_02910 gene flgG 148759 147941 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937819.1 protein_id gnl|my_center|LOCUS_02910 149586 148810 gene locus_tag LOCUS_02920 gene flgF 149586 148810 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392318.1 protein_id gnl|my_center|LOCUS_02920 150605 149610 gene locus_tag LOCUS_02930 150605 149610 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356149.1 protein_id gnl|my_center|LOCUS_02930 153687 150835 gene locus_tag LOCUS_02940 gene uvrA 153687 150835 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_02940 155689 153680 gene locus_tag LOCUS_02950 gene uvrB 155689 153680 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_02950 >Feature sequence03 135 1133 gene locus_tag LOCUS_02960 135 1133 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_02960 1194 2399 gene locus_tag LOCUS_02970 1194 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_02970 2445 2891 gene locus_tag LOCUS_02980 gene rpiB 2445 2891 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389089.1 protein_id gnl|my_center|LOCUS_02980 4186 2999 gene locus_tag LOCUS_02990 4186 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5105 4329 gene locus_tag LOCUS_03000 5105 4329 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393133.1 protein_id gnl|my_center|LOCUS_03000 6896 5121 gene locus_tag LOCUS_03010 gene dhaK 6896 5121 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720758.1 protein_id gnl|my_center|LOCUS_03010 8059 6992 gene locus_tag LOCUS_03020 8059 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 9092 8121 gene locus_tag LOCUS_03030 gene rbsC 9092 8121 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_03030 10613 9099 gene locus_tag LOCUS_03040 10613 9099 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 protein_id gnl|my_center|LOCUS_03040 12135 10600 gene locus_tag LOCUS_03050 gene xylB 12135 10600 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_03050 13470 12154 gene locus_tag LOCUS_03060 gene pfkC 13470 12154 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249331.1 protein_id gnl|my_center|LOCUS_03060 14335 13505 gene locus_tag LOCUS_03070 14335 13505 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584123.1 protein_id gnl|my_center|LOCUS_03070 15932 14724 gene locus_tag LOCUS_03080 15932 14724 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812341.1 protein_id gnl|my_center|LOCUS_03080 16311 16045 gene locus_tag LOCUS_03090 16311 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 17081 16530 gene locus_tag LOCUS_03100 17081 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 18911 17082 gene locus_tag LOCUS_03110 gene glgX 18911 17082 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_03110 19312 19635 gene locus_tag LOCUS_03120 19312 19635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 21485 19674 gene locus_tag LOCUS_03130 21485 19674 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949010.1 protein_id gnl|my_center|LOCUS_03130 22926 21475 gene locus_tag LOCUS_03140 gene gltX 22926 21475 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_03140 24422 22923 gene locus_tag LOCUS_03150 24422 22923 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_03150 26555 24546 gene locus_tag LOCUS_03160 gene feoB 26555 24546 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 protein_id gnl|my_center|LOCUS_03160 26800 26552 gene locus_tag LOCUS_03170 26800 26552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 28437 26947 gene locus_tag LOCUS_03180 gene spoVAF 28437 26947 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_03180 29035 28523 gene locus_tag LOCUS_03190 29035 28523 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939955.1 protein_id gnl|my_center|LOCUS_03190 29561 29052 gene locus_tag LOCUS_03200 gene nrdG 29561 29052 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_03200 31828 29642 gene locus_tag LOCUS_03210 gene nrdD 31828 29642 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_03210 32143 31868 gene locus_tag LOCUS_03220 32143 31868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 32613 32140 gene locus_tag LOCUS_03230 gene rnhA 32613 32140 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368126.1 protein_id gnl|my_center|LOCUS_03230 34421 32610 gene locus_tag LOCUS_03240 34421 32610 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 protein_id gnl|my_center|LOCUS_03240 35134 34418 gene locus_tag LOCUS_03250 35134 34418 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_03250 36298 35267 gene locus_tag LOCUS_03260 gene queA 36298 35267 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_03260 37746 36295 gene locus_tag LOCUS_03270 37746 36295 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_03270 40203 37780 gene locus_tag LOCUS_03280 gene pheT 40203 37780 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_03280 41255 40236 gene locus_tag LOCUS_03290 gene pheS 41255 40236 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_03290 44737 41678 gene locus_tag LOCUS_03300 44737 41678 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_03300 46617 44749 gene locus_tag LOCUS_03310 46617 44749 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_03310 47222 46638 gene locus_tag LOCUS_03320 47222 46638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 48526 47342 gene locus_tag LOCUS_03330 48526 47342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 49073 48564 gene locus_tag LOCUS_03340 49073 48564 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864729.1 protein_id gnl|my_center|LOCUS_03340 50180 49314 gene locus_tag LOCUS_03350 50180 49314 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_03350 52283 50196 gene locus_tag LOCUS_03360 52283 50196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 53060 52704 gene locus_tag LOCUS_03370 53060 52704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 54858 53152 gene locus_tag LOCUS_03380 54858 53152 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 protein_id gnl|my_center|LOCUS_03380 56835 55021 gene locus_tag LOCUS_03390 56835 55021 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_03390 57531 56866 gene locus_tag LOCUS_03400 gene deoC 57531 56866 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_03400 57890 59257 gene locus_tag LOCUS_03410 57890 59257 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_03410 59759 59418 gene locus_tag LOCUS_03420 59759 59418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 61374 59875 gene locus_tag LOCUS_03430 gene thrC 61374 59875 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_03430 62085 61507 gene locus_tag LOCUS_03440 62085 61507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 62296 63132 gene locus_tag LOCUS_03450 62296 63132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 63715 63113 gene locus_tag LOCUS_03460 gene hisB 63715 63113 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_03460 64906 63791 gene locus_tag LOCUS_03470 64906 63791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 65098 66039 gene locus_tag LOCUS_03480 65098 66039 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_03480 66856 65978 gene locus_tag LOCUS_03490 66856 65978 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_03490 67013 67366 gene locus_tag LOCUS_03500 67013 67366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 68234 67368 gene locus_tag LOCUS_03510 68234 67368 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_03510 69533 68310 gene locus_tag LOCUS_03520 gene ilvA 69533 68310 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_03520 70473 69526 gene locus_tag LOCUS_03530 gene ftsY 70473 69526 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_03530 74122 70556 gene locus_tag LOCUS_03540 gene smc 74122 70556 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861158.1 protein_id gnl|my_center|LOCUS_03540 74835 74131 gene locus_tag LOCUS_03550 gene rncS 74835 74131 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_03550 75082 74822 gene locus_tag LOCUS_03560 gene acpP 75082 74822 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_03560 76115 75099 gene locus_tag LOCUS_03570 gene plsX 76115 75099 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_03570 76506 76327 gene locus_tag LOCUS_03580 gene rpmF 76506 76327 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183295.1 protein_id gnl|my_center|LOCUS_03580 77027 76509 gene locus_tag LOCUS_03590 77027 76509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 77741 77223 gene locus_tag LOCUS_03600 77741 77223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 79044 77848 gene locus_tag LOCUS_03610 gene ackA 79044 77848 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_03610 80067 79066 gene locus_tag LOCUS_03620 gene pta 80067 79066 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_03620 80323 81669 gene locus_tag LOCUS_03630 80323 81669 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_03630 83148 81700 gene locus_tag LOCUS_03640 83148 81700 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_03640 83515 83159 gene locus_tag LOCUS_03650 83515 83159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 85425 83524 gene locus_tag LOCUS_03660 85425 83524 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_03660 86910 85546 gene locus_tag LOCUS_03670 86910 85546 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_03670 87194 86922 gene locus_tag LOCUS_03680 87194 86922 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_03680 88015 87218 gene locus_tag LOCUS_03690 88015 87218 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_03690 90170 88017 gene locus_tag LOCUS_03700 90170 88017 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949018.1 protein_id gnl|my_center|LOCUS_03700 90763 90158 gene locus_tag LOCUS_03710 gene coaE 90763 90158 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_03710 93423 90787 gene locus_tag LOCUS_03720 gene polA 93423 90787 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_03720 93743 93420 gene locus_tag LOCUS_03730 93743 93420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 95482 94034 gene locus_tag LOCUS_03740 gene nagE 95482 94034 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418270.1 protein_id gnl|my_center|LOCUS_03740 95809 95546 gene locus_tag LOCUS_03750 95809 95546 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_03750 97487 95868 gene locus_tag LOCUS_03760 gene ptsP 97487 95868 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_03760 97987 97502 gene locus_tag LOCUS_03770 97987 97502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 98855 98019 gene locus_tag LOCUS_03780 gene licT 98855 98019 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_03780 99269 100750 gene locus_tag LOCUS_03790 99269 100750 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_03790 101543 100743 gene locus_tag LOCUS_03800 gene pdaA 101543 100743 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_03800 102040 101627 gene locus_tag LOCUS_03810 102040 101627 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458892.1 protein_id gnl|my_center|LOCUS_03810 102926 102069 gene locus_tag LOCUS_03820 102926 102069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 103749 103132 gene locus_tag LOCUS_03830 103749 103132 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706697.1 protein_id gnl|my_center|LOCUS_03830 104453 103725 gene locus_tag LOCUS_03840 104453 103725 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226867.1 protein_id gnl|my_center|LOCUS_03840 104900 104523 gene locus_tag LOCUS_03850 104900 104523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 105226 104915 gene locus_tag LOCUS_03860 105226 104915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 106068 105277 gene locus_tag LOCUS_03870 106068 105277 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_03870 106665 106072 gene locus_tag LOCUS_03880 gene rsxA 106665 106072 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_03880 107398 106667 gene locus_tag LOCUS_03890 107398 106667 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_03890 108002 107388 gene locus_tag LOCUS_03900 108002 107388 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_03900 108931 107999 gene locus_tag LOCUS_03910 108931 107999 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_03910 110259 108943 gene locus_tag LOCUS_03920 gene rsxC 110259 108943 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_03920 110426 111523 gene locus_tag LOCUS_03930 110426 111523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 112380 111604 gene locus_tag LOCUS_03940 gene cheR 112380 111604 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582875.1 protein_id gnl|my_center|LOCUS_03940 113548 112403 gene locus_tag LOCUS_03950 gene rpsA 113548 112403 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_03950 114374 113529 gene locus_tag LOCUS_03960 114374 113529 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_03960 115048 114389 gene locus_tag LOCUS_03970 gene cmk 115048 114389 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 protein_id gnl|my_center|LOCUS_03970 116315 115062 gene locus_tag LOCUS_03980 116315 115062 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_03980 117233 116337 gene locus_tag LOCUS_03990 117233 116337 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_03990 117793 117236 gene locus_tag LOCUS_04000 117793 117236 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564519.1 protein_id gnl|my_center|LOCUS_04000 119234 117924 gene locus_tag LOCUS_04010 119234 117924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 120753 119323 gene locus_tag LOCUS_04020 120753 119323 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_04020 121941 120790 gene locus_tag LOCUS_04030 121941 120790 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_04030 122352 121981 gene locus_tag LOCUS_04040 122352 121981 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_04040 123118 122372 gene locus_tag LOCUS_04050 123118 122372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 124570 123140 gene locus_tag LOCUS_04060 124570 123140 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_04060 126218 124818 gene locus_tag LOCUS_04070 126218 124818 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965357.1 protein_id gnl|my_center|LOCUS_04070 127004 126321 gene locus_tag LOCUS_04080 127004 126321 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209520.1 protein_id gnl|my_center|LOCUS_04080 127658 127089 gene locus_tag LOCUS_04090 gene scpB 127658 127089 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_04090 128505 127756 gene locus_tag LOCUS_04100 128505 127756 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_04100 129373 128489 gene locus_tag LOCUS_04110 129373 128489 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_04110 130739 129444 gene locus_tag LOCUS_04120 gene dacF 130739 129444 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_04120 132611 130899 gene locus_tag LOCUS_04130 132611 130899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 133245 132652 gene locus_tag LOCUS_04140 133245 132652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 133500 133324 gene locus_tag LOCUS_04150 gene rpsU 133500 133324 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_04150 136311 133672 gene locus_tag LOCUS_04160 gene alaS 136311 133672 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_04160 137786 136386 gene locus_tag LOCUS_04170 137786 136386 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_04170 138491 137823 gene locus_tag LOCUS_04180 138491 137823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 139193 138546 gene locus_tag LOCUS_04190 139193 138546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 139329 139156 gene locus_tag LOCUS_04200 139329 139156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 140330 139428 gene locus_tag LOCUS_04210 gene era 140330 139428 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_04210 141480 140323 gene locus_tag LOCUS_04220 141480 140323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 144412 141470 gene locus_tag LOCUS_04230 144412 141470 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_04230 144660 145568 gene locus_tag LOCUS_04240 144660 145568 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_04240 145659 146027 gene locus_tag LOCUS_04250 145659 146027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence04 1016 81 gene locus_tag LOCUS_04260 gene tsf 1016 81 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_04260 1821 1093 gene locus_tag LOCUS_04270 gene rpsB 1821 1093 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_04270 2597 1983 gene locus_tag LOCUS_04280 2597 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3446 2604 gene locus_tag LOCUS_04290 3446 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3763 3449 gene locus_tag LOCUS_04300 3763 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 5388 3799 gene locus_tag LOCUS_04310 5388 3799 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973629.1 protein_id gnl|my_center|LOCUS_04310 6241 5420 gene locus_tag LOCUS_04320 gene whiG 6241 5420 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_04320 6579 6292 gene locus_tag LOCUS_04330 6579 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 7077 6592 gene locus_tag LOCUS_04340 7077 6592 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_04340 7723 7106 gene locus_tag LOCUS_04350 7723 7106 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_04350 8253 7750 gene locus_tag LOCUS_04360 8253 7750 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839906.1 protein_id gnl|my_center|LOCUS_04360 10461 8281 gene locus_tag LOCUS_04370 10461 8281 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965518.1 protein_id gnl|my_center|LOCUS_04370 11536 10463 gene locus_tag LOCUS_04380 11536 10463 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868672.1 protein_id gnl|my_center|LOCUS_04380 12282 11563 gene locus_tag LOCUS_04390 12282 11563 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965443.1 protein_id gnl|my_center|LOCUS_04390 13173 12289 gene locus_tag LOCUS_04400 13173 12289 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460747.1 protein_id gnl|my_center|LOCUS_04400 14414 13185 gene locus_tag LOCUS_04410 gene flhF 14414 13185 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_04410 16447 14414 gene locus_tag LOCUS_04420 gene flhA 16447 14414 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_04420 17582 16470 gene locus_tag LOCUS_04430 gene flhB 17582 16470 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_04430 18361 17579 gene locus_tag LOCUS_04440 gene fliR 18361 17579 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983977.1 protein_id gnl|my_center|LOCUS_04440 18635 18366 gene locus_tag LOCUS_04450 gene fliQ 18635 18366 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392308.1 protein_id gnl|my_center|LOCUS_04450 19543 18656 gene locus_tag LOCUS_04460 19543 18656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 19915 19553 gene locus_tag LOCUS_04470 19915 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 20277 19915 gene locus_tag LOCUS_04480 20277 19915 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816218.1 protein_id gnl|my_center|LOCUS_04480 21606 20296 gene locus_tag LOCUS_04490 21606 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 22590 21610 gene locus_tag LOCUS_04500 gene fliM 22590 21610 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870065.1 protein_id gnl|my_center|LOCUS_04500 23160 22642 gene locus_tag LOCUS_04510 23160 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 24012 23182 gene locus_tag LOCUS_04520 24012 23182 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809827.1 protein_id gnl|my_center|LOCUS_04520 24778 23984 gene locus_tag LOCUS_04530 24778 23984 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_04530 24988 24803 gene locus_tag LOCUS_04540 24988 24803 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870069.1 protein_id gnl|my_center|LOCUS_04540 27233 25188 gene locus_tag LOCUS_04550 27233 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 27719 27318 gene locus_tag LOCUS_04560 27719 27318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 28514 27753 gene locus_tag LOCUS_04570 28514 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 29934 28528 gene locus_tag LOCUS_04580 29934 28528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 30904 30017 gene locus_tag LOCUS_04590 30904 30017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 31403 30930 gene locus_tag LOCUS_04600 31403 30930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 32721 31411 gene locus_tag LOCUS_04610 gene fliI 32721 31411 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082899.1 protein_id gnl|my_center|LOCUS_04610 33572 32724 gene locus_tag LOCUS_04620 33572 32724 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870077.1 protein_id gnl|my_center|LOCUS_04620 34572 33562 gene locus_tag LOCUS_04630 gene fliG 34572 33562 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_04630 36180 34579 gene locus_tag LOCUS_04640 36180 34579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 36529 36200 gene locus_tag LOCUS_04650 36529 36200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 37054 36611 gene locus_tag LOCUS_04660 gene flgC 37054 36611 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_04660 37463 37074 gene locus_tag LOCUS_04670 gene flgB 37463 37074 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_04670 38430 37627 gene locus_tag LOCUS_04680 gene codY 38430 37627 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965092.1 protein_id gnl|my_center|LOCUS_04680 40616 38523 gene locus_tag LOCUS_04690 gene topA 40616 38523 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_04690 41756 40686 gene locus_tag LOCUS_04700 41756 40686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 43294 41756 gene locus_tag LOCUS_04710 43294 41756 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_04710 44624 43572 gene locus_tag LOCUS_04720 44624 43572 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_04720 45463 44672 gene locus_tag LOCUS_04730 45463 44672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 46552 45482 gene locus_tag LOCUS_04740 46552 45482 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_04740 46680 46549 gene locus_tag LOCUS_04750 46680 46549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 47233 46766 gene locus_tag LOCUS_04760 47233 46766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04760 47480 47256 gene locus_tag LOCUS_04770 47480 47256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 48798 48109 gene locus_tag LOCUS_04780 gene sigK 48798 48109 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_04780 50051 48894 gene locus_tag LOCUS_04790 gene hemW 50051 48894 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_04790 51867 50053 gene locus_tag LOCUS_04800 gene lepA 51867 50053 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_04800 53277 52012 gene locus_tag LOCUS_04810 53277 52012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 54342 53434 gene locus_tag LOCUS_04820 gene gpr 54342 53434 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_04820 54609 54872 gene locus_tag LOCUS_04830 gene rpsT 54609 54872 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_04830 56040 54955 gene locus_tag LOCUS_04840 56040 54955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 56821 56102 gene locus_tag LOCUS_04850 gene deoD 56821 56102 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_04850 57783 56881 gene locus_tag LOCUS_04860 57783 56881 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_04860 58599 58021 gene locus_tag LOCUS_04870 58599 58021 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_04870 59591 58596 gene locus_tag LOCUS_04880 gene bioB 59591 58596 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_04880 60337 59783 gene locus_tag LOCUS_04890 60337 59783 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_04890 60930 60334 gene locus_tag LOCUS_04900 60930 60334 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_04900 61062 61925 gene locus_tag LOCUS_04910 61062 61925 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_04910 63272 61920 gene locus_tag LOCUS_04920 63272 61920 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_04920 63599 64219 gene locus_tag LOCUS_04930 63599 64219 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_04930 64578 64994 gene locus_tag LOCUS_04940 64578 64994 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438466.1 protein_id gnl|my_center|LOCUS_04940 65789 65007 gene locus_tag LOCUS_04950 65789 65007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 66737 65817 gene locus_tag LOCUS_04960 66737 65817 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693969.1 protein_id gnl|my_center|LOCUS_04960 67843 66737 gene locus_tag LOCUS_04970 67843 66737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 68297 67926 gene locus_tag LOCUS_04980 68297 67926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 69455 68523 gene locus_tag LOCUS_04990 gene pyrF 69455 68523 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_04990 70299 69604 gene locus_tag LOCUS_05000 70299 69604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 71518 70472 gene locus_tag LOCUS_05010 71518 70472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 72205 71579 gene locus_tag LOCUS_05020 72205 71579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 72875 72207 gene locus_tag LOCUS_05030 gene deoC 72875 72207 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_05030 74085 72895 gene locus_tag LOCUS_05040 gene deoB 74085 72895 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_05040 76003 74345 gene locus_tag LOCUS_05050 76003 74345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 76317 76051 gene locus_tag LOCUS_05060 76317 76051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 76834 76457 gene locus_tag LOCUS_05070 76834 76457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 78025 76853 gene locus_tag LOCUS_05080 78025 76853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 78394 78038 gene locus_tag LOCUS_05090 78394 78038 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_05090 78892 78458 gene locus_tag LOCUS_05100 78892 78458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 79501 78911 gene locus_tag LOCUS_05110 79501 78911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 79953 79519 gene locus_tag LOCUS_05120 79953 79519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 81233 80151 gene locus_tag LOCUS_05130 gene prfA 81233 80151 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_05130 82158 81319 gene locus_tag LOCUS_05140 gene prmC 82158 81319 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640077.1 protein_id gnl|my_center|LOCUS_05140 83401 82148 gene locus_tag LOCUS_05150 83401 82148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 83674 83468 gene locus_tag LOCUS_05160 gene rpmE 83674 83468 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_05160 85267 83789 gene locus_tag LOCUS_05170 gene rho 85267 83789 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_05170 85508 86665 gene locus_tag LOCUS_05180 85508 86665 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_05180 86677 87636 gene locus_tag LOCUS_05190 86677 87636 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461526.1 protein_id gnl|my_center|LOCUS_05190 87749 88264 gene locus_tag LOCUS_05200 87749 88264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 89753 88314 gene locus_tag LOCUS_05210 89753 88314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 91229 89919 gene locus_tag LOCUS_05220 91229 89919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 92759 91245 gene locus_tag LOCUS_05230 92759 91245 CDS product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202628.1 protein_id gnl|my_center|LOCUS_05230 94083 92734 gene locus_tag LOCUS_05240 94083 92734 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058547.1 protein_id gnl|my_center|LOCUS_05240 94967 94131 gene locus_tag LOCUS_05250 94967 94131 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_05250 96298 95252 gene locus_tag LOCUS_05260 96298 95252 CDS product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 protein_id gnl|my_center|LOCUS_05260 97188 96313 gene locus_tag LOCUS_05270 97188 96313 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_05270 99366 97201 gene locus_tag LOCUS_05280 99366 97201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 100849 99485 gene locus_tag LOCUS_05290 100849 99485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 102829 101036 gene locus_tag LOCUS_05300 gene thrS 102829 101036 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_05300 104186 103182 gene locus_tag LOCUS_05310 104186 103182 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974994.1 protein_id gnl|my_center|LOCUS_05310 106192 104183 gene locus_tag LOCUS_05320 106192 104183 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060992245.1 protein_id gnl|my_center|LOCUS_05320 107091 106360 gene locus_tag LOCUS_05330 107091 106360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 107348 107190 gene locus_tag LOCUS_05340 107348 107190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 107989 107411 gene locus_tag LOCUS_05350 107989 107411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 109460 108177 gene locus_tag LOCUS_05360 109460 108177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 110179 109457 gene locus_tag LOCUS_05370 gene rgbR 110179 109457 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_05370 111213 110305 gene locus_tag LOCUS_05380 111213 110305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 112547 111405 gene locus_tag LOCUS_05390 112547 111405 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_05390 113952 112552 gene locus_tag LOCUS_05400 113952 112552 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_05400 114848 114081 gene locus_tag LOCUS_05410 114848 114081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 115474 114845 gene locus_tag LOCUS_05420 gene udk 115474 114845 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 protein_id gnl|my_center|LOCUS_05420 116629 115604 gene locus_tag LOCUS_05430 116629 115604 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_05430 117654 116788 gene locus_tag LOCUS_05440 gene metF 117654 116788 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_05440 118574 117828 gene locus_tag LOCUS_05450 118574 117828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 119512 118571 gene locus_tag LOCUS_05460 119512 118571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_05460 120630 119515 gene locus_tag LOCUS_05470 120630 119515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_05470 122159 120627 gene locus_tag LOCUS_05480 122159 120627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_05480 123388 122198 gene locus_tag LOCUS_05490 123388 122198 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_05490 123884 123456 gene locus_tag LOCUS_05500 123884 123456 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_05500 124751 123978 gene locus_tag LOCUS_05510 gene udp 124751 123978 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_05510 126385 125066 gene locus_tag LOCUS_05520 126385 125066 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_05520 127646 126438 gene locus_tag LOCUS_05530 127646 126438 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_05530 128863 127649 gene locus_tag LOCUS_05540 128863 127649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 129312 128869 gene locus_tag LOCUS_05550 129312 128869 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_05550 130645 129497 gene locus_tag LOCUS_05560 gene fucO 130645 129497 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_05560 130848 130624 gene locus_tag LOCUS_05570 130848 130624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 131631 130894 gene locus_tag LOCUS_05580 131631 130894 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_05580 132283 131618 gene locus_tag LOCUS_05590 132283 131618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 133224 132376 gene locus_tag LOCUS_05600 133224 132376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 134564 133326 gene locus_tag LOCUS_05610 134564 133326 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861660.1 protein_id gnl|my_center|LOCUS_05610 135623 134712 gene locus_tag LOCUS_05620 135623 134712 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799698.1 protein_id gnl|my_center|LOCUS_05620 136807 135668 gene locus_tag LOCUS_05630 gene mutY 136807 135668 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132598.1 protein_id gnl|my_center|LOCUS_05630 137592 136840 gene locus_tag LOCUS_05640 gene sfsA 137592 136840 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_05640 138461 137613 gene locus_tag LOCUS_05650 138461 137613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 139853 138501 gene locus_tag LOCUS_05660 139853 138501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 140028 141413 gene locus_tag LOCUS_05670 140028 141413 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_05670 141628 141819 gene locus_tag LOCUS_05680 141628 141819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 142026 143072 gene locus_tag LOCUS_05690 142026 143072 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986736.1 protein_id gnl|my_center|LOCUS_05690 143630 143175 gene locus_tag LOCUS_05700 143630 143175 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906378.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence05 187 1452 gene locus_tag LOCUS_05710 gene leuC 187 1452 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_05710 1466 1960 gene locus_tag LOCUS_05720 gene leuD 1466 1960 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_05720 2086 2475 gene locus_tag LOCUS_05730 2086 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2472 3017 gene locus_tag LOCUS_05740 2472 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3014 3619 gene locus_tag LOCUS_05750 gene ruvA 3014 3619 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_05750 3635 4633 gene locus_tag LOCUS_05760 gene ruvB 3635 4633 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_05760 4703 5113 gene locus_tag LOCUS_05770 4703 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5110 7374 gene locus_tag LOCUS_05780 5110 7374 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_05780 7392 8777 gene locus_tag LOCUS_05790 7392 8777 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_05790 8692 10224 gene locus_tag LOCUS_05800 8692 10224 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_05800 10303 10755 gene locus_tag LOCUS_05810 10303 10755 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_05810 10770 11081 gene locus_tag LOCUS_05820 10770 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 11093 12100 gene locus_tag LOCUS_05830 11093 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 12087 12479 gene locus_tag LOCUS_05840 12087 12479 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_05840 12530 12679 gene locus_tag LOCUS_05850 12530 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 12747 13391 gene locus_tag LOCUS_05860 12747 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 13739 14101 gene locus_tag LOCUS_05870 13739 14101 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_05870 14094 15782 gene locus_tag LOCUS_05880 14094 15782 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_05880 16544 15810 gene locus_tag LOCUS_05890 16544 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 16706 17188 gene locus_tag LOCUS_05900 16706 17188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 19176 17257 gene locus_tag LOCUS_05910 19176 17257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 19330 20613 gene locus_tag LOCUS_05920 19330 20613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 20619 22325 gene locus_tag LOCUS_05930 20619 22325 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 protein_id gnl|my_center|LOCUS_05930 22374 23624 gene locus_tag LOCUS_05940 22374 23624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 23545 25575 gene locus_tag LOCUS_05950 gene recG 23545 25575 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_05950 25618 26478 gene locus_tag LOCUS_05960 25618 26478 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_05960 26531 27697 gene locus_tag LOCUS_05970 gene cbiD 26531 27697 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_05970 27708 28460 gene locus_tag LOCUS_05980 gene cobM 27708 28460 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_05980 28482 29591 gene locus_tag LOCUS_05990 gene cbiG 28482 29591 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 protein_id gnl|my_center|LOCUS_05990 29629 31221 gene locus_tag LOCUS_06000 29629 31221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 31218 32444 gene locus_tag LOCUS_06010 31218 32444 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214081.1 protein_id gnl|my_center|LOCUS_06010 32456 33829 gene locus_tag LOCUS_06020 32456 33829 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948610.1 protein_id gnl|my_center|LOCUS_06020 33851 34918 gene locus_tag LOCUS_06030 gene cobT 33851 34918 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_06030 34919 35488 gene locus_tag LOCUS_06040 gene cobU 34919 35488 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963579.1 protein_id gnl|my_center|LOCUS_06040 35476 36255 gene locus_tag LOCUS_06050 gene cobS 35476 36255 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_06050 36240 36665 gene locus_tag LOCUS_06060 36240 36665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 37236 36658 gene locus_tag LOCUS_06070 37236 36658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 37387 38529 gene locus_tag LOCUS_06080 37387 38529 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765153.1 protein_id gnl|my_center|LOCUS_06080 38531 41743 gene locus_tag LOCUS_06090 38531 41743 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247622.1 protein_id gnl|my_center|LOCUS_06090 41812 42402 gene locus_tag LOCUS_06100 gene cobC 41812 42402 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948519.1 protein_id gnl|my_center|LOCUS_06100 42422 43597 gene locus_tag LOCUS_06110 42422 43597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 43800 44435 gene locus_tag LOCUS_06120 43800 44435 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_06120 44458 45573 gene locus_tag LOCUS_06130 gene cobD 44458 45573 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_06130 45575 47095 gene locus_tag LOCUS_06140 45575 47095 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964683.1 protein_id gnl|my_center|LOCUS_06140 47175 49097 gene locus_tag LOCUS_06150 gene gyrB 47175 49097 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_06150 49110 51347 gene locus_tag LOCUS_06160 gene gyrA 49110 51347 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 protein_id gnl|my_center|LOCUS_06160 51362 51913 gene locus_tag LOCUS_06170 gene rsmD 51362 51913 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_06170 51910 52398 gene locus_tag LOCUS_06180 gene coaD 51910 52398 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_06180 52542 53138 gene locus_tag LOCUS_06190 52542 53138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 53153 54187 gene locus_tag LOCUS_06200 53153 54187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 54524 59992 gene locus_tag LOCUS_06210 54524 59992 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861690.1 protein_id gnl|my_center|LOCUS_06210 60031 61404 gene locus_tag LOCUS_06220 60031 61404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 61549 62139 gene locus_tag LOCUS_06230 61549 62139 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378484.1 protein_id gnl|my_center|LOCUS_06230 62108 62941 gene locus_tag LOCUS_06240 62108 62941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 63072 63890 gene locus_tag LOCUS_06250 63072 63890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 64922 63990 gene locus_tag LOCUS_06260 gene ylbJ 64922 63990 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965047.1 protein_id gnl|my_center|LOCUS_06260 64985 65707 gene locus_tag LOCUS_06270 64985 65707 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012560779.1 protein_id gnl|my_center|LOCUS_06270 65710 66387 gene locus_tag LOCUS_06280 65710 66387 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_06280 66384 68300 gene locus_tag LOCUS_06290 66384 68300 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_06290 68312 69076 gene locus_tag LOCUS_06300 68312 69076 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_06300 69108 69665 gene locus_tag LOCUS_06310 69108 69665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 69691 70710 gene locus_tag LOCUS_06320 69691 70710 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_06320 70737 71270 gene locus_tag LOCUS_06330 gene recU 70737 71270 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_06330 71358 73232 gene locus_tag LOCUS_06340 71358 73232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 73247 74551 gene locus_tag LOCUS_06350 gene hisD 73247 74551 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_06350 74564 75850 gene locus_tag LOCUS_06360 74564 75850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 75994 77745 gene locus_tag LOCUS_06370 75994 77745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 78280 77843 gene locus_tag LOCUS_06380 78280 77843 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288073.1 protein_id gnl|my_center|LOCUS_06380 78450 79574 gene locus_tag LOCUS_06390 78450 79574 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_06390 79673 80068 gene locus_tag LOCUS_06400 79673 80068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 80104 82017 gene locus_tag LOCUS_06410 80104 82017 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_06410 82014 82715 gene locus_tag LOCUS_06420 82014 82715 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392092.1 protein_id gnl|my_center|LOCUS_06420 82712 84052 gene locus_tag LOCUS_06430 82712 84052 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028844369.1 protein_id gnl|my_center|LOCUS_06430 84049 84600 gene locus_tag LOCUS_06440 84049 84600 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_06440 84721 85026 gene locus_tag LOCUS_06450 gene rplU 84721 85026 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_06450 85048 85374 gene locus_tag LOCUS_06460 85048 85374 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816543.1 protein_id gnl|my_center|LOCUS_06460 85379 85663 gene locus_tag LOCUS_06470 gene rpmA 85379 85663 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_06470 85790 87079 gene locus_tag LOCUS_06480 gene obgE 85790 87079 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_06480 87090 87386 gene locus_tag LOCUS_06490 gene yhbY 87090 87386 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_06490 87395 88027 gene locus_tag LOCUS_06500 gene nadD 87395 88027 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416411.1 protein_id gnl|my_center|LOCUS_06500 88032 88619 gene locus_tag LOCUS_06510 gene yqeK 88032 88619 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_06510 88616 88978 gene locus_tag LOCUS_06520 gene rsfS 88616 88978 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_06520 89619 88999 gene locus_tag LOCUS_06530 gene lexA 89619 88999 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_06530 89796 90158 gene locus_tag LOCUS_06540 89796 90158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 91253 90189 gene locus_tag LOCUS_06550 91253 90189 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_06550 91906 91643 gene locus_tag LOCUS_06560 91906 91643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 92051 93007 gene locus_tag LOCUS_06570 92051 93007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 93646 93122 gene locus_tag LOCUS_06580 93646 93122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 94161 93700 gene locus_tag LOCUS_06590 gene dtd 94161 93700 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965571.1 protein_id gnl|my_center|LOCUS_06590 95578 94175 gene locus_tag LOCUS_06600 95578 94175 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_06600 96777 95599 gene locus_tag LOCUS_06610 96777 95599 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_06610 97545 96832 gene locus_tag LOCUS_06620 97545 96832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 99122 97569 gene locus_tag LOCUS_06630 99122 97569 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236747.1 protein_id gnl|my_center|LOCUS_06630 100433 99213 gene locus_tag LOCUS_06640 100433 99213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 101059 100433 gene locus_tag LOCUS_06650 101059 100433 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_06650 102067 101189 gene locus_tag LOCUS_06660 gene sdaAA 102067 101189 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 protein_id gnl|my_center|LOCUS_06660 102745 102083 gene locus_tag LOCUS_06670 gene sdaAB 102745 102083 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671219.1 protein_id gnl|my_center|LOCUS_06670 104618 102903 gene locus_tag LOCUS_06680 104618 102903 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_06680 105151 104615 gene locus_tag LOCUS_06690 105151 104615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 106197 105280 gene locus_tag LOCUS_06700 106197 105280 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_06700 106752 106234 gene locus_tag LOCUS_06710 gene lspA 106752 106234 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_06710 107849 106749 gene locus_tag LOCUS_06720 gene aroB 107849 106749 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_06720 108415 107921 gene locus_tag LOCUS_06730 108415 107921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 109139 108429 gene locus_tag LOCUS_06740 109139 108429 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_06740 110553 109159 gene locus_tag LOCUS_06750 110553 109159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 111032 110613 gene locus_tag LOCUS_06760 111032 110613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_06760 111958 111098 gene locus_tag LOCUS_06770 111958 111098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 112472 112077 gene locus_tag LOCUS_06780 112472 112077 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_06780 113598 112483 gene locus_tag LOCUS_06790 gene rodA 113598 112483 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_06790 113891 113613 gene locus_tag LOCUS_06800 113891 113613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 114695 113904 gene locus_tag LOCUS_06810 gene minD 114695 113904 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_06810 115446 114775 gene locus_tag LOCUS_06820 gene minC 115446 114775 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816782.1 protein_id gnl|my_center|LOCUS_06820 118347 115474 gene locus_tag LOCUS_06830 118347 115474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 118858 118340 gene locus_tag LOCUS_06840 118858 118340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 119741 118872 gene locus_tag LOCUS_06850 gene mreC 119741 118872 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_06850 120755 119745 gene locus_tag LOCUS_06860 120755 119745 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_06860 121511 120774 gene locus_tag LOCUS_06870 gene radC 121511 120774 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_06870 122961 121630 gene locus_tag LOCUS_06880 122961 121630 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_06880 123914 122958 gene locus_tag LOCUS_06890 gene miaA 123914 122958 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_06890 125837 123933 gene locus_tag LOCUS_06900 gene mutL 125837 123933 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_06900 127052 125853 gene locus_tag LOCUS_06910 127052 125853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 128147 127362 gene locus_tag LOCUS_06920 128147 127362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 128526 128149 gene locus_tag LOCUS_06930 128526 128149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 128877 128569 gene locus_tag LOCUS_06940 128877 128569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 129233 128874 gene locus_tag LOCUS_06950 129233 128874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 129523 129371 gene locus_tag LOCUS_06960 129523 129371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 129803 129540 gene locus_tag LOCUS_06970 129803 129540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 130893 129763 gene locus_tag LOCUS_06980 130893 129763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence06 105 1460 gene locus_tag LOCUS_06990 105 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1751 2326 gene locus_tag LOCUS_07000 1751 2326 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088168.1 protein_id gnl|my_center|LOCUS_07000 2323 3039 gene locus_tag LOCUS_07010 2323 3039 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981011.1 protein_id gnl|my_center|LOCUS_07010 3051 4403 gene locus_tag LOCUS_07020 3051 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4444 5574 gene locus_tag LOCUS_07030 4444 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 5579 6934 gene locus_tag LOCUS_07040 5579 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 6962 8071 gene locus_tag LOCUS_07050 gene vioA 6962 8071 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998544.1 protein_id gnl|my_center|LOCUS_07050 8110 9300 gene locus_tag LOCUS_07060 8110 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 9297 10067 gene locus_tag LOCUS_07070 9297 10067 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_07070 10064 11368 gene locus_tag LOCUS_07080 10064 11368 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_07080 11358 12128 gene locus_tag LOCUS_07090 11358 12128 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_07090 12188 13270 gene locus_tag LOCUS_07100 12188 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 13295 14218 gene locus_tag LOCUS_07110 13295 14218 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_07110 14231 14968 gene locus_tag LOCUS_07120 14231 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 14986 15876 gene locus_tag LOCUS_07130 14986 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 15873 16730 gene locus_tag LOCUS_07140 15873 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 16769 17815 gene locus_tag LOCUS_07150 gene neuB 16769 17815 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066398080.1 protein_id gnl|my_center|LOCUS_07150 17866 18273 gene locus_tag LOCUS_07160 17866 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 18174 18725 gene locus_tag LOCUS_07170 18174 18725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 18728 19594 gene locus_tag LOCUS_07180 18728 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 19613 21031 gene locus_tag LOCUS_07190 19613 21031 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_07190 21050 22018 gene locus_tag LOCUS_07200 21050 22018 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289366.1 protein_id gnl|my_center|LOCUS_07200 22033 23334 gene locus_tag LOCUS_07210 22033 23334 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466255.1 protein_id gnl|my_center|LOCUS_07210 23347 24138 gene locus_tag LOCUS_07220 23347 24138 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964972.1 protein_id gnl|my_center|LOCUS_07220 24201 24962 gene locus_tag LOCUS_07230 24201 24962 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465710.1 protein_id gnl|my_center|LOCUS_07230 24959 25978 gene locus_tag LOCUS_07240 24959 25978 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465709.1 protein_id gnl|my_center|LOCUS_07240 26124 27605 gene locus_tag LOCUS_07250 26124 27605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 27613 28422 gene locus_tag LOCUS_07260 27613 28422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 28434 29405 gene locus_tag LOCUS_07270 28434 29405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 29418 29618 gene locus_tag LOCUS_07280 29418 29618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 29706 30623 gene locus_tag LOCUS_07290 29706 30623 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288204.1 protein_id gnl|my_center|LOCUS_07290 30628 31968 gene locus_tag LOCUS_07300 30628 31968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 32002 32478 gene locus_tag LOCUS_07310 32002 32478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 32598 33434 gene locus_tag LOCUS_07320 32598 33434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 33723 34736 gene locus_tag LOCUS_07330 33723 34736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 34729 36087 gene locus_tag LOCUS_07340 34729 36087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 36137 37510 gene locus_tag LOCUS_07350 36137 37510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 37515 38345 gene locus_tag LOCUS_07360 37515 38345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 38333 39664 gene locus_tag LOCUS_07370 38333 39664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 39771 41078 gene locus_tag LOCUS_07380 39771 41078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 41082 42068 gene locus_tag LOCUS_07390 41082 42068 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_07390 42145 43107 gene locus_tag LOCUS_07400 42145 43107 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_07400 43108 44424 gene locus_tag LOCUS_07410 43108 44424 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_07410 44517 45485 gene locus_tag LOCUS_07420 44517 45485 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 protein_id gnl|my_center|LOCUS_07420 45688 48270 gene locus_tag LOCUS_07430 gene clpB 45688 48270 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_07430 48901 48275 gene locus_tag LOCUS_07440 48901 48275 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860815.1 protein_id gnl|my_center|LOCUS_07440 49197 50801 gene locus_tag LOCUS_07450 49197 50801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 51435 50761 gene locus_tag LOCUS_07460 51435 50761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 51731 56278 gene locus_tag LOCUS_07470 gene gltB 51731 56278 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_07470 56292 57782 gene locus_tag LOCUS_07480 56292 57782 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_07480 58137 59285 gene locus_tag LOCUS_07490 58137 59285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 59289 60236 gene locus_tag LOCUS_07500 59289 60236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 60417 61268 gene locus_tag LOCUS_07510 60417 61268 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860817.1 protein_id gnl|my_center|LOCUS_07510 61261 62589 gene locus_tag LOCUS_07520 61261 62589 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_07520 62730 64004 gene locus_tag LOCUS_07530 62730 64004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 64205 65332 gene locus_tag LOCUS_07540 64205 65332 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813028.1 protein_id gnl|my_center|LOCUS_07540 66164 65499 gene locus_tag LOCUS_07550 gene thiT 66164 65499 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_07550 66472 66651 gene locus_tag LOCUS_07560 66472 66651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 66731 67267 gene locus_tag LOCUS_07570 66731 67267 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_07570 67264 68718 gene locus_tag LOCUS_07580 67264 68718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 68776 68991 gene locus_tag LOCUS_07590 68776 68991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 69004 69177 gene locus_tag LOCUS_07600 69004 69177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 69482 69925 gene locus_tag LOCUS_07610 69482 69925 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_07610 71336 69951 gene locus_tag LOCUS_07620 71336 69951 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_07620 71998 71333 gene locus_tag LOCUS_07630 71998 71333 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_07630 72214 73671 gene locus_tag LOCUS_07640 72214 73671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 75921 73684 gene locus_tag LOCUS_07650 75921 73684 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476111.1 protein_id gnl|my_center|LOCUS_07650 76115 77791 gene locus_tag LOCUS_07660 76115 77791 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_07660 77803 78357 gene locus_tag LOCUS_07670 77803 78357 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041381.1 protein_id gnl|my_center|LOCUS_07670 78560 79633 gene locus_tag LOCUS_07680 78560 79633 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_07680 79730 80803 gene locus_tag LOCUS_07690 79730 80803 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_07690 80819 81454 gene locus_tag LOCUS_07700 80819 81454 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361699.1 protein_id gnl|my_center|LOCUS_07700 81506 83443 gene locus_tag LOCUS_07710 81506 83443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 83647 83787 gene locus_tag LOCUS_07720 83647 83787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 84017 84142 gene locus_tag LOCUS_07730 84017 84142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 84237 84962 gene locus_tag LOCUS_07740 84237 84962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 85024 85698 gene locus_tag LOCUS_07750 85024 85698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 85724 86023 gene locus_tag LOCUS_07760 85724 86023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07760 86055 86297 gene locus_tag LOCUS_07770 86055 86297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 86439 86717 gene locus_tag LOCUS_07780 86439 86717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 86732 87409 gene locus_tag LOCUS_07790 86732 87409 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_07790 87427 87960 gene locus_tag LOCUS_07800 87427 87960 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_07800 87950 88294 gene locus_tag LOCUS_07810 87950 88294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681709.1 protein_id gnl|my_center|LOCUS_07810 88341 88619 gene locus_tag LOCUS_07820 88341 88619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 88848 89528 gene locus_tag LOCUS_07830 gene pyrE 88848 89528 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_07830 89546 89698 gene locus_tag LOCUS_07840 89546 89698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 89737 90060 gene locus_tag LOCUS_07850 89737 90060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 90057 92189 gene locus_tag LOCUS_07860 90057 92189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 92225 92725 gene locus_tag LOCUS_07870 gene purE 92225 92725 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_07870 92747 93772 gene locus_tag LOCUS_07880 gene purM 92747 93772 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_07880 93766 94392 gene locus_tag LOCUS_07890 gene purN 93766 94392 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_07890 94415 95692 gene locus_tag LOCUS_07900 gene purD 94415 95692 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_07900 95725 96174 gene locus_tag LOCUS_07910 95725 96174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 96193 97662 gene locus_tag LOCUS_07920 96193 97662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 97824 98201 gene locus_tag LOCUS_07930 97824 98201 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_07930 98198 100681 gene locus_tag LOCUS_07940 gene clpC 98198 100681 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_07940 100695 101105 gene locus_tag LOCUS_07950 100695 101105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 101140 102525 gene locus_tag LOCUS_07960 gene radA 101140 102525 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989380.1 protein_id gnl|my_center|LOCUS_07960 102558 102746 gene locus_tag LOCUS_07970 102558 102746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 103173 103622 gene locus_tag LOCUS_07980 103173 103622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 103628 104065 gene locus_tag LOCUS_07990 103628 104065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 104558 104740 gene locus_tag LOCUS_08000 104558 104740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 105671 106636 gene locus_tag LOCUS_08010 105671 106636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence07 965 144 gene locus_tag LOCUS_08020 965 144 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_08020 1699 1037 gene locus_tag LOCUS_08030 1699 1037 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_08030 2699 1689 gene locus_tag LOCUS_08040 2699 1689 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_08040 2936 3874 gene locus_tag LOCUS_08050 gene arcC 2936 3874 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367131.1 protein_id gnl|my_center|LOCUS_08050 3939 4136 gene locus_tag LOCUS_08060 3939 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4952 4287 gene locus_tag LOCUS_08070 4952 4287 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_08070 5404 4949 gene locus_tag LOCUS_08080 5404 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 6035 5661 gene locus_tag LOCUS_08090 6035 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 7608 6052 gene locus_tag LOCUS_08100 gene tndX 7608 6052 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_08100 7796 7644 gene locus_tag LOCUS_08110 7796 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 8989 8024 gene locus_tag LOCUS_08120 8989 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9765 8986 gene locus_tag LOCUS_08130 9765 8986 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_08130 10198 9785 gene locus_tag LOCUS_08140 10198 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 10810 10229 gene locus_tag LOCUS_08150 10810 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 11319 11143 gene locus_tag LOCUS_08160 11319 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 11484 11843 gene locus_tag LOCUS_08170 11484 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 12289 12107 gene locus_tag LOCUS_08180 12289 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 12546 12298 gene locus_tag LOCUS_08190 12546 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 13589 12705 gene locus_tag LOCUS_08200 13589 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 16138 14165 gene locus_tag LOCUS_08210 16138 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 17402 16038 gene locus_tag LOCUS_08220 17402 16038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 20527 17399 gene locus_tag LOCUS_08230 20527 17399 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331160.1 protein_id gnl|my_center|LOCUS_08230 20965 20546 gene locus_tag LOCUS_08240 20965 20546 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004843362.1 protein_id gnl|my_center|LOCUS_08240 21343 20981 gene locus_tag LOCUS_08250 21343 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 22369 21356 gene locus_tag LOCUS_08260 22369 21356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 23906 22344 gene locus_tag LOCUS_08270 23906 22344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 27334 23903 gene locus_tag LOCUS_08280 27334 23903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 28166 27315 gene locus_tag LOCUS_08290 gene xerA 28166 27315 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_08290 28641 28300 gene locus_tag LOCUS_08300 28641 28300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 29055 28669 gene locus_tag LOCUS_08310 29055 28669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 29636 29487 gene locus_tag LOCUS_08320 29636 29487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 30536 29655 gene locus_tag LOCUS_08330 30536 29655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 31996 30533 gene locus_tag LOCUS_08340 31996 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 32758 32054 gene locus_tag LOCUS_08350 32758 32054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 33718 32783 gene locus_tag LOCUS_08360 33718 32783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 34172 33684 gene locus_tag LOCUS_08370 34172 33684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 35272 34202 gene locus_tag LOCUS_08380 35272 34202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 36976 35312 gene locus_tag LOCUS_08390 36976 35312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 37437 37105 gene locus_tag LOCUS_08400 37437 37105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 38254 37466 gene locus_tag LOCUS_08410 38254 37466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 40727 38274 gene locus_tag LOCUS_08420 40727 38274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 41418 40744 gene locus_tag LOCUS_08430 41418 40744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 42622 41459 gene locus_tag LOCUS_08440 42622 41459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 44729 42615 gene locus_tag LOCUS_08450 44729 42615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 45339 44758 gene locus_tag LOCUS_08460 45339 44758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 45841 45332 gene locus_tag LOCUS_08470 45841 45332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 46329 45880 gene locus_tag LOCUS_08480 46329 45880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 46863 46453 gene locus_tag LOCUS_08490 46863 46453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 49171 46934 gene locus_tag LOCUS_08500 49171 46934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 50118 49516 gene locus_tag LOCUS_08510 50118 49516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 50534 50133 gene locus_tag LOCUS_08520 50534 50133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 51843 50566 gene locus_tag LOCUS_08530 51843 50566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 52565 51840 gene locus_tag LOCUS_08540 52565 51840 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_08540 53292 52708 gene locus_tag LOCUS_08550 53292 52708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 53469 53299 gene locus_tag LOCUS_08560 53469 53299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 54761 53541 gene locus_tag LOCUS_08570 54761 53541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 55634 54849 gene locus_tag LOCUS_08580 55634 54849 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399975.1 protein_id gnl|my_center|LOCUS_08580 55800 56159 gene locus_tag LOCUS_08590 55800 56159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 56845 56318 gene locus_tag LOCUS_08600 gene raiA 56845 56318 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_08600 58978 57578 gene locus_tag LOCUS_08610 58978 57578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 60107 59184 gene locus_tag LOCUS_08620 gene trxB 60107 59184 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243021.1 protein_id gnl|my_center|LOCUS_08620 60481 61209 gene locus_tag LOCUS_08630 60481 61209 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_08630 61412 61206 gene locus_tag LOCUS_08640 61412 61206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 61646 61500 gene locus_tag LOCUS_08650 61646 61500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 63460 62138 gene locus_tag LOCUS_08660 63460 62138 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_08660 65280 63640 gene locus_tag LOCUS_08670 65280 63640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 67702 65357 gene locus_tag LOCUS_08680 67702 65357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 68318 68106 gene locus_tag LOCUS_08690 68318 68106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 68667 68272 gene locus_tag LOCUS_08700 gene rpsI 68667 68272 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_08700 69126 68698 gene locus_tag LOCUS_08710 gene rplM 69126 68698 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650450.1 protein_id gnl|my_center|LOCUS_08710 70069 69335 gene locus_tag LOCUS_08720 gene truA 70069 69335 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067314.1 protein_id gnl|my_center|LOCUS_08720 70878 70069 gene locus_tag LOCUS_08730 70878 70069 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_08730 71752 70901 gene locus_tag LOCUS_08740 71752 70901 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_08740 72610 71765 gene locus_tag LOCUS_08750 72610 71765 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_08750 72943 73914 gene locus_tag LOCUS_08760 72943 73914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 74501 73989 gene locus_tag LOCUS_08770 74501 73989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 74640 74879 gene locus_tag LOCUS_08780 74640 74879 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_08780 75601 75065 gene locus_tag LOCUS_08790 gene rplQ 75601 75065 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_08790 76689 75730 gene locus_tag LOCUS_08800 76689 75730 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_08800 77317 76724 gene locus_tag LOCUS_08810 gene rpsD 77317 76724 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_08810 77830 77435 gene locus_tag LOCUS_08820 gene rpsK 77830 77435 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_08820 78246 77878 gene locus_tag LOCUS_08830 gene rpsM 78246 77878 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_08830 79151 78933 gene locus_tag LOCUS_08840 gene infA 79151 78933 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_08840 79443 79162 gene locus_tag LOCUS_08850 79443 79162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 80198 79434 gene locus_tag LOCUS_08860 gene map 80198 79434 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_08860 80906 80262 gene locus_tag LOCUS_08870 80906 80262 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_08870 82333 81020 gene locus_tag LOCUS_08880 gene secY 82333 81020 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_08880 82773 82333 gene locus_tag LOCUS_08890 gene rplO 82773 82333 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_08890 82969 82787 gene locus_tag LOCUS_08900 gene rpmD 82969 82787 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693169.1 protein_id gnl|my_center|LOCUS_08900 83493 82984 gene locus_tag LOCUS_08910 gene rpsE 83493 82984 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_08910 83880 83512 gene locus_tag LOCUS_08920 gene rplR 83880 83512 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_08920 <84454 83901 gene locus_tag LOCUS_08930 <84454 83901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435668.1:50S ribosomal protein L6 >Feature sequence08 431 1051 gene locus_tag LOCUS_08940 431 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1085 2641 gene locus_tag LOCUS_08950 1085 2641 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047851.1 protein_id gnl|my_center|LOCUS_08950 3359 2664 gene locus_tag LOCUS_08960 3359 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5041 3461 gene locus_tag LOCUS_08970 gene clpX 5041 3461 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082752.1 protein_id gnl|my_center|LOCUS_08970 6125 5358 gene locus_tag LOCUS_08980 6125 5358 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789184.1 protein_id gnl|my_center|LOCUS_08980 6241 6681 gene locus_tag LOCUS_08990 6241 6681 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033125641.1 protein_id gnl|my_center|LOCUS_08990 8118 6802 gene locus_tag LOCUS_09000 8118 6802 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290101.1 protein_id gnl|my_center|LOCUS_09000 10102 8276 gene locus_tag LOCUS_09010 gene glmS 10102 8276 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_09010 11053 10124 gene locus_tag LOCUS_09020 gene rfbN 11053 10124 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_09020 12586 11120 gene locus_tag LOCUS_09030 12586 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 14029 12620 gene locus_tag LOCUS_09040 14029 12620 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_09040 15107 14100 gene locus_tag LOCUS_09050 15107 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 16416 15130 gene locus_tag LOCUS_09060 16416 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 17165 16491 gene locus_tag LOCUS_09070 17165 16491 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_09070 17893 17162 gene locus_tag LOCUS_09080 17893 17162 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_09080 18326 17898 gene locus_tag LOCUS_09090 18326 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 20072 18339 gene locus_tag LOCUS_09100 20072 18339 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_09100 22221 20221 gene locus_tag LOCUS_09110 22221 20221 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_09110 24128 22230 gene locus_tag LOCUS_09120 24128 22230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 26188 24110 gene locus_tag LOCUS_09130 26188 24110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 27536 26190 gene locus_tag LOCUS_09140 27536 26190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 28578 27583 gene locus_tag LOCUS_09150 28578 27583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_09150 29141 28575 gene locus_tag LOCUS_09160 gene rfbC 29141 28575 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_09160 30398 29148 gene locus_tag LOCUS_09170 30398 29148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 31257 30388 gene locus_tag LOCUS_09180 gene rfbA 31257 30388 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_09180 32409 31327 gene locus_tag LOCUS_09190 gene rfbB 32409 31327 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_09190 35606 32541 gene locus_tag LOCUS_09200 35606 32541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 35925 36167 gene locus_tag LOCUS_09210 35925 36167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 36531 36196 gene locus_tag LOCUS_09220 36531 36196 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089868.1 protein_id gnl|my_center|LOCUS_09220 36893 36528 gene locus_tag LOCUS_09230 36893 36528 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805125.1 protein_id gnl|my_center|LOCUS_09230 37329 38891 gene locus_tag LOCUS_09240 37329 38891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 38912 40360 gene locus_tag LOCUS_09250 38912 40360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 41768 40344 gene locus_tag LOCUS_09260 41768 40344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 41868 43040 gene locus_tag LOCUS_09270 41868 43040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 44062 43037 gene locus_tag LOCUS_09280 44062 43037 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_09280 46220 44076 gene locus_tag LOCUS_09290 46220 44076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 48229 46235 gene locus_tag LOCUS_09300 48229 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 49237 48230 gene locus_tag LOCUS_09310 49237 48230 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_09310 50096 49224 gene locus_tag LOCUS_09320 50096 49224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 51184 50147 gene locus_tag LOCUS_09330 51184 50147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 52241 51186 gene locus_tag LOCUS_09340 52241 51186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083206.1 protein_id gnl|my_center|LOCUS_09340 53752 52274 gene locus_tag LOCUS_09350 53752 52274 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_09350 54723 53755 gene locus_tag LOCUS_09360 54723 53755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 54944 55597 gene locus_tag LOCUS_09370 54944 55597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 55600 57867 gene locus_tag LOCUS_09380 55600 57867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 57857 58834 gene locus_tag LOCUS_09390 57857 58834 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_09390 60134 58878 gene locus_tag LOCUS_09400 60134 58878 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895005.1 protein_id gnl|my_center|LOCUS_09400 61927 60131 gene locus_tag LOCUS_09410 61927 60131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 63085 61949 gene locus_tag LOCUS_09420 63085 61949 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_09420 64585 63131 gene locus_tag LOCUS_09430 64585 63131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 66106 64619 gene locus_tag LOCUS_09440 66106 64619 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_09440 67932 66109 gene locus_tag LOCUS_09450 67932 66109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 69910 67943 gene locus_tag LOCUS_09460 69910 67943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 70072 71205 gene locus_tag LOCUS_09470 70072 71205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 71266 72444 gene locus_tag LOCUS_09480 gene pseC 71266 72444 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_09480 72454 72969 gene locus_tag LOCUS_09490 72454 72969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 72988 73932 gene locus_tag LOCUS_09500 72988 73932 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724804.1 protein_id gnl|my_center|LOCUS_09500 73965 74597 gene locus_tag LOCUS_09510 73965 74597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 74601 76265 gene locus_tag LOCUS_09520 74601 76265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 77940 76201 gene locus_tag LOCUS_09530 77940 76201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_09530 79327 77957 gene locus_tag LOCUS_09540 79327 77957 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence09 1516 14 gene locus_tag LOCUS_09550 gene lysS 1516 14 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_09550 2078 1533 gene locus_tag LOCUS_09560 gene greA 2078 1533 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_09560 3172 2120 gene locus_tag LOCUS_09570 3172 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3668 3231 gene locus_tag LOCUS_09580 3668 3231 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816710.1 protein_id gnl|my_center|LOCUS_09580 4632 3655 gene locus_tag LOCUS_09590 gene dusB 4632 3655 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_09590 5440 4652 gene locus_tag LOCUS_09600 5440 4652 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_09600 5844 5482 gene locus_tag LOCUS_09610 5844 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 6817 5831 gene locus_tag LOCUS_09620 6817 5831 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_09620 7809 6814 gene locus_tag LOCUS_09630 gene argF 7809 6814 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_09630 8756 7836 gene locus_tag LOCUS_09640 8756 7836 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_09640 9297 8758 gene locus_tag LOCUS_09650 9297 8758 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_09650 10611 9463 gene locus_tag LOCUS_09660 10611 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 11568 10774 gene locus_tag LOCUS_09670 gene proC 11568 10774 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360723.1 protein_id gnl|my_center|LOCUS_09670 12374 11565 gene locus_tag LOCUS_09680 12374 11565 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_09680 13380 12406 gene locus_tag LOCUS_09690 gene pfkA 13380 12406 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_09690 16927 13460 gene locus_tag LOCUS_09700 16927 13460 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_09700 18040 16964 gene locus_tag LOCUS_09710 18040 16964 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937723.1 protein_id gnl|my_center|LOCUS_09710 19446 18259 gene locus_tag LOCUS_09720 gene metK 19446 18259 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_09720 21337 20042 gene locus_tag LOCUS_09730 21337 20042 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_09730 23013 21445 gene locus_tag LOCUS_09740 23013 21445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 23210 24427 gene locus_tag LOCUS_09750 23210 24427 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_09750 24994 24431 gene locus_tag LOCUS_09760 24994 24431 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_09760 26036 25062 gene locus_tag LOCUS_09770 26036 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 26596 27066 gene locus_tag LOCUS_09780 26596 27066 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_09780 27746 27096 gene locus_tag LOCUS_09790 27746 27096 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_09790 28132 27851 gene locus_tag LOCUS_09800 28132 27851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 28295 28957 gene locus_tag LOCUS_09810 28295 28957 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_09810 30007 28991 gene locus_tag LOCUS_09820 gene galE 30007 28991 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996163.1 protein_id gnl|my_center|LOCUS_09820 31421 30189 gene locus_tag LOCUS_09830 31421 30189 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_09830 32456 31536 gene locus_tag LOCUS_09840 32456 31536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 33971 32466 gene locus_tag LOCUS_09850 33971 32466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 35293 33968 gene locus_tag LOCUS_09860 35293 33968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 36485 35439 gene locus_tag LOCUS_09870 36485 35439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 36615 37037 gene locus_tag LOCUS_09880 36615 37037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 38946 37126 gene locus_tag LOCUS_09890 38946 37126 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458911.1 protein_id gnl|my_center|LOCUS_09890 40484 39066 gene locus_tag LOCUS_09900 40484 39066 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891467.1 protein_id gnl|my_center|LOCUS_09900 41529 40579 gene locus_tag LOCUS_09910 41529 40579 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_09910 41819 42313 gene locus_tag LOCUS_09920 41819 42313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 42438 42845 gene locus_tag LOCUS_09930 42438 42845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 43181 42888 gene locus_tag LOCUS_09940 43181 42888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 44090 43320 gene locus_tag LOCUS_09950 44090 43320 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 protein_id gnl|my_center|LOCUS_09950 45209 44427 gene locus_tag LOCUS_09960 45209 44427 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 protein_id gnl|my_center|LOCUS_09960 46533 45196 gene locus_tag LOCUS_09970 46533 45196 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964805.1 protein_id gnl|my_center|LOCUS_09970 47433 46567 gene locus_tag LOCUS_09980 47433 46567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 47633 49048 gene locus_tag LOCUS_09990 47633 49048 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_09990 49051 49740 gene locus_tag LOCUS_10000 49051 49740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 50098 49844 gene locus_tag LOCUS_10010 50098 49844 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476650.1 protein_id gnl|my_center|LOCUS_10010 50491 50327 gene locus_tag LOCUS_10020 50491 50327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 50556 50484 gene locus_tag LOCUS_t00010 50556 50484 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 50890 50738 gene locus_tag LOCUS_10030 50890 50738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 51805 51047 gene locus_tag LOCUS_10040 51805 51047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 52665 51949 gene locus_tag LOCUS_10050 52665 51949 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965980.1 protein_id gnl|my_center|LOCUS_10050 52859 53785 gene locus_tag LOCUS_10060 52859 53785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 53782 54723 gene locus_tag LOCUS_10070 53782 54723 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_10070 55605 54724 gene locus_tag LOCUS_10080 55605 54724 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_10080 55875 55636 gene locus_tag LOCUS_10090 55875 55636 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992809.1 protein_id gnl|my_center|LOCUS_10090 56682 55930 gene locus_tag LOCUS_10100 56682 55930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 56910 56752 gene locus_tag LOCUS_10110 56910 56752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 58113 56950 gene locus_tag LOCUS_10120 58113 56950 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 protein_id gnl|my_center|LOCUS_10120 59282 58452 gene locus_tag LOCUS_10130 59282 58452 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_10130 59566 60462 gene locus_tag LOCUS_10140 59566 60462 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_10140 61049 60615 gene locus_tag LOCUS_10150 61049 60615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 61298 62068 gene locus_tag LOCUS_10160 61298 62068 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_10160 62187 62654 gene locus_tag LOCUS_10170 62187 62654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence10 2465 1842 gene locus_tag LOCUS_10180 2465 1842 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 protein_id gnl|my_center|LOCUS_10180 2636 2466 gene locus_tag LOCUS_10190 2636 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7652 2682 gene locus_tag LOCUS_10200 7652 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 8547 7681 gene locus_tag LOCUS_10210 gene srtB 8547 7681 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_10210 8748 8993 gene locus_tag LOCUS_10220 8748 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9217 9708 gene locus_tag LOCUS_10230 9217 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 9701 9976 gene locus_tag LOCUS_10240 9701 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 10798 10145 gene locus_tag LOCUS_10250 10798 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 13233 10819 gene locus_tag LOCUS_10260 gene leuS 13233 10819 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 protein_id gnl|my_center|LOCUS_10260 14487 13453 gene locus_tag LOCUS_10270 14487 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 16284 14647 gene locus_tag LOCUS_10280 16284 14647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_10280 18560 16470 gene locus_tag LOCUS_10290 gene fusA 18560 16470 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_10290 18807 19907 gene locus_tag LOCUS_10300 gene tyrA 18807 19907 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_10300 19953 21236 gene locus_tag LOCUS_10310 gene aroA 19953 21236 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_10310 21264 21839 gene locus_tag LOCUS_10320 21264 21839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 23444 21963 gene locus_tag LOCUS_10330 gene spoIVA 23444 21963 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_10330 24757 23549 gene locus_tag LOCUS_10340 24757 23549 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_10340 25592 24777 gene locus_tag LOCUS_10350 25592 24777 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_10350 26650 25640 gene locus_tag LOCUS_10360 26650 25640 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_10360 27319 26672 gene locus_tag LOCUS_10370 gene plsY 27319 26672 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_10370 28655 27321 gene locus_tag LOCUS_10380 gene der 28655 27321 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_10380 30029 28665 gene locus_tag LOCUS_10390 30029 28665 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_10390 30158 31345 gene locus_tag LOCUS_10400 30158 31345 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_10400 32571 31447 gene locus_tag LOCUS_10410 32571 31447 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606035.1 protein_id gnl|my_center|LOCUS_10410 35147 32556 gene locus_tag LOCUS_10420 35147 32556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 35889 35191 gene locus_tag LOCUS_10430 35889 35191 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_10430 36865 35984 gene locus_tag LOCUS_10440 gene pgeF 36865 35984 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 protein_id gnl|my_center|LOCUS_10440 37271 36891 gene locus_tag LOCUS_10450 37271 36891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 37573 37289 gene locus_tag LOCUS_10460 37573 37289 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_10460 39326 37584 gene locus_tag LOCUS_10470 39326 37584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 40111 39347 gene locus_tag LOCUS_10480 40111 39347 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_10480 40665 40126 gene locus_tag LOCUS_10490 gene lepB 40665 40126 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_10490 41519 40680 gene locus_tag LOCUS_10500 gene ylqF 41519 40680 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_10500 42148 41564 gene locus_tag LOCUS_10510 gene lepB 42148 41564 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460443.1 protein_id gnl|my_center|LOCUS_10510 42665 42318 gene locus_tag LOCUS_10520 gene rplS 42665 42318 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_10520 43462 42758 gene locus_tag LOCUS_10530 gene trmD 43462 42758 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_10530 43991 43482 gene locus_tag LOCUS_10540 gene rimM 43991 43482 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_10540 44296 44069 gene locus_tag LOCUS_10550 44296 44069 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_10550 44593 44348 gene locus_tag LOCUS_10560 gene rpsP 44593 44348 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_10560 46014 44659 gene locus_tag LOCUS_10570 gene ffh 46014 44659 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_10570 46371 46015 gene locus_tag LOCUS_10580 46371 46015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 46526 46888 gene locus_tag LOCUS_10590 46526 46888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10590 46845 47102 gene locus_tag LOCUS_10600 46845 47102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 47947 47342 gene locus_tag LOCUS_10610 47947 47342 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_10610 49335 47944 gene locus_tag LOCUS_10620 49335 47944 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_10620 49818 49519 gene locus_tag LOCUS_10630 49818 49519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 50465 50172 gene locus_tag LOCUS_10640 50465 50172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 50963 50685 gene locus_tag LOCUS_10650 50963 50685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 51118 51660 gene locus_tag LOCUS_10660 51118 51660 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643718.1 protein_id gnl|my_center|LOCUS_10660 52002 52391 gene locus_tag LOCUS_10670 52002 52391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 52927 52514 gene locus_tag LOCUS_10680 52927 52514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 53210 52866 gene locus_tag LOCUS_10690 53210 52866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 53714 53244 gene locus_tag LOCUS_10700 53714 53244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10700 54898 53729 gene locus_tag LOCUS_10710 54898 53729 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679610.1 protein_id gnl|my_center|LOCUS_10710 55062 54910 gene locus_tag LOCUS_10720 55062 54910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 56079 55186 gene locus_tag LOCUS_10730 56079 55186 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102012.1 protein_id gnl|my_center|LOCUS_10730 56387 56305 gene locus_tag LOCUS_t00020 56387 56305 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57139 56462 gene locus_tag LOCUS_10740 57139 56462 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_10740 57919 57158 gene locus_tag LOCUS_10750 gene hisF 57919 57158 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_10750 58540 57935 gene locus_tag LOCUS_10760 gene hisH 58540 57935 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_10760 60583 58559 gene locus_tag LOCUS_10770 60583 58559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 61162 60656 gene locus_tag LOCUS_10780 61162 60656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 62141 61248 gene locus_tag LOCUS_10790 62141 61248 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403172.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence11 1386 10 gene locus_tag LOCUS_10800 gene rlmD 1386 10 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_10800 2441 1497 gene locus_tag LOCUS_10810 2441 1497 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_10810 3881 2568 gene locus_tag LOCUS_10820 3881 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3979 6351 gene locus_tag LOCUS_10830 3979 6351 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_10830 6492 7193 gene locus_tag LOCUS_10840 6492 7193 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_10840 7196 8620 gene locus_tag LOCUS_10850 7196 8620 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_10850 9164 8706 gene locus_tag LOCUS_10860 9164 8706 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_10860 10937 9192 gene locus_tag LOCUS_10870 10937 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 13973 11049 gene locus_tag LOCUS_10880 13973 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 15475 13988 gene locus_tag LOCUS_10890 15475 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 16784 15480 gene locus_tag LOCUS_10900 16784 15480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 17418 16807 gene locus_tag LOCUS_10910 17418 16807 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_10910 18857 17442 gene locus_tag LOCUS_10920 18857 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 20038 18854 gene locus_tag LOCUS_10930 20038 18854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 21137 20112 gene locus_tag LOCUS_10940 21137 20112 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460776.1 protein_id gnl|my_center|LOCUS_10940 21773 21171 gene locus_tag LOCUS_10950 21773 21171 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_10950 24121 21776 gene locus_tag LOCUS_10960 24121 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 25304 24114 gene locus_tag LOCUS_10970 25304 24114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 26216 25518 gene locus_tag LOCUS_10980 26216 25518 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023352.1 protein_id gnl|my_center|LOCUS_10980 26418 26257 gene locus_tag LOCUS_10990 26418 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 26920 26423 gene locus_tag LOCUS_11000 gene trmL 26920 26423 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_11000 28225 27047 gene locus_tag LOCUS_11010 28225 27047 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_11010 28704 28222 gene locus_tag LOCUS_11020 28704 28222 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_11020 29708 28719 gene locus_tag LOCUS_11030 29708 28719 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_11030 31431 29779 gene locus_tag LOCUS_11040 31431 29779 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_11040 31679 32296 gene locus_tag LOCUS_11050 31679 32296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 32945 32253 gene locus_tag LOCUS_11060 32945 32253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 33700 32942 gene locus_tag LOCUS_11070 gene nth 33700 32942 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_11070 35373 33697 gene locus_tag LOCUS_11080 35373 33697 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 protein_id gnl|my_center|LOCUS_11080 36895 35381 gene locus_tag LOCUS_11090 gene galT 36895 35381 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_11090 38071 36908 gene locus_tag LOCUS_11100 38071 36908 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966242.1 protein_id gnl|my_center|LOCUS_11100 39772 38243 gene locus_tag LOCUS_11110 39772 38243 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_11110 41245 40553 gene locus_tag LOCUS_11120 gene pnuC 41245 40553 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 protein_id gnl|my_center|LOCUS_11120 42147 41242 gene locus_tag LOCUS_11130 42147 41242 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011970.1 protein_id gnl|my_center|LOCUS_11130 43142 42144 gene locus_tag LOCUS_11140 43142 42144 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097909.1 protein_id gnl|my_center|LOCUS_11140 43363 44100 gene locus_tag LOCUS_11150 43363 44100 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113827.1 protein_id gnl|my_center|LOCUS_11150 45023 44121 gene locus_tag LOCUS_11160 45023 44121 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_11160 45401 45093 gene locus_tag LOCUS_11170 45401 45093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 46152 45391 gene locus_tag LOCUS_11180 46152 45391 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_11180 46281 46356 gene locus_tag LOCUS_t00030 46281 46356 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 48212 47481 gene locus_tag LOCUS_11190 48212 47481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 48430 48212 gene locus_tag LOCUS_11200 48430 48212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390601.1 protein_id gnl|my_center|LOCUS_11200 48768 48445 gene locus_tag LOCUS_11210 48768 48445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 49434 48799 gene locus_tag LOCUS_11220 49434 48799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 49852 49436 gene locus_tag LOCUS_11230 49852 49436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 51577 49853 gene locus_tag LOCUS_11240 51577 49853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 51990 51586 gene locus_tag LOCUS_11250 51990 51586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 55853 51987 gene locus_tag LOCUS_11260 55853 51987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 56204 56004 gene locus_tag LOCUS_11270 56204 56004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 56422 56201 gene locus_tag LOCUS_11280 56422 56201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 57047 56442 gene locus_tag LOCUS_11290 57047 56442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 57349 57170 gene locus_tag LOCUS_11300 57349 57170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 58710 57469 gene locus_tag LOCUS_11310 58710 57469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence12 36 587 gene locus_tag LOCUS_11320 36 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 644 5089 gene locus_tag LOCUS_11330 gene essC 644 5089 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963368.1 protein_id gnl|my_center|LOCUS_11330 5119 5943 gene locus_tag LOCUS_11340 5119 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5955 6242 gene locus_tag LOCUS_11350 5955 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6252 6548 gene locus_tag LOCUS_11360 6252 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 6574 8034 gene locus_tag LOCUS_11370 6574 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8106 8402 gene locus_tag LOCUS_11380 8106 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 8414 8662 gene locus_tag LOCUS_11390 8414 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 8706 9593 gene locus_tag LOCUS_11400 8706 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 9616 10773 gene locus_tag LOCUS_11410 9616 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 10688 11305 gene locus_tag LOCUS_11420 10688 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 11372 12664 gene locus_tag LOCUS_11430 11372 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 12691 13401 gene locus_tag LOCUS_11440 12691 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 13431 13994 gene locus_tag LOCUS_11450 13431 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 14361 15332 gene locus_tag LOCUS_11460 14361 15332 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_11460 15412 16308 gene locus_tag LOCUS_11470 15412 16308 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_11470 16305 18137 gene locus_tag LOCUS_11480 gene yesM 16305 18137 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_11480 18112 19602 gene locus_tag LOCUS_11490 18112 19602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 19667 20875 gene locus_tag LOCUS_11500 19667 20875 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226191.1 protein_id gnl|my_center|LOCUS_11500 20993 22285 gene locus_tag LOCUS_11510 20993 22285 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061827.1 protein_id gnl|my_center|LOCUS_11510 22371 23282 gene locus_tag LOCUS_11520 22371 23282 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_11520 23282 24112 gene locus_tag LOCUS_11530 23282 24112 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226189.1 protein_id gnl|my_center|LOCUS_11530 24212 26140 gene locus_tag LOCUS_11540 24212 26140 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_11540 26231 26854 gene locus_tag LOCUS_11550 26231 26854 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964741.1 protein_id gnl|my_center|LOCUS_11550 26891 27094 gene locus_tag LOCUS_11560 26891 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 27049 27267 gene locus_tag LOCUS_11570 27049 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 27538 28509 gene locus_tag LOCUS_11580 27538 28509 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390188.1 protein_id gnl|my_center|LOCUS_11580 28675 32742 gene locus_tag LOCUS_11590 gene cas9 28675 32742 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_11590 32739 33611 gene locus_tag LOCUS_11600 gene cas1 32739 33611 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_11600 33631 33921 gene locus_tag LOCUS_11610 gene cas2 33631 33921 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_11610 33931 34605 gene locus_tag LOCUS_11620 gene csn2 33931 34605 CDS product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681294.1 protein_id gnl|my_center|LOCUS_11620 34663 35095 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgagaaccttgtaagttaagaggggtaagaaac 36249 35845 gene locus_tag LOCUS_11630 36249 35845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 36841 38529 gene locus_tag LOCUS_11640 36841 38529 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_11640 38713 39594 gene locus_tag LOCUS_11650 38713 39594 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_11650 39663 41345 gene locus_tag LOCUS_11660 gene pdcB 39663 41345 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_11660 41503 42576 gene locus_tag LOCUS_11670 41503 42576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 42573 44333 gene locus_tag LOCUS_11680 42573 44333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_11680 44351 45886 gene locus_tag LOCUS_11690 44351 45886 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 protein_id gnl|my_center|LOCUS_11690 45966 47099 gene locus_tag LOCUS_11700 45966 47099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 47143 47802 gene locus_tag LOCUS_11710 47143 47802 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_11710 47799 49244 gene locus_tag LOCUS_11720 47799 49244 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_11720 49241 50071 gene locus_tag LOCUS_11730 49241 50071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 50287 51735 gene locus_tag LOCUS_11740 50287 51735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 51802 52734 gene locus_tag LOCUS_11750 51802 52734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 52825 53328 gene locus_tag LOCUS_11760 gene greA 52825 53328 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564597.1 protein_id gnl|my_center|LOCUS_11760 53421 53879 gene locus_tag LOCUS_11770 53421 53879 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816073.1 protein_id gnl|my_center|LOCUS_11770 54082 54573 gene locus_tag LOCUS_11780 54082 54573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 54769 55479 gene locus_tag LOCUS_11790 54769 55479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 55485 58133 gene locus_tag LOCUS_11800 55485 58133 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_11800 58805 58107 gene locus_tag LOCUS_11810 58805 58107 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939837.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence13 35 223 gene locus_tag LOCUS_11820 35 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 293 442 gene locus_tag LOCUS_11830 293 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 457 960 gene locus_tag LOCUS_11840 457 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1006 1551 gene locus_tag LOCUS_11850 1006 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1786 3051 gene locus_tag LOCUS_11860 1786 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3242 4420 gene locus_tag LOCUS_11870 3242 4420 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_11870 4559 5344 gene locus_tag LOCUS_11880 4559 5344 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_11880 5420 6259 gene locus_tag LOCUS_11890 5420 6259 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_11890 6286 7437 gene locus_tag LOCUS_11900 6286 7437 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_11900 7498 8283 gene locus_tag LOCUS_11910 7498 8283 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_11910 8304 9353 gene locus_tag LOCUS_11920 8304 9353 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_11920 9590 10759 gene locus_tag LOCUS_11930 9590 10759 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_11930 10914 12455 gene locus_tag LOCUS_11940 10914 12455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_11940 12448 13581 gene locus_tag LOCUS_11950 12448 13581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_11950 13578 14531 gene locus_tag LOCUS_11960 13578 14531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_11960 14757 16388 gene locus_tag LOCUS_11970 14757 16388 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 protein_id gnl|my_center|LOCUS_11970 16403 17533 gene locus_tag LOCUS_11980 16403 17533 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388656.1 protein_id gnl|my_center|LOCUS_11980 17530 18594 gene locus_tag LOCUS_11990 17530 18594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 19567 18608 gene locus_tag LOCUS_12000 19567 18608 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_12000 19721 21163 gene locus_tag LOCUS_12010 19721 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 21205 21795 gene locus_tag LOCUS_12020 21205 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 21807 24086 gene locus_tag LOCUS_12030 21807 24086 CDS product YceG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964719.1 protein_id gnl|my_center|LOCUS_12030 24077 25234 gene locus_tag LOCUS_12040 24077 25234 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964720.1 protein_id gnl|my_center|LOCUS_12040 25253 25834 gene locus_tag LOCUS_12050 25253 25834 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_12050 25849 26430 gene locus_tag LOCUS_12060 25849 26430 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_12060 26447 27034 gene locus_tag LOCUS_12070 26447 27034 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_12070 27091 29745 gene locus_tag LOCUS_12080 27091 29745 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068264.1 protein_id gnl|my_center|LOCUS_12080 29766 30611 gene locus_tag LOCUS_12090 29766 30611 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861281.1 protein_id gnl|my_center|LOCUS_12090 30794 31717 gene locus_tag LOCUS_12100 30794 31717 CDS product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 protein_id gnl|my_center|LOCUS_12100 31891 33120 gene locus_tag LOCUS_12110 31891 33120 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_12110 33297 34286 gene locus_tag LOCUS_12120 33297 34286 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404261.1 protein_id gnl|my_center|LOCUS_12120 34467 36782 gene locus_tag LOCUS_12130 gene glgP 34467 36782 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_12130 37170 38522 gene locus_tag LOCUS_12140 37170 38522 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_12140 38618 39460 gene locus_tag LOCUS_12150 38618 39460 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_12150 39462 40301 gene locus_tag LOCUS_12160 39462 40301 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_12160 40462 41943 gene locus_tag LOCUS_12170 gene malQ 40462 41943 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_12170 42043 43074 gene locus_tag LOCUS_12180 gene ccpA 42043 43074 CDS product LacI family transcriptional regulator CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888871.1 protein_id gnl|my_center|LOCUS_12180 43134 44609 gene locus_tag LOCUS_12190 gene malQ 43134 44609 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_12190 44761 46200 gene locus_tag LOCUS_12200 44761 46200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 46775 46338 gene locus_tag LOCUS_12210 46775 46338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 47303 46848 gene locus_tag LOCUS_12220 47303 46848 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689851.1 protein_id gnl|my_center|LOCUS_12220 47890 47411 gene locus_tag LOCUS_12230 47890 47411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 48197 47925 gene locus_tag LOCUS_12240 48197 47925 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_12240 49196 48300 gene locus_tag LOCUS_12250 49196 48300 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018365292.1 protein_id gnl|my_center|LOCUS_12250 49584 50135 gene locus_tag LOCUS_12260 49584 50135 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_12260 50205 50810 gene locus_tag LOCUS_12270 50205 50810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 50815 52203 gene locus_tag LOCUS_12280 50815 52203 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_12280 52229 52849 gene locus_tag LOCUS_12290 52229 52849 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_12290 52842 53024 gene locus_tag LOCUS_12300 52842 53024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 53044 54360 gene locus_tag LOCUS_12310 53044 54360 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_12310 54434 54443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54496 55857 gene locus_tag LOCUS_12320 54496 55857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 56295 55954 gene locus_tag LOCUS_12330 56295 55954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence14 51 1397 gene locus_tag LOCUS_12340 51 1397 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021363290.1 protein_id gnl|my_center|LOCUS_12340 1615 2415 gene locus_tag LOCUS_12350 1615 2415 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_12350 2515 3786 gene locus_tag LOCUS_12360 2515 3786 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_12360 4458 3799 gene locus_tag LOCUS_12370 4458 3799 CDS product DUF6320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804300.1 protein_id gnl|my_center|LOCUS_12370 5741 4461 gene locus_tag LOCUS_12380 5741 4461 CDS product alcohol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930145.1 protein_id gnl|my_center|LOCUS_12380 6667 5744 gene locus_tag LOCUS_12390 6667 5744 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804298.1 protein_id gnl|my_center|LOCUS_12390 7895 6966 gene locus_tag LOCUS_12400 7895 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 8978 7923 gene locus_tag LOCUS_12410 8978 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 9074 9613 gene locus_tag LOCUS_12420 9074 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 9643 10407 gene locus_tag LOCUS_12430 9643 10407 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_12430 10579 11241 gene locus_tag LOCUS_12440 10579 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 11323 11970 gene locus_tag LOCUS_12450 11323 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 12153 13361 gene locus_tag LOCUS_12460 12153 13361 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_12460 13355 14497 gene locus_tag LOCUS_12470 gene glgD 13355 14497 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_12470 14617 15801 gene locus_tag LOCUS_12480 14617 15801 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_12480 15856 17145 gene locus_tag LOCUS_12490 15856 17145 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_12490 18011 17142 gene locus_tag LOCUS_12500 gene pocR 18011 17142 CDS product regulatory protein PocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622044.1 protein_id gnl|my_center|LOCUS_12500 18189 19055 gene locus_tag LOCUS_12510 18189 19055 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131820.1 protein_id gnl|my_center|LOCUS_12510 19071 20483 gene locus_tag LOCUS_12520 19071 20483 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_12520 20486 21970 gene locus_tag LOCUS_12530 gene xylB 20486 21970 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_12530 22080 23087 gene locus_tag LOCUS_12540 22080 23087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 23084 24355 gene locus_tag LOCUS_12550 23084 24355 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_12550 25030 24350 gene locus_tag LOCUS_12560 25030 24350 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_12560 26003 25074 gene locus_tag LOCUS_12570 26003 25074 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_12570 26466 26083 gene locus_tag LOCUS_12580 26466 26083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 26522 26665 gene locus_tag LOCUS_12590 26522 26665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 26823 26620 gene locus_tag LOCUS_12600 26823 26620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 26979 27932 gene locus_tag LOCUS_12610 gene pfkB 26979 27932 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_12610 28032 28307 gene locus_tag LOCUS_12620 28032 28307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 28313 28831 gene locus_tag LOCUS_12630 28313 28831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 28852 30531 gene locus_tag LOCUS_12640 gene flgK 28852 30531 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965510.1 protein_id gnl|my_center|LOCUS_12640 30554 32494 gene locus_tag LOCUS_12650 30554 32494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 32520 34256 gene locus_tag LOCUS_12660 32520 34256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 34278 34739 gene locus_tag LOCUS_12670 34278 34739 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_12670 34741 34959 gene locus_tag LOCUS_12680 gene csrA 34741 34959 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_12680 35084 35509 gene locus_tag LOCUS_12690 35084 35509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 35522 37708 gene locus_tag LOCUS_12700 35522 37708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 37754 38137 gene locus_tag LOCUS_12710 gene fliS 37754 38137 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_12710 38127 38633 gene locus_tag LOCUS_12720 38127 38633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 38832 40457 gene locus_tag LOCUS_12730 38832 40457 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_12730 41873 40569 gene locus_tag LOCUS_12740 41873 40569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 42279 42542 gene locus_tag LOCUS_12750 42279 42542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 42809 42964 gene locus_tag LOCUS_12760 gene rpmG 42809 42964 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_12760 42992 43192 gene locus_tag LOCUS_12770 42992 43192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 43209 43724 gene locus_tag LOCUS_12780 gene nusG 43209 43724 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_12780 43973 44398 gene locus_tag LOCUS_12790 gene rplK 43973 44398 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_12790 44458 45147 gene locus_tag LOCUS_12800 gene rplA 44458 45147 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_12800 45265 46731 gene locus_tag LOCUS_12810 45265 46731 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_12810 46777 47832 gene locus_tag LOCUS_12820 46777 47832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 47813 49123 gene locus_tag LOCUS_12830 47813 49123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 49317 49862 gene locus_tag LOCUS_12840 49317 49862 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_12840 49877 50428 gene locus_tag LOCUS_12850 49877 50428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 50721 51266 gene locus_tag LOCUS_12860 gene rplJ 50721 51266 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_12860 51339 51713 gene locus_tag LOCUS_12870 gene rplL 51339 51713 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159736.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence15 1784 363 gene locus_tag LOCUS_12880 1784 363 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_12880 2020 1781 gene locus_tag LOCUS_12890 2020 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 5286 2020 gene locus_tag LOCUS_12900 gene hsdR 5286 2020 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_12900 6857 5385 gene locus_tag LOCUS_12910 6857 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 7606 6875 gene locus_tag LOCUS_12920 7606 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 9890 8139 gene locus_tag LOCUS_12930 9890 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 12176 9981 gene locus_tag LOCUS_12940 12176 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 12926 12420 gene locus_tag LOCUS_12950 gene folA 12926 12420 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261097.1 protein_id gnl|my_center|LOCUS_12950 14556 12958 gene locus_tag LOCUS_12960 14556 12958 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_12960 15596 14796 gene locus_tag LOCUS_12970 15596 14796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 15770 17143 gene locus_tag LOCUS_12980 15770 17143 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_12980 17966 17742 gene locus_tag LOCUS_12990 17966 17742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 19299 18487 gene locus_tag LOCUS_13000 19299 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 19580 19508 gene locus_tag LOCUS_t00040 19580 19508 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20554 19673 gene locus_tag LOCUS_13010 20554 19673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 22726 21218 gene locus_tag LOCUS_13020 22726 21218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 23337 22840 gene locus_tag LOCUS_13030 23337 22840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 24386 23340 gene locus_tag LOCUS_13040 gene spoVAD 24386 23340 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_13040 25475 24465 gene locus_tag LOCUS_13050 25475 24465 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054703570.1 protein_id gnl|my_center|LOCUS_13050 25841 25485 gene locus_tag LOCUS_13060 gene spoVAE 25841 25485 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_13060 26977 26030 gene locus_tag LOCUS_13070 26977 26030 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_13070 27372 26998 gene locus_tag LOCUS_13080 27372 26998 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_13080 27613 27353 gene locus_tag LOCUS_13090 27613 27353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 28815 27673 gene locus_tag LOCUS_13100 28815 27673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 29270 30079 gene locus_tag LOCUS_13110 29270 30079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 31224 30214 gene locus_tag LOCUS_13120 31224 30214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 31882 31301 gene locus_tag LOCUS_13130 31882 31301 CDS product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454130.1 protein_id gnl|my_center|LOCUS_13130 32034 31879 gene locus_tag LOCUS_13140 32034 31879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 33535 32210 gene locus_tag LOCUS_13150 33535 32210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 34257 33541 gene locus_tag LOCUS_13160 34257 33541 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_13160 35377 34514 gene locus_tag LOCUS_13170 35377 34514 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_13170 35994 35437 gene locus_tag LOCUS_13180 35994 35437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 36460 35984 gene locus_tag LOCUS_13190 36460 35984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 37079 36450 gene locus_tag LOCUS_13200 37079 36450 CDS product stage V sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438369.1 protein_id gnl|my_center|LOCUS_13200 37784 37149 gene locus_tag LOCUS_13210 gene cobC 37784 37149 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_13210 38554 37838 gene locus_tag LOCUS_13220 gene sigF 38554 37838 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393005.1 protein_id gnl|my_center|LOCUS_13220 39001 38558 gene locus_tag LOCUS_13230 gene spoIIAB 39001 38558 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_13230 39317 38994 gene locus_tag LOCUS_13240 gene spoIIAA 39317 38994 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_13240 40991 39570 gene locus_tag LOCUS_13250 40991 39570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 41156 41007 gene locus_tag LOCUS_13260 41156 41007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 42454 41159 gene locus_tag LOCUS_13270 42454 41159 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_13270 43920 42460 gene locus_tag LOCUS_13280 43920 42460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 46972 44309 gene locus_tag LOCUS_13290 46972 44309 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_13290 47536 47297 gene locus_tag LOCUS_13300 47536 47297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 47676 48503 gene locus_tag LOCUS_13310 47676 48503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 50274 48418 gene locus_tag LOCUS_13320 50274 48418 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802963.1 protein_id gnl|my_center|LOCUS_13320 52061 50274 gene locus_tag LOCUS_13330 52061 50274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798723.1 protein_id gnl|my_center|LOCUS_13330 52259 52840 gene locus_tag LOCUS_13340 52259 52840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 53172 52975 gene locus_tag LOCUS_13350 53172 52975 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_13350 54118 53162 gene locus_tag LOCUS_13360 54118 53162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 54825 54115 gene locus_tag LOCUS_13370 54825 54115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 55145 54822 gene locus_tag LOCUS_13380 55145 54822 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence16 2238 463 gene locus_tag LOCUS_13390 2238 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2444 4585 gene locus_tag LOCUS_13400 2444 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4585 5481 gene locus_tag LOCUS_13410 4585 5481 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_13410 5481 6320 gene locus_tag LOCUS_13420 5481 6320 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_13420 6381 7706 gene locus_tag LOCUS_13430 6381 7706 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399402.1 protein_id gnl|my_center|LOCUS_13430 7749 10109 gene locus_tag LOCUS_13440 gene yicI 7749 10109 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964400.1 protein_id gnl|my_center|LOCUS_13440 10200 11003 gene locus_tag LOCUS_13450 10200 11003 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_13450 11713 12612 gene locus_tag LOCUS_13460 11713 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 13382 12747 gene locus_tag LOCUS_13470 13382 12747 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948953.1 protein_id gnl|my_center|LOCUS_13470 14759 13485 gene locus_tag LOCUS_13480 gene sleC 14759 13485 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_13480 15643 14837 gene locus_tag LOCUS_13490 15643 14837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436375.1 protein_id gnl|my_center|LOCUS_13490 16341 15637 gene locus_tag LOCUS_13500 16341 15637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_13500 16708 16343 gene locus_tag LOCUS_13510 16708 16343 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_13510 17939 16842 gene locus_tag LOCUS_13520 17939 16842 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 protein_id gnl|my_center|LOCUS_13520 18282 21851 gene locus_tag LOCUS_13530 18282 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 21901 23163 gene locus_tag LOCUS_13540 21901 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 23197 24030 gene locus_tag LOCUS_13550 23197 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 24034 25230 gene locus_tag LOCUS_13560 24034 25230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 25327 26229 gene locus_tag LOCUS_13570 25327 26229 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_13570 26292 26942 gene locus_tag LOCUS_13580 26292 26942 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262170.1 protein_id gnl|my_center|LOCUS_13580 26952 27707 gene locus_tag LOCUS_13590 26952 27707 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_13590 27723 28112 gene locus_tag LOCUS_13600 27723 28112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 28179 28370 gene locus_tag LOCUS_13610 28179 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 28718 29842 gene locus_tag LOCUS_13620 gene ribD 28718 29842 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_13620 29824 30471 gene locus_tag LOCUS_13630 29824 30471 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_13630 30604 31821 gene locus_tag LOCUS_13640 30604 31821 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_13640 31850 32317 gene locus_tag LOCUS_13650 gene ribE 31850 32317 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_13650 32786 32409 gene locus_tag LOCUS_13660 32786 32409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 33011 33670 gene locus_tag LOCUS_13670 33011 33670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 33778 34137 gene locus_tag LOCUS_13680 33778 34137 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_13680 34143 35702 gene locus_tag LOCUS_13690 34143 35702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 35965 36579 gene locus_tag LOCUS_13700 gene ispF 35965 36579 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_13700 36497 37744 gene locus_tag LOCUS_13710 36497 37744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 37870 38583 gene locus_tag LOCUS_13720 gene cysE 37870 38583 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_13720 38570 39979 gene locus_tag LOCUS_13730 gene cysS 38570 39979 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_13730 39964 40428 gene locus_tag LOCUS_13740 39964 40428 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_13740 40425 41171 gene locus_tag LOCUS_13750 gene rlmB 40425 41171 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_13750 41178 41807 gene locus_tag LOCUS_13760 41178 41807 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_13760 41963 41891 gene locus_tag LOCUS_t00050 41963 41891 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42525 42064 gene locus_tag LOCUS_13770 42525 42064 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861759.1 protein_id gnl|my_center|LOCUS_13770 43068 42544 gene locus_tag LOCUS_13780 43068 42544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 43266 43694 gene locus_tag LOCUS_13790 43266 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 43761 44192 gene locus_tag LOCUS_13800 43761 44192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 44194 45498 gene locus_tag LOCUS_13810 44194 45498 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861032.1 protein_id gnl|my_center|LOCUS_13810 45523 45990 gene locus_tag LOCUS_13820 45523 45990 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429851.1 protein_id gnl|my_center|LOCUS_13820 46009 46425 gene locus_tag LOCUS_13830 46009 46425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 46611 48728 gene locus_tag LOCUS_13840 46611 48728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 48721 49380 gene locus_tag LOCUS_13850 48721 49380 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861037.1 protein_id gnl|my_center|LOCUS_13850 49377 50375 gene locus_tag LOCUS_13860 49377 50375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 50368 50751 gene locus_tag LOCUS_13870 50368 50751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 50748 51149 gene locus_tag LOCUS_13880 50748 51149 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_13880 51150 52232 gene locus_tag LOCUS_13890 51150 52232 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861040.1 protein_id gnl|my_center|LOCUS_13890 52225 52776 gene locus_tag LOCUS_13900 52225 52776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence17 543 34 gene locus_tag LOCUS_13910 543 34 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_13910 875 1162 gene locus_tag LOCUS_13920 875 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1388 2881 gene locus_tag LOCUS_13930 1388 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3016 3768 gene locus_tag LOCUS_13940 3016 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3943 4947 gene locus_tag LOCUS_13950 3943 4947 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258767.1 protein_id gnl|my_center|LOCUS_13950 5013 6788 gene locus_tag LOCUS_13960 gene dnaG 5013 6788 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816339.1 protein_id gnl|my_center|LOCUS_13960 6830 7942 gene locus_tag LOCUS_13970 gene rpoD 6830 7942 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_13970 7951 8691 gene locus_tag LOCUS_13980 7951 8691 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_13980 8751 9533 gene locus_tag LOCUS_13990 8751 9533 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_13990 9551 11206 gene locus_tag LOCUS_14000 9551 11206 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_14000 11751 13115 gene locus_tag LOCUS_14010 11751 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 13611 14843 gene locus_tag LOCUS_14020 gene hemL 13611 14843 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_14020 14840 15451 gene locus_tag LOCUS_14030 14840 15451 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476110.1 protein_id gnl|my_center|LOCUS_14030 16633 15629 gene locus_tag LOCUS_14040 16633 15629 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051408.1 protein_id gnl|my_center|LOCUS_14040 18527 16692 gene locus_tag LOCUS_14050 gene typA 18527 16692 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_14050 18782 19426 gene locus_tag LOCUS_14060 18782 19426 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_14060 19543 20055 gene locus_tag LOCUS_14070 19543 20055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 20514 21404 gene locus_tag LOCUS_14080 gene dapA 20514 21404 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_14080 21563 22057 gene locus_tag LOCUS_14090 21563 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 22081 22428 gene locus_tag LOCUS_14100 22081 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 22553 23314 gene locus_tag LOCUS_14110 gene dapB 22553 23314 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_14110 23346 25331 gene locus_tag LOCUS_14120 23346 25331 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_14120 25885 25436 gene locus_tag LOCUS_14130 25885 25436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 26091 26870 gene locus_tag LOCUS_14140 26091 26870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 27859 26882 gene locus_tag LOCUS_14150 27859 26882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 28226 28026 gene locus_tag LOCUS_14160 gene cspA 28226 28026 CDS product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831260.1 protein_id gnl|my_center|LOCUS_14160 28409 29212 gene locus_tag LOCUS_14170 28409 29212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 29223 29762 gene locus_tag LOCUS_14180 29223 29762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 30114 29812 gene locus_tag LOCUS_14190 30114 29812 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830443.1 protein_id gnl|my_center|LOCUS_14190 30320 30976 gene locus_tag LOCUS_14200 30320 30976 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_14200 30995 32062 gene locus_tag LOCUS_14210 30995 32062 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082691.1 protein_id gnl|my_center|LOCUS_14210 32046 33536 gene locus_tag LOCUS_14220 32046 33536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 33523 35124 gene locus_tag LOCUS_14230 33523 35124 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_14230 35126 36187 gene locus_tag LOCUS_14240 gene xylF 35126 36187 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693436.1 protein_id gnl|my_center|LOCUS_14240 36363 37520 gene locus_tag LOCUS_14250 gene chvE 36363 37520 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 protein_id gnl|my_center|LOCUS_14250 37604 39145 gene locus_tag LOCUS_14260 gene gguA 37604 39145 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535529.1 protein_id gnl|my_center|LOCUS_14260 39149 40327 gene locus_tag LOCUS_14270 gene gguB 39149 40327 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_14270 41101 40484 gene locus_tag LOCUS_14280 41101 40484 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_14280 41443 42501 gene locus_tag LOCUS_14290 41443 42501 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_14290 42674 44158 gene locus_tag LOCUS_14300 42674 44158 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 protein_id gnl|my_center|LOCUS_14300 44184 45191 gene locus_tag LOCUS_14310 44184 45191 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860722.1 protein_id gnl|my_center|LOCUS_14310 45333 46319 gene locus_tag LOCUS_14320 45333 46319 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_14320 46335 47654 gene locus_tag LOCUS_14330 46335 47654 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964763.1 protein_id gnl|my_center|LOCUS_14330 47647 48321 gene locus_tag LOCUS_14340 47647 48321 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964764.1 protein_id gnl|my_center|LOCUS_14340 48318 49631 gene locus_tag LOCUS_14350 48318 49631 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964765.1 protein_id gnl|my_center|LOCUS_14350 49714 50691 gene locus_tag LOCUS_14360 49714 50691 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence18 1847 255 gene locus_tag LOCUS_14370 1847 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3159 1873 gene locus_tag LOCUS_14380 3159 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 4376 3246 gene locus_tag LOCUS_14390 4376 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5102 4395 gene locus_tag LOCUS_14400 5102 4395 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_14400 5321 5488 gene locus_tag LOCUS_14410 5321 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 5523 7241 gene locus_tag LOCUS_14420 5523 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 7284 8726 gene locus_tag LOCUS_14430 gene ccpM 7284 8726 CDS product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 protein_id gnl|my_center|LOCUS_14430 8749 9822 gene locus_tag LOCUS_14440 8749 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 9904 10029 gene locus_tag LOCUS_14450 9904 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 10146 11375 gene locus_tag LOCUS_14460 10146 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 11393 12067 gene locus_tag LOCUS_14470 11393 12067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943050.1 protein_id gnl|my_center|LOCUS_14470 13239 12172 gene locus_tag LOCUS_14480 gene buk 13239 12172 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_14480 14205 13285 gene locus_tag LOCUS_14490 gene ptb 14205 13285 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_14490 15699 14353 gene locus_tag LOCUS_14500 15699 14353 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_14500 15877 16797 gene locus_tag LOCUS_14510 15877 16797 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705688.1 protein_id gnl|my_center|LOCUS_14510 16979 19543 gene locus_tag LOCUS_14520 gene secA 16979 19543 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 protein_id gnl|my_center|LOCUS_14520 19663 20682 gene locus_tag LOCUS_14530 gene prfB 19663 20682 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 protein_id gnl|my_center|LOCUS_14530 20901 23981 gene locus_tag LOCUS_14540 20901 23981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 24541 26292 gene locus_tag LOCUS_14550 gene aspS 24541 26292 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_14550 26321 26614 gene locus_tag LOCUS_14560 gene gatC 26321 26614 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 protein_id gnl|my_center|LOCUS_14560 26626 28089 gene locus_tag LOCUS_14570 gene gatA 26626 28089 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_14570 28090 29541 gene locus_tag LOCUS_14580 gene gatB 28090 29541 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966259.1 protein_id gnl|my_center|LOCUS_14580 29639 30124 gene locus_tag LOCUS_14590 29639 30124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 30204 31658 gene locus_tag LOCUS_14600 gene guaB 30204 31658 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_14600 31746 32888 gene locus_tag LOCUS_14610 31746 32888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 32878 33816 gene locus_tag LOCUS_14620 32878 33816 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840860.1 protein_id gnl|my_center|LOCUS_14620 33827 34750 gene locus_tag LOCUS_14630 33827 34750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 34747 36936 gene locus_tag LOCUS_14640 34747 36936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 36940 37728 gene locus_tag LOCUS_14650 36940 37728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 37725 38519 gene locus_tag LOCUS_14660 37725 38519 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_14660 38763 38527 gene locus_tag LOCUS_14670 38763 38527 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_14670 39003 39392 gene locus_tag LOCUS_14680 39003 39392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 39404 39832 gene locus_tag LOCUS_14690 39404 39832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 40157 40312 gene locus_tag LOCUS_14700 40157 40312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 40396 41553 gene locus_tag LOCUS_14710 40396 41553 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_14710 41553 42620 gene locus_tag LOCUS_14720 41553 42620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 42633 43244 gene locus_tag LOCUS_14730 42633 43244 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_14730 43268 43750 gene locus_tag LOCUS_14740 43268 43750 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386618.1 protein_id gnl|my_center|LOCUS_14740 43883 43959 gene locus_tag LOCUS_t00060 43883 43959 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45007 44165 gene locus_tag LOCUS_14750 45007 44165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 45353 45817 gene locus_tag LOCUS_14760 45353 45817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 45801 47195 gene locus_tag LOCUS_14770 45801 47195 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_14770 47583 47870 gene locus_tag LOCUS_14780 47583 47870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 47932 48002 gene locus_tag LOCUS_t00070 47932 48002 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 48253 48528 gene locus_tag LOCUS_14790 48253 48528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 48637 48713 gene locus_tag LOCUS_t00080 48637 48713 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 789 67 gene locus_tag LOCUS_14800 789 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 2030 786 gene locus_tag LOCUS_14810 gene murA 2030 786 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_14810 3288 2125 gene locus_tag LOCUS_14820 gene spoVE 3288 2125 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_14820 4667 3291 gene locus_tag LOCUS_14830 gene murD 4667 3291 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_14830 5654 4692 gene locus_tag LOCUS_14840 gene mraY 5654 4692 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_14840 7467 5737 gene locus_tag LOCUS_14850 7467 5737 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_14850 9739 7559 gene locus_tag LOCUS_14860 9739 7559 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_14860 10259 9756 gene locus_tag LOCUS_14870 10259 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 11200 10262 gene locus_tag LOCUS_14880 gene rsmH 11200 10262 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_14880 11675 11244 gene locus_tag LOCUS_14890 gene mraZ 11675 11244 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_14890 13993 12029 gene locus_tag LOCUS_14900 gene thrS 13993 12029 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_14900 16114 14024 gene locus_tag LOCUS_14910 gene pnp 16114 14024 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_14910 16532 16266 gene locus_tag LOCUS_14920 gene rpsO 16532 16266 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_14920 17844 16690 gene locus_tag LOCUS_14930 17844 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 18211 17990 gene locus_tag LOCUS_14940 18211 17990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 18845 18255 gene locus_tag LOCUS_14950 18845 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 20134 18827 gene locus_tag LOCUS_14960 20134 18827 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_14960 20832 20134 gene locus_tag LOCUS_14970 gene rgbR 20832 20134 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_14970 22672 21008 gene locus_tag LOCUS_14980 22672 21008 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_14980 23710 22787 gene locus_tag LOCUS_14990 23710 22787 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_14990 24659 23730 gene locus_tag LOCUS_15000 gene truB 24659 23730 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_15000 25615 24656 gene locus_tag LOCUS_15010 25615 24656 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_15010 26044 25655 gene locus_tag LOCUS_15020 gene rbfA 26044 25655 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_15020 28862 26064 gene locus_tag LOCUS_15030 28862 26064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 29191 28883 gene locus_tag LOCUS_15040 29191 28883 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419470.1 protein_id gnl|my_center|LOCUS_15040 29460 29188 gene locus_tag LOCUS_15050 29460 29188 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_15050 30736 29450 gene locus_tag LOCUS_15060 30736 29450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 31228 30767 gene locus_tag LOCUS_15070 31228 30767 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_15070 32298 31402 gene locus_tag LOCUS_15080 32298 31402 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858561.1 protein_id gnl|my_center|LOCUS_15080 33418 32288 gene locus_tag LOCUS_15090 33418 32288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 36041 33540 gene locus_tag LOCUS_15100 36041 33540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 36471 36118 gene locus_tag LOCUS_15110 36471 36118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 37947 36589 gene locus_tag LOCUS_15120 37947 36589 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963447.1 protein_id gnl|my_center|LOCUS_15120 38497 37961 gene locus_tag LOCUS_15130 38497 37961 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_15130 40691 38523 gene locus_tag LOCUS_15140 40691 38523 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_15140 41126 40734 gene locus_tag LOCUS_15150 41126 40734 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_15150 42173 41139 gene locus_tag LOCUS_15160 42173 41139 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_15160 42995 42177 gene locus_tag LOCUS_15170 42995 42177 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963448.1 protein_id gnl|my_center|LOCUS_15170 44080 43019 gene locus_tag LOCUS_15180 44080 43019 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280537.1 protein_id gnl|my_center|LOCUS_15180 45538 44105 gene locus_tag LOCUS_15190 45538 44105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 46708 45617 gene locus_tag LOCUS_15200 46708 45617 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence20 919 428 gene locus_tag LOCUS_15210 919 428 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_15210 1816 920 gene locus_tag LOCUS_15220 1816 920 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_15220 2507 1986 gene locus_tag LOCUS_15230 2507 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2776 2579 gene locus_tag LOCUS_15240 2776 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3202 3807 gene locus_tag LOCUS_15250 3202 3807 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_15250 3877 5139 gene locus_tag LOCUS_15260 3877 5139 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_15260 5156 5467 gene locus_tag LOCUS_15270 5156 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 5485 5763 gene locus_tag LOCUS_15280 5485 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 6708 8153 gene locus_tag LOCUS_15290 6708 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 9132 8179 gene locus_tag LOCUS_15300 9132 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 11249 9129 gene locus_tag LOCUS_15310 gene glgX 11249 9129 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_15310 11448 12089 gene locus_tag LOCUS_15320 gene trmB 11448 12089 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132468.1 protein_id gnl|my_center|LOCUS_15320 12156 12470 gene locus_tag LOCUS_15330 gene trxA 12156 12470 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_15330 12542 13009 gene locus_tag LOCUS_15340 12542 13009 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024441.1 protein_id gnl|my_center|LOCUS_15340 13017 13334 gene locus_tag LOCUS_15350 13017 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 13327 13650 gene locus_tag LOCUS_15360 13327 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 13647 13922 gene locus_tag LOCUS_15370 13647 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 13903 14883 gene locus_tag LOCUS_15380 13903 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 14885 15256 gene locus_tag LOCUS_15390 14885 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 15259 16752 gene locus_tag LOCUS_15400 15259 16752 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_15400 16765 18243 gene locus_tag LOCUS_15410 16765 18243 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_15410 18263 19732 gene locus_tag LOCUS_15420 18263 19732 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_15420 19745 21898 gene locus_tag LOCUS_15430 19745 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 22785 21979 gene locus_tag LOCUS_15440 22785 21979 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963754.1 protein_id gnl|my_center|LOCUS_15440 23882 22863 gene locus_tag LOCUS_15450 23882 22863 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086178.1 protein_id gnl|my_center|LOCUS_15450 24184 25653 gene locus_tag LOCUS_15460 gene xylB 24184 25653 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_15460 25721 26338 gene locus_tag LOCUS_15470 25721 26338 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_15470 26371 27855 gene locus_tag LOCUS_15480 26371 27855 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_15480 28149 29747 gene locus_tag LOCUS_15490 gene fliC 28149 29747 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112503.1 protein_id gnl|my_center|LOCUS_15490 29901 32096 gene locus_tag LOCUS_15500 29901 32096 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987020.1 protein_id gnl|my_center|LOCUS_15500 32231 33628 gene locus_tag LOCUS_15510 32231 33628 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_15510 33640 34749 gene locus_tag LOCUS_15520 33640 34749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938446.1 protein_id gnl|my_center|LOCUS_15520 34850 34775 gene locus_tag LOCUS_t00090 34850 34775 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 34949 35443 gene locus_tag LOCUS_15530 34949 35443 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 protein_id gnl|my_center|LOCUS_15530 35897 35481 gene locus_tag LOCUS_15540 35897 35481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 36050 37681 gene locus_tag LOCUS_15550 36050 37681 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453968.1 protein_id gnl|my_center|LOCUS_15550 37689 38408 gene locus_tag LOCUS_15560 37689 38408 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_15560 38410 39672 gene locus_tag LOCUS_15570 38410 39672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 39798 40154 gene locus_tag LOCUS_15580 39798 40154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 40250 40621 gene locus_tag LOCUS_15590 40250 40621 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_15590 40715 42040 gene locus_tag LOCUS_15600 gene hflX 40715 42040 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_15600 41958 42842 gene locus_tag LOCUS_15610 41958 42842 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_15610 42972 43532 gene locus_tag LOCUS_15620 42972 43532 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_15620 43695 43782 gene locus_tag LOCUS_t00100 43695 43782 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 60 134 gene locus_tag LOCUS_t00110 60 134 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 174 248 gene locus_tag LOCUS_t00120 174 248 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 714 280 gene locus_tag LOCUS_15630 714 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 941 1528 gene locus_tag LOCUS_15640 941 1528 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_15640 1546 2298 gene locus_tag LOCUS_15650 1546 2298 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_15650 2501 4282 gene locus_tag LOCUS_15660 2501 4282 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_15660 4325 4807 gene locus_tag LOCUS_15670 4325 4807 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_15670 4890 6251 gene locus_tag LOCUS_15680 gene speA 4890 6251 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 protein_id gnl|my_center|LOCUS_15680 6244 7656 gene locus_tag LOCUS_15690 gene pyk 6244 7656 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_15690 7666 8253 gene locus_tag LOCUS_15700 gene gmk 7666 8253 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771415.1 protein_id gnl|my_center|LOCUS_15700 8258 8698 gene locus_tag LOCUS_15710 8258 8698 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_15710 8721 9710 gene locus_tag LOCUS_15720 8721 9710 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_15720 9751 10659 gene locus_tag LOCUS_15730 9751 10659 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_15730 10649 11386 gene locus_tag LOCUS_15740 10649 11386 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_15740 11367 12236 gene locus_tag LOCUS_15750 gene rsmI 11367 12236 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_15750 12323 12556 gene locus_tag LOCUS_15760 gene acpP 12323 12556 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_15760 12557 13480 gene locus_tag LOCUS_15770 gene fabK 12557 13480 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048429.1 protein_id gnl|my_center|LOCUS_15770 13602 14516 gene locus_tag LOCUS_15780 gene fabD 13602 14516 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_15780 14597 15337 gene locus_tag LOCUS_15790 gene fabG 14597 15337 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_15790 15377 16615 gene locus_tag LOCUS_15800 gene fabF 15377 16615 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_15800 16652 17089 gene locus_tag LOCUS_15810 gene fabZ 16652 17089 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_15810 17094 18155 gene locus_tag LOCUS_15820 17094 18155 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_15820 18189 19151 gene locus_tag LOCUS_15830 18189 19151 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_15830 19484 20629 gene locus_tag LOCUS_15840 19484 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 20662 24090 gene locus_tag LOCUS_15850 20662 24090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 24191 25075 gene locus_tag LOCUS_15860 24191 25075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 25204 25893 gene locus_tag LOCUS_15870 25204 25893 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_15870 25883 26626 gene locus_tag LOCUS_15880 25883 26626 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_15880 26705 27823 gene locus_tag LOCUS_15890 gene nagA 26705 27823 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_15890 27976 29508 gene locus_tag LOCUS_15900 27976 29508 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_15900 29551 30231 gene locus_tag LOCUS_15910 29551 30231 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_15910 30343 31002 gene locus_tag LOCUS_15920 gene spmA 30343 31002 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398980.1 protein_id gnl|my_center|LOCUS_15920 31230 32420 gene locus_tag LOCUS_15930 31230 32420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 32600 33052 gene locus_tag LOCUS_15940 32600 33052 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_15940 33337 33786 gene locus_tag LOCUS_15950 33337 33786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 33770 34240 gene locus_tag LOCUS_15960 gene ogt 33770 34240 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232502.1 protein_id gnl|my_center|LOCUS_15960 34338 34778 gene locus_tag LOCUS_15970 34338 34778 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_15970 36675 34873 gene locus_tag LOCUS_15980 36675 34873 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_15980 36797 38284 gene locus_tag LOCUS_15990 36797 38284 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_15990 38287 39327 gene locus_tag LOCUS_16000 38287 39327 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_16000 39342 40970 gene locus_tag LOCUS_16010 39342 40970 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_16010 42084 40996 gene locus_tag LOCUS_16020 42084 40996 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102220.1 protein_id gnl|my_center|LOCUS_16020 42281 42559 gene locus_tag LOCUS_16030 42281 42559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 42553 43656 gene locus_tag LOCUS_16040 42553 43656 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877170.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence22 64 1338 gene locus_tag LOCUS_16050 64 1338 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_16050 1335 2453 gene locus_tag LOCUS_16060 gene glgD 1335 2453 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_16060 2479 2754 gene locus_tag LOCUS_16070 gene spoVG 2479 2754 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_16070 2868 3470 gene locus_tag LOCUS_16080 gene pth 2868 3470 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_16080 3445 6969 gene locus_tag LOCUS_16090 gene mfd 3445 6969 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_16090 7115 8851 gene locus_tag LOCUS_16100 7115 8851 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963863.1 protein_id gnl|my_center|LOCUS_16100 8855 10963 gene locus_tag LOCUS_16110 8855 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 11802 11086 gene locus_tag LOCUS_16120 11802 11086 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_16120 11994 12539 gene locus_tag LOCUS_16130 gene spoVT 11994 12539 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_16130 14016 12550 gene locus_tag LOCUS_16140 14016 12550 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_16140 14553 17711 gene locus_tag LOCUS_16150 gene ileS 14553 17711 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_16150 17868 20342 gene locus_tag LOCUS_16160 17868 20342 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_16160 20390 22678 gene locus_tag LOCUS_16170 20390 22678 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_16170 22808 23923 gene locus_tag LOCUS_16180 22808 23923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 24082 24966 gene locus_tag LOCUS_16190 24082 24966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 25012 25893 gene locus_tag LOCUS_16200 25012 25893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 25917 26180 gene locus_tag LOCUS_16210 25917 26180 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_16210 26236 27498 gene locus_tag LOCUS_16220 26236 27498 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943599.1 protein_id gnl|my_center|LOCUS_16220 27597 28931 gene locus_tag LOCUS_16230 27597 28931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 28993 30027 gene locus_tag LOCUS_16240 28993 30027 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_16240 30031 31419 gene locus_tag LOCUS_16250 30031 31419 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_16250 32150 31416 gene locus_tag LOCUS_16260 32150 31416 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616577.1 protein_id gnl|my_center|LOCUS_16260 32367 32828 gene locus_tag LOCUS_16270 32367 32828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 32990 33643 gene locus_tag LOCUS_16280 32990 33643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 33640 34956 gene locus_tag LOCUS_16290 33640 34956 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_16290 34970 35749 gene locus_tag LOCUS_16300 gene pyrK 34970 35749 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 protein_id gnl|my_center|LOCUS_16300 35746 36651 gene locus_tag LOCUS_16310 35746 36651 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_16310 36705 38246 gene locus_tag LOCUS_16320 36705 38246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 39020 38364 gene locus_tag LOCUS_16330 39020 38364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 40082 39114 gene locus_tag LOCUS_16340 40082 39114 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296123.1 protein_id gnl|my_center|LOCUS_16340 41580 40150 gene locus_tag LOCUS_16350 41580 40150 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 protein_id gnl|my_center|LOCUS_16350 42924 41692 gene locus_tag LOCUS_16360 42924 41692 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733138.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence23 814 1812 gene locus_tag LOCUS_16370 814 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1824 2507 gene locus_tag LOCUS_16380 1824 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2528 3340 gene locus_tag LOCUS_16390 gene aroF 2528 3340 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867571.1 protein_id gnl|my_center|LOCUS_16390 3341 3976 gene locus_tag LOCUS_16400 3341 3976 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218129451.1 protein_id gnl|my_center|LOCUS_16400 3990 4493 gene locus_tag LOCUS_16410 3990 4493 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_16410 4480 5640 gene locus_tag LOCUS_16420 4480 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5731 6483 gene locus_tag LOCUS_16430 5731 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6480 6878 gene locus_tag LOCUS_16440 6480 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6889 8436 gene locus_tag LOCUS_16450 6889 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 8457 11657 gene locus_tag LOCUS_16460 8457 11657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 11682 12698 gene locus_tag LOCUS_16470 11682 12698 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_16470 12777 13451 gene locus_tag LOCUS_16480 12777 13451 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770434.1 protein_id gnl|my_center|LOCUS_16480 13448 14317 gene locus_tag LOCUS_16490 13448 14317 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194206.1 protein_id gnl|my_center|LOCUS_16490 14314 15366 gene locus_tag LOCUS_16500 14314 15366 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194087.1 protein_id gnl|my_center|LOCUS_16500 15371 16582 gene locus_tag LOCUS_16510 15371 16582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 16614 17873 gene locus_tag LOCUS_16520 16614 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 17830 19374 gene locus_tag LOCUS_16530 17830 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 19692 19390 gene locus_tag LOCUS_16540 19692 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 19957 22116 gene locus_tag LOCUS_16550 19957 22116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 22194 23903 gene locus_tag LOCUS_16560 22194 23903 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_16560 23906 24658 gene locus_tag LOCUS_16570 23906 24658 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948004.1 protein_id gnl|my_center|LOCUS_16570 24660 26057 gene locus_tag LOCUS_16580 24660 26057 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_16580 26327 26043 gene locus_tag LOCUS_16590 26327 26043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 26549 27160 gene locus_tag LOCUS_16600 26549 27160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 27179 28519 gene locus_tag LOCUS_16610 27179 28519 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_16610 28623 32087 gene locus_tag LOCUS_16620 gene addB 28623 32087 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151864400.1 protein_id gnl|my_center|LOCUS_16620 32089 35892 gene locus_tag LOCUS_16630 gene addA 32089 35892 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_16630 36693 35809 gene locus_tag LOCUS_16640 36693 35809 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_16640 36961 37383 gene locus_tag LOCUS_16650 36961 37383 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384928.1 protein_id gnl|my_center|LOCUS_16650 37752 37519 gene locus_tag LOCUS_16660 37752 37519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 38070 37999 gene locus_tag LOCUS_t00130 38070 37999 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 38299 42072 gene locus_tag LOCUS_16670 38299 42072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence24 169 1509 gene locus_tag LOCUS_16680 169 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2068 1619 gene locus_tag LOCUS_16690 2068 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 3601 2204 gene locus_tag LOCUS_16700 3601 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4312 3617 gene locus_tag LOCUS_16710 4312 3617 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_16710 6025 4343 gene locus_tag LOCUS_16720 6025 4343 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_16720 6805 6266 gene locus_tag LOCUS_16730 6805 6266 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_16730 7843 7007 gene locus_tag LOCUS_16740 7843 7007 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_16740 8727 7858 gene locus_tag LOCUS_16750 8727 7858 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892675.1 protein_id gnl|my_center|LOCUS_16750 9990 8791 gene locus_tag LOCUS_16760 9990 8791 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052235.1 protein_id gnl|my_center|LOCUS_16760 10223 11353 gene locus_tag LOCUS_16770 10223 11353 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_16770 12193 11465 gene locus_tag LOCUS_16780 12193 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 12307 12828 gene locus_tag LOCUS_16790 12307 12828 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_16790 13251 14654 gene locus_tag LOCUS_16800 13251 14654 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216257.1 protein_id gnl|my_center|LOCUS_16800 16654 14759 gene locus_tag LOCUS_16810 16654 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 19013 16647 gene locus_tag LOCUS_16820 19013 16647 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_16820 19792 19214 gene locus_tag LOCUS_16830 19792 19214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 20408 19836 gene locus_tag LOCUS_16840 20408 19836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 22418 20724 gene locus_tag LOCUS_16850 22418 20724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 24249 22621 gene locus_tag LOCUS_16860 24249 22621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459511.1 protein_id gnl|my_center|LOCUS_16860 24601 24353 gene locus_tag LOCUS_16870 24601 24353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 25786 24830 gene locus_tag LOCUS_16880 25786 24830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 27082 25853 gene locus_tag LOCUS_16890 27082 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 28144 27137 gene locus_tag LOCUS_16900 28144 27137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 29570 28158 gene locus_tag LOCUS_16910 29570 28158 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_16910 31312 29735 gene locus_tag LOCUS_16920 gene cls 31312 29735 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_16920 33222 31348 gene locus_tag LOCUS_16930 gene mcpA 33222 31348 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244077.1 protein_id gnl|my_center|LOCUS_16930 35328 33358 gene locus_tag LOCUS_16940 35328 33358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 36461 35475 gene locus_tag LOCUS_16950 36461 35475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 38531 36531 gene locus_tag LOCUS_16960 38531 36531 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_16960 38817 38572 gene locus_tag LOCUS_16970 38817 38572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 39326 38841 gene locus_tag LOCUS_16980 39326 38841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 39767 39525 gene locus_tag LOCUS_16990 39767 39525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16990 40138 39896 gene locus_tag LOCUS_17000 40138 39896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 40440 40583 gene locus_tag LOCUS_17010 40440 40583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 40655 40969 gene locus_tag LOCUS_17020 40655 40969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence25 200 1576 gene locus_tag LOCUS_17030 gene murC 200 1576 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_17030 1875 2933 gene locus_tag LOCUS_17040 1875 2933 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_17040 2956 3912 gene locus_tag LOCUS_17050 2956 3912 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_17050 3922 5106 gene locus_tag LOCUS_17060 3922 5106 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_17060 5475 5951 gene locus_tag LOCUS_17070 5475 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 6392 6063 gene locus_tag LOCUS_17080 6392 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 6717 7208 gene locus_tag LOCUS_17090 6717 7208 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_17090 7404 7219 gene locus_tag LOCUS_17100 7404 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 9874 7340 gene locus_tag LOCUS_17110 9874 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 11047 9878 gene locus_tag LOCUS_17120 11047 9878 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_17120 11360 13084 gene locus_tag LOCUS_17130 11360 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 13590 13183 gene locus_tag LOCUS_17140 13590 13183 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251965.1 protein_id gnl|my_center|LOCUS_17140 14993 13602 gene locus_tag LOCUS_17150 gene atpD 14993 13602 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_17150 15935 15057 gene locus_tag LOCUS_17160 gene atpG 15935 15057 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_17160 17451 15955 gene locus_tag LOCUS_17170 gene atpA 17451 15955 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_17170 18032 17481 gene locus_tag LOCUS_17180 gene atpH 18032 17481 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_17180 18538 18020 gene locus_tag LOCUS_17190 18538 18020 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327528.1 protein_id gnl|my_center|LOCUS_17190 18829 18575 gene locus_tag LOCUS_17200 18829 18575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 19589 18873 gene locus_tag LOCUS_17210 19589 18873 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_17210 20001 19594 gene locus_tag LOCUS_17220 20001 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 20257 19964 gene locus_tag LOCUS_17230 20257 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 20458 20940 gene locus_tag LOCUS_17240 20458 20940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 22142 20979 gene locus_tag LOCUS_17250 22142 20979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 22648 22169 gene locus_tag LOCUS_17260 22648 22169 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_17260 23291 22662 gene locus_tag LOCUS_17270 gene upp 23291 22662 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_17270 23770 23339 gene locus_tag LOCUS_17280 gene rpiB 23770 23339 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_17280 24846 23767 gene locus_tag LOCUS_17290 24846 23767 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_17290 26043 24910 gene locus_tag LOCUS_17300 26043 24910 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964071.1 protein_id gnl|my_center|LOCUS_17300 26877 26044 gene locus_tag LOCUS_17310 26877 26044 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_17310 27942 27226 gene locus_tag LOCUS_17320 gene cwlD 27942 27226 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_17320 29697 28012 gene locus_tag LOCUS_17330 29697 28012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 30142 29927 gene locus_tag LOCUS_17340 30142 29927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 30870 31658 gene locus_tag LOCUS_17350 30870 31658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 31964 31773 gene locus_tag LOCUS_17360 31964 31773 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_17360 32264 34303 gene locus_tag LOCUS_17370 gene pflB 32264 34303 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_17370 34336 34536 gene locus_tag LOCUS_17380 34336 34536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 34590 34832 gene locus_tag LOCUS_17390 34590 34832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 34938 35696 gene locus_tag LOCUS_17400 gene pflA 34938 35696 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 protein_id gnl|my_center|LOCUS_17400 35823 35993 gene locus_tag LOCUS_17410 35823 35993 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_17410 36657 36028 gene locus_tag LOCUS_17420 36657 36028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 38155 36818 gene locus_tag LOCUS_17430 gene dnaB 38155 36818 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_17430 38615 38166 gene locus_tag LOCUS_17440 gene rplI 38615 38166 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_17440 40660 38612 gene locus_tag LOCUS_17450 40660 38612 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence26 151 459 gene locus_tag LOCUS_17460 151 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 646 1572 gene locus_tag LOCUS_17470 646 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1904 2188 gene locus_tag LOCUS_17480 1904 2188 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_17480 2221 3843 gene locus_tag LOCUS_17490 gene groL 2221 3843 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_17490 4405 4614 gene locus_tag LOCUS_17500 4405 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4770 5696 gene locus_tag LOCUS_17510 4770 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5838 6362 gene locus_tag LOCUS_17520 5838 6362 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_17520 6399 8702 gene locus_tag LOCUS_17530 6399 8702 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_17530 8704 9336 gene locus_tag LOCUS_17540 8704 9336 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_17540 9363 10853 gene locus_tag LOCUS_17550 9363 10853 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_17550 10868 11368 gene locus_tag LOCUS_17560 10868 11368 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_17560 12728 11523 gene locus_tag LOCUS_17570 gene coaBC 12728 11523 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_17570 13425 12751 gene locus_tag LOCUS_17580 13425 12751 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356501.1 protein_id gnl|my_center|LOCUS_17580 14487 13609 gene locus_tag LOCUS_17590 14487 13609 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897528.1 protein_id gnl|my_center|LOCUS_17590 14665 16026 gene locus_tag LOCUS_17600 14665 16026 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_17600 16293 18143 gene locus_tag LOCUS_17610 gene recQ 16293 18143 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_17610 18046 18267 gene locus_tag LOCUS_17620 18046 18267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 18267 18845 gene locus_tag LOCUS_17630 18267 18845 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_17630 19359 18838 gene locus_tag LOCUS_17640 19359 18838 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964672.1 protein_id gnl|my_center|LOCUS_17640 19545 20480 gene locus_tag LOCUS_17650 gene fba 19545 20480 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_17650 21060 20557 gene locus_tag LOCUS_17660 21060 20557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 21440 22276 gene locus_tag LOCUS_17670 21440 22276 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 protein_id gnl|my_center|LOCUS_17670 22720 22427 gene locus_tag LOCUS_17680 22720 22427 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221875345.1 protein_id gnl|my_center|LOCUS_17680 23948 22728 gene locus_tag LOCUS_17690 23948 22728 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_17690 24171 25283 gene locus_tag LOCUS_17700 gene argC 24171 25283 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_17700 25339 27324 gene locus_tag LOCUS_17710 25339 27324 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966489.1 protein_id gnl|my_center|LOCUS_17710 27321 27764 gene locus_tag LOCUS_17720 27321 27764 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_17720 27817 29052 gene locus_tag LOCUS_17730 gene argJ 27817 29052 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_17730 29074 29967 gene locus_tag LOCUS_17740 gene argB 29074 29967 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_17740 29964 31160 gene locus_tag LOCUS_17750 29964 31160 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_17750 31185 32462 gene locus_tag LOCUS_17760 31185 32462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 32611 33042 gene locus_tag LOCUS_17770 32611 33042 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_17770 33178 33945 gene locus_tag LOCUS_17780 gene comEA 33178 33945 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 protein_id gnl|my_center|LOCUS_17780 33951 34643 gene locus_tag LOCUS_17790 gene yycF 33951 34643 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_17790 34656 36143 gene locus_tag LOCUS_17800 34656 36143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 36158 37072 gene locus_tag LOCUS_17810 36158 37072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 37069 39354 gene locus_tag LOCUS_17820 37069 39354 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990137.1 protein_id gnl|my_center|LOCUS_17820 39462 40061 gene locus_tag LOCUS_17830 39462 40061 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence27 78 2441 gene locus_tag LOCUS_17840 78 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2482 3078 gene locus_tag LOCUS_17850 2482 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3146 3694 gene locus_tag LOCUS_17860 3146 3694 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809539.1 protein_id gnl|my_center|LOCUS_17860 4374 3751 gene locus_tag LOCUS_17870 4374 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4681 6111 gene locus_tag LOCUS_17880 gene glnA 4681 6111 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_17880 6186 9305 gene locus_tag LOCUS_17890 6186 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 9320 10120 gene locus_tag LOCUS_17900 9320 10120 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_17900 10222 11382 gene locus_tag LOCUS_17910 10222 11382 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_17910 12004 11450 gene locus_tag LOCUS_17920 12004 11450 CDS product manganese efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963648.1 protein_id gnl|my_center|LOCUS_17920 12113 13027 gene locus_tag LOCUS_17930 12113 13027 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364431.1 protein_id gnl|my_center|LOCUS_17930 14660 13053 gene locus_tag LOCUS_17940 14660 13053 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_17940 14887 17088 gene locus_tag LOCUS_17950 gene ftsH 14887 17088 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_17950 17224 19089 gene locus_tag LOCUS_17960 gene uvrC 17224 19089 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_17960 19169 20110 gene locus_tag LOCUS_17970 gene hprK 19169 20110 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_17970 20141 21076 gene locus_tag LOCUS_17980 20141 21076 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_17980 21095 22036 gene locus_tag LOCUS_17990 gene murB 21095 22036 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_17990 22064 22933 gene locus_tag LOCUS_18000 gene rapZ 22064 22933 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_18000 22944 23867 gene locus_tag LOCUS_18010 gene whiA 22944 23867 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_18010 23880 24140 gene locus_tag LOCUS_18020 23880 24140 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_18020 24146 25045 gene locus_tag LOCUS_18030 24146 25045 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_18030 26122 25187 gene locus_tag LOCUS_18040 26122 25187 CDS product auxin efflux carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582699.1 protein_id gnl|my_center|LOCUS_18040 26465 26127 gene locus_tag LOCUS_18050 26465 26127 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909986.1 protein_id gnl|my_center|LOCUS_18050 28242 26680 gene locus_tag LOCUS_18060 gene lsrK 28242 26680 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042875210.1 protein_id gnl|my_center|LOCUS_18060 29195 28269 gene locus_tag LOCUS_18070 29195 28269 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192701.1 protein_id gnl|my_center|LOCUS_18070 29538 31070 gene locus_tag LOCUS_18080 29538 31070 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426491.1 protein_id gnl|my_center|LOCUS_18080 31067 32086 gene locus_tag LOCUS_18090 gene lsrC 31067 32086 CDS product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911130.1 protein_id gnl|my_center|LOCUS_18090 32083 33087 gene locus_tag LOCUS_18100 32083 33087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878507.1 protein_id gnl|my_center|LOCUS_18100 33143 34327 gene locus_tag LOCUS_18110 gene lsrB 33143 34327 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564137.1 protein_id gnl|my_center|LOCUS_18110 34450 35331 gene locus_tag LOCUS_18120 gene lsrF 34450 35331 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_18120 35592 38213 gene locus_tag LOCUS_18130 gene ppdK 35592 38213 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence28 92 358 gene locus_tag LOCUS_18140 92 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 954 436 gene locus_tag LOCUS_18150 gene cobO 954 436 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812021.1 protein_id gnl|my_center|LOCUS_18150 1571 951 gene locus_tag LOCUS_18160 1571 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3493 1568 gene locus_tag LOCUS_18170 3493 1568 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_18170 3728 3507 gene locus_tag LOCUS_18180 3728 3507 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_18180 4226 3861 gene locus_tag LOCUS_18190 4226 3861 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_18190 5461 4487 gene locus_tag LOCUS_18200 5461 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5933 5586 gene locus_tag LOCUS_18210 5933 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6301 5930 gene locus_tag LOCUS_18220 6301 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 6330 6429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7156 6677 gene locus_tag LOCUS_18230 7156 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7922 7134 gene locus_tag LOCUS_18240 gene truA 7922 7134 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_18240 9180 8017 gene locus_tag LOCUS_18250 gene ytvI 9180 8017 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081398.1 protein_id gnl|my_center|LOCUS_18250 9833 9234 gene locus_tag LOCUS_18260 gene yihA 9833 9234 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_18260 12219 9835 gene locus_tag LOCUS_18270 gene lon 12219 9835 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_18270 13534 12281 gene locus_tag LOCUS_18280 gene clpX 13534 12281 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_18280 14146 13556 gene locus_tag LOCUS_18290 gene clpP 14146 13556 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_18290 15496 14204 gene locus_tag LOCUS_18300 gene tig 15496 14204 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_18300 15782 15985 gene locus_tag LOCUS_18310 15782 15985 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_18310 16236 16772 gene locus_tag LOCUS_18320 16236 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 16788 18233 gene locus_tag LOCUS_18330 16788 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 18500 18425 gene locus_tag LOCUS_t00140 18500 18425 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19455 18607 gene locus_tag LOCUS_18340 19455 18607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 20270 19653 gene locus_tag LOCUS_18350 20270 19653 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_18350 23851 20384 gene locus_tag LOCUS_18360 23851 20384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 25666 23921 gene locus_tag LOCUS_18370 25666 23921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 26791 25961 gene locus_tag LOCUS_18380 26791 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 26943 26812 gene locus_tag LOCUS_18390 26943 26812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 29523 26971 gene locus_tag LOCUS_18400 29523 26971 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_18400 29933 29592 gene locus_tag LOCUS_18410 29933 29592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 30193 30903 gene locus_tag LOCUS_18420 30193 30903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 32119 30968 gene locus_tag LOCUS_18430 32119 30968 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_18430 32930 32160 gene locus_tag LOCUS_18440 32930 32160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_18440 33807 32992 gene locus_tag LOCUS_18450 gene cbiQ 33807 32992 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938356.1 protein_id gnl|my_center|LOCUS_18450 34808 33807 gene locus_tag LOCUS_18460 34808 33807 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_18460 36184 34865 gene locus_tag LOCUS_18470 gene larC 36184 34865 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_18470 37064 36186 gene locus_tag LOCUS_18480 gene larE 37064 36186 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_18480 37833 37081 gene locus_tag LOCUS_18490 gene larB 37833 37081 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_18490 38611 37745 gene locus_tag LOCUS_18500 38611 37745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 38838 38751 gene locus_tag LOCUS_t00150 38838 38751 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence29 43 1287 gene locus_tag LOCUS_18510 43 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1474 2298 gene locus_tag LOCUS_18520 gene spoIIGA 1474 2298 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_18520 2295 3035 gene locus_tag LOCUS_18530 gene sigE 2295 3035 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_18530 3147 3926 gene locus_tag LOCUS_18540 gene sigG 3147 3926 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_18540 4080 5177 gene locus_tag LOCUS_18550 4080 5177 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_18550 5234 6136 gene locus_tag LOCUS_18560 5234 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 6149 6790 gene locus_tag LOCUS_18570 6149 6790 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862458.1 protein_id gnl|my_center|LOCUS_18570 6753 6989 gene locus_tag LOCUS_18580 6753 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 7080 7529 gene locus_tag LOCUS_18590 gene nrdR 7080 7529 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_18590 7587 9197 gene locus_tag LOCUS_18600 7587 9197 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_18600 9245 9757 gene locus_tag LOCUS_18610 9245 9757 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_18610 9748 10620 gene locus_tag LOCUS_18620 9748 10620 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_18620 10613 11119 gene locus_tag LOCUS_18630 10613 11119 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350371.1 protein_id gnl|my_center|LOCUS_18630 11116 11568 gene locus_tag LOCUS_18640 gene aroQ 11116 11568 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083137.1 protein_id gnl|my_center|LOCUS_18640 11627 12184 gene locus_tag LOCUS_18650 gene efp 11627 12184 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_18650 12412 13236 gene locus_tag LOCUS_18660 12412 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 13300 13373 gene locus_tag LOCUS_t00160 13300 13373 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13413 14735 gene locus_tag LOCUS_18670 13413 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 14903 15334 gene locus_tag LOCUS_18680 14903 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 15458 16792 gene locus_tag LOCUS_18690 gene gdhA 15458 16792 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_18690 18327 16867 gene locus_tag LOCUS_18700 18327 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 18525 19238 gene locus_tag LOCUS_18710 18525 19238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942799.1 protein_id gnl|my_center|LOCUS_18710 19235 20944 gene locus_tag LOCUS_18720 19235 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 20946 22295 gene locus_tag LOCUS_18730 20946 22295 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_18730 22350 23708 gene locus_tag LOCUS_18740 22350 23708 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068584.1 protein_id gnl|my_center|LOCUS_18740 25833 23824 gene locus_tag LOCUS_18750 25833 23824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 26076 26546 gene locus_tag LOCUS_18760 26076 26546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 26567 27151 gene locus_tag LOCUS_18770 26567 27151 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243967.1 protein_id gnl|my_center|LOCUS_18770 27166 30960 gene locus_tag LOCUS_18780 27166 30960 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_18780 31098 32273 gene locus_tag LOCUS_18790 gene carA 31098 32273 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_18790 32266 35466 gene locus_tag LOCUS_18800 gene carB 32266 35466 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_18800 35546 36244 gene locus_tag LOCUS_18810 35546 36244 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957156.1 protein_id gnl|my_center|LOCUS_18810 36268 38040 gene locus_tag LOCUS_18820 gene argS 36268 38040 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_18820 38156 38229 gene locus_tag LOCUS_t00170 38156 38229 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence30 <1 1091 gene locus_tag LOCUS_18830 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061820.1:sugar ABC transporter ATP-binding protein 1084 2148 gene locus_tag LOCUS_18840 1084 2148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_18840 2145 3164 gene locus_tag LOCUS_18850 gene yjfF 2145 3164 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704198.1 protein_id gnl|my_center|LOCUS_18850 3352 3729 gene locus_tag LOCUS_18860 3352 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 4088 5257 gene locus_tag LOCUS_18870 gene chvE 4088 5257 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287997.1 protein_id gnl|my_center|LOCUS_18870 5385 6944 gene locus_tag LOCUS_18880 gene gguA 5385 6944 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287995.1 protein_id gnl|my_center|LOCUS_18880 6937 8106 gene locus_tag LOCUS_18890 gene gguB 6937 8106 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085994.1 protein_id gnl|my_center|LOCUS_18890 8197 9294 gene locus_tag LOCUS_18900 gene araR 8197 9294 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_18900 9351 10850 gene locus_tag LOCUS_18910 gene araA 9351 10850 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_18910 10873 12480 gene locus_tag LOCUS_18920 10873 12480 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_18920 12618 13316 gene locus_tag LOCUS_18930 12618 13316 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_18930 13379 14233 gene locus_tag LOCUS_18940 13379 14233 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_18940 14233 15177 gene locus_tag LOCUS_18950 14233 15177 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_18950 15191 15853 gene locus_tag LOCUS_18960 gene rpe 15191 15853 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_18960 16095 18059 gene locus_tag LOCUS_18970 gene metG 16095 18059 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_18970 18181 19170 gene locus_tag LOCUS_18980 18181 19170 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_18980 19271 19750 gene locus_tag LOCUS_18990 19271 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 19795 21060 gene locus_tag LOCUS_19000 19795 21060 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073332.1 protein_id gnl|my_center|LOCUS_19000 21057 21710 gene locus_tag LOCUS_19010 21057 21710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 21833 22939 gene locus_tag LOCUS_19020 gene ugpC 21833 22939 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_19020 22948 24036 gene locus_tag LOCUS_19030 22948 24036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 24117 25559 gene locus_tag LOCUS_19040 24117 25559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 26104 25571 gene locus_tag LOCUS_19050 26104 25571 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902956.1 protein_id gnl|my_center|LOCUS_19050 26521 26273 gene locus_tag LOCUS_19060 26521 26273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 26720 27700 gene locus_tag LOCUS_19070 26720 27700 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_19070 27687 28208 gene locus_tag LOCUS_19080 gene tadA 27687 28208 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_19080 28602 29585 gene locus_tag LOCUS_19090 28602 29585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 29617 30156 gene locus_tag LOCUS_19100 29617 30156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 30325 30239 gene locus_tag LOCUS_t00180 30325 30239 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30534 31607 gene locus_tag LOCUS_19110 30534 31607 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_19110 31652 33241 gene locus_tag LOCUS_19120 gene dnaX 31652 33241 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963452.1 protein_id gnl|my_center|LOCUS_19120 33262 33615 gene locus_tag LOCUS_19130 33262 33615 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_19130 33615 34211 gene locus_tag LOCUS_19140 gene recR 33615 34211 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_19140 34225 35259 gene locus_tag LOCUS_19150 34225 35259 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_19150 35430 36146 gene locus_tag LOCUS_19160 35430 36146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 36221 37414 gene locus_tag LOCUS_19170 36221 37414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 37451 37954 gene locus_tag LOCUS_19180 37451 37954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence31 174 1034 gene locus_tag LOCUS_19190 174 1034 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_19190 1172 1984 gene locus_tag LOCUS_19200 1172 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2796 1981 gene locus_tag LOCUS_19210 2796 1981 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_19210 3553 2789 gene locus_tag LOCUS_19220 3553 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4517 3588 gene locus_tag LOCUS_19230 4517 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5657 4578 gene locus_tag LOCUS_19240 5657 4578 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_19240 6503 5703 gene locus_tag LOCUS_19250 6503 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 7461 6496 gene locus_tag LOCUS_19260 gene hemB 7461 6496 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948609.1 protein_id gnl|my_center|LOCUS_19260 9989 7458 gene locus_tag LOCUS_19270 9989 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 10473 9874 gene locus_tag LOCUS_19280 10473 9874 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_19280 11684 10476 gene locus_tag LOCUS_19290 gene hemA 11684 10476 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_19290 13245 11713 gene locus_tag LOCUS_19300 13245 11713 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437727.1 protein_id gnl|my_center|LOCUS_19300 13453 15450 gene locus_tag LOCUS_19310 13453 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 15447 15908 gene locus_tag LOCUS_19320 15447 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 16456 16010 gene locus_tag LOCUS_19330 16456 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 18443 16473 gene locus_tag LOCUS_19340 18443 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 19171 18494 gene locus_tag LOCUS_19350 19171 18494 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_19350 21122 19188 gene locus_tag LOCUS_19360 21122 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 24764 21252 gene locus_tag LOCUS_19370 gene nifJ 24764 21252 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_19370 26499 25066 gene locus_tag LOCUS_19380 gene purB 26499 25066 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_19380 27962 26529 gene locus_tag LOCUS_19390 gene purF 27962 26529 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_19390 28689 27985 gene locus_tag LOCUS_19400 28689 27985 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_19400 28919 29560 gene locus_tag LOCUS_19410 28919 29560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 30083 29724 gene locus_tag LOCUS_19420 30083 29724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 30832 30080 gene locus_tag LOCUS_19430 30832 30080 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_19430 32019 31186 gene locus_tag LOCUS_19440 32019 31186 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_19440 32732 32016 gene locus_tag LOCUS_19450 gene cbiQ 32732 32016 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060748.1 protein_id gnl|my_center|LOCUS_19450 32890 34284 gene locus_tag LOCUS_19460 32890 34284 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 protein_id gnl|my_center|LOCUS_19460 35456 34440 gene locus_tag LOCUS_19470 35456 34440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 35866 35453 gene locus_tag LOCUS_19480 35866 35453 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357842.1 protein_id gnl|my_center|LOCUS_19480 36205 36630 gene locus_tag LOCUS_19490 36205 36630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 36956 36678 gene locus_tag LOCUS_19500 36956 36678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence32 261 431 gene locus_tag LOCUS_19510 261 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 535 462 gene locus_tag LOCUS_t00190 535 462 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 772 702 gene locus_tag LOCUS_t00200 772 702 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1069 2088 gene locus_tag LOCUS_19520 1069 2088 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_19520 2234 3919 gene locus_tag LOCUS_19530 2234 3919 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382333.1 protein_id gnl|my_center|LOCUS_19530 4173 5258 gene locus_tag LOCUS_19540 4173 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 5347 6555 gene locus_tag LOCUS_19550 5347 6555 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_19550 7455 6565 gene locus_tag LOCUS_19560 gene rbsK 7455 6565 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702891.1 protein_id gnl|my_center|LOCUS_19560 8807 7500 gene locus_tag LOCUS_19570 8807 7500 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_19570 9772 8810 gene locus_tag LOCUS_19580 9772 8810 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_19580 12001 9857 gene locus_tag LOCUS_19590 12001 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 14231 12396 gene locus_tag LOCUS_19600 gene ftsH 14231 12396 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_19600 14790 14266 gene locus_tag LOCUS_19610 gene hpt 14790 14266 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_19610 16174 14774 gene locus_tag LOCUS_19620 gene tilS 16174 14774 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_19620 17457 16258 gene locus_tag LOCUS_19630 17457 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 17939 17631 gene locus_tag LOCUS_19640 17939 17631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 18444 17956 gene locus_tag LOCUS_19650 18444 17956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 18787 18452 gene locus_tag LOCUS_19660 18787 18452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 19039 18800 gene locus_tag LOCUS_19670 19039 18800 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567635.1 protein_id gnl|my_center|LOCUS_19670 19421 19146 gene locus_tag LOCUS_19680 gene hbs 19421 19146 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_19680 20264 19524 gene locus_tag LOCUS_19690 20264 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 21781 20225 gene locus_tag LOCUS_19700 21781 20225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 22800 21817 gene locus_tag LOCUS_19710 22800 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 24177 22861 gene locus_tag LOCUS_19720 24177 22861 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_19720 25705 24356 gene locus_tag LOCUS_19730 25705 24356 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_19730 26257 25718 gene locus_tag LOCUS_19740 26257 25718 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_19740 26720 26250 gene locus_tag LOCUS_19750 gene perR 26720 26250 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110007.1 protein_id gnl|my_center|LOCUS_19750 28103 26907 gene locus_tag LOCUS_19760 28103 26907 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438096.1 protein_id gnl|my_center|LOCUS_19760 29584 28151 gene locus_tag LOCUS_19770 gene proS 29584 28151 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_19770 30785 29691 gene locus_tag LOCUS_19780 gene ytvI 30785 29691 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902953.1 protein_id gnl|my_center|LOCUS_19780 31614 30868 gene locus_tag LOCUS_19790 31614 30868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 32089 31604 gene locus_tag LOCUS_19800 32089 31604 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_19800 32464 32105 gene locus_tag LOCUS_19810 32464 32105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 33743 32568 gene locus_tag LOCUS_19820 33743 32568 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228872.1 protein_id gnl|my_center|LOCUS_19820 34536 33799 gene locus_tag LOCUS_19830 34536 33799 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_19830 35330 34791 gene locus_tag LOCUS_19840 35330 34791 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_19840 35865 35473 gene locus_tag LOCUS_19850 35865 35473 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence33 32 1897 gene locus_tag LOCUS_19860 32 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1890 2957 gene locus_tag LOCUS_19870 1890 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3099 4817 gene locus_tag LOCUS_19880 3099 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5108 5350 gene locus_tag LOCUS_19890 5108 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19890 5331 5888 gene locus_tag LOCUS_19900 5331 5888 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263641.1 protein_id gnl|my_center|LOCUS_19900 5958 6830 gene locus_tag LOCUS_19910 5958 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7066 7587 gene locus_tag LOCUS_19920 7066 7587 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_19920 7584 8939 gene locus_tag LOCUS_19930 7584 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 9431 10429 gene locus_tag LOCUS_19940 9431 10429 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389859.1 protein_id gnl|my_center|LOCUS_19940 10466 11377 gene locus_tag LOCUS_19950 10466 11377 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_19950 11343 12116 gene locus_tag LOCUS_19960 11343 12116 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_19960 12620 12234 gene locus_tag LOCUS_19970 12620 12234 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948264.1 protein_id gnl|my_center|LOCUS_19970 13078 12647 gene locus_tag LOCUS_19980 13078 12647 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965941.1 protein_id gnl|my_center|LOCUS_19980 14046 13108 gene locus_tag LOCUS_19990 gene pyrB 14046 13108 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_19990 14670 14128 gene locus_tag LOCUS_20000 14670 14128 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_20000 14795 16135 gene locus_tag LOCUS_20010 14795 16135 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_20010 16546 16142 gene locus_tag LOCUS_20020 16546 16142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 16600 17937 gene locus_tag LOCUS_20030 16600 17937 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_20030 17915 18481 gene locus_tag LOCUS_20040 gene folE 17915 18481 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262832.1 protein_id gnl|my_center|LOCUS_20040 18478 18960 gene locus_tag LOCUS_20050 18478 18960 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_20050 18999 19814 gene locus_tag LOCUS_20060 gene folP 18999 19814 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_20060 19801 20679 gene locus_tag LOCUS_20070 gene folK 19801 20679 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_20070 21795 20767 gene locus_tag LOCUS_20080 21795 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 22070 23206 gene locus_tag LOCUS_20090 gene pheA 22070 23206 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_20090 23255 24562 gene locus_tag LOCUS_20100 23255 24562 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_20100 24568 26106 gene locus_tag LOCUS_20110 24568 26106 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_20110 26109 28259 gene locus_tag LOCUS_20120 26109 28259 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_20120 28263 28886 gene locus_tag LOCUS_20130 28263 28886 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_20130 28883 29533 gene locus_tag LOCUS_20140 28883 29533 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_20140 29581 29841 gene locus_tag LOCUS_20150 29581 29841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 30696 29878 gene locus_tag LOCUS_20160 30696 29878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 31531 30686 gene locus_tag LOCUS_20170 31531 30686 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_20170 33235 31547 gene locus_tag LOCUS_20180 33235 31547 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_20180 33328 33930 gene locus_tag LOCUS_20190 33328 33930 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence34 1284 259 gene locus_tag LOCUS_20200 1284 259 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_20200 1940 1329 gene locus_tag LOCUS_20210 1940 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2117 2191 gene locus_tag LOCUS_t00210 2117 2191 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3147 2254 gene locus_tag LOCUS_20220 gene mscS 3147 2254 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_20220 5608 3179 gene locus_tag LOCUS_20230 gene glgB 5608 3179 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_20230 6929 5691 gene locus_tag LOCUS_20240 6929 5691 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_20240 7144 7422 gene locus_tag LOCUS_20250 7144 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 8696 7533 gene locus_tag LOCUS_20260 8696 7533 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_20260 9778 8696 gene locus_tag LOCUS_20270 gene serC 9778 8696 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_20270 10950 9880 gene locus_tag LOCUS_20280 gene blaCDD 10950 9880 CDS product CDD family class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021358847.1 protein_id gnl|my_center|LOCUS_20280 12833 11160 gene locus_tag LOCUS_20290 gene ilvB 12833 11160 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_20290 14547 12877 gene locus_tag LOCUS_20300 gene ilvD 14547 12877 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_20300 15644 14544 gene locus_tag LOCUS_20310 gene leuB 15644 14544 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_20310 16131 15823 gene locus_tag LOCUS_20320 16131 15823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 17402 16263 gene locus_tag LOCUS_20330 gene tgt 17402 16263 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_20330 18504 17407 gene locus_tag LOCUS_20340 18504 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 18708 19814 gene locus_tag LOCUS_20350 gene aroC 18708 19814 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_20350 21000 19984 gene locus_tag LOCUS_20360 gene ilvC 21000 19984 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_20360 21556 21059 gene locus_tag LOCUS_20370 gene ilvN 21556 21059 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_20370 22193 21717 gene locus_tag LOCUS_20380 gene ilvN 22193 21717 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_20380 23823 22207 gene locus_tag LOCUS_20390 23823 22207 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_20390 26353 23864 gene locus_tag LOCUS_20400 26353 23864 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938876.1 protein_id gnl|my_center|LOCUS_20400 26540 27175 gene locus_tag LOCUS_20410 26540 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 27699 27292 gene locus_tag LOCUS_20420 27699 27292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 27937 27782 gene locus_tag LOCUS_20430 27937 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 28788 28093 gene locus_tag LOCUS_20440 28788 28093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 29538 28903 gene locus_tag LOCUS_20450 29538 28903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 30484 29555 gene locus_tag LOCUS_20460 30484 29555 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965083.1 protein_id gnl|my_center|LOCUS_20460 31522 30584 gene locus_tag LOCUS_20470 31522 30584 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 protein_id gnl|my_center|LOCUS_20470 32565 31546 gene locus_tag LOCUS_20480 32565 31546 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 protein_id gnl|my_center|LOCUS_20480 33315 33605 gene locus_tag LOCUS_20490 33315 33605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20490 >Feature sequence35 187 1446 gene locus_tag LOCUS_20500 187 1446 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_20500 1691 2170 gene locus_tag LOCUS_20510 1691 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2186 2401 gene locus_tag LOCUS_20520 2186 2401 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_20520 2414 4222 gene locus_tag LOCUS_20530 2414 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4500 4928 gene locus_tag LOCUS_20540 4500 4928 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_20540 5181 5429 gene locus_tag LOCUS_20550 5181 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5507 6382 gene locus_tag LOCUS_20560 5507 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_20560 6576 7508 gene locus_tag LOCUS_20570 gene cysK 6576 7508 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_20570 7557 8276 gene locus_tag LOCUS_20580 7557 8276 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_20580 8281 9882 gene locus_tag LOCUS_20590 8281 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 10098 10751 gene locus_tag LOCUS_20600 10098 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 10706 11593 gene locus_tag LOCUS_20610 10706 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 11590 13272 gene locus_tag LOCUS_20620 11590 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 13247 14869 gene locus_tag LOCUS_20630 13247 14869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 14866 16209 gene locus_tag LOCUS_20640 14866 16209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_20640 16278 16961 gene locus_tag LOCUS_20650 16278 16961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 protein_id gnl|my_center|LOCUS_20650 16976 17188 gene locus_tag LOCUS_20660 16976 17188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 17079 17657 gene locus_tag LOCUS_20670 17079 17657 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_20670 17660 18223 gene locus_tag LOCUS_20680 gene dhaS 17660 18223 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204281.1 protein_id gnl|my_center|LOCUS_20680 18271 18549 gene locus_tag LOCUS_20690 18271 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 21459 18649 gene locus_tag LOCUS_20700 21459 18649 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860956.1 protein_id gnl|my_center|LOCUS_20700 21774 22418 gene locus_tag LOCUS_20710 21774 22418 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_20710 22438 23790 gene locus_tag LOCUS_20720 gene mgtE 22438 23790 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_20720 23807 24565 gene locus_tag LOCUS_20730 23807 24565 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_20730 25099 24566 gene locus_tag LOCUS_20740 25099 24566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 25281 26573 gene locus_tag LOCUS_20750 25281 26573 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_20750 26763 27341 gene locus_tag LOCUS_20760 26763 27341 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_20760 27369 28079 gene locus_tag LOCUS_20770 gene bioD 27369 28079 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_20770 28163 29362 gene locus_tag LOCUS_20780 28163 29362 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930773.1 protein_id gnl|my_center|LOCUS_20780 30114 29401 gene locus_tag LOCUS_20790 30114 29401 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475861.1 protein_id gnl|my_center|LOCUS_20790 30281 30883 gene locus_tag LOCUS_20800 30281 30883 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_20800 31031 31735 gene locus_tag LOCUS_20810 31031 31735 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_20810 31844 32572 gene locus_tag LOCUS_20820 gene nagB 31844 32572 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_20820 33207 32704 gene locus_tag LOCUS_20830 33207 32704 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence36 1105 383 gene locus_tag LOCUS_20840 1105 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1305 2801 gene locus_tag LOCUS_20850 gene glpK 1305 2801 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_20850 2807 4342 gene locus_tag LOCUS_20860 2807 4342 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_20860 4339 5610 gene locus_tag LOCUS_20870 4339 5610 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_20870 5617 5982 gene locus_tag LOCUS_20880 5617 5982 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_20880 7088 6057 gene locus_tag LOCUS_20890 7088 6057 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_20890 7354 8730 gene locus_tag LOCUS_20900 7354 8730 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 protein_id gnl|my_center|LOCUS_20900 8792 9664 gene locus_tag LOCUS_20910 8792 9664 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_20910 9664 10524 gene locus_tag LOCUS_20920 9664 10524 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_20920 10614 11939 gene locus_tag LOCUS_20930 10614 11939 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608887.1 protein_id gnl|my_center|LOCUS_20930 11957 14107 gene locus_tag LOCUS_20940 11957 14107 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 protein_id gnl|my_center|LOCUS_20940 14189 14947 gene locus_tag LOCUS_20950 14189 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 15001 16992 gene locus_tag LOCUS_20960 gene ligA 15001 16992 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545963.1 protein_id gnl|my_center|LOCUS_20960 17014 17931 gene locus_tag LOCUS_20970 gene metA 17014 17931 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_20970 18525 17995 gene locus_tag LOCUS_20980 18525 17995 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 protein_id gnl|my_center|LOCUS_20980 18671 19582 gene locus_tag LOCUS_20990 18671 19582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 19647 22751 gene locus_tag LOCUS_21000 19647 22751 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_21000 23076 23002 gene locus_tag LOCUS_t00220 23076 23002 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23189 24574 gene locus_tag LOCUS_21010 gene amrA 23189 24574 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964729.1 protein_id gnl|my_center|LOCUS_21010 24649 25533 gene locus_tag LOCUS_21020 gene amrS 24649 25533 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_21020 29912 25656 gene locus_tag LOCUS_21030 29912 25656 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_21030 30165 31040 gene locus_tag LOCUS_21040 30165 31040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 31088 31843 gene locus_tag LOCUS_21050 31088 31843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 31824 32234 gene locus_tag LOCUS_21060 31824 32234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence37 278 715 gene locus_tag LOCUS_21070 278 715 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_21070 749 2119 gene locus_tag LOCUS_21080 749 2119 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224723.1 protein_id gnl|my_center|LOCUS_21080 3209 2166 gene locus_tag LOCUS_21090 3209 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 3400 5160 gene locus_tag LOCUS_21100 3400 5160 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992302.1 protein_id gnl|my_center|LOCUS_21100 5141 7660 gene locus_tag LOCUS_21110 5141 7660 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_21110 9168 7657 gene locus_tag LOCUS_21120 9168 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 9344 9526 gene locus_tag LOCUS_21130 9344 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 9646 10713 gene locus_tag LOCUS_21140 gene hisC 9646 10713 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949115.1 protein_id gnl|my_center|LOCUS_21140 10731 11231 gene locus_tag LOCUS_21150 10731 11231 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_21150 11291 12070 gene locus_tag LOCUS_21160 11291 12070 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_21160 12063 12947 gene locus_tag LOCUS_21170 gene hslO 12063 12947 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_21170 12944 14857 gene locus_tag LOCUS_21180 12944 14857 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_21180 15371 14904 gene locus_tag LOCUS_21190 15371 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 15703 16545 gene locus_tag LOCUS_21200 15703 16545 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438284.1 protein_id gnl|my_center|LOCUS_21200 16535 17449 gene locus_tag LOCUS_21210 16535 17449 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_21210 17433 17855 gene locus_tag LOCUS_21220 17433 17855 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889078.1 protein_id gnl|my_center|LOCUS_21220 18191 19522 gene locus_tag LOCUS_21230 gene glnA 18191 19522 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393265.1 protein_id gnl|my_center|LOCUS_21230 19573 20118 gene locus_tag LOCUS_21240 19573 20118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 20256 21101 gene locus_tag LOCUS_21250 gene dapF 20256 21101 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_21250 21147 22370 gene locus_tag LOCUS_21260 21147 22370 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_21260 23236 22514 gene locus_tag LOCUS_21270 23236 22514 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579984.1 protein_id gnl|my_center|LOCUS_21270 23712 23260 gene locus_tag LOCUS_21280 23712 23260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 23971 23753 gene locus_tag LOCUS_21290 23971 23753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 24620 26977 gene locus_tag LOCUS_21300 24620 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 27158 27901 gene locus_tag LOCUS_21310 27158 27901 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_21310 27933 28460 gene locus_tag LOCUS_21320 27933 28460 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038821.1 protein_id gnl|my_center|LOCUS_21320 28497 29531 gene locus_tag LOCUS_21330 28497 29531 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_21330 30422 29532 gene locus_tag LOCUS_21340 30422 29532 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_21340 30546 30845 gene locus_tag LOCUS_21350 30546 30845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 30842 31348 gene locus_tag LOCUS_21360 30842 31348 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence38 1009 215 gene locus_tag LOCUS_21370 1009 215 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 protein_id gnl|my_center|LOCUS_21370 1920 1003 gene locus_tag LOCUS_21380 1920 1003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_21380 3108 2065 gene locus_tag LOCUS_21390 3108 2065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_21390 5516 3294 gene locus_tag LOCUS_21400 5516 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 6216 5548 gene locus_tag LOCUS_21410 6216 5548 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_21410 8241 6223 gene locus_tag LOCUS_21420 8241 6223 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_21420 9614 8250 gene locus_tag LOCUS_21430 9614 8250 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867976.1 protein_id gnl|my_center|LOCUS_21430 11366 9627 gene locus_tag LOCUS_21440 11366 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 12482 11391 gene locus_tag LOCUS_21450 gene asd 12482 11391 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_21450 13946 12522 gene locus_tag LOCUS_21460 gene argH 13946 12522 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_21460 14111 14881 gene locus_tag LOCUS_21470 14111 14881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_21470 14871 15683 gene locus_tag LOCUS_21480 14871 15683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_21480 16498 15722 gene locus_tag LOCUS_21490 gene tepA 16498 15722 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139806.1 protein_id gnl|my_center|LOCUS_21490 16619 16482 gene locus_tag LOCUS_21500 16619 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 16834 16661 gene locus_tag LOCUS_21510 16834 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 17754 16855 gene locus_tag LOCUS_21520 17754 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 18528 17800 gene locus_tag LOCUS_21530 18528 17800 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_21530 19487 18567 gene locus_tag LOCUS_21540 19487 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 20412 19546 gene locus_tag LOCUS_21550 20412 19546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 20765 20424 gene locus_tag LOCUS_21560 gene ndoA 20765 20424 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_21560 22021 20804 gene locus_tag LOCUS_21570 gene alr 22021 20804 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_21570 23568 22012 gene locus_tag LOCUS_21580 23568 22012 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_21580 24301 23645 gene locus_tag LOCUS_21590 24301 23645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 24951 24310 gene locus_tag LOCUS_21600 24951 24310 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_21600 25116 27032 gene locus_tag LOCUS_21610 25116 27032 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_21610 28308 27103 gene locus_tag LOCUS_21620 28308 27103 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_21620 29074 28382 gene locus_tag LOCUS_21630 29074 28382 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_21630 30120 29218 gene locus_tag LOCUS_21640 30120 29218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 30305 30487 gene locus_tag LOCUS_21650 30305 30487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 30961 30698 gene locus_tag LOCUS_21660 30961 30698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence39 281 1348 gene locus_tag LOCUS_21670 281 1348 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_21670 1792 1950 gene locus_tag LOCUS_21680 1792 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2613 2026 gene locus_tag LOCUS_21690 2613 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2515 2745 gene locus_tag LOCUS_21700 2515 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2898 3218 gene locus_tag LOCUS_21710 2898 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3663 4553 gene locus_tag LOCUS_21720 3663 4553 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_21720 4758 5534 gene locus_tag LOCUS_21730 4758 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 5674 6927 gene locus_tag LOCUS_21740 5674 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 6955 7953 gene locus_tag LOCUS_21750 6955 7953 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705392.1 protein_id gnl|my_center|LOCUS_21750 8087 8938 gene locus_tag LOCUS_21760 8087 8938 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_21760 11182 8990 gene locus_tag LOCUS_21770 11182 8990 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_21770 11726 11328 gene locus_tag LOCUS_21780 11726 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21780 12167 11751 gene locus_tag LOCUS_21790 12167 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21790 13070 12180 gene locus_tag LOCUS_21800 13070 12180 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_21800 14383 13085 gene locus_tag LOCUS_21810 14383 13085 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804267.1 protein_id gnl|my_center|LOCUS_21810 14720 16630 gene locus_tag LOCUS_21820 14720 16630 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861602.1 protein_id gnl|my_center|LOCUS_21820 16645 17211 gene locus_tag LOCUS_21830 16645 17211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 17269 17577 gene locus_tag LOCUS_21840 17269 17577 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134124.1 protein_id gnl|my_center|LOCUS_21840 17598 17921 gene locus_tag LOCUS_21850 17598 17921 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_21850 17925 19277 gene locus_tag LOCUS_21860 gene celB 17925 19277 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_21860 19346 19870 gene locus_tag LOCUS_21870 19346 19870 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_21870 19952 20974 gene locus_tag LOCUS_21880 19952 20974 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229261.1 protein_id gnl|my_center|LOCUS_21880 20971 22044 gene locus_tag LOCUS_21890 20971 22044 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076673.1 protein_id gnl|my_center|LOCUS_21890 22059 23012 gene locus_tag LOCUS_21900 22059 23012 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_21900 23022 24158 gene locus_tag LOCUS_21910 23022 24158 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860644.1 protein_id gnl|my_center|LOCUS_21910 24155 25243 gene locus_tag LOCUS_21920 24155 25243 CDS product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360357.1 protein_id gnl|my_center|LOCUS_21920 25263 26003 gene locus_tag LOCUS_21930 25263 26003 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_21930 26000 26878 gene locus_tag LOCUS_21940 26000 26878 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364431.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence40 217 14 gene locus_tag LOCUS_21950 217 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 1003 419 gene locus_tag LOCUS_21960 1003 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1226 1038 gene locus_tag LOCUS_21970 1226 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2488 1238 gene locus_tag LOCUS_21980 2488 1238 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_21980 3120 2533 gene locus_tag LOCUS_21990 3120 2533 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924827.1 protein_id gnl|my_center|LOCUS_21990 4032 3163 gene locus_tag LOCUS_22000 gene proB 4032 3163 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_22000 5770 4025 gene locus_tag LOCUS_22010 5770 4025 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_22010 7018 5780 gene locus_tag LOCUS_22020 7018 5780 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_22020 7707 7042 gene locus_tag LOCUS_22030 7707 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 9444 7786 gene locus_tag LOCUS_22040 9444 7786 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_22040 10909 9458 gene locus_tag LOCUS_22050 10909 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 11952 10927 gene locus_tag LOCUS_22060 11952 10927 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_22060 13197 11956 gene locus_tag LOCUS_22070 gene yqfD 13197 11956 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_22070 13524 13210 gene locus_tag LOCUS_22080 13524 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 14773 13580 gene locus_tag LOCUS_22090 14773 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 15459 14902 gene locus_tag LOCUS_22100 15459 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 15795 15490 gene locus_tag LOCUS_22110 15795 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 15954 15823 gene locus_tag LOCUS_22120 15954 15823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 16169 15951 gene locus_tag LOCUS_22130 16169 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 16407 16183 gene locus_tag LOCUS_22140 16407 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 16720 16397 gene locus_tag LOCUS_22150 16720 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 16904 16665 gene locus_tag LOCUS_22160 16904 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 18162 16945 gene locus_tag LOCUS_22170 18162 16945 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_22170 19317 18202 gene locus_tag LOCUS_22180 19317 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 20477 19347 gene locus_tag LOCUS_22190 20477 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201904.1 protein_id gnl|my_center|LOCUS_22190 22293 20470 gene locus_tag LOCUS_22200 22293 20470 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018463.1 protein_id gnl|my_center|LOCUS_22200 23202 22414 gene locus_tag LOCUS_22210 23202 22414 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095898091.1 protein_id gnl|my_center|LOCUS_22210 23515 23231 gene locus_tag LOCUS_22220 23515 23231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 23936 23571 gene locus_tag LOCUS_22230 23936 23571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 24189 23971 gene locus_tag LOCUS_22240 24189 23971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 24391 24182 gene locus_tag LOCUS_22250 24391 24182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 25192 24557 gene locus_tag LOCUS_22260 gene thiE 25192 24557 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_22260 26024 25182 gene locus_tag LOCUS_22270 gene thiD 26024 25182 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_22270 26700 26044 gene locus_tag LOCUS_22280 gene tenA 26700 26044 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864183.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence41 1444 815 gene locus_tag LOCUS_22290 1444 815 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433837.1 protein_id gnl|my_center|LOCUS_22290 1590 1937 gene locus_tag LOCUS_22300 1590 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 3566 2022 gene locus_tag LOCUS_22310 gene guaA 3566 2022 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_22310 4568 3747 gene locus_tag LOCUS_22320 4568 3747 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_22320 5032 4769 gene locus_tag LOCUS_22330 gene spoIIID 5032 4769 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_22330 5414 5262 gene locus_tag LOCUS_22340 5414 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 5703 5473 gene locus_tag LOCUS_22350 5703 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 6149 7540 gene locus_tag LOCUS_22360 gene trkA 6149 7540 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_22360 7558 9027 gene locus_tag LOCUS_22370 7558 9027 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_22370 10562 9147 gene locus_tag LOCUS_22380 10562 9147 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722014.1 protein_id gnl|my_center|LOCUS_22380 11805 10567 gene locus_tag LOCUS_22390 11805 10567 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947929.1 protein_id gnl|my_center|LOCUS_22390 13294 11903 gene locus_tag LOCUS_22400 gene asnS 13294 11903 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_22400 14463 13396 gene locus_tag LOCUS_22410 14463 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 15995 14517 gene locus_tag LOCUS_22420 gene cls 15995 14517 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_22420 16192 16671 gene locus_tag LOCUS_22430 16192 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 18091 16799 gene locus_tag LOCUS_22440 18091 16799 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_22440 18540 18109 gene locus_tag LOCUS_22450 18540 18109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 19369 18551 gene locus_tag LOCUS_22460 gene murI 19369 18551 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_22460 19628 19338 gene locus_tag LOCUS_22470 19628 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 20387 19683 gene locus_tag LOCUS_22480 20387 19683 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_22480 21296 20415 gene locus_tag LOCUS_22490 gene ispE 21296 20415 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_22490 21709 21452 gene locus_tag LOCUS_22500 21709 21452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 22953 21940 gene locus_tag LOCUS_22510 gene mglC 22953 21940 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340252.1 protein_id gnl|my_center|LOCUS_22510 24490 22991 gene locus_tag LOCUS_22520 gene mglA 24490 22991 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 protein_id gnl|my_center|LOCUS_22520 25723 24608 gene locus_tag LOCUS_22530 gene mglB 25723 24608 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence42 85 1584 gene locus_tag LOCUS_22540 85 1584 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_22540 1562 2251 gene locus_tag LOCUS_22550 1562 2251 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_22550 2317 2757 gene locus_tag LOCUS_22560 2317 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2836 3324 gene locus_tag LOCUS_22570 2836 3324 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_22570 3341 4042 gene locus_tag LOCUS_22580 3341 4042 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_22580 5572 4232 gene locus_tag LOCUS_22590 5572 4232 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_22590 5721 6506 gene locus_tag LOCUS_22600 5721 6506 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_22600 7629 6604 gene locus_tag LOCUS_22610 7629 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 8535 7741 gene locus_tag LOCUS_22620 8535 7741 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965895.1 protein_id gnl|my_center|LOCUS_22620 10327 8840 gene locus_tag LOCUS_22630 10327 8840 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_22630 11665 10331 gene locus_tag LOCUS_22640 11665 10331 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_22640 13125 11698 gene locus_tag LOCUS_22650 gene uxaC 13125 11698 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_22650 14834 13200 gene locus_tag LOCUS_22660 14834 13200 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_22660 15932 14865 gene locus_tag LOCUS_22670 gene uxuA 15932 14865 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_22670 16321 15980 gene locus_tag LOCUS_22680 16321 15980 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_22680 17520 16318 gene locus_tag LOCUS_22690 gene tsgA 17520 16318 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215690.1 protein_id gnl|my_center|LOCUS_22690 18570 17536 gene locus_tag LOCUS_22700 18570 17536 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_22700 19383 18598 gene locus_tag LOCUS_22710 19383 18598 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_22710 20869 19373 gene locus_tag LOCUS_22720 20869 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 21461 20982 gene locus_tag LOCUS_22730 21461 20982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 22784 21489 gene locus_tag LOCUS_22740 22784 21489 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_22740 23323 22781 gene locus_tag LOCUS_22750 23323 22781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 24652 23549 gene locus_tag LOCUS_22760 24652 23549 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972787.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence43 124 687 gene locus_tag LOCUS_22770 124 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 692 2674 gene locus_tag LOCUS_22780 692 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2689 5754 gene locus_tag LOCUS_22790 2689 5754 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_22790 5973 8051 gene locus_tag LOCUS_22800 5973 8051 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948168.1 protein_id gnl|my_center|LOCUS_22800 8105 9049 gene locus_tag LOCUS_22810 8105 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 9079 10350 gene locus_tag LOCUS_22820 9079 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 10410 11090 gene locus_tag LOCUS_22830 gene pyrH 10410 11090 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_22830 11106 11657 gene locus_tag LOCUS_22840 gene frr 11106 11657 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_22840 11742 12449 gene locus_tag LOCUS_22850 11742 12449 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_22850 12451 13299 gene locus_tag LOCUS_22860 12451 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 13304 14452 gene locus_tag LOCUS_22870 13304 14452 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_22870 14520 15587 gene locus_tag LOCUS_22880 gene rseP 14520 15587 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_22880 15600 16382 gene locus_tag LOCUS_22890 15600 16382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 16437 17714 gene locus_tag LOCUS_22900 16437 17714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 17761 18816 gene locus_tag LOCUS_22910 gene ispG 17761 18816 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_22910 18820 23388 gene locus_tag LOCUS_22920 gene polC 18820 23388 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_22920 23467 23539 gene locus_tag LOCUS_t00230 23467 23539 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence44 60 770 gene locus_tag LOCUS_22930 60 770 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_22930 772 2091 gene locus_tag LOCUS_22940 772 2091 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861322.1 protein_id gnl|my_center|LOCUS_22940 2179 2700 gene locus_tag LOCUS_22950 2179 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2729 2893 gene locus_tag LOCUS_22960 2729 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3028 5742 gene locus_tag LOCUS_22970 3028 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 5771 7441 gene locus_tag LOCUS_22980 5771 7441 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_22980 7470 8318 gene locus_tag LOCUS_22990 gene folD 7470 8318 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_22990 8337 9755 gene locus_tag LOCUS_23000 8337 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 9833 10723 gene locus_tag LOCUS_23010 9833 10723 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_23010 10723 12108 gene locus_tag LOCUS_23020 gene gltA 10723 12108 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_23020 12193 12864 gene locus_tag LOCUS_23030 12193 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 13113 13592 gene locus_tag LOCUS_23040 gene rlmH 13113 13592 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_23040 13706 14557 gene locus_tag LOCUS_23050 13706 14557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 14573 15256 gene locus_tag LOCUS_23060 14573 15256 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_23060 15520 16413 gene locus_tag LOCUS_23070 15520 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 16458 16667 gene locus_tag LOCUS_23080 16458 16667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 16690 17193 gene locus_tag LOCUS_23090 16690 17193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 17249 17503 gene locus_tag LOCUS_23100 17249 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23100 17809 19413 gene locus_tag LOCUS_23110 17809 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence45 1123 140 gene locus_tag LOCUS_23120 1123 140 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_23120 1652 1125 gene locus_tag LOCUS_23130 gene nrdG 1652 1125 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_23130 3847 1691 gene locus_tag LOCUS_23140 gene nrdD 3847 1691 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 protein_id gnl|my_center|LOCUS_23140 3973 4623 gene locus_tag LOCUS_23150 3973 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 5569 4646 gene locus_tag LOCUS_23160 5569 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 6372 5650 gene locus_tag LOCUS_23170 6372 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 8631 6421 gene locus_tag LOCUS_23180 8631 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 10423 8684 gene locus_tag LOCUS_23190 10423 8684 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_23190 11254 10442 gene locus_tag LOCUS_23200 11254 10442 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_23200 11569 11435 gene locus_tag LOCUS_23210 11569 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 12150 11566 gene locus_tag LOCUS_23220 12150 11566 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439354.1 protein_id gnl|my_center|LOCUS_23220 13534 12473 gene locus_tag LOCUS_23230 13534 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 13946 14413 gene locus_tag LOCUS_23240 13946 14413 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_23240 15141 14686 gene locus_tag LOCUS_23250 15141 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 15610 15134 gene locus_tag LOCUS_23260 15610 15134 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_23260 15825 15625 gene locus_tag LOCUS_23270 15825 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 15901 16503 gene locus_tag LOCUS_23280 15901 16503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 16529 16798 gene locus_tag LOCUS_23290 16529 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 17149 17424 gene locus_tag LOCUS_23300 17149 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23300 18665 17673 gene locus_tag LOCUS_23310 18665 17673 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence46 1436 42 gene locus_tag LOCUS_23320 gene rlmD 1436 42 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_23320 2482 2270 gene locus_tag LOCUS_23330 2482 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2962 2669 gene locus_tag LOCUS_23340 2962 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 5540 3174 gene locus_tag LOCUS_23350 gene pcrA 5540 3174 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_23350 5839 6855 gene locus_tag LOCUS_23360 5839 6855 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_23360 8388 7045 gene locus_tag LOCUS_23370 8388 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 8638 9033 gene locus_tag LOCUS_23380 8638 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 10370 9240 gene locus_tag LOCUS_23390 10370 9240 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989346.1 protein_id gnl|my_center|LOCUS_23390 11888 10599 gene locus_tag LOCUS_23400 11888 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 13390 11891 gene locus_tag LOCUS_23410 13390 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 14345 13383 gene locus_tag LOCUS_23420 14345 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 15411 14410 gene locus_tag LOCUS_23430 gene mglC 15411 14410 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340252.1 protein_id gnl|my_center|LOCUS_23430 16951 15392 gene locus_tag LOCUS_23440 gene mglA 16951 15392 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 protein_id gnl|my_center|LOCUS_23440 18341 17193 gene locus_tag LOCUS_23450 gene mglB 18341 17193 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence47 317 230 gene locus_tag LOCUS_t00240 317 230 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1301 573 gene locus_tag LOCUS_23460 gene ispD 1301 573 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_23460 2323 1301 gene locus_tag LOCUS_23470 gene tsaD 2323 1301 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_23470 2921 2349 gene locus_tag LOCUS_23480 2921 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 3817 2942 gene locus_tag LOCUS_23490 3817 2942 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_23490 4188 3940 gene locus_tag LOCUS_23500 4188 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 4748 4320 gene locus_tag LOCUS_23510 gene rimI 4748 4320 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_23510 5479 4745 gene locus_tag LOCUS_23520 gene tsaB 5479 4745 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_23520 5975 5517 gene locus_tag LOCUS_23530 gene tsaE 5975 5517 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_23530 6448 5969 gene locus_tag LOCUS_23540 6448 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 7096 6614 gene locus_tag LOCUS_23550 7096 6614 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_23550 7439 7200 gene locus_tag LOCUS_23560 7439 7200 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722106.1 protein_id gnl|my_center|LOCUS_23560 7818 7495 gene locus_tag LOCUS_23570 7818 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 8119 8655 gene locus_tag LOCUS_23580 8119 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 8827 9480 gene locus_tag LOCUS_23590 8827 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 10878 9658 gene locus_tag LOCUS_23600 10878 9658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_23600 12388 10889 gene locus_tag LOCUS_23610 12388 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 13255 12530 gene locus_tag LOCUS_23620 13255 12530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_23620 13528 13337 gene locus_tag LOCUS_23630 13528 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 14916 13585 gene locus_tag LOCUS_23640 14916 13585 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_23640 15380 14913 gene locus_tag LOCUS_23650 15380 14913 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390305.1 protein_id gnl|my_center|LOCUS_23650 15968 15537 gene locus_tag LOCUS_23660 15968 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 16786 16148 gene locus_tag LOCUS_23670 16786 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 17178 16795 gene locus_tag LOCUS_23680 17178 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence48 2451 1912 gene locus_tag LOCUS_23690 2451 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3965 3540 gene locus_tag LOCUS_23700 3965 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 4599 4456 gene locus_tag LOCUS_23710 4599 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 6892 4568 gene locus_tag LOCUS_23720 6892 4568 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_23720 7841 7122 gene locus_tag LOCUS_23730 7841 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 7996 8442 gene locus_tag LOCUS_23740 7996 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 8442 9152 gene locus_tag LOCUS_23750 8442 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 10693 9212 gene locus_tag LOCUS_23760 10693 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965677.1 protein_id gnl|my_center|LOCUS_23760 12106 10706 gene locus_tag LOCUS_23770 12106 10706 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_23770 12280 13536 gene locus_tag LOCUS_23780 12280 13536 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097917.1 protein_id gnl|my_center|LOCUS_23780 13967 13698 gene locus_tag LOCUS_23790 13967 13698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 14482 13856 gene locus_tag LOCUS_23800 14482 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 16311 14479 gene locus_tag LOCUS_23810 16311 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23810 16627 16415 gene locus_tag LOCUS_23820 16627 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence49 856 398 gene locus_tag LOCUS_23830 856 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1547 933 gene locus_tag LOCUS_23840 1547 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2611 1610 gene locus_tag LOCUS_23850 2611 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3891 2671 gene locus_tag LOCUS_23860 3891 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 5786 3906 gene locus_tag LOCUS_23870 5786 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 7332 5800 gene locus_tag LOCUS_23880 7332 5800 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082994.1 protein_id gnl|my_center|LOCUS_23880 8162 7338 gene locus_tag LOCUS_23890 8162 7338 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_23890 10754 8478 gene locus_tag LOCUS_23900 10754 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 12538 10751 gene locus_tag LOCUS_23910 12538 10751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_23910 13892 12543 gene locus_tag LOCUS_23920 13892 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 14881 13889 gene locus_tag LOCUS_23930 14881 13889 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_23930 <16203 15040 gene locus_tag LOCUS_23940 <16203 15040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208596.1:lipopolysaccharide biosynthesis protein RfbH >Feature sequence50 331 1368 gene locus_tag LOCUS_23950 331 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 1561 2535 gene locus_tag LOCUS_23960 gene holA 1561 2535 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_23960 2624 3904 gene locus_tag LOCUS_23970 gene hisS 2624 3904 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142552.1 protein_id gnl|my_center|LOCUS_23970 3919 5718 gene locus_tag LOCUS_23980 gene aspS 3919 5718 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_23980 5718 6407 gene locus_tag LOCUS_23990 5718 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 6486 7025 gene locus_tag LOCUS_24000 6486 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 7104 8447 gene locus_tag LOCUS_24010 7104 8447 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_24010 8464 9150 gene locus_tag LOCUS_24020 8464 9150 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_24020 9285 10517 gene locus_tag LOCUS_24030 9285 10517 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_24030 10735 11619 gene locus_tag LOCUS_24040 10735 11619 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_24040 11629 12702 gene locus_tag LOCUS_24050 11629 12702 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_24050 12754 13512 gene locus_tag LOCUS_24060 12754 13512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_24060 13525 14235 gene locus_tag LOCUS_24070 13525 14235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_24070 14258 14878 gene locus_tag LOCUS_24080 14258 14878 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_24080 14879 15616 gene locus_tag LOCUS_24090 14879 15616 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113632.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence51 162 89 gene locus_tag LOCUS_t00250 162 89 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2406 289 gene locus_tag LOCUS_24100 2406 289 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_24100 3822 2596 gene locus_tag LOCUS_24110 3822 2596 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_24110 4477 3836 gene locus_tag LOCUS_24120 4477 3836 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288107.1 protein_id gnl|my_center|LOCUS_24120 4871 4479 gene locus_tag LOCUS_24130 4871 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 5252 4917 gene locus_tag LOCUS_24140 5252 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 6980 5310 gene locus_tag LOCUS_24150 6980 5310 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_24150 7412 7146 gene locus_tag LOCUS_24160 7412 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 7863 7423 gene locus_tag LOCUS_24170 gene ruvX 7863 7423 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_24170 8132 7869 gene locus_tag LOCUS_24180 8132 7869 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_24180 9613 8246 gene locus_tag LOCUS_24190 gene mtaB 9613 8246 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_24190 9716 9946 gene locus_tag LOCUS_24200 9716 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 11308 10034 gene locus_tag LOCUS_24210 gene thiI 11308 10034 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_24210 12468 11311 gene locus_tag LOCUS_24220 12468 11311 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_24220 13251 12505 gene locus_tag LOCUS_24230 13251 12505 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_24230 14242 13256 gene locus_tag LOCUS_24240 gene prmA 14242 13256 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872101.1 protein_id gnl|my_center|LOCUS_24240 14339 14172 gene locus_tag LOCUS_24250 14339 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence52 61 981 gene locus_tag LOCUS_24260 61 981 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_24260 1979 1131 gene locus_tag LOCUS_24270 1979 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2621 2076 gene locus_tag LOCUS_24280 2621 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 3866 2790 gene locus_tag LOCUS_24290 3866 2790 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468109.1 protein_id gnl|my_center|LOCUS_24290 4123 4662 gene locus_tag LOCUS_24300 4123 4662 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_24300 4683 5753 gene locus_tag LOCUS_24310 4683 5753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_24310 5746 6558 gene locus_tag LOCUS_24320 5746 6558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_24320 6555 7334 gene locus_tag LOCUS_24330 6555 7334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_24330 7365 8432 gene locus_tag LOCUS_24340 7365 8432 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_24340 9581 8577 gene locus_tag LOCUS_24350 gene trpS 9581 8577 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_24350 10015 9728 gene locus_tag LOCUS_24360 10015 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 10683 10054 gene locus_tag LOCUS_24370 10683 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 11552 10701 gene locus_tag LOCUS_24380 11552 10701 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_24380 12698 11940 gene locus_tag LOCUS_24390 12698 11940 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_24390 14300 12957 gene locus_tag LOCUS_24400 14300 12957 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence53 1676 2383 gene locus_tag LOCUS_24410 gene rgaR 1676 2383 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_24410 3014 2850 gene locus_tag LOCUS_24420 3014 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3378 3109 gene locus_tag LOCUS_24430 3378 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3957 3745 gene locus_tag LOCUS_24440 3957 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4199 3960 gene locus_tag LOCUS_24450 4199 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4690 4199 gene locus_tag LOCUS_24460 4690 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 6245 4788 gene locus_tag LOCUS_24470 6245 4788 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682237.1 protein_id gnl|my_center|LOCUS_24470 6596 6261 gene locus_tag LOCUS_24480 6596 6261 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018366816.1 protein_id gnl|my_center|LOCUS_24480 6901 6593 gene locus_tag LOCUS_24490 6901 6593 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991611.1 protein_id gnl|my_center|LOCUS_24490 9244 7112 gene locus_tag LOCUS_24500 9244 7112 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_24500 9606 9382 gene locus_tag LOCUS_24510 9606 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681036.1 protein_id gnl|my_center|LOCUS_24510 9866 9606 gene locus_tag LOCUS_24520 9866 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 9949 10048 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11746 10055 gene locus_tag LOCUS_24530 11746 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 13533 11791 gene locus_tag LOCUS_24540 13533 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence54 561 277 gene locus_tag LOCUS_24550 561 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2269 575 gene locus_tag LOCUS_24560 2269 575 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_24560 3698 2343 gene locus_tag LOCUS_24570 3698 2343 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458877.1 protein_id gnl|my_center|LOCUS_24570 4543 3710 gene locus_tag LOCUS_24580 4543 3710 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_24580 5269 4640 gene locus_tag LOCUS_24590 5269 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 7599 5410 gene locus_tag LOCUS_24600 7599 5410 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897225.1 protein_id gnl|my_center|LOCUS_24600 9962 7824 gene locus_tag LOCUS_24610 9962 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 10664 10083 gene locus_tag LOCUS_24620 gene clpP 10664 10083 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 protein_id gnl|my_center|LOCUS_24620 11059 10661 gene locus_tag LOCUS_24630 11059 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 11309 11716 gene locus_tag LOCUS_24640 11309 11716 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121698.1 protein_id gnl|my_center|LOCUS_24640 12591 11848 gene locus_tag LOCUS_24650 12591 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 13318 12638 gene locus_tag LOCUS_24660 13318 12638 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393123.1 protein_id gnl|my_center|LOCUS_24660 13517 13305 gene locus_tag LOCUS_24670 13517 13305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence55 139 309 gene locus_tag LOCUS_24680 139 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24680 1149 565 gene locus_tag LOCUS_24690 1149 565 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642400.1 protein_id gnl|my_center|LOCUS_24690 1338 2213 gene locus_tag LOCUS_24700 1338 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2257 2520 gene locus_tag LOCUS_24710 2257 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2529 2696 gene locus_tag LOCUS_24720 2529 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2923 3120 gene locus_tag LOCUS_24730 2923 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 3262 4494 gene locus_tag LOCUS_24740 3262 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 5388 4477 gene locus_tag LOCUS_24750 5388 4477 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_24750 5584 6528 gene locus_tag LOCUS_24760 5584 6528 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854796.1 protein_id gnl|my_center|LOCUS_24760 6532 6717 gene locus_tag LOCUS_24770 6532 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 6686 6838 gene locus_tag LOCUS_24780 6686 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 6822 7871 gene locus_tag LOCUS_24790 6822 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 7993 8592 gene locus_tag LOCUS_24800 7993 8592 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966771.1 protein_id gnl|my_center|LOCUS_24800 8909 8628 gene locus_tag LOCUS_24810 8909 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 9305 9478 gene locus_tag LOCUS_24820 9305 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 9965 9570 gene locus_tag LOCUS_24830 9965 9570 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417583.1 protein_id gnl|my_center|LOCUS_24830 10346 11323 gene locus_tag LOCUS_24840 10346 11323 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_24840 13493 11460 gene locus_tag LOCUS_24850 13493 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence56 307 867 gene locus_tag LOCUS_24860 307 867 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895666.1 protein_id gnl|my_center|LOCUS_24860 864 1061 gene locus_tag LOCUS_24870 864 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1610 2485 gene locus_tag LOCUS_24880 1610 2485 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_24880 2475 3392 gene locus_tag LOCUS_24890 2475 3392 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_24890 3767 4636 gene locus_tag LOCUS_24900 3767 4636 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912466.1 protein_id gnl|my_center|LOCUS_24900 7153 4631 gene locus_tag LOCUS_24910 7153 4631 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948260.1 protein_id gnl|my_center|LOCUS_24910 7593 7366 gene locus_tag LOCUS_24920 7593 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 8653 7805 gene locus_tag LOCUS_24930 8653 7805 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_24930 9978 8635 gene locus_tag LOCUS_24940 9978 8635 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_24940 10293 10490 gene locus_tag LOCUS_24950 10293 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 11278 10685 gene locus_tag LOCUS_24960 11278 10685 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_24960 11496 12509 gene locus_tag LOCUS_24970 gene asnA 11496 12509 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence57 76 267 gene locus_tag LOCUS_24980 76 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 191 1279 gene locus_tag LOCUS_24990 191 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 1307 2041 gene locus_tag LOCUS_25000 gene ftsE 1307 2041 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_25000 2031 2927 gene locus_tag LOCUS_25010 gene ftsX 2031 2927 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_25010 2941 4167 gene locus_tag LOCUS_25020 2941 4167 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_25020 4209 5429 gene locus_tag LOCUS_25030 4209 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 6689 5505 gene locus_tag LOCUS_25040 6689 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 7871 7038 gene locus_tag LOCUS_25050 7871 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 8599 8090 gene locus_tag LOCUS_25060 8599 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 9846 8602 gene locus_tag LOCUS_25070 9846 8602 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_25070 10562 9888 gene locus_tag LOCUS_25080 10562 9888 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_25080 <12382 10682 gene locus_tag LOCUS_25090 <12382 10682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989383.1:M56 family metallopeptidase >Feature sequence58 970 110 gene locus_tag LOCUS_25100 970 110 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_25100 1201 2739 gene locus_tag LOCUS_25110 gene putP 1201 2739 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_25110 2761 3654 gene locus_tag LOCUS_25120 2761 3654 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_25120 3659 3976 gene locus_tag LOCUS_25130 3659 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3973 4584 gene locus_tag LOCUS_25140 3973 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 4888 5205 gene locus_tag LOCUS_25150 gene rpsJ 4888 5205 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_25150 5266 5949 gene locus_tag LOCUS_25160 gene rplC 5266 5949 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_25160 5977 6597 gene locus_tag LOCUS_25170 gene rplD 5977 6597 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_25170 6597 6896 gene locus_tag LOCUS_25180 gene rplW 6597 6896 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_25180 6964 7806 gene locus_tag LOCUS_25190 gene rplB 6964 7806 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129965.1 protein_id gnl|my_center|LOCUS_25190 7832 8113 gene locus_tag LOCUS_25200 gene rpsS 7832 8113 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 protein_id gnl|my_center|LOCUS_25200 8137 8523 gene locus_tag LOCUS_25210 gene rplV 8137 8523 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894484.1 protein_id gnl|my_center|LOCUS_25210 8535 9194 gene locus_tag LOCUS_25220 gene rpsC 8535 9194 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_25220 9194 9631 gene locus_tag LOCUS_25230 gene rplP 9194 9631 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_25230 9621 9830 gene locus_tag LOCUS_25240 gene rpmC 9621 9830 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_25240 9866 10120 gene locus_tag LOCUS_25250 gene rpsQ 9866 10120 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_25250 10158 10526 gene locus_tag LOCUS_25260 gene rplN 10158 10526 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_25260 10539 10850 gene locus_tag LOCUS_25270 gene rplX 10539 10850 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_25270 10874 11413 gene locus_tag LOCUS_25280 gene rplE 10874 11413 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_25280 11428 11613 gene locus_tag LOCUS_25290 11428 11613 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_25290 11879 12280 gene locus_tag LOCUS_25300 gene rpsH 11879 12280 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence59 640 143 gene locus_tag LOCUS_25310 640 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 801 658 gene locus_tag LOCUS_25320 801 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3094 902 gene locus_tag LOCUS_25330 gene feoB 3094 902 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_25330 3399 3166 gene locus_tag LOCUS_25340 3399 3166 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_25340 3621 3412 gene locus_tag LOCUS_25350 3621 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3807 4175 gene locus_tag LOCUS_25360 3807 4175 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_25360 4240 4875 gene locus_tag LOCUS_25370 4240 4875 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889536.1 protein_id gnl|my_center|LOCUS_25370 5679 4933 gene locus_tag LOCUS_25380 5679 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 6265 5717 gene locus_tag LOCUS_25390 6265 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 7083 6283 gene locus_tag LOCUS_25400 7083 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 7999 7238 gene locus_tag LOCUS_25410 7999 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 8927 8259 gene locus_tag LOCUS_25420 8927 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 10126 9050 gene locus_tag LOCUS_25430 10126 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 10959 10279 gene locus_tag LOCUS_25440 10959 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence60 123 587 gene locus_tag LOCUS_25450 123 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1551 829 gene locus_tag LOCUS_25460 1551 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_25460 3100 1595 gene locus_tag LOCUS_25470 3100 1595 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_25470 4194 3100 gene locus_tag LOCUS_25480 4194 3100 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_25480 4521 6278 gene locus_tag LOCUS_25490 4521 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 6316 7767 gene locus_tag LOCUS_25500 gene purF 6316 7767 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_25500 7980 8567 gene locus_tag LOCUS_25510 7980 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 8597 10096 gene locus_tag LOCUS_25520 8597 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 10236 10802 gene locus_tag LOCUS_25530 10236 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence61 689 342 gene locus_tag LOCUS_25540 689 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1046 708 gene locus_tag LOCUS_25550 1046 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1612 1145 gene locus_tag LOCUS_25560 1612 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25560 2619 1606 gene locus_tag LOCUS_25570 2619 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25570 2840 3745 gene locus_tag LOCUS_25580 2840 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3742 4674 gene locus_tag LOCUS_25590 3742 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 5459 4845 gene locus_tag LOCUS_25600 5459 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 5936 5490 gene locus_tag LOCUS_25610 5936 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 7188 6007 gene locus_tag LOCUS_25620 gene dnaJ 7188 6007 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_25620 9134 7260 gene locus_tag LOCUS_25630 gene dnaK 9134 7260 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_25630 9853 9218 gene locus_tag LOCUS_25640 9853 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 10924 9890 gene locus_tag LOCUS_25650 gene hrcA 10924 9890 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence62 27 1772 gene locus_tag LOCUS_25660 27 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1784 2032 gene locus_tag LOCUS_25670 1784 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2040 2534 gene locus_tag LOCUS_25680 gene infC 2040 2534 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_25680 2590 2787 gene locus_tag LOCUS_25690 gene rpmI 2590 2787 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_25690 2809 3165 gene locus_tag LOCUS_25700 gene rplT 2809 3165 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_25700 4893 3268 gene locus_tag LOCUS_25710 4893 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 4978 5202 gene locus_tag LOCUS_25720 4978 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 5159 5548 gene locus_tag LOCUS_25730 5159 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 5570 6589 gene locus_tag LOCUS_25740 5570 6589 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 protein_id gnl|my_center|LOCUS_25740 6598 7755 gene locus_tag LOCUS_25750 6598 7755 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390161.1 protein_id gnl|my_center|LOCUS_25750 7868 8854 gene locus_tag LOCUS_25760 7868 8854 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_25760 9136 9540 gene locus_tag LOCUS_25770 9136 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 9587 10342 gene locus_tag LOCUS_25780 9587 10342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 10420 10504 gene locus_tag LOCUS_t00260 10420 10504 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10510 10594 gene locus_tag LOCUS_t00270 10510 10594 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence63 249 1703 gene locus_tag LOCUS_25790 249 1703 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_25790 1883 3304 gene locus_tag LOCUS_25800 1883 3304 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_25800 3465 4979 gene locus_tag LOCUS_25810 3465 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 5044 5760 gene locus_tag LOCUS_25820 5044 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 5812 7779 gene locus_tag LOCUS_25830 gene ligA 5812 7779 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_25830 7784 8035 gene locus_tag LOCUS_25840 7784 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 8144 8359 gene locus_tag LOCUS_25850 8144 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 8304 8480 gene locus_tag LOCUS_25860 8304 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 <10663 8960 gene locus_tag LOCUS_25870 <10663 8960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989383.1:M56 family metallopeptidase >Feature sequence64 313 2001 gene locus_tag LOCUS_25880 313 2001 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_25880 3308 2433 gene locus_tag LOCUS_25890 3308 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3786 4700 gene locus_tag LOCUS_25900 3786 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 4848 6518 gene locus_tag LOCUS_25910 4848 6518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948347.1 protein_id gnl|my_center|LOCUS_25910 6622 8181 gene locus_tag LOCUS_25920 6622 8181 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_25920 8274 9203 gene locus_tag LOCUS_25930 8274 9203 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_25930 9331 9534 gene locus_tag LOCUS_25940 9331 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence65 <1 1400 gene locus_tag LOCUS_25950 <1 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000811883.1:phosphorylcholine transferase LicD 1531 3372 gene locus_tag LOCUS_25960 gene ilvB 1531 3372 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816359.1 protein_id gnl|my_center|LOCUS_25960 3382 5994 gene locus_tag LOCUS_25970 3382 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 6036 7154 gene locus_tag LOCUS_25980 gene rfbG 6036 7154 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_25980 7179 7949 gene locus_tag LOCUS_25990 gene rfbF 7179 7949 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107730.1 protein_id gnl|my_center|LOCUS_25990 7960 8733 gene locus_tag LOCUS_26000 gene rfbF 7960 8733 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_26000 8788 9771 gene locus_tag LOCUS_26010 8788 9771 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence66 359 1402 gene locus_tag LOCUS_26020 359 1402 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_26020 1510 2175 gene locus_tag LOCUS_26030 1510 2175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_26030 2192 4759 gene locus_tag LOCUS_26040 2192 4759 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_26040 5743 4811 gene locus_tag LOCUS_26050 5743 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 6122 7450 gene locus_tag LOCUS_26060 6122 7450 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_26060 7479 7781 gene locus_tag LOCUS_26070 7479 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 8406 7804 gene locus_tag LOCUS_26080 8406 7804 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence67 202 633 gene locus_tag LOCUS_26090 202 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 1537 1271 gene locus_tag LOCUS_26100 1537 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1577 1807 gene locus_tag LOCUS_26110 1577 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1804 2082 gene locus_tag LOCUS_26120 1804 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2327 2608 gene locus_tag LOCUS_26130 2327 2608 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_26130 2622 2924 gene locus_tag LOCUS_26140 2622 2924 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646479.1 protein_id gnl|my_center|LOCUS_26140 4218 2944 gene locus_tag LOCUS_26150 4218 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 4967 4257 gene locus_tag LOCUS_26160 4967 4257 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_26160 5309 6046 gene locus_tag LOCUS_26170 5309 6046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895631.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence68 383 718 gene locus_tag LOCUS_26180 383 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1229 885 gene locus_tag LOCUS_26190 1229 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1384 3255 gene locus_tag LOCUS_26200 1384 3255 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272533.1 protein_id gnl|my_center|LOCUS_26200 3259 3852 gene locus_tag LOCUS_26210 3259 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218149482.1 protein_id gnl|my_center|LOCUS_26210 3893 4807 gene locus_tag LOCUS_26220 3893 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460980.1 protein_id gnl|my_center|LOCUS_26220 4809 5690 gene locus_tag LOCUS_26230 4809 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460981.1 protein_id gnl|my_center|LOCUS_26230 5896 6765 gene locus_tag LOCUS_26240 5896 6765 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_26240 6762 7844 gene locus_tag LOCUS_26250 6762 7844 CDS product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence69 1222 146 gene locus_tag LOCUS_26260 1222 146 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_26260 1574 1245 gene locus_tag LOCUS_26270 1574 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1918 1634 gene locus_tag LOCUS_26280 1918 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3636 2305 gene locus_tag LOCUS_26290 3636 2305 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_26290 3778 4596 gene locus_tag LOCUS_26300 3778 4596 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895974.1 protein_id gnl|my_center|LOCUS_26300 5399 4659 gene locus_tag LOCUS_26310 5399 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 6012 5404 gene locus_tag LOCUS_26320 6012 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence70 634 1287 gene locus_tag LOCUS_26330 634 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1470 2075 gene locus_tag LOCUS_26340 1470 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2228 3604 gene locus_tag LOCUS_26350 2228 3604 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_26350 3657 4400 gene locus_tag LOCUS_26360 3657 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 4636 5763 gene locus_tag LOCUS_26370 4636 5763 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966934.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence71 247 2 gene locus_tag LOCUS_26380 247 2 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_26380 520 353 gene locus_tag LOCUS_26390 520 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 810 1301 gene locus_tag LOCUS_26400 810 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 1622 2257 gene locus_tag LOCUS_26410 gene spoVAA 1622 2257 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 protein_id gnl|my_center|LOCUS_26410 2287 2781 gene locus_tag LOCUS_26420 2287 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 2847 3335 gene locus_tag LOCUS_26430 gene spoVAC 2847 3335 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_26430 3813 3912 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4155 4607 gene locus_tag LOCUS_26440 4155 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 4898 5314 gene locus_tag LOCUS_26450 4898 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence72 2409 220 gene locus_tag LOCUS_26460 2409 220 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_26460 3403 2558 gene locus_tag LOCUS_26470 3403 2558 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_26470 4260 3400 gene locus_tag LOCUS_26480 4260 3400 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_26480 5571 4279 gene locus_tag LOCUS_26490 5571 4279 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence73 496 77 gene locus_tag LOCUS_26500 496 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107995.1 protein_id gnl|my_center|LOCUS_26500 1244 618 gene locus_tag LOCUS_26510 1244 618 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_26510 1258 1357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1736 1389 gene locus_tag LOCUS_26520 1736 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272171.1 protein_id gnl|my_center|LOCUS_26520 2281 2000 gene locus_tag LOCUS_26530 2281 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2424 2523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3080 3382 gene locus_tag LOCUS_26540 3080 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 4357 3443 gene locus_tag LOCUS_26550 4357 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence74 317 919 gene locus_tag LOCUS_26560 317 919 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_26560 1051 1938 gene locus_tag LOCUS_26570 1051 1938 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860980.1 protein_id gnl|my_center|LOCUS_26570 3309 1987 gene locus_tag LOCUS_26580 3309 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 4246 3299 gene locus_tag LOCUS_26590 4246 3299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859655.1 protein_id gnl|my_center|LOCUS_26590 4652 5161 gene locus_tag LOCUS_26600 4652 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence75 2775 112 gene locus_tag LOCUS_26610 2775 112 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_26610 3027 3680 gene locus_tag LOCUS_26620 3027 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3677 4150 gene locus_tag LOCUS_26630 3677 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 4275 4613 gene locus_tag LOCUS_26640 4275 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence76 180 109 gene locus_tag LOCUS_t00280 180 109 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 466 299 gene locus_tag LOCUS_26650 466 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1937 618 gene locus_tag LOCUS_26660 1937 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 4532 1953 gene locus_tag LOCUS_26670 4532 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence77 65 808 gene locus_tag LOCUS_26680 65 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1140 1694 gene locus_tag LOCUS_26690 1140 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1993 2769 gene locus_tag LOCUS_26700 1993 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2927 3478 gene locus_tag LOCUS_26710 2927 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 3699 4514 gene locus_tag LOCUS_26720 3699 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence78 797 114 gene locus_tag LOCUS_26730 797 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1723 794 gene locus_tag LOCUS_26740 1723 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 1966 1733 gene locus_tag LOCUS_26750 1966 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 2907 2062 gene locus_tag LOCUS_26760 2907 2062 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_26760 3632 2922 gene locus_tag LOCUS_26770 3632 2922 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393691.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence79 59 247 gene locus_tag LOCUS_26780 59 247 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_26780 327 1955 gene locus_tag LOCUS_26790 gene hcp 327 1955 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966037.1 protein_id gnl|my_center|LOCUS_26790 2154 2489 gene locus_tag LOCUS_26800 2154 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2893 2630 gene locus_tag LOCUS_26810 2893 2630 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272727.1 protein_id gnl|my_center|LOCUS_26810 <3728 2908 gene locus_tag LOCUS_26820 <3728 2908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461989.1:type IV secretory system conjugative DNA transfer family protein >Feature sequence80 352 41 gene locus_tag LOCUS_26830 352 41 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 protein_id gnl|my_center|LOCUS_26830 1044 349 gene locus_tag LOCUS_26840 1044 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 3250 1058 gene locus_tag LOCUS_26850 3250 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1783 1882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence81 1119 91 gene locus_tag LOCUS_26860 1119 91 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_26860 2059 1109 gene locus_tag LOCUS_26870 2059 1109 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_26870 3282 2056 gene locus_tag LOCUS_26880 3282 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence82 1182 145 gene locus_tag LOCUS_26890 1182 145 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_26890 2152 1172 gene locus_tag LOCUS_26900 2152 1172 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_26900 3402 2149 gene locus_tag LOCUS_26910 3402 2149 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188697727.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence83 427 627 gene locus_tag LOCUS_26920 427 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1613 1290 gene locus_tag LOCUS_26930 1613 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2628 1627 gene locus_tag LOCUS_26940 2628 1627 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389115.1 protein_id gnl|my_center|LOCUS_26940 3303 2674 gene locus_tag LOCUS_26950 gene dhaL 3303 2674 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969459.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence84 5 77 gene locus_tag LOCUS_t00290 5 77 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 95 170 gene locus_tag LOCUS_t00300 95 170 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 251 883 gene locus_tag LOCUS_26960 251 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 907 1098 gene locus_tag LOCUS_26970 907 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1113 2474 gene locus_tag LOCUS_26980 1113 2474 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_26980 2667 2751 gene locus_tag LOCUS_t00310 2667 2751 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence85 832 80 gene locus_tag LOCUS_26990 832 80 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072245.1 protein_id gnl|my_center|LOCUS_26990 1544 903 gene locus_tag LOCUS_27000 1544 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1801 2562 gene locus_tag LOCUS_27010 1801 2562 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896901.1 protein_id gnl|my_center|LOCUS_27010 2897 2586 gene locus_tag LOCUS_27020 2897 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence86 2890 1589 gene locus_tag LOCUS_27030 gene miaB 2890 1589 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence87 247 657 gene locus_tag LOCUS_27040 247 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 798 1610 gene locus_tag LOCUS_27050 798 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1643 2713 gene locus_tag LOCUS_27060 1643 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence88 793 53 gene locus_tag LOCUS_27070 793 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2040 955 gene locus_tag LOCUS_27080 2040 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 <2786 2037 gene locus_tag LOCUS_27090 <2786 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964889.1:LytTR family DNA-binding domain-containing protein >Feature sequence89 287 1156 gene locus_tag LOCUS_27100 287 1156 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514171.1 protein_id gnl|my_center|LOCUS_27100 1149 2366 gene locus_tag LOCUS_27110 1149 2366 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence90 1284 1129 gene locus_tag LOCUS_27120 1284 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 1288 1387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2230 1994 gene locus_tag LOCUS_27130 2230 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence91 1645 863 gene locus_tag LOCUS_27140 1645 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2187 1861 gene locus_tag LOCUS_27150 2187 1861 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644759.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence92 375 103 gene locus_tag LOCUS_27160 375 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2306 1068 gene locus_tag LOCUS_27170 2306 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence93 269 1447 gene locus_tag LOCUS_27180 269 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1447 2184 gene locus_tag LOCUS_27190 gene istB 1447 2184 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence94 168 824 gene locus_tag LOCUS_27200 168 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 808 1926 gene locus_tag LOCUS_27210 808 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 >Feature sequence95 262 1632 gene locus_tag LOCUS_27220 262 1632 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399787.1 protein_id gnl|my_center|LOCUS_27220