>Feature sequence001 631 191 gene locus_tag LOCUS_00010 631 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1519 875 gene locus_tag LOCUS_00020 gene can 1519 875 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095021.1 protein_id gnl|my_center|LOCUS_00020 1742 3103 gene locus_tag LOCUS_00030 gene gorA 1742 3103 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463388.1 protein_id gnl|my_center|LOCUS_00030 3443 4030 gene locus_tag LOCUS_00040 gene ectA 3443 4030 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810598.1 protein_id gnl|my_center|LOCUS_00040 4115 5380 gene locus_tag LOCUS_00050 gene ectB 4115 5380 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878029.1 protein_id gnl|my_center|LOCUS_00050 5466 5858 gene locus_tag LOCUS_00060 5466 5858 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 protein_id gnl|my_center|LOCUS_00060 7817 6210 gene locus_tag LOCUS_00070 7817 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9515 8055 gene locus_tag LOCUS_00080 gene lnt 9515 8055 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 protein_id gnl|my_center|LOCUS_00080 9736 12387 gene locus_tag LOCUS_00090 9736 12387 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336989.1 protein_id gnl|my_center|LOCUS_00090 13814 12909 gene locus_tag LOCUS_00100 13814 12909 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_00100 14289 14128 gene locus_tag LOCUS_00110 14289 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15487 14594 gene locus_tag LOCUS_00120 gene cyoE 15487 14594 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971326.1 protein_id gnl|my_center|LOCUS_00120 15824 15495 gene locus_tag LOCUS_00130 15824 15495 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704585.1 protein_id gnl|my_center|LOCUS_00130 16371 15826 gene locus_tag LOCUS_00140 16371 15826 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163525.1 protein_id gnl|my_center|LOCUS_00140 18428 16446 gene locus_tag LOCUS_00150 gene cyoB 18428 16446 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163523.1 protein_id gnl|my_center|LOCUS_00150 19275 18433 gene locus_tag LOCUS_00160 gene cyoA 19275 18433 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239441.1 protein_id gnl|my_center|LOCUS_00160 19896 20339 gene locus_tag LOCUS_00170 gene zur 19896 20339 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_00170 20376 20819 gene locus_tag LOCUS_00180 gene hisI 20376 20819 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_00180 20828 21136 gene locus_tag LOCUS_00190 20828 21136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21558 21130 gene locus_tag LOCUS_00200 21558 21130 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_00200 21736 22707 gene locus_tag LOCUS_00210 21736 22707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 5114 747 gene locus_tag LOCUS_00220 5114 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 7558 5186 gene locus_tag LOCUS_00230 7558 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 9731 7560 gene locus_tag LOCUS_00240 9731 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 10657 9728 gene locus_tag LOCUS_00250 10657 9728 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_00250 11698 10679 gene locus_tag LOCUS_00260 11698 10679 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_00260 12409 11906 gene locus_tag LOCUS_00270 12409 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 >Feature sequence003 1891 404 gene locus_tag LOCUS_00280 1891 404 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_00280 2643 1888 gene locus_tag LOCUS_00290 2643 1888 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706380.1 protein_id gnl|my_center|LOCUS_00290 2914 3702 gene locus_tag LOCUS_00300 2914 3702 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_00300 4236 3703 gene locus_tag LOCUS_00310 4236 3703 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_00310 5634 4291 gene locus_tag LOCUS_00320 5634 4291 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_00320 5910 7961 gene locus_tag LOCUS_00330 gene prlC 5910 7961 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_00330 8029 8286 gene locus_tag LOCUS_00340 8029 8286 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 protein_id gnl|my_center|LOCUS_00340 8982 8320 gene locus_tag LOCUS_00350 8982 8320 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258735.1 protein_id gnl|my_center|LOCUS_00350 9874 9203 gene locus_tag LOCUS_00360 9874 9203 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_00360 10568 10035 gene locus_tag LOCUS_00370 10568 10035 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810321.1 protein_id gnl|my_center|LOCUS_00370 10859 10656 gene locus_tag LOCUS_00380 10859 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 10764 11240 gene locus_tag LOCUS_00390 10764 11240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 >Feature sequence004 1578 3002 gene locus_tag LOCUS_00400 1578 3002 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_00400 3102 4391 gene locus_tag LOCUS_00410 gene gabT 3102 4391 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_00410 4978 4505 gene locus_tag LOCUS_00420 4978 4505 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083750.1 protein_id gnl|my_center|LOCUS_00420 5141 6115 gene locus_tag LOCUS_00430 5141 6115 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090528.1 protein_id gnl|my_center|LOCUS_00430 7802 6282 gene locus_tag LOCUS_00440 7802 6282 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118247.1 protein_id gnl|my_center|LOCUS_00440 7998 8399 gene locus_tag LOCUS_00450 7998 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 9904 8633 gene locus_tag LOCUS_00460 9904 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 >Feature sequence005 549 923 gene locus_tag LOCUS_00470 549 923 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_00470 920 1114 gene locus_tag LOCUS_00480 920 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 1291 2301 gene locus_tag LOCUS_00490 1291 2301 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188723.1 protein_id gnl|my_center|LOCUS_00490 2634 2416 gene locus_tag LOCUS_00500 2634 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 3109 4629 gene locus_tag LOCUS_00510 gene glpD 3109 4629 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035614.1 protein_id gnl|my_center|LOCUS_00510 4827 5555 gene locus_tag LOCUS_00520 4827 5555 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776957.1 protein_id gnl|my_center|LOCUS_00520 5603 7111 gene locus_tag LOCUS_00530 gene glpK 5603 7111 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035612.1 protein_id gnl|my_center|LOCUS_00530 7377 9572 gene locus_tag LOCUS_00540 7377 9572 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_00540 >Feature sequence006 1575 457 gene locus_tag LOCUS_00550 gene plsX 1575 457 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054091481.1 protein_id gnl|my_center|LOCUS_00550 2376 1804 gene locus_tag LOCUS_00560 gene yceD 2376 1804 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174444.1 protein_id gnl|my_center|LOCUS_00560 2470 3063 gene locus_tag LOCUS_00570 2470 3063 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 protein_id gnl|my_center|LOCUS_00570 4115 3051 gene locus_tag LOCUS_00580 gene sppA 4115 3051 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_00580 4909 4232 gene locus_tag LOCUS_00590 4909 4232 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 protein_id gnl|my_center|LOCUS_00590 5873 4926 gene locus_tag LOCUS_00600 gene rluC 5873 4926 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 protein_id gnl|my_center|LOCUS_00600 6665 6904 gene locus_tag LOCUS_00610 6665 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00610 >Feature sequence007 534 1331 gene locus_tag LOCUS_00620 534 1331 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_00620 1319 2098 gene locus_tag LOCUS_00630 1319 2098 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_00630 3098 2040 gene locus_tag LOCUS_00640 3098 2040 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_00640 3245 3496 gene locus_tag LOCUS_00650 3245 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 3802 4026 gene locus_tag LOCUS_00660 3802 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4290 5489 gene locus_tag LOCUS_00670 4290 5489 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_00670 5497 6666 gene locus_tag LOCUS_00680 gene nspC 5497 6666 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_00680 7665 6724 gene locus_tag LOCUS_00690 7665 6724 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085908.1 protein_id gnl|my_center|LOCUS_00690 8110 7679 gene locus_tag LOCUS_00700 8110 7679 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530143.1 protein_id gnl|my_center|LOCUS_00700 8174 8872 gene locus_tag LOCUS_00710 8174 8872 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966301.1 protein_id gnl|my_center|LOCUS_00710 >Feature sequence008 1080 406 gene locus_tag LOCUS_00720 gene pgl 1080 406 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113441.1 protein_id gnl|my_center|LOCUS_00720 2551 1067 gene locus_tag LOCUS_00730 gene zwf 2551 1067 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113442.1 protein_id gnl|my_center|LOCUS_00730 2786 3646 gene locus_tag LOCUS_00740 2786 3646 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552324.1 protein_id gnl|my_center|LOCUS_00740 3779 4633 gene locus_tag LOCUS_00750 3779 4633 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_00750 4639 5793 gene locus_tag LOCUS_00760 4639 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 5798 6940 gene locus_tag LOCUS_00770 5798 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 6937 7524 gene locus_tag LOCUS_00780 6937 7524 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228626.1 protein_id gnl|my_center|LOCUS_00780 7548 7799 gene locus_tag LOCUS_00790 7548 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 7800 8498 gene locus_tag LOCUS_00800 7800 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 >Feature sequence009 196 11 gene locus_tag LOCUS_00810 196 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 195 533 gene locus_tag LOCUS_00820 195 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 1115 1987 gene locus_tag LOCUS_00830 1115 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 2034 2948 gene locus_tag LOCUS_00840 2034 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 3111 3446 gene locus_tag LOCUS_00850 3111 3446 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_00850 3475 4062 gene locus_tag LOCUS_00860 3475 4062 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383793.1 protein_id gnl|my_center|LOCUS_00860 4149 5171 gene locus_tag LOCUS_00870 4149 5171 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 protein_id gnl|my_center|LOCUS_00870 5997 5107 gene locus_tag LOCUS_00880 5997 5107 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262779.1 protein_id gnl|my_center|LOCUS_00880 5996 6484 gene locus_tag LOCUS_00890 5996 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 6693 6535 gene locus_tag LOCUS_00900 6693 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 7148 6894 gene locus_tag LOCUS_00910 7148 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 7461 7784 gene locus_tag LOCUS_00920 7461 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 7908 8105 gene locus_tag LOCUS_00930 7908 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 8175 8546 gene locus_tag LOCUS_00940 8175 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 >Feature sequence010 3033 4115 gene locus_tag LOCUS_00950 3033 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 4155 5975 gene locus_tag LOCUS_00960 gene oadA 4155 5975 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_00960 7527 6064 gene locus_tag LOCUS_00970 gene pyk 7527 6064 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072456.1 protein_id gnl|my_center|LOCUS_00970 7931 7785 gene locus_tag LOCUS_00980 7931 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 >Feature sequence011 341 1549 gene locus_tag LOCUS_00990 gene iscS 341 1549 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860663.1 protein_id gnl|my_center|LOCUS_00990 1594 1920 gene locus_tag LOCUS_01000 gene iscA 1594 1920 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209834.1 protein_id gnl|my_center|LOCUS_01000 2223 2651 gene locus_tag LOCUS_01010 gene ndk 2223 2651 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958107.1 protein_id gnl|my_center|LOCUS_01010 2734 3867 gene locus_tag LOCUS_01020 gene rlmN 2734 3867 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771021.1 protein_id gnl|my_center|LOCUS_01020 4110 4799 gene locus_tag LOCUS_01030 4110 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 4859 5914 gene locus_tag LOCUS_01040 4859 5914 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266909.1 protein_id gnl|my_center|LOCUS_01040 5923 7038 gene locus_tag LOCUS_01050 gene ispG 5923 7038 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_01050 7221 8498 gene locus_tag LOCUS_01060 gene hisS 7221 8498 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence012 360 166 gene locus_tag LOCUS_01070 360 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 2354 450 gene locus_tag LOCUS_01080 gene fabY 2354 450 CDS product beta-ketoacyl-ACP synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114068.1 protein_id gnl|my_center|LOCUS_01080 2811 3587 gene locus_tag LOCUS_01090 2811 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 3600 3929 gene locus_tag LOCUS_01100 3600 3929 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191709.1 protein_id gnl|my_center|LOCUS_01100 4090 5538 gene locus_tag LOCUS_01110 gene dacB 4090 5538 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_01110 5604 6095 gene locus_tag LOCUS_01120 5604 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 6167 6691 gene locus_tag LOCUS_01130 6167 6691 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566468.1 protein_id gnl|my_center|LOCUS_01130 7138 6692 gene locus_tag LOCUS_01140 7138 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 7270 8010 gene locus_tag LOCUS_01150 7270 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence013 <1 677 gene locus_tag LOCUS_01160 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014832758.1:NADH-quinone oxidoreductase subunit L 770 2296 gene locus_tag LOCUS_01170 gene nuoM 770 2296 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071275.1 protein_id gnl|my_center|LOCUS_01170 2293 3750 gene locus_tag LOCUS_01180 gene nuoN 2293 3750 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090482.1 protein_id gnl|my_center|LOCUS_01180 4655 3834 gene locus_tag LOCUS_01190 4655 3834 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_01190 5298 4660 gene locus_tag LOCUS_01200 5298 4660 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763490.1 protein_id gnl|my_center|LOCUS_01200 5636 6253 gene locus_tag LOCUS_01210 gene yihA 5636 6253 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 protein_id gnl|my_center|LOCUS_01210 7326 6589 gene locus_tag LOCUS_01220 7326 6589 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_01220 7827 7339 gene locus_tag LOCUS_01230 7827 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 >Feature sequence014 1912 575 gene locus_tag LOCUS_01240 gene pepP 1912 575 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_01240 2660 2016 gene locus_tag LOCUS_01250 2660 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 2918 3238 gene locus_tag LOCUS_01260 2918 3238 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_01260 3585 3355 gene locus_tag LOCUS_01270 3585 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 3473 4189 gene locus_tag LOCUS_01280 3473 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 6176 4659 gene locus_tag LOCUS_01290 gene ilvA 6176 4659 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_01290 6364 7035 gene locus_tag LOCUS_01300 gene rpiA 6364 7035 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 protein_id gnl|my_center|LOCUS_01300 7377 7808 gene locus_tag LOCUS_01310 7377 7808 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460159.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence015 2155 683 gene locus_tag LOCUS_01320 2155 683 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114563.1 protein_id gnl|my_center|LOCUS_01320 3062 2274 gene locus_tag LOCUS_01330 3062 2274 CDS product protein bax inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830204.1 protein_id gnl|my_center|LOCUS_01330 5233 3335 gene locus_tag LOCUS_01340 gene htpG 5233 3335 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769616.1 protein_id gnl|my_center|LOCUS_01340 5662 5327 gene locus_tag LOCUS_01350 5662 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 6014 7978 gene locus_tag LOCUS_01360 6014 7978 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence016 1579 1310 gene locus_tag LOCUS_01370 gene rpsO 1579 1310 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095184.1 protein_id gnl|my_center|LOCUS_01370 2660 1728 gene locus_tag LOCUS_01380 gene truB 2660 1728 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_01380 3097 2660 gene locus_tag LOCUS_01390 gene rbfA 3097 2660 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_01390 5693 3165 gene locus_tag LOCUS_01400 gene infB 5693 3165 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 protein_id gnl|my_center|LOCUS_01400 7214 5721 gene locus_tag LOCUS_01410 gene nusA 7214 5721 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_01410 7782 7321 gene locus_tag LOCUS_01420 gene rimP 7782 7321 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence017 552 1718 gene locus_tag LOCUS_01430 552 1718 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767816.1 protein_id gnl|my_center|LOCUS_01430 2085 3335 gene locus_tag LOCUS_01440 gene serA 2085 3335 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_01440 3612 3433 gene locus_tag LOCUS_01450 3612 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5895 3769 gene locus_tag LOCUS_01460 gene pqqU 5895 3769 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 protein_id gnl|my_center|LOCUS_01460 6139 6936 gene locus_tag LOCUS_01470 6139 6936 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479969.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence018 385 116 gene locus_tag LOCUS_01480 385 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 284 1048 gene locus_tag LOCUS_01490 gene sfsA 284 1048 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071164.1 protein_id gnl|my_center|LOCUS_01490 1641 1045 gene locus_tag LOCUS_01500 gene metW 1641 1045 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_01500 2798 1641 gene locus_tag LOCUS_01510 2798 1641 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621066.1 protein_id gnl|my_center|LOCUS_01510 3554 2964 gene locus_tag LOCUS_01520 3554 2964 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_01520 4407 3568 gene locus_tag LOCUS_01530 gene proC 4407 3568 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769432.1 protein_id gnl|my_center|LOCUS_01530 5159 4464 gene locus_tag LOCUS_01540 5159 4464 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_01540 5215 6249 gene locus_tag LOCUS_01550 gene pilT 5215 6249 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_01550 6218 7180 gene locus_tag LOCUS_01560 gene pilU 6218 7180 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_01560 >Feature sequence019 1170 142 gene locus_tag LOCUS_01570 gene cgtA 1170 142 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957543.1 protein_id gnl|my_center|LOCUS_01570 1536 1279 gene locus_tag LOCUS_01580 gene rpmA 1536 1279 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940599.1 protein_id gnl|my_center|LOCUS_01580 1880 1569 gene locus_tag LOCUS_01590 gene rplU 1880 1569 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_01590 2176 3168 gene locus_tag LOCUS_01600 2176 3168 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_01600 3262 3338 gene locus_tag LOCUS_t00010 3262 3338 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3613 3960 gene locus_tag LOCUS_01610 3613 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 4257 5165 gene locus_tag LOCUS_01620 4257 5165 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_01620 5250 6098 gene locus_tag LOCUS_01630 5250 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence020 1533 490 gene locus_tag LOCUS_01640 1533 490 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402385.1 protein_id gnl|my_center|LOCUS_01640 1884 3560 gene locus_tag LOCUS_01650 1884 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 3887 5302 gene locus_tag LOCUS_01660 3887 5302 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015600258.1 protein_id gnl|my_center|LOCUS_01660 5621 5382 gene locus_tag LOCUS_01670 5621 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 6353 5724 gene locus_tag LOCUS_01680 6353 5724 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525148.1 protein_id gnl|my_center|LOCUS_01680 <7026 6366 gene locus_tag LOCUS_01690 <7026 6366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958575.1:phospholipase/carboxylesterase >Feature sequence021 203 976 gene locus_tag LOCUS_01700 203 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 3220 1001 gene locus_tag LOCUS_01710 gene yccS 3220 1001 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113274.1 protein_id gnl|my_center|LOCUS_01710 3572 4603 gene locus_tag LOCUS_01720 3572 4603 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_01720 4629 5513 gene locus_tag LOCUS_01730 4629 5513 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_01730 6406 5510 gene locus_tag LOCUS_01740 6406 5510 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266143.1 protein_id gnl|my_center|LOCUS_01740 >Feature sequence022 1511 126 gene locus_tag LOCUS_01750 1511 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1751 2605 gene locus_tag LOCUS_01760 gene rsmI 1751 2605 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_01760 3152 4153 gene locus_tag LOCUS_01770 gene rsmH 3152 4153 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_01770 4162 4494 gene locus_tag LOCUS_01780 4162 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 4491 6221 gene locus_tag LOCUS_01790 gene ftsI 4491 6221 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence023 <1 960 gene locus_tag LOCUS_01800 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889263.1:NAD-dependent succinate-semialdehyde dehydrogenase 960 2546 gene locus_tag LOCUS_01810 960 2546 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027970.1 protein_id gnl|my_center|LOCUS_01810 2624 3343 gene locus_tag LOCUS_01820 2624 3343 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970447.1 protein_id gnl|my_center|LOCUS_01820 3953 3348 gene locus_tag LOCUS_01830 3953 3348 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249790.1 protein_id gnl|my_center|LOCUS_01830 4541 3978 gene locus_tag LOCUS_01840 4541 3978 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973277.1 protein_id gnl|my_center|LOCUS_01840 4591 5223 gene locus_tag LOCUS_01850 4591 5223 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_01850 5325 6317 gene locus_tag LOCUS_01860 5325 6317 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388524.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence024 <1 893 gene locus_tag LOCUS_01870 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189169.1:NCS2 family permease 1542 1273 gene locus_tag LOCUS_01880 1542 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3575 1539 gene locus_tag LOCUS_01890 gene ligA 3575 1539 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443716.1 protein_id gnl|my_center|LOCUS_01890 4982 3741 gene locus_tag LOCUS_01900 4982 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 <6744 5190 gene locus_tag LOCUS_01910 <6744 5190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114676.1:chromosome segregation protein SMC >Feature sequence025 3045 1132 gene locus_tag LOCUS_01920 3045 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 3270 5090 gene locus_tag LOCUS_01930 3270 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6469 5150 gene locus_tag LOCUS_01940 6469 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence026 942 103 gene locus_tag LOCUS_01950 942 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1268 1495 gene locus_tag LOCUS_01960 1268 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 2191 1529 gene locus_tag LOCUS_01970 2191 1529 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 protein_id gnl|my_center|LOCUS_01970 2458 3234 gene locus_tag LOCUS_01980 2458 3234 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390684.1 protein_id gnl|my_center|LOCUS_01980 3291 4664 gene locus_tag LOCUS_01990 3291 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 5516 4755 gene locus_tag LOCUS_02000 gene madM 5516 4755 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 protein_id gnl|my_center|LOCUS_02000 5932 5531 gene locus_tag LOCUS_02010 gene madL 5932 5531 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_02010 <6602 6078 gene locus_tag LOCUS_02020 <6602 6078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243929.1:malonyl-CoA synthase >Feature sequence027 <1 509 gene locus_tag LOCUS_02030 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266803.1:molybdopterin synthase catalytic subunit MoaE 506 1495 gene locus_tag LOCUS_02040 gene moaA 506 1495 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317890.1 protein_id gnl|my_center|LOCUS_02040 1656 1946 gene locus_tag LOCUS_02050 1656 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4003 2315 gene locus_tag LOCUS_02060 4003 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4267 5115 gene locus_tag LOCUS_02070 gene purU 4267 5115 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_02070 5283 6281 gene locus_tag LOCUS_02080 5283 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence028 1278 799 gene locus_tag LOCUS_02090 1278 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 1917 1309 gene locus_tag LOCUS_02100 1917 1309 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_02100 2134 1970 gene locus_tag LOCUS_02110 2134 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 2445 3314 gene locus_tag LOCUS_02120 gene eamA 2445 3314 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096629.1 protein_id gnl|my_center|LOCUS_02120 3311 3769 gene locus_tag LOCUS_02130 3311 3769 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 protein_id gnl|my_center|LOCUS_02130 4657 3782 gene locus_tag LOCUS_02140 4657 3782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_02140 5763 4654 gene locus_tag LOCUS_02150 5763 4654 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226863.1 protein_id gnl|my_center|LOCUS_02150 <6556 5770 gene locus_tag LOCUS_02160 <6556 5770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082397.1:iron chelate uptake ABC transporter family permease subunit >Feature sequence029 3363 1033 gene locus_tag LOCUS_02170 3363 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 5782 3461 gene locus_tag LOCUS_02180 5782 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence030 1407 2408 gene locus_tag LOCUS_02190 gene gap 1407 2408 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114837.1 protein_id gnl|my_center|LOCUS_02190 2761 3078 gene locus_tag LOCUS_02200 2761 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 3143 4450 gene locus_tag LOCUS_02210 3143 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 4518 5321 gene locus_tag LOCUS_02220 4518 5321 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_02220 6160 5447 gene locus_tag LOCUS_02230 6160 5447 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_02230 >Feature sequence031 <1 1301 gene locus_tag LOCUS_02240 <1 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970164.1:DNA ligase D 1346 2119 gene locus_tag LOCUS_02250 1346 2119 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104573.1 protein_id gnl|my_center|LOCUS_02250 2112 3347 gene locus_tag LOCUS_02260 2112 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 3850 5532 gene locus_tag LOCUS_02270 3850 5532 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535875.1 protein_id gnl|my_center|LOCUS_02270 <6413 5608 gene locus_tag LOCUS_02280 <6413 5608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816923.1:glucoamylase family protein >Feature sequence032 <1 793 gene locus_tag LOCUS_02290 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268227.1:AGE family epimerase/isomerase 981 2639 gene locus_tag LOCUS_02300 gene treA 981 2639 CDS product alpha,alpha-trehalase TreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053678.1 protein_id gnl|my_center|LOCUS_02300 4948 2813 gene locus_tag LOCUS_02310 4948 2813 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339292.1 protein_id gnl|my_center|LOCUS_02310 6148 5165 gene locus_tag LOCUS_02320 6148 5165 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170959.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence033 2468 810 gene locus_tag LOCUS_02330 2468 810 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_02330 3333 2608 gene locus_tag LOCUS_02340 3333 2608 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216474.1 protein_id gnl|my_center|LOCUS_02340 4775 3468 gene locus_tag LOCUS_02350 4775 3468 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197818.1 protein_id gnl|my_center|LOCUS_02350 5053 6273 gene locus_tag LOCUS_02360 5053 6273 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777090.1 protein_id gnl|my_center|LOCUS_02360 >Feature sequence034 1655 309 gene locus_tag LOCUS_02370 gene mgtE 1655 309 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 protein_id gnl|my_center|LOCUS_02370 2033 1764 gene locus_tag LOCUS_02380 2033 1764 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 protein_id gnl|my_center|LOCUS_02380 2976 2020 gene locus_tag LOCUS_02390 gene rapZ 2976 2020 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_02390 3476 2994 gene locus_tag LOCUS_02400 gene ptsN 3476 2994 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_02400 3791 3483 gene locus_tag LOCUS_02410 gene raiA 3791 3483 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_02410 5356 3923 gene locus_tag LOCUS_02420 5356 3923 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_02420 <6278 5506 gene locus_tag LOCUS_02430 <6278 5506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005620338.1:LPS export ABC transporter ATP-binding protein >Feature sequence035 525 2435 gene locus_tag LOCUS_02440 gene speA 525 2435 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071982.1 protein_id gnl|my_center|LOCUS_02440 3253 2591 gene locus_tag LOCUS_02450 3253 2591 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 protein_id gnl|my_center|LOCUS_02450 4417 3467 gene locus_tag LOCUS_02460 gene thpD 4417 3467 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804195.1 protein_id gnl|my_center|LOCUS_02460 4815 5048 gene locus_tag LOCUS_02470 4815 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 5387 5082 gene locus_tag LOCUS_02480 5387 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 6061 5525 gene locus_tag LOCUS_02490 6061 5525 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence036 <1 1353 gene locus_tag LOCUS_02500 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001562609.1:glucans biosynthesis protein MdoG 1459 3354 gene locus_tag LOCUS_02510 gene mrdA 1459 3354 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_02510 3344 4486 gene locus_tag LOCUS_02520 gene mrdB 3344 4486 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_02520 4522 5568 gene locus_tag LOCUS_02530 gene mltB 4522 5568 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_02530 >Feature sequence037 1363 398 gene locus_tag LOCUS_02540 1363 398 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389119.1 protein_id gnl|my_center|LOCUS_02540 2256 1795 gene locus_tag LOCUS_02550 gene rpiB 2256 1795 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187340.1 protein_id gnl|my_center|LOCUS_02550 2603 4327 gene locus_tag LOCUS_02560 2603 4327 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 protein_id gnl|my_center|LOCUS_02560 4397 5164 gene locus_tag LOCUS_02570 4397 5164 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027216.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence038 877 260 gene locus_tag LOCUS_02580 877 260 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388391.1 protein_id gnl|my_center|LOCUS_02580 2706 889 gene locus_tag LOCUS_02590 2706 889 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 protein_id gnl|my_center|LOCUS_02590 3426 3686 gene locus_tag LOCUS_02600 3426 3686 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_02600 3693 5507 gene locus_tag LOCUS_02610 3693 5507 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_02610 >Feature sequence039 1 831 gene locus_tag LOCUS_02620 1 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1880 891 gene locus_tag LOCUS_02630 1880 891 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210220.1 protein_id gnl|my_center|LOCUS_02630 2356 3675 gene locus_tag LOCUS_02640 2356 3675 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_02640 3964 3752 gene locus_tag LOCUS_02650 3964 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3906 4751 gene locus_tag LOCUS_02660 3906 4751 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203801.1 protein_id gnl|my_center|LOCUS_02660 4748 5572 gene locus_tag LOCUS_02670 4748 5572 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530860.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence040 187 1248 gene locus_tag LOCUS_02680 187 1248 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 protein_id gnl|my_center|LOCUS_02680 1381 2478 gene locus_tag LOCUS_02690 gene ddlA 1381 2478 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095807.1 protein_id gnl|my_center|LOCUS_02690 2601 4163 gene locus_tag LOCUS_02700 2601 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4839 4156 gene locus_tag LOCUS_02710 4839 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 <6102 5240 gene locus_tag LOCUS_02720 <6102 5240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703805.1:glycosyltransferase >Feature sequence041 1055 264 gene locus_tag LOCUS_02730 gene panB 1055 264 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_02730 1725 1228 gene locus_tag LOCUS_02740 gene folK 1725 1228 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_02740 3148 1718 gene locus_tag LOCUS_02750 3148 1718 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_02750 4999 4109 gene locus_tag LOCUS_02760 gene gluQRS 4999 4109 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_02760 5454 5092 gene locus_tag LOCUS_02770 gene dksA 5454 5092 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence042 642 878 gene locus_tag LOCUS_02780 642 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 1681 917 gene locus_tag LOCUS_02790 1681 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 2019 1672 gene locus_tag LOCUS_02800 2019 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2369 2154 gene locus_tag LOCUS_02810 2369 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 2707 2393 gene locus_tag LOCUS_02820 2707 2393 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418948.1 protein_id gnl|my_center|LOCUS_02820 2814 3290 gene locus_tag LOCUS_02830 gene pgpA 2814 3290 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208663.1 protein_id gnl|my_center|LOCUS_02830 3514 4146 gene locus_tag LOCUS_02840 gene carR 3514 4146 CDS product two-component system response regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090494.1 protein_id gnl|my_center|LOCUS_02840 4169 5440 gene locus_tag LOCUS_02850 gene carS 4169 5440 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_02850 5929 5606 gene locus_tag LOCUS_02860 5929 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence043 429 217 gene locus_tag LOCUS_02870 429 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 364 804 gene locus_tag LOCUS_02880 364 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 1134 862 gene locus_tag LOCUS_02890 1134 862 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976290.1 protein_id gnl|my_center|LOCUS_02890 2068 1073 gene locus_tag LOCUS_02900 2068 1073 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_02900 3183 2251 gene locus_tag LOCUS_02910 3183 2251 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418861.1 protein_id gnl|my_center|LOCUS_02910 4659 3229 gene locus_tag LOCUS_02920 gene cls 4659 3229 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144064.1 protein_id gnl|my_center|LOCUS_02920 5982 4825 gene locus_tag LOCUS_02930 5982 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence044 452 117 gene locus_tag LOCUS_02940 452 117 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046692.1 protein_id gnl|my_center|LOCUS_02940 1184 510 gene locus_tag LOCUS_02950 1184 510 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 protein_id gnl|my_center|LOCUS_02950 2183 1248 gene locus_tag LOCUS_02960 2183 1248 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926822.1 protein_id gnl|my_center|LOCUS_02960 2337 5132 gene locus_tag LOCUS_02970 2337 5132 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016415173.1 protein_id gnl|my_center|LOCUS_02970 >Feature sequence045 745 440 gene locus_tag LOCUS_02980 745 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 1063 1479 gene locus_tag LOCUS_02990 1063 1479 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_02990 2663 1548 gene locus_tag LOCUS_03000 2663 1548 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 protein_id gnl|my_center|LOCUS_03000 5436 2665 gene locus_tag LOCUS_03010 gene rbbA 5436 2665 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_03010 <5956 5433 gene locus_tag LOCUS_03020 <5956 5433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099200.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence046 1135 209 gene locus_tag LOCUS_03030 1135 209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975890.1 protein_id gnl|my_center|LOCUS_03030 1983 1135 gene locus_tag LOCUS_03040 1983 1135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311615.1 protein_id gnl|my_center|LOCUS_03040 2567 1980 gene locus_tag LOCUS_03050 2567 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3706 2564 gene locus_tag LOCUS_03060 3706 2564 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969594.1 protein_id gnl|my_center|LOCUS_03060 4110 4742 gene locus_tag LOCUS_03070 gene ompW 4110 4742 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714798.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence047 1779 517 gene locus_tag LOCUS_03080 gene murA 1779 517 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_03080 2091 1837 gene locus_tag LOCUS_03090 gene ibaG 2091 1837 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429656.1 protein_id gnl|my_center|LOCUS_03090 2599 2234 gene locus_tag LOCUS_03100 2599 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3225 2596 gene locus_tag LOCUS_03110 3225 2596 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 protein_id gnl|my_center|LOCUS_03110 3776 3315 gene locus_tag LOCUS_03120 gene mlaD 3776 3315 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377572.1 protein_id gnl|my_center|LOCUS_03120 4555 3773 gene locus_tag LOCUS_03130 gene mlaE 4555 3773 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313588.1 protein_id gnl|my_center|LOCUS_03130 5352 4552 gene locus_tag LOCUS_03140 5352 4552 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence048 533 1846 gene locus_tag LOCUS_03150 533 1846 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 protein_id gnl|my_center|LOCUS_03150 1905 2516 gene locus_tag LOCUS_03160 1905 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2610 3677 gene locus_tag LOCUS_03170 2610 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838772.1 protein_id gnl|my_center|LOCUS_03170 4772 3717 gene locus_tag LOCUS_03180 4772 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5224 4907 gene locus_tag LOCUS_03190 5224 4907 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383290.1 protein_id gnl|my_center|LOCUS_03190 >Feature sequence049 504 1163 gene locus_tag LOCUS_03200 gene yrfG 504 1163 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_03200 1374 1766 gene locus_tag LOCUS_03210 gene hslR 1374 1766 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098853.1 protein_id gnl|my_center|LOCUS_03210 1867 2739 gene locus_tag LOCUS_03220 gene hslO 1867 2739 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_03220 2933 2658 gene locus_tag LOCUS_03230 2933 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 2926 4509 gene locus_tag LOCUS_03240 2926 4509 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100068.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence050 1062 322 gene locus_tag LOCUS_03250 1062 322 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815396.1 protein_id gnl|my_center|LOCUS_03250 2365 1265 gene locus_tag LOCUS_03260 2365 1265 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_03260 4151 2634 gene locus_tag LOCUS_03270 4151 2634 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_03270 4353 5435 gene locus_tag LOCUS_03280 gene lptF 4353 5435 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence051 1219 590 gene locus_tag LOCUS_03290 1219 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1769 1251 gene locus_tag LOCUS_03300 gene nuoE 1769 1251 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090460.1 protein_id gnl|my_center|LOCUS_03300 3557 1791 gene locus_tag LOCUS_03310 gene nuoC 3557 1791 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619059.1 protein_id gnl|my_center|LOCUS_03310 4369 3692 gene locus_tag LOCUS_03320 4369 3692 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554012.1 protein_id gnl|my_center|LOCUS_03320 4959 4504 gene locus_tag LOCUS_03330 4959 4504 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554011.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence052 364 1107 gene locus_tag LOCUS_03340 364 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1123 3423 gene locus_tag LOCUS_03350 1123 3423 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267036.1 protein_id gnl|my_center|LOCUS_03350 3552 4517 gene locus_tag LOCUS_03360 3552 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 4442 4609 gene locus_tag LOCUS_03370 4442 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence053 476 1261 gene locus_tag LOCUS_03380 476 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 1435 2043 gene locus_tag LOCUS_03390 gene azoR3 1435 2043 CDS product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 protein_id gnl|my_center|LOCUS_03390 2227 2667 gene locus_tag LOCUS_03400 2227 2667 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_03400 2673 3146 gene locus_tag LOCUS_03410 2673 3146 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_03410 3319 4008 gene locus_tag LOCUS_03420 3319 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 4428 4027 gene locus_tag LOCUS_03430 4428 4027 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence054 2173 89 gene locus_tag LOCUS_03440 2173 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3202 2186 gene locus_tag LOCUS_03450 3202 2186 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_03450 3636 3283 gene locus_tag LOCUS_03460 3636 3283 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017131138.1 protein_id gnl|my_center|LOCUS_03460 4065 3646 gene locus_tag LOCUS_03470 4065 3646 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_03470 >Feature sequence055 <1 1072 gene locus_tag LOCUS_03480 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267377.1:2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase 1156 2607 gene locus_tag LOCUS_03490 gene lpdA 1156 2607 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_03490 2728 3894 gene locus_tag LOCUS_03500 gene sucC 2728 3894 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_03500 3894 4766 gene locus_tag LOCUS_03510 gene sucD 3894 4766 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_03510 5408 4881 gene locus_tag LOCUS_03520 5408 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence056 346 699 gene locus_tag LOCUS_03530 346 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 741 1142 gene locus_tag LOCUS_03540 741 1142 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383864.1 protein_id gnl|my_center|LOCUS_03540 1139 2116 gene locus_tag LOCUS_03550 1139 2116 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268505.1 protein_id gnl|my_center|LOCUS_03550 2726 2103 gene locus_tag LOCUS_03560 2726 2103 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036258.1 protein_id gnl|my_center|LOCUS_03560 2897 3637 gene locus_tag LOCUS_03570 2897 3637 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223997.1 protein_id gnl|my_center|LOCUS_03570 3690 4094 gene locus_tag LOCUS_03580 3690 4094 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence057 1094 657 gene locus_tag LOCUS_03590 1094 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 981 1457 gene locus_tag LOCUS_03600 981 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 1454 1795 gene locus_tag LOCUS_03610 1454 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1764 2285 gene locus_tag LOCUS_03620 1764 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2334 2894 gene locus_tag LOCUS_03630 2334 2894 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_03630 2943 3914 gene locus_tag LOCUS_03640 2943 3914 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 protein_id gnl|my_center|LOCUS_03640 4427 3936 gene locus_tag LOCUS_03650 4427 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 5081 4566 gene locus_tag LOCUS_03660 5081 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence058 1332 196 gene locus_tag LOCUS_03670 1332 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 2872 1412 gene locus_tag LOCUS_03680 2872 1412 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055873.1 protein_id gnl|my_center|LOCUS_03680 4236 2887 gene locus_tag LOCUS_03690 4236 2887 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934990.1 protein_id gnl|my_center|LOCUS_03690 <5606 4267 gene locus_tag LOCUS_03700 <5606 4267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703513.1:outer membrane channel protein TolC >Feature sequence059 <1 1828 gene locus_tag LOCUS_03710 <1 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113862.1:[protein-PII] uridylyltransferase 2291 1884 gene locus_tag LOCUS_03720 2291 1884 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399589.1 protein_id gnl|my_center|LOCUS_03720 2503 2865 gene locus_tag LOCUS_03730 2503 2865 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 protein_id gnl|my_center|LOCUS_03730 2936 3961 gene locus_tag LOCUS_03740 gene dapD 2936 3961 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 protein_id gnl|my_center|LOCUS_03740 3997 5154 gene locus_tag LOCUS_03750 gene dapE 3997 5154 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082377.1 protein_id gnl|my_center|LOCUS_03750 5162 5554 gene locus_tag LOCUS_03760 5162 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765957.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence060 1046 375 gene locus_tag LOCUS_03770 1046 375 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731541.1 protein_id gnl|my_center|LOCUS_03770 1578 1270 gene locus_tag LOCUS_03780 1578 1270 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809467.1 protein_id gnl|my_center|LOCUS_03780 2606 1575 gene locus_tag LOCUS_03790 2606 1575 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_03790 2960 2739 gene locus_tag LOCUS_03800 2960 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 3068 3229 gene locus_tag LOCUS_03810 3068 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 3462 4679 gene locus_tag LOCUS_03820 3462 4679 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896596.1 protein_id gnl|my_center|LOCUS_03820 4689 4916 gene locus_tag LOCUS_03830 4689 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 4885 5112 gene locus_tag LOCUS_03840 4885 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 5300 5569 gene locus_tag LOCUS_03850 5300 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence061 765 1379 gene locus_tag LOCUS_03860 765 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1450 2154 gene locus_tag LOCUS_03870 1450 2154 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112481.1 protein_id gnl|my_center|LOCUS_03870 2388 3665 gene locus_tag LOCUS_03880 2388 3665 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878155.1 protein_id gnl|my_center|LOCUS_03880 3742 4164 gene locus_tag LOCUS_03890 gene mntR 3742 4164 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091024.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence062 <1 999 gene locus_tag LOCUS_03900 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545708.1:NADH-quinone oxidoreductase subunit D 1002 2000 gene locus_tag LOCUS_03910 gene nuoH 1002 2000 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_03910 2004 2519 gene locus_tag LOCUS_03920 2004 2519 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_03920 2520 2828 gene locus_tag LOCUS_03930 gene nuoK 2520 2828 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_03930 2863 4995 gene locus_tag LOCUS_03940 gene nuoL 2863 4995 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence063 2876 456 gene locus_tag LOCUS_03950 gene plsB 2876 456 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266965.1 protein_id gnl|my_center|LOCUS_03950 3052 4179 gene locus_tag LOCUS_03960 3052 4179 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 protein_id gnl|my_center|LOCUS_03960 4884 4207 gene locus_tag LOCUS_03970 4884 4207 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767637.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence064 2627 1551 gene locus_tag LOCUS_03980 gene flgJ 2627 1551 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811877.1 protein_id gnl|my_center|LOCUS_03980 3766 2627 gene locus_tag LOCUS_03990 3766 2627 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_03990 4470 3772 gene locus_tag LOCUS_04000 gene flgH 4470 3772 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367324.1 protein_id gnl|my_center|LOCUS_04000 5264 4485 gene locus_tag LOCUS_04010 gene flgG 5264 4485 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050114401.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence065 2210 1701 gene locus_tag LOCUS_04020 gene tsaE 2210 1701 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209146.1 protein_id gnl|my_center|LOCUS_04020 3339 2194 gene locus_tag LOCUS_04030 3339 2194 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence066 991 404 gene locus_tag LOCUS_04040 991 404 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_04040 2065 1307 gene locus_tag LOCUS_04050 2065 1307 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525123.1 protein_id gnl|my_center|LOCUS_04050 2465 2178 gene locus_tag LOCUS_04060 2465 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2909 2834 gene locus_tag LOCUS_t00020 2909 2834 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3297 3944 gene locus_tag LOCUS_04070 gene uvrY 3297 3944 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737926.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence067 382 1407 gene locus_tag LOCUS_04080 382 1407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_04080 1764 1543 gene locus_tag LOCUS_04090 1764 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 1702 2952 gene locus_tag LOCUS_04100 1702 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3146 3619 gene locus_tag LOCUS_04110 3146 3619 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_04110 3833 5212 gene locus_tag LOCUS_04120 3833 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence068 473 1324 gene locus_tag LOCUS_04130 gene pstA 473 1324 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_04130 1345 2169 gene locus_tag LOCUS_04140 gene pstB 1345 2169 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500183.1 protein_id gnl|my_center|LOCUS_04140 2349 3455 gene locus_tag LOCUS_04150 2349 3455 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099154.1 protein_id gnl|my_center|LOCUS_04150 3976 3653 gene locus_tag LOCUS_04160 gene trxA 3976 3653 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_04160 4220 5188 gene locus_tag LOCUS_04170 gene cysB 4220 5188 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence069 1232 2956 gene locus_tag LOCUS_04180 1232 2956 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095071.1 protein_id gnl|my_center|LOCUS_04180 2956 3447 gene locus_tag LOCUS_04190 gene ilvN 2956 3447 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_04190 4418 3534 gene locus_tag LOCUS_04200 gene ilvY 4418 3534 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence070 343 179 gene locus_tag LOCUS_04210 343 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 285 908 gene locus_tag LOCUS_04220 285 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 1037 1288 gene locus_tag LOCUS_04230 gene hfq 1037 1288 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_04230 1303 2625 gene locus_tag LOCUS_04240 gene hflX 1303 2625 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_04240 2821 4056 gene locus_tag LOCUS_04250 gene hflK 2821 4056 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 protein_id gnl|my_center|LOCUS_04250 4056 4916 gene locus_tag LOCUS_04260 gene hflC 4056 4916 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_04260 4958 5176 gene locus_tag LOCUS_04270 4958 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence071 309 935 gene locus_tag LOCUS_04280 309 935 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705976.1 protein_id gnl|my_center|LOCUS_04280 1069 1620 gene locus_tag LOCUS_04290 1069 1620 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 protein_id gnl|my_center|LOCUS_04290 1674 2162 gene locus_tag LOCUS_04300 gene gpt 1674 2162 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_04300 2181 2870 gene locus_tag LOCUS_04310 gene ung 2181 2870 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972337.1 protein_id gnl|my_center|LOCUS_04310 2928 3557 gene locus_tag LOCUS_04320 gene upp 2928 3557 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457783.1 protein_id gnl|my_center|LOCUS_04320 3554 4174 gene locus_tag LOCUS_04330 gene mobA 3554 4174 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192903.1 protein_id gnl|my_center|LOCUS_04330 4164 4742 gene locus_tag LOCUS_04340 gene mobB 4164 4742 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907623.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence072 2368 1535 gene locus_tag LOCUS_04350 2368 1535 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088390.1 protein_id gnl|my_center|LOCUS_04350 2579 3298 gene locus_tag LOCUS_04360 2579 3298 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184412.1 protein_id gnl|my_center|LOCUS_04360 3779 3333 gene locus_tag LOCUS_04370 3779 3333 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_04370 5008 4004 gene locus_tag LOCUS_04380 5008 4004 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691143.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence073 1421 2710 gene locus_tag LOCUS_04390 gene gbcA 1421 2710 CDS product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096766.1 protein_id gnl|my_center|LOCUS_04390 4900 2849 gene locus_tag LOCUS_04400 4900 2849 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819036.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence074 1 537 gene locus_tag LOCUS_04410 1 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 633 1121 gene locus_tag LOCUS_04420 gene lptE 633 1121 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100322.1 protein_id gnl|my_center|LOCUS_04420 1118 2176 gene locus_tag LOCUS_04430 gene holA 1118 2176 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_04430 2246 3496 gene locus_tag LOCUS_04440 2246 3496 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149323740.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence075 911 1588 gene locus_tag LOCUS_04450 911 1588 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707638.1 protein_id gnl|my_center|LOCUS_04450 3221 1659 gene locus_tag LOCUS_04460 3221 1659 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266666.1 protein_id gnl|my_center|LOCUS_04460 4542 3253 gene locus_tag LOCUS_04470 gene hemL 4542 3253 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence076 <1 1251 gene locus_tag LOCUS_04480 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001242442.1:BCCT family transporter 1839 1366 gene locus_tag LOCUS_04490 1839 1366 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091405.1 protein_id gnl|my_center|LOCUS_04490 3412 2198 gene locus_tag LOCUS_04500 3412 2198 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_04500 <5316 3557 gene locus_tag LOCUS_04510 <5316 3557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095207.1:carbamoyl-phosphate synthase large subunit >Feature sequence077 343 810 gene locus_tag LOCUS_04520 343 810 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 protein_id gnl|my_center|LOCUS_04520 2268 904 gene locus_tag LOCUS_04530 2268 904 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_04530 3947 2652 gene locus_tag LOCUS_04540 gene nasR 3947 2652 CDS product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096246.1 protein_id gnl|my_center|LOCUS_04540 4617 4255 gene locus_tag LOCUS_04550 4617 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 5258 4800 gene locus_tag LOCUS_04560 5258 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence078 349 1089 gene locus_tag LOCUS_04570 349 1089 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104736.1 protein_id gnl|my_center|LOCUS_04570 1089 1712 gene locus_tag LOCUS_04580 1089 1712 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 protein_id gnl|my_center|LOCUS_04580 1742 3256 gene locus_tag LOCUS_04590 gene purF 1742 3256 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence079 1414 641 gene locus_tag LOCUS_04600 1414 641 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 protein_id gnl|my_center|LOCUS_04600 1357 1509 gene locus_tag LOCUS_04610 1357 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2439 3110 gene locus_tag LOCUS_04620 2439 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3457 3373 gene locus_tag LOCUS_t00030 3457 3373 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3893 4369 gene locus_tag LOCUS_04630 3893 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4626 4396 gene locus_tag LOCUS_04640 4626 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 4997 4704 gene locus_tag LOCUS_04650 4997 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence080 2597 393 gene locus_tag LOCUS_04660 gene dnaK 2597 393 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095212.1 protein_id gnl|my_center|LOCUS_04660 3397 2765 gene locus_tag LOCUS_04670 gene grpE 3397 2765 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021933.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence081 75 794 gene locus_tag LOCUS_04680 75 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 1962 892 gene locus_tag LOCUS_04690 1962 892 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064355.1 protein_id gnl|my_center|LOCUS_04690 3223 2003 gene locus_tag LOCUS_04700 gene hmpA 3223 2003 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922502.1 protein_id gnl|my_center|LOCUS_04700 3304 3738 gene locus_tag LOCUS_04710 3304 3738 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689406.1 protein_id gnl|my_center|LOCUS_04710 4759 3773 gene locus_tag LOCUS_04720 4759 3773 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence082 472 2394 gene locus_tag LOCUS_04730 472 2394 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_04730 2507 3790 gene locus_tag LOCUS_04740 2507 3790 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099579.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence083 965 678 gene locus_tag LOCUS_04750 965 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 985 1320 gene locus_tag LOCUS_04760 985 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1548 1958 gene locus_tag LOCUS_04770 1548 1958 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948673.1 protein_id gnl|my_center|LOCUS_04770 1962 2828 gene locus_tag LOCUS_04780 gene atpB 1962 2828 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114072.1 protein_id gnl|my_center|LOCUS_04780 2902 3150 gene locus_tag LOCUS_04790 gene atpE 2902 3150 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555987.1 protein_id gnl|my_center|LOCUS_04790 3221 3691 gene locus_tag LOCUS_04800 3221 3691 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_04800 3703 4245 gene locus_tag LOCUS_04810 3703 4245 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315956.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence084 1292 105 gene locus_tag LOCUS_04820 1292 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2011 2751 gene locus_tag LOCUS_04830 2011 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355475.1 protein_id gnl|my_center|LOCUS_04830 3169 2855 gene locus_tag LOCUS_04840 3169 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3859 4734 gene locus_tag LOCUS_04850 3859 4734 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103454.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence085 3 428 gene locus_tag LOCUS_04860 3 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 673 3747 gene locus_tag LOCUS_04870 gene fdnG 673 3747 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895684.1 transl_except (pos:1264..1266,aa:Sec) note codon on position 198 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_04870 3757 4695 gene locus_tag LOCUS_04880 gene fdxH 3757 4695 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106793.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence086 1251 349 gene locus_tag LOCUS_04890 1251 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2855 1467 gene locus_tag LOCUS_04900 2855 1467 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 protein_id gnl|my_center|LOCUS_04900 3209 3403 gene locus_tag LOCUS_04910 3209 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence087 2519 1143 gene locus_tag LOCUS_04920 2519 1143 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 protein_id gnl|my_center|LOCUS_04920 2791 3456 gene locus_tag LOCUS_04930 2791 3456 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463955.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence088 311 811 gene locus_tag LOCUS_04940 gene dut 311 811 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976081.1 protein_id gnl|my_center|LOCUS_04940 893 1444 gene locus_tag LOCUS_04950 893 1444 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 protein_id gnl|my_center|LOCUS_04950 1457 2893 gene locus_tag LOCUS_04960 1457 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3033 3935 gene locus_tag LOCUS_04970 gene argB 3033 3935 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_04970 4059 4634 gene locus_tag LOCUS_04980 gene slmA 4059 4634 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence089 <1 1233 gene locus_tag LOCUS_04990 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706998.1:ATP-binding protein 3096 1339 gene locus_tag LOCUS_05000 3096 1339 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038828.1 protein_id gnl|my_center|LOCUS_05000 3408 3112 gene locus_tag LOCUS_05010 3408 3112 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389676.1 protein_id gnl|my_center|LOCUS_05010 4196 3405 gene locus_tag LOCUS_05020 4196 3405 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269433.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence090 820 1203 gene locus_tag LOCUS_05030 820 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1196 1924 gene locus_tag LOCUS_05040 1196 1924 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_05040 2113 2871 gene locus_tag LOCUS_05050 2113 2871 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928911.1 protein_id gnl|my_center|LOCUS_05050 3928 2888 gene locus_tag LOCUS_05060 3928 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4105 4743 gene locus_tag LOCUS_05070 4105 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence091 234 536 gene locus_tag LOCUS_05080 234 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 1171 833 gene locus_tag LOCUS_05090 gene glnK 1171 833 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 protein_id gnl|my_center|LOCUS_05090 2591 1341 gene locus_tag LOCUS_05100 2591 1341 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_05100 2955 2617 gene locus_tag LOCUS_05110 gene glnK 2955 2617 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_05110 3116 2952 gene locus_tag LOCUS_05120 3116 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3273 3599 gene locus_tag LOCUS_05130 3273 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence092 666 1082 gene locus_tag LOCUS_05140 666 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1166 1456 gene locus_tag LOCUS_05150 1166 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1456 1575 gene locus_tag LOCUS_05160 1456 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence093 662 1528 gene locus_tag LOCUS_05170 662 1528 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085910.1 protein_id gnl|my_center|LOCUS_05170 1525 2694 gene locus_tag LOCUS_05180 1525 2694 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_05180 2719 4068 gene locus_tag LOCUS_05190 2719 4068 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_05190 4118 4399 gene locus_tag LOCUS_05200 4118 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence094 1775 858 gene locus_tag LOCUS_05210 1775 858 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_05210 2483 2112 gene locus_tag LOCUS_05220 2483 2112 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526300.1 protein_id gnl|my_center|LOCUS_05220 2626 3531 gene locus_tag LOCUS_05230 2626 3531 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098128.1 protein_id gnl|my_center|LOCUS_05230 4656 3580 gene locus_tag LOCUS_05240 4656 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence095 <1 1073 gene locus_tag LOCUS_05250 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895627.1:DNA translocase FtsK 1229 1885 gene locus_tag LOCUS_05260 gene lolA 1229 1885 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405079.1 protein_id gnl|my_center|LOCUS_05260 3333 1981 gene locus_tag LOCUS_05270 gene rarA 3333 1981 CDS product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704877.1 protein_id gnl|my_center|LOCUS_05270 3641 4189 gene locus_tag LOCUS_05280 3641 4189 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706927.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence096 105 1061 gene locus_tag LOCUS_05290 gene coaA 105 1061 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539100.1 protein_id gnl|my_center|LOCUS_05290 1214 2239 gene locus_tag LOCUS_05300 1214 2239 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402782.1 protein_id gnl|my_center|LOCUS_05300 4434 2305 gene locus_tag LOCUS_05310 gene pnp 4434 2305 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence097 2749 1820 gene locus_tag LOCUS_05320 2749 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4022 2829 gene locus_tag LOCUS_05330 4022 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 <4818 4288 gene locus_tag LOCUS_05340 <4818 4288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186129.1:serine--tRNA ligase >Feature sequence098 769 269 gene locus_tag LOCUS_05350 769 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 938 1024 gene locus_tag LOCUS_t00040 938 1024 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1994 1263 gene locus_tag LOCUS_05360 1994 1263 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598666.1 protein_id gnl|my_center|LOCUS_05360 3599 1998 gene locus_tag LOCUS_05370 3599 1998 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746421.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence099 <1 849 gene locus_tag LOCUS_05380 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776708.1:hydroxyethylthiazole kinase 1702 860 gene locus_tag LOCUS_05390 gene cysE 1702 860 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393467.1 protein_id gnl|my_center|LOCUS_05390 3790 1742 gene locus_tag LOCUS_05400 gene rep 3790 1742 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110454.1 protein_id gnl|my_center|LOCUS_05400 3982 4443 gene locus_tag LOCUS_05410 3982 4443 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074042.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence100 344 1579 gene locus_tag LOCUS_05420 344 1579 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929595.1 protein_id gnl|my_center|LOCUS_05420 2671 1772 gene locus_tag LOCUS_05430 gene cho 2671 1772 CDS product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252369.1 protein_id gnl|my_center|LOCUS_05430 3646 2696 gene locus_tag LOCUS_05440 3646 2696 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 protein_id gnl|my_center|LOCUS_05440 4478 3660 gene locus_tag LOCUS_05450 4478 3660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence101 365 1054 gene locus_tag LOCUS_05460 365 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 1257 1988 gene locus_tag LOCUS_05470 1257 1988 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225220.1 protein_id gnl|my_center|LOCUS_05470 2135 2224 gene locus_tag LOCUS_t00050 2135 2224 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3210 2290 gene locus_tag LOCUS_05480 3210 2290 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_05480 3641 3243 gene locus_tag LOCUS_05490 3641 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3531 3920 gene locus_tag LOCUS_05500 3531 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 3917 4435 gene locus_tag LOCUS_05510 3917 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence102 225 617 gene locus_tag LOCUS_05520 225 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 772 1191 gene locus_tag LOCUS_05530 gene infC 772 1191 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080374.1 protein_id gnl|my_center|LOCUS_05530 1284 1478 gene locus_tag LOCUS_05540 gene rpmI 1284 1478 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 protein_id gnl|my_center|LOCUS_05540 1515 1865 gene locus_tag LOCUS_05550 gene rplT 1515 1865 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 protein_id gnl|my_center|LOCUS_05550 2012 3031 gene locus_tag LOCUS_05560 gene pheS 2012 3031 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence103 1364 804 gene locus_tag LOCUS_05570 gene aroK 1364 804 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_05570 3421 1364 gene locus_tag LOCUS_05580 gene pilQ 3421 1364 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_05580 3987 3433 gene locus_tag LOCUS_05590 gene pilP 3987 3433 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_05590 4619 3984 gene locus_tag LOCUS_05600 gene pilO 4619 3984 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence104 929 1915 gene locus_tag LOCUS_05610 929 1915 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_05610 2026 3411 gene locus_tag LOCUS_05620 2026 3411 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392249.1 protein_id gnl|my_center|LOCUS_05620 3476 4648 gene locus_tag LOCUS_05630 3476 4648 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence105 4419 2578 gene locus_tag LOCUS_05640 4419 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence106 986 495 gene locus_tag LOCUS_05650 986 495 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013721963.1 protein_id gnl|my_center|LOCUS_05650 1552 1097 gene locus_tag LOCUS_05660 1552 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2556 1789 gene locus_tag LOCUS_05670 2556 1789 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_05670 3899 2655 gene locus_tag LOCUS_05680 3899 2655 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161469396.1 protein_id gnl|my_center|LOCUS_05680 4510 3899 gene locus_tag LOCUS_05690 4510 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence107 484 293 gene locus_tag LOCUS_05700 484 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 1445 2128 gene locus_tag LOCUS_05710 1445 2128 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940072.1 protein_id gnl|my_center|LOCUS_05710 3045 2347 gene locus_tag LOCUS_05720 gene fliA 3045 2347 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087467.1 protein_id gnl|my_center|LOCUS_05720 3582 3175 gene locus_tag LOCUS_05730 3582 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 <4703 3693 gene locus_tag LOCUS_05740 <4703 3693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000066986.1:flagellar biosynthesis protein FlhA >Feature sequence108 146 1225 gene locus_tag LOCUS_05750 gene rlmM 146 1225 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212119.1 protein_id gnl|my_center|LOCUS_05750 1229 1486 gene locus_tag LOCUS_05760 gene tusA 1229 1486 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105999.1 protein_id gnl|my_center|LOCUS_05760 2133 1528 gene locus_tag LOCUS_05770 2133 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 3753 2329 gene locus_tag LOCUS_05780 3753 2329 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_05780 3866 4429 gene locus_tag LOCUS_05790 gene epmC 3866 4429 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089227.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence109 993 1877 gene locus_tag LOCUS_05800 993 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1918 3075 gene locus_tag LOCUS_05810 1918 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4303 3182 gene locus_tag LOCUS_05820 4303 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence110 1020 472 gene locus_tag LOCUS_05830 1020 472 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 protein_id gnl|my_center|LOCUS_05830 1389 1039 gene locus_tag LOCUS_05840 1389 1039 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 protein_id gnl|my_center|LOCUS_05840 1679 1389 gene locus_tag LOCUS_05850 1679 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2100 1696 gene locus_tag LOCUS_05860 gene tusC 2100 1696 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_05860 2492 2097 gene locus_tag LOCUS_05870 gene tusD 2492 2097 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209692.1 protein_id gnl|my_center|LOCUS_05870 3273 2602 gene locus_tag LOCUS_05880 3273 2602 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553978.1 protein_id gnl|my_center|LOCUS_05880 3438 3528 gene locus_tag LOCUS_t00060 3438 3528 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3904 4155 gene locus_tag LOCUS_05890 3904 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4304 4546 gene locus_tag LOCUS_05900 4304 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence111 <1 680 gene locus_tag LOCUS_05910 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043526237.1:flagellar motor switch protein FliM 673 1182 gene locus_tag LOCUS_05920 gene fliN 673 1182 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282098.1 protein_id gnl|my_center|LOCUS_05920 1179 1622 gene locus_tag LOCUS_05930 1179 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1646 2392 gene locus_tag LOCUS_05940 gene fliP 1646 2392 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 protein_id gnl|my_center|LOCUS_05940 2452 2721 gene locus_tag LOCUS_05950 gene fliQ 2452 2721 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 protein_id gnl|my_center|LOCUS_05950 2738 3529 gene locus_tag LOCUS_05960 gene fliR 2738 3529 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_05960 <4630 3729 gene locus_tag LOCUS_05970 <4630 3729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037107.1:flagellar hook-associated protein FlgL >Feature sequence112 1504 167 gene locus_tag LOCUS_05980 1504 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 2491 1514 gene locus_tag LOCUS_05990 2491 1514 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 protein_id gnl|my_center|LOCUS_05990 3696 2488 gene locus_tag LOCUS_06000 3696 2488 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 protein_id gnl|my_center|LOCUS_06000 4015 4455 gene locus_tag LOCUS_06010 4015 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence113 484 65 gene locus_tag LOCUS_06020 484 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 1727 579 gene locus_tag LOCUS_06030 1727 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4109 1773 gene locus_tag LOCUS_06040 4109 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence114 <1 811 gene locus_tag LOCUS_06050 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085519.1:tripartite tricarboxylate transporter substrate binding protein 893 1264 gene locus_tag LOCUS_06060 893 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 1289 2059 gene locus_tag LOCUS_06070 1289 2059 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085585.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence115 637 1119 gene locus_tag LOCUS_06080 637 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 3034 1100 gene locus_tag LOCUS_06090 3034 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3597 3031 gene locus_tag LOCUS_06100 3597 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence116 950 525 gene locus_tag LOCUS_06110 950 525 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326136.1 protein_id gnl|my_center|LOCUS_06110 1864 1055 gene locus_tag LOCUS_06120 1864 1055 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121194.1 protein_id gnl|my_center|LOCUS_06120 3025 2579 gene locus_tag LOCUS_06130 3025 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 4170 3061 gene locus_tag LOCUS_06140 4170 3061 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261546.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence117 836 567 gene locus_tag LOCUS_06150 gene minE 836 567 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_06150 1654 833 gene locus_tag LOCUS_06160 gene minD 1654 833 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382726.1 protein_id gnl|my_center|LOCUS_06160 2441 1701 gene locus_tag LOCUS_06170 gene minC 2441 1701 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104763.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence118 474 1064 gene locus_tag LOCUS_06180 474 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1780 2973 gene locus_tag LOCUS_06190 1780 2973 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275407.1 protein_id gnl|my_center|LOCUS_06190 3818 3210 gene locus_tag LOCUS_06200 3818 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence119 1198 1581 gene locus_tag LOCUS_06210 gene rnpA 1198 1581 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100251.1 protein_id gnl|my_center|LOCUS_06210 1687 3375 gene locus_tag LOCUS_06220 gene yidC 1687 3375 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 protein_id gnl|my_center|LOCUS_06220 3510 4250 gene locus_tag LOCUS_06230 3510 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence120 1154 87 gene locus_tag LOCUS_06240 gene mnmH 1154 87 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064861.1 protein_id gnl|my_center|LOCUS_06240 2191 1151 gene locus_tag LOCUS_06250 gene selD 2191 1151 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211671.1 protein_id gnl|my_center|LOCUS_06250 3700 2324 gene locus_tag LOCUS_06260 gene radA 3700 2324 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 protein_id gnl|my_center|LOCUS_06260 4257 3847 gene locus_tag LOCUS_06270 4257 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence121 545 1792 gene locus_tag LOCUS_06280 545 1792 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_06280 1936 3252 gene locus_tag LOCUS_06290 1936 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3297 3791 gene locus_tag LOCUS_06300 3297 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3816 4394 gene locus_tag LOCUS_06310 3816 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence122 284 33 gene locus_tag LOCUS_06320 gene rpsP 284 33 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 protein_id gnl|my_center|LOCUS_06320 1835 423 gene locus_tag LOCUS_06330 gene ffh 1835 423 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462720.1 protein_id gnl|my_center|LOCUS_06330 2117 2920 gene locus_tag LOCUS_06340 2117 2920 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_06340 2942 4309 gene locus_tag LOCUS_06350 2942 4309 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340990.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence123 1232 471 gene locus_tag LOCUS_06360 gene uppS 1232 471 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_06360 1853 1296 gene locus_tag LOCUS_06370 gene frr 1853 1296 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262432.1 protein_id gnl|my_center|LOCUS_06370 2637 1864 gene locus_tag LOCUS_06380 gene pyrH 2637 1864 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_06380 3666 2797 gene locus_tag LOCUS_06390 gene tsf 3666 2797 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092393.1 protein_id gnl|my_center|LOCUS_06390 4139 3840 gene locus_tag LOCUS_06400 4139 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 4326 4484 gene locus_tag LOCUS_06410 4326 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence124 59 1468 gene locus_tag LOCUS_06420 gene nuoN 59 1468 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_06420 1532 2878 gene locus_tag LOCUS_06430 gene egtB 1532 2878 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275134.1 protein_id gnl|my_center|LOCUS_06430 2944 3906 gene locus_tag LOCUS_06440 gene egtD 2944 3906 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence125 1070 195 gene locus_tag LOCUS_06450 gene glyQ 1070 195 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_06450 1213 2196 gene locus_tag LOCUS_06460 gene rfaD 1213 2196 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_06460 2189 3241 gene locus_tag LOCUS_06470 gene waaF 2189 3241 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_06470 3275 4183 gene locus_tag LOCUS_06480 3275 4183 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795870.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence126 1155 136 gene locus_tag LOCUS_06490 gene dctP 1155 136 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 protein_id gnl|my_center|LOCUS_06490 1957 1178 gene locus_tag LOCUS_06500 1957 1178 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975370.1 protein_id gnl|my_center|LOCUS_06500 2811 2143 gene locus_tag LOCUS_06510 2811 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 3475 2804 gene locus_tag LOCUS_06520 3475 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 <4491 3666 gene locus_tag LOCUS_06530 <4491 3666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006995535.1:O-antigen ligase >Feature sequence127 175 99 gene locus_tag LOCUS_t00070 175 99 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 323 231 gene locus_tag LOCUS_t00080 323 231 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 738 541 gene locus_tag LOCUS_06540 gene csrA 738 541 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 protein_id gnl|my_center|LOCUS_06540 2212 968 gene locus_tag LOCUS_06550 2212 968 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_06550 4409 2286 gene locus_tag LOCUS_06560 4409 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence128 1758 3098 gene locus_tag LOCUS_06570 1758 3098 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence129 2944 479 gene locus_tag LOCUS_06580 2944 479 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269131.1 protein_id gnl|my_center|LOCUS_06580 3314 4345 gene locus_tag LOCUS_06590 3314 4345 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence130 418 74 gene locus_tag LOCUS_06600 418 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 1025 606 gene locus_tag LOCUS_06610 1025 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 1716 1030 gene locus_tag LOCUS_06620 1716 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 2009 2839 gene locus_tag LOCUS_06630 gene rhdA 2009 2839 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_06630 2921 3814 gene locus_tag LOCUS_06640 gene asd 2921 3814 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063853.1 protein_id gnl|my_center|LOCUS_06640 3867 4283 gene locus_tag LOCUS_06650 gene arfB 3867 4283 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence131 926 600 gene locus_tag LOCUS_06660 926 600 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_06660 1666 1130 gene locus_tag LOCUS_06670 1666 1130 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 protein_id gnl|my_center|LOCUS_06670 2038 1865 gene locus_tag LOCUS_06680 2038 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2697 2173 gene locus_tag LOCUS_06690 2697 2173 CDS product DUF6438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206923.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence132 74 583 gene locus_tag LOCUS_06700 74 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1883 966 gene locus_tag LOCUS_06710 1883 966 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705173.1 protein_id gnl|my_center|LOCUS_06710 3198 1975 gene locus_tag LOCUS_06720 3198 1975 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 protein_id gnl|my_center|LOCUS_06720 <4452 3195 gene locus_tag LOCUS_06730 <4452 3195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073974.1:uroporphyrinogen-III C-methyltransferase >Feature sequence133 1586 465 gene locus_tag LOCUS_06740 gene ribF 1586 465 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_06740 3306 1684 gene locus_tag LOCUS_06750 gene murJ 3306 1684 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 protein_id gnl|my_center|LOCUS_06750 3715 3449 gene locus_tag LOCUS_06760 gene rpsT 3715 3449 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073368.1 protein_id gnl|my_center|LOCUS_06760 4349 3963 gene locus_tag LOCUS_06770 4349 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06770 >Feature sequence134 111 1763 gene locus_tag LOCUS_06780 111 1763 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_06780 1760 2848 gene locus_tag LOCUS_06790 1760 2848 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972586.1 protein_id gnl|my_center|LOCUS_06790 2849 3757 gene locus_tag LOCUS_06800 2849 3757 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence135 <1 501 gene locus_tag LOCUS_06810 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145098967.1:leucine-rich repeat domain-containing protein 909 751 gene locus_tag LOCUS_06820 909 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1416 979 gene locus_tag LOCUS_06830 1416 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 2913 2152 gene locus_tag LOCUS_06840 2913 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3777 2965 gene locus_tag LOCUS_06850 3777 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4061 3774 gene locus_tag LOCUS_06860 4061 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence136 <1 1121 gene locus_tag LOCUS_06870 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103275.1:exodeoxyribonuclease V subunit gamma >Feature sequence137 579 379 gene locus_tag LOCUS_06880 579 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1252 2349 gene locus_tag LOCUS_06890 1252 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2785 2399 gene locus_tag LOCUS_06900 2785 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4238 3003 gene locus_tag LOCUS_06910 4238 3003 CDS product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904572.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence138 542 2056 gene locus_tag LOCUS_06920 gene betC 542 2056 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171724.1 protein_id gnl|my_center|LOCUS_06920 2241 3830 gene locus_tag LOCUS_06930 2241 3830 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666072.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence139 2300 1287 gene locus_tag LOCUS_06940 2300 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3343 2396 gene locus_tag LOCUS_06950 gene ald 3343 2396 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_06950 3417 4211 gene locus_tag LOCUS_06960 3417 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence140 2646 3788 gene locus_tag LOCUS_06970 2646 3788 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_06970 4062 3685 gene locus_tag LOCUS_06980 4062 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence141 263 1948 gene locus_tag LOCUS_06990 gene argS 263 1948 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038936.1 protein_id gnl|my_center|LOCUS_06990 1952 2656 gene locus_tag LOCUS_07000 1952 2656 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_07000 2957 3475 gene locus_tag LOCUS_07010 gene hslV 2957 3475 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455873.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence142 <1 613 gene locus_tag LOCUS_07020 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115345.1:peptidylprolyl isomerase 613 1620 gene locus_tag LOCUS_07030 gene pdxA 613 1620 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_07030 1636 2481 gene locus_tag LOCUS_07040 gene rsmA 1636 2481 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_07040 2478 2861 gene locus_tag LOCUS_07050 gene apaG 2478 2861 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368292.1 protein_id gnl|my_center|LOCUS_07050 2967 3821 gene locus_tag LOCUS_07060 2967 3821 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110655318.1 protein_id gnl|my_center|LOCUS_07060 3858 4184 gene locus_tag LOCUS_07070 gene glpE 3858 4184 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085081.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence143 <1 747 gene locus_tag LOCUS_07080 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085861.1:rhodanese-related sulfurtransferase 1535 918 gene locus_tag LOCUS_07090 1535 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4195 1604 gene locus_tag LOCUS_07100 gene glnE 4195 1604 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence144 <1 1561 gene locus_tag LOCUS_07110 <1 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:EAL domain-containing protein 1610 2398 gene locus_tag LOCUS_07120 1610 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 3576 2494 gene locus_tag LOCUS_07130 3576 2494 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728063.1 protein_id gnl|my_center|LOCUS_07130 <4275 3584 gene locus_tag LOCUS_07140 <4275 3584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523002.1:alpha/beta hydrolase >Feature sequence145 1041 349 gene locus_tag LOCUS_07150 gene ehuD 1041 349 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209942630.1 protein_id gnl|my_center|LOCUS_07150 1716 1045 gene locus_tag LOCUS_07160 gene ehuC 1716 1045 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220332953.1 protein_id gnl|my_center|LOCUS_07160 2740 1856 gene locus_tag LOCUS_07170 gene ehuB 2740 1856 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220332954.1 protein_id gnl|my_center|LOCUS_07170 3223 3660 gene locus_tag LOCUS_07180 gene dtd 3223 3660 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103447.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence146 3032 1296 gene locus_tag LOCUS_07190 gene fadD1 3032 1296 CDS product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104873.1 protein_id gnl|my_center|LOCUS_07190 4245 3160 gene locus_tag LOCUS_07200 4245 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence147 327 713 gene locus_tag LOCUS_07210 gene rplQ 327 713 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 protein_id gnl|my_center|LOCUS_07210 3743 891 gene locus_tag LOCUS_07220 gene uvrA 3743 891 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence148 3071 534 gene locus_tag LOCUS_07230 3071 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3958 3278 gene locus_tag LOCUS_07240 3958 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence149 1071 325 gene locus_tag LOCUS_07250 1071 325 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463438.1 protein_id gnl|my_center|LOCUS_07250 1394 2794 gene locus_tag LOCUS_07260 gene pabB 1394 2794 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 protein_id gnl|my_center|LOCUS_07260 2892 3953 gene locus_tag LOCUS_07270 2892 3953 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972996.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence150 1102 2025 gene locus_tag LOCUS_07280 1102 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2086 2427 gene locus_tag LOCUS_07290 2086 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2427 2807 gene locus_tag LOCUS_07300 2427 2807 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210419.1 protein_id gnl|my_center|LOCUS_07300 2800 3099 gene locus_tag LOCUS_07310 2800 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 <4181 3169 gene locus_tag LOCUS_07320 <4181 3169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113227.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence151 445 41 gene locus_tag LOCUS_07330 445 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 874 2346 gene locus_tag LOCUS_07340 874 2346 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627647.1 protein_id gnl|my_center|LOCUS_07340 3762 2518 gene locus_tag LOCUS_07350 3762 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence152 2540 765 gene locus_tag LOCUS_07360 2540 765 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390306.1 protein_id gnl|my_center|LOCUS_07360 3191 2739 gene locus_tag LOCUS_07370 3191 2739 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919041.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence153 <1 3058 gene locus_tag LOCUS_07380 <1 3058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103675.1:mechanosensitive channel MscK 3743 3087 gene locus_tag LOCUS_07390 3743 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence154 <1 536 gene locus_tag LOCUS_07400 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083018.1:HlyC/CorC family transporter 708 1319 gene locus_tag LOCUS_07410 708 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 1324 2604 gene locus_tag LOCUS_07420 1324 2604 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 protein_id gnl|my_center|LOCUS_07420 3240 2656 gene locus_tag LOCUS_07430 gene sodB 3240 2656 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863548.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence155 1879 1673 gene locus_tag LOCUS_07440 1879 1673 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_07440 2677 1982 gene locus_tag LOCUS_07450 gene pncA 2677 1982 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_07450 3925 2909 gene locus_tag LOCUS_07460 3925 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence156 474 3662 gene locus_tag LOCUS_07470 474 3662 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_07470 3739 4089 gene locus_tag LOCUS_07480 3739 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence157 49 537 gene locus_tag LOCUS_07490 49 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 634 867 gene locus_tag LOCUS_07500 gene acpP 634 867 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 protein_id gnl|my_center|LOCUS_07500 1159 2397 gene locus_tag LOCUS_07510 gene fabF 1159 2397 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072710.1 protein_id gnl|my_center|LOCUS_07510 2403 3209 gene locus_tag LOCUS_07520 gene pabC 2403 3209 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence158 <1 1226 gene locus_tag LOCUS_07530 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111339.1:L-serine ammonia-lyase 1378 2112 gene locus_tag LOCUS_07540 1378 2112 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529286.1 protein_id gnl|my_center|LOCUS_07540 3134 2160 gene locus_tag LOCUS_07550 3134 2160 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence159 1829 135 gene locus_tag LOCUS_07560 1829 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2106 3554 gene locus_tag LOCUS_07570 gene mltF 2106 3554 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence160 1033 209 gene locus_tag LOCUS_07580 1033 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1225 2094 gene locus_tag LOCUS_07590 1225 2094 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986242.1 protein_id gnl|my_center|LOCUS_07590 2171 3550 gene locus_tag LOCUS_07600 2171 3550 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence161 17 1234 gene locus_tag LOCUS_07610 17 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2828 1287 gene locus_tag LOCUS_07620 gene rmuC 2828 1287 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 protein_id gnl|my_center|LOCUS_07620 3045 3608 gene locus_tag LOCUS_07630 3045 3608 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence162 1002 199 gene locus_tag LOCUS_07640 1002 199 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_07640 1130 2095 gene locus_tag LOCUS_07650 gene rarD 1130 2095 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_07650 2495 2169 gene locus_tag LOCUS_07660 gene fliE 2495 2169 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 protein_id gnl|my_center|LOCUS_07660 2801 3910 gene locus_tag LOCUS_07670 2801 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence163 1585 170 gene locus_tag LOCUS_07680 1585 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3389 1791 gene locus_tag LOCUS_07690 3389 1791 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence164 537 43 gene locus_tag LOCUS_07700 gene rimI 537 43 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225787.1 protein_id gnl|my_center|LOCUS_07700 1482 598 gene locus_tag LOCUS_07710 1482 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1790 1479 gene locus_tag LOCUS_07720 1790 1479 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613859.1 protein_id gnl|my_center|LOCUS_07720 3272 1884 gene locus_tag LOCUS_07730 3272 1884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705407.1 protein_id gnl|my_center|LOCUS_07730 3705 3319 gene locus_tag LOCUS_07740 3705 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229974.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence165 514 789 gene locus_tag LOCUS_07750 514 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 786 1550 gene locus_tag LOCUS_07760 786 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1662 2102 gene locus_tag LOCUS_07770 1662 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2820 2161 gene locus_tag LOCUS_07780 gene sanA 2820 2161 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211966.1 protein_id gnl|my_center|LOCUS_07780 3558 2995 gene locus_tag LOCUS_07790 gene sufT 3558 2995 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence166 916 392 gene locus_tag LOCUS_07800 916 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 1691 1029 gene locus_tag LOCUS_07810 1691 1029 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817296.1 protein_id gnl|my_center|LOCUS_07810 2148 1843 gene locus_tag LOCUS_07820 2148 1843 CDS product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 protein_id gnl|my_center|LOCUS_07820 3495 2275 gene locus_tag LOCUS_07830 3495 2275 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence167 1029 1451 gene locus_tag LOCUS_07840 1029 1451 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269284.1 protein_id gnl|my_center|LOCUS_07840 1564 2061 gene locus_tag LOCUS_07850 gene secB 1564 2061 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164715.1 protein_id gnl|my_center|LOCUS_07850 2066 2791 gene locus_tag LOCUS_07860 2066 2791 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_07860 3669 2899 gene locus_tag LOCUS_07870 3669 2899 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551505.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence168 >Feature sequence169 780 181 gene locus_tag LOCUS_07880 gene cobO 780 181 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096364.1 protein_id gnl|my_center|LOCUS_07880 1147 839 gene locus_tag LOCUS_07890 1147 839 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705368.1 protein_id gnl|my_center|LOCUS_07890 2225 1236 gene locus_tag LOCUS_07900 2225 1236 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269432.1 protein_id gnl|my_center|LOCUS_07900 2968 2285 gene locus_tag LOCUS_07910 2968 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence170 903 310 gene locus_tag LOCUS_07920 903 310 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 protein_id gnl|my_center|LOCUS_07920 1541 1212 gene locus_tag LOCUS_07930 1541 1212 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_07930 1818 3167 gene locus_tag LOCUS_07940 gene miaB 1818 3167 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093158.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence171 1624 1385 gene locus_tag LOCUS_07950 1624 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1794 2750 gene locus_tag LOCUS_07960 gene nadC 1794 2750 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_07960 2755 3909 gene locus_tag LOCUS_07970 2755 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence172 3594 1531 gene locus_tag LOCUS_07980 gene betT 3594 1531 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704693.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence173 896 1120 gene locus_tag LOCUS_07990 896 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1233 1760 gene locus_tag LOCUS_08000 1233 1760 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_08000 2625 1699 gene locus_tag LOCUS_08010 2625 1699 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338116.1 protein_id gnl|my_center|LOCUS_08010 <3991 2622 gene locus_tag LOCUS_08020 <3991 2622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106515452.1:phytoene desaturase >Feature sequence174 1291 17 gene locus_tag LOCUS_08030 1291 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2016 1288 gene locus_tag LOCUS_08040 2016 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2630 2238 gene locus_tag LOCUS_08050 2630 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 <3989 3196 gene locus_tag LOCUS_08060 <3989 3196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729414.1:wax ester/triacylglycerol synthase family O-acyltransferase >Feature sequence175 755 177 gene locus_tag LOCUS_08070 755 177 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724673.1 protein_id gnl|my_center|LOCUS_08070 1250 828 gene locus_tag LOCUS_08080 1250 828 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404557.1 protein_id gnl|my_center|LOCUS_08080 1753 1959 gene locus_tag LOCUS_08090 1753 1959 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 protein_id gnl|my_center|LOCUS_08090 2512 2072 gene locus_tag LOCUS_08100 2512 2072 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 protein_id gnl|my_center|LOCUS_08100 3506 2577 gene locus_tag LOCUS_08110 gene yegS 3506 2577 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477542.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence176 2834 396 gene locus_tag LOCUS_08120 gene rnr 2834 396 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 protein_id gnl|my_center|LOCUS_08120 3104 3190 gene locus_tag LOCUS_t00090 3104 3190 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <3972 3316 gene locus_tag LOCUS_08130 <3972 3316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459147.1:DNA/RNA non-specific endonuclease >Feature sequence177 3063 2272 gene locus_tag LOCUS_08140 3063 2272 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228477.1 protein_id gnl|my_center|LOCUS_08140 3728 3060 gene locus_tag LOCUS_08150 3728 3060 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937417.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence178 2089 1187 gene locus_tag LOCUS_08160 2089 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3639 2170 gene locus_tag LOCUS_08170 3639 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence179 47 2929 gene locus_tag LOCUS_08180 47 2929 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_08180 2916 3815 gene locus_tag LOCUS_08190 2916 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence180 1346 897 gene locus_tag LOCUS_08200 1346 897 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_08200 2370 1339 gene locus_tag LOCUS_08210 2370 1339 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261355.1 protein_id gnl|my_center|LOCUS_08210 2577 2903 gene locus_tag LOCUS_08220 2577 2903 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369955.1 protein_id gnl|my_center|LOCUS_08220 3549 2995 gene locus_tag LOCUS_08230 gene oprG 3549 2995 CDS product outer membrane protein OprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093337.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence181 588 40 gene locus_tag LOCUS_08240 588 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1605 601 gene locus_tag LOCUS_08250 1605 601 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974537.1 protein_id gnl|my_center|LOCUS_08250 3267 1681 gene locus_tag LOCUS_08260 3267 1681 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723837.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence182 331 1326 gene locus_tag LOCUS_08270 331 1326 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336874.1 protein_id gnl|my_center|LOCUS_08270 1523 2059 gene locus_tag LOCUS_08280 1523 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2065 3600 gene locus_tag LOCUS_08290 2065 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence183 <1 686 gene locus_tag LOCUS_08300 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105529.1:5-(carboxyamino)imidazole ribonucleotide synthase 1268 786 gene locus_tag LOCUS_08310 gene bfrB 1268 786 CDS product bacterioferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092078.1 protein_id gnl|my_center|LOCUS_08310 1815 1612 gene locus_tag LOCUS_08320 1815 1612 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003350768.1 protein_id gnl|my_center|LOCUS_08320 2893 2135 gene locus_tag LOCUS_08330 2893 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3870 2914 gene locus_tag LOCUS_08340 3870 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence184 1260 3779 gene locus_tag LOCUS_08350 gene ybiO 1260 3779 CDS product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704820.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence185 355 2499 gene locus_tag LOCUS_08360 gene foxA 355 2499 CDS product ferrioxamine B receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127727.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence186 <1 788 gene locus_tag LOCUS_08370 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478448.1:glycine cleavage system aminomethyltransferase GcvT 1526 909 gene locus_tag LOCUS_08380 1526 909 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_08380 2091 1534 gene locus_tag LOCUS_08390 2091 1534 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_08390 3217 2060 gene locus_tag LOCUS_08400 3217 2060 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_08400 3715 3365 gene locus_tag LOCUS_08410 3715 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence187 <1 565 gene locus_tag LOCUS_08420 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002217034.1:tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ 2342 666 gene locus_tag LOCUS_08430 gene rpsA 2342 666 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_08430 3247 2567 gene locus_tag LOCUS_08440 gene cmk 3247 2567 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616463.1 protein_id gnl|my_center|LOCUS_08440 3618 3244 gene locus_tag LOCUS_08450 3618 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence188 758 1213 gene locus_tag LOCUS_08460 758 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1527 3002 gene locus_tag LOCUS_08470 1527 3002 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence189 <1 1156 gene locus_tag LOCUS_08480 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036696.1:AGE family epimerase/isomerase 2338 1145 gene locus_tag LOCUS_08490 2338 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2303 3475 gene locus_tag LOCUS_08500 2303 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3527 3841 gene locus_tag LOCUS_08510 3527 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence190 662 306 gene locus_tag LOCUS_08520 gene tnpB 662 306 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 protein_id gnl|my_center|LOCUS_08520 868 659 gene locus_tag LOCUS_08530 868 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1580 3151 gene locus_tag LOCUS_08540 1580 3151 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720404.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence191 1139 342 gene locus_tag LOCUS_08550 1139 342 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103002.1 protein_id gnl|my_center|LOCUS_08550 2089 1139 gene locus_tag LOCUS_08560 gene hemC 2089 1139 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703979.1 protein_id gnl|my_center|LOCUS_08560 2466 3803 gene locus_tag LOCUS_08570 gene argH 2466 3803 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103000.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence192 155 988 gene locus_tag LOCUS_08580 155 988 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707806.1 protein_id gnl|my_center|LOCUS_08580 1504 1031 gene locus_tag LOCUS_08590 1504 1031 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114769.1 protein_id gnl|my_center|LOCUS_08590 2436 1636 gene locus_tag LOCUS_08600 gene metQ 2436 1636 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704853.1 protein_id gnl|my_center|LOCUS_08600 3234 2581 gene locus_tag LOCUS_08610 3234 2581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 protein_id gnl|my_center|LOCUS_08610 <3797 3215 gene locus_tag LOCUS_08620 <3797 3215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704855.1:methionine ABC transporter ATP-binding protein MetN >Feature sequence193 1009 1845 gene locus_tag LOCUS_08630 1009 1845 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_08630 1963 2568 gene locus_tag LOCUS_08640 1963 2568 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 protein_id gnl|my_center|LOCUS_08640 3209 2598 gene locus_tag LOCUS_08650 3209 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 3594 3442 gene locus_tag LOCUS_08660 3594 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence194 2109 1573 gene locus_tag LOCUS_08670 2109 1573 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703720.1 protein_id gnl|my_center|LOCUS_08670 3158 2169 gene locus_tag LOCUS_08680 3158 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08680 <3793 3155 gene locus_tag LOCUS_08690 <3793 3155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105311.1:glycosyltransferase family 2 protein >Feature sequence195 403 696 gene locus_tag LOCUS_08700 403 696 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110276.1 protein_id gnl|my_center|LOCUS_08700 1201 794 gene locus_tag LOCUS_08710 1201 794 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895859.1 protein_id gnl|my_center|LOCUS_08710 1813 1217 gene locus_tag LOCUS_08720 1813 1217 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389865.1 protein_id gnl|my_center|LOCUS_08720 2115 3104 gene locus_tag LOCUS_08730 2115 3104 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_08730 3665 3123 gene locus_tag LOCUS_08740 3665 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence196 1336 1043 gene locus_tag LOCUS_08750 1336 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2848 1463 gene locus_tag LOCUS_08760 gene dnaB 2848 1463 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317209.1 protein_id gnl|my_center|LOCUS_08760 3471 3025 gene locus_tag LOCUS_08770 gene rplI 3471 3025 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence197 523 684 gene locus_tag LOCUS_08780 523 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1012 770 gene locus_tag LOCUS_08790 1012 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1605 1147 gene locus_tag LOCUS_08800 1605 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 <3768 1602 gene locus_tag LOCUS_08810 <3768 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268332.1:type I DNA topoisomerase >Feature sequence198 834 490 gene locus_tag LOCUS_08820 834 490 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494473.1 protein_id gnl|my_center|LOCUS_08820 1246 2163 gene locus_tag LOCUS_08830 gene argF 1246 2163 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412919.1 protein_id gnl|my_center|LOCUS_08830 2855 2229 gene locus_tag LOCUS_08840 2855 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3285 2995 gene locus_tag LOCUS_08850 3285 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence199 1420 2760 gene locus_tag LOCUS_08860 1420 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence200 1977 538 gene locus_tag LOCUS_08870 gene hemG 1977 538 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383354.1 protein_id gnl|my_center|LOCUS_08870 3441 2071 gene locus_tag LOCUS_08880 3441 2071 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence201 681 322 gene locus_tag LOCUS_08890 681 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2733 835 gene locus_tag LOCUS_08900 gene ftsH 2733 835 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_08900 3369 2737 gene locus_tag LOCUS_08910 3369 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence202 344 880 gene locus_tag LOCUS_08920 344 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1266 1943 gene locus_tag LOCUS_08930 1266 1943 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_08930 2011 3645 gene locus_tag LOCUS_08940 2011 3645 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence203 379 1284 gene locus_tag LOCUS_08950 379 1284 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530537.1 protein_id gnl|my_center|LOCUS_08950 1408 2178 gene locus_tag LOCUS_08960 1408 2178 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224211.1 protein_id gnl|my_center|LOCUS_08960 2289 2720 gene locus_tag LOCUS_08970 2289 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2790 3104 gene locus_tag LOCUS_08980 2790 3104 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972805.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence204 2 376 gene locus_tag LOCUS_08990 2 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1054 410 gene locus_tag LOCUS_09000 1054 410 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_09000 1755 1099 gene locus_tag LOCUS_09010 gene grxB 1755 1099 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780921.1 protein_id gnl|my_center|LOCUS_09010 2135 1887 gene locus_tag LOCUS_09020 2135 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2242 3273 gene locus_tag LOCUS_09030 2242 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence205 398 964 gene locus_tag LOCUS_09040 gene dcd 398 964 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 protein_id gnl|my_center|LOCUS_09040 2326 1241 gene locus_tag LOCUS_09050 2326 1241 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032887275.1 protein_id gnl|my_center|LOCUS_09050 3266 2514 gene locus_tag LOCUS_09060 gene purN 3266 2514 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766657.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence206 2069 1347 gene locus_tag LOCUS_09070 2069 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2068 2790 gene locus_tag LOCUS_09080 2068 2790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence207 1253 369 gene locus_tag LOCUS_09090 1253 369 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_09090 1507 1241 gene locus_tag LOCUS_09100 1507 1241 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 protein_id gnl|my_center|LOCUS_09100 2361 1504 gene locus_tag LOCUS_09110 2361 1504 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_09110 <3701 2758 gene locus_tag LOCUS_09120 <3701 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091336.1:metallophosphoesterase >Feature sequence208 1997 3376 gene locus_tag LOCUS_09130 1997 3376 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776660.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence209 748 2109 gene locus_tag LOCUS_09140 748 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3245 2259 gene locus_tag LOCUS_09150 3245 2259 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369595.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence210 1129 1629 gene locus_tag LOCUS_09160 1129 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1703 2746 gene locus_tag LOCUS_09170 1703 2746 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_09170 2759 3013 gene locus_tag LOCUS_09180 2759 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence211 249 1574 gene locus_tag LOCUS_09190 gene guaD 249 1574 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419799.1 protein_id gnl|my_center|LOCUS_09190 2652 1687 gene locus_tag LOCUS_09200 2652 1687 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 protein_id gnl|my_center|LOCUS_09200 3299 2652 gene locus_tag LOCUS_09210 3299 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence212 <1 521 gene locus_tag LOCUS_09220 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103968156.1:AsmA-like C-terminal region-containing protein 518 1987 gene locus_tag LOCUS_09230 gene tldD 518 1987 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 protein_id gnl|my_center|LOCUS_09230 2566 2051 gene locus_tag LOCUS_09240 gene yjgA 2566 2051 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417486.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence213 1363 254 gene locus_tag LOCUS_09250 1363 254 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940064.1 protein_id gnl|my_center|LOCUS_09250 1627 2583 gene locus_tag LOCUS_09260 1627 2583 CDS product sugar phosphate isomerase/epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421554.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence214 389 1366 gene locus_tag LOCUS_09270 389 1366 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 protein_id gnl|my_center|LOCUS_09270 1587 2117 gene locus_tag LOCUS_09280 1587 2117 CDS product DUF5943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103127.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence215 1418 633 gene locus_tag LOCUS_09290 gene fdhD 1418 633 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809308.1 protein_id gnl|my_center|LOCUS_09290 2261 2686 gene locus_tag LOCUS_09300 2261 2686 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406157.1 protein_id gnl|my_center|LOCUS_09300 <3670 2780 gene locus_tag LOCUS_09310 <3670 2780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066990.1:nickel/cobalt transporter >Feature sequence216 780 463 gene locus_tag LOCUS_09320 780 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09320 793 1518 gene locus_tag LOCUS_09330 793 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1523 2803 gene locus_tag LOCUS_09340 1523 2803 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence217 252 470 gene locus_tag LOCUS_09350 252 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 470 1474 gene locus_tag LOCUS_09360 470 1474 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091654.1 protein_id gnl|my_center|LOCUS_09360 1480 3564 gene locus_tag LOCUS_09370 1480 3564 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113160.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence218 3410 636 gene locus_tag LOCUS_09380 gene nuoG 3410 636 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113377.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence219 1699 956 gene locus_tag LOCUS_09390 1699 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2119 1712 gene locus_tag LOCUS_09400 2119 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3126 2116 gene locus_tag LOCUS_09410 3126 2116 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532293.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence220 2156 861 gene locus_tag LOCUS_09420 2156 861 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626156.1 protein_id gnl|my_center|LOCUS_09420 <3657 2359 gene locus_tag LOCUS_09430 <3657 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001309217.1:quinoprotein glucose dehydrogenase >Feature sequence221 188 2221 gene locus_tag LOCUS_09440 188 2221 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537232.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence222 378 878 gene locus_tag LOCUS_09450 378 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09450 1053 2075 gene locus_tag LOCUS_09460 1053 2075 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_09460 3172 2147 gene locus_tag LOCUS_09470 gene dusA 3172 2147 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence223 100 681 gene locus_tag LOCUS_09480 100 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 864 1460 gene locus_tag LOCUS_09490 864 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1538 3412 gene locus_tag LOCUS_09500 1538 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence224 536 30 gene locus_tag LOCUS_09510 536 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1067 555 gene locus_tag LOCUS_09520 gene pal 1067 555 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176628.1 protein_id gnl|my_center|LOCUS_09520 2428 1115 gene locus_tag LOCUS_09530 gene tolB 2428 1115 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339472.1 protein_id gnl|my_center|LOCUS_09530 3078 2440 gene locus_tag LOCUS_09540 3078 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence225 2812 2102 gene locus_tag LOCUS_09550 2812 2102 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316554.1 protein_id gnl|my_center|LOCUS_09550 <3613 2827 gene locus_tag LOCUS_09560 <3613 2827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769628.1:succinate dehydrogenase flavoprotein subunit >Feature sequence226 596 246 gene locus_tag LOCUS_09570 596 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1758 691 gene locus_tag LOCUS_09580 1758 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3386 1773 gene locus_tag LOCUS_09590 3386 1773 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114225.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence227 265 1485 gene locus_tag LOCUS_09600 265 1485 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_09600 1700 1987 gene locus_tag LOCUS_09610 1700 1987 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_09610 1993 2661 gene locus_tag LOCUS_09620 gene lipB 1993 2661 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261452.1 protein_id gnl|my_center|LOCUS_09620 2697 3455 gene locus_tag LOCUS_09630 2697 3455 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820420.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence228 251 96 gene locus_tag LOCUS_09640 251 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 342 926 gene locus_tag LOCUS_09650 342 926 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054718.1 protein_id gnl|my_center|LOCUS_09650 1526 927 gene locus_tag LOCUS_09660 1526 927 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975511.1 protein_id gnl|my_center|LOCUS_09660 2402 1626 gene locus_tag LOCUS_09670 gene djlA 2402 1626 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417332.1 protein_id gnl|my_center|LOCUS_09670 3273 2413 gene locus_tag LOCUS_09680 3273 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence229 2231 138 gene locus_tag LOCUS_09690 2231 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2671 2228 gene locus_tag LOCUS_09700 2671 2228 CDS product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence230 <1 655 gene locus_tag LOCUS_09710 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706534.1:2-isopropylmalate synthase 1320 772 gene locus_tag LOCUS_09720 1320 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1999 1340 gene locus_tag LOCUS_09730 1999 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 3020 2172 gene locus_tag LOCUS_09740 3020 2172 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815895.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence231 85 1275 gene locus_tag LOCUS_09750 gene recF 85 1275 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_09750 1302 1754 gene locus_tag LOCUS_09760 1302 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2347 1724 gene locus_tag LOCUS_09770 gene lspA 2347 1724 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 protein_id gnl|my_center|LOCUS_09770 <3558 2340 gene locus_tag LOCUS_09780 <3558 2340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103291.1:isoleucine--tRNA ligase >Feature sequence232 632 1363 gene locus_tag LOCUS_09790 632 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09790 1424 1741 gene locus_tag LOCUS_09800 1424 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09800 2000 3205 gene locus_tag LOCUS_09810 2000 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence233 1196 3400 gene locus_tag LOCUS_09820 1196 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence234 135 1709 gene locus_tag LOCUS_09830 135 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2697 1738 gene locus_tag LOCUS_09840 2697 1738 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820327.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence235 772 1758 gene locus_tag LOCUS_09850 772 1758 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_09850 1891 3081 gene locus_tag LOCUS_09860 1891 3081 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114240.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence236 16 924 gene locus_tag LOCUS_09870 16 924 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_09870 953 2317 gene locus_tag LOCUS_09880 gene dnaB 953 2317 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317209.1 protein_id gnl|my_center|LOCUS_09880 2314 2727 gene locus_tag LOCUS_09890 2314 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence237 2524 1451 gene locus_tag LOCUS_09900 2524 1451 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243977.1 protein_id gnl|my_center|LOCUS_09900 <3519 2630 gene locus_tag LOCUS_09910 <3519 2630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007247147.1:DNA topoisomerase IB >Feature sequence238 54 692 gene locus_tag LOCUS_09920 54 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 956 1567 gene locus_tag LOCUS_09930 956 1567 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659678.1 protein_id gnl|my_center|LOCUS_09930 2205 1699 gene locus_tag LOCUS_09940 2205 1699 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_09940 2386 2673 gene locus_tag LOCUS_09950 2386 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 <3518 2807 gene locus_tag LOCUS_09960 <3518 2807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389754.1:lipid A deacylase LpxR family protein >Feature sequence239 1477 605 gene locus_tag LOCUS_09970 1477 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1653 2420 gene locus_tag LOCUS_09980 gene gloB 1653 2420 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939287.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence240 <1 820 gene locus_tag LOCUS_09990 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707724.1:HAMP domain-containing sensor histidine kinase 805 1341 gene locus_tag LOCUS_10000 805 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1523 2953 gene locus_tag LOCUS_10010 gene glrR 1523 2953 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_10010 3037 3495 gene locus_tag LOCUS_10020 3037 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence241 <1 504 gene locus_tag LOCUS_10030 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088782.1:FAD-binding and (Fe-S)-binding domain-containing protein 772 2331 gene locus_tag LOCUS_10040 772 2331 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_10040 2408 3337 gene locus_tag LOCUS_10050 2408 3337 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085989.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence242 292 1644 gene locus_tag LOCUS_10060 gene fliI 292 1644 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_10060 1877 2335 gene locus_tag LOCUS_10070 gene fliJ 1877 2335 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367295.1 protein_id gnl|my_center|LOCUS_10070 2600 2385 gene locus_tag LOCUS_10080 2600 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence243 2187 763 gene locus_tag LOCUS_10090 gene rlmD 2187 763 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 protein_id gnl|my_center|LOCUS_10090 3086 2190 gene locus_tag LOCUS_10100 gene cysM 3086 2190 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616363.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence244 1695 139 gene locus_tag LOCUS_10110 gene treF 1695 139 CDS product alpha,alpha-trehalase TreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934251.1 protein_id gnl|my_center|LOCUS_10110 2509 1745 gene locus_tag LOCUS_10120 2509 1745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence245 1920 106 gene locus_tag LOCUS_10130 1920 106 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_10130 2697 2098 gene locus_tag LOCUS_10140 2697 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3016 3384 gene locus_tag LOCUS_10150 3016 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence246 287 1258 gene locus_tag LOCUS_10160 287 1258 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_10160 1415 1813 gene locus_tag LOCUS_10170 1415 1813 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_10170 1810 2874 gene locus_tag LOCUS_10180 1810 2874 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_10180 2874 3251 gene locus_tag LOCUS_10190 2874 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence247 1018 1560 gene locus_tag LOCUS_10200 1018 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3050 1791 gene locus_tag LOCUS_10210 3050 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830606.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence248 616 2457 gene locus_tag LOCUS_10220 616 2457 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429522.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence249 2090 570 gene locus_tag LOCUS_10230 2090 570 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267554.1 protein_id gnl|my_center|LOCUS_10230 2306 3253 gene locus_tag LOCUS_10240 2306 3253 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408081.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence250 <1 1462 gene locus_tag LOCUS_10250 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_105062910.1:TMAO reductase system sensor histidine kinase/response regulator TorS 2136 1432 gene locus_tag LOCUS_10260 2136 1432 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626143.1 protein_id gnl|my_center|LOCUS_10260 2568 2245 gene locus_tag LOCUS_10270 2568 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3294 2770 gene locus_tag LOCUS_10280 3294 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence251 2242 2027 gene locus_tag LOCUS_10290 gene rpsU 2242 2027 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence252 <1 1192 gene locus_tag LOCUS_10300 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038855.1:conjugal transfer protein TraG N-terminal domain-containing protein 1652 2080 gene locus_tag LOCUS_10310 1652 2080 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388571.1 protein_id gnl|my_center|LOCUS_10310 2182 2595 gene locus_tag LOCUS_10320 2182 2595 CDS product RES domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525336.1 protein_id gnl|my_center|LOCUS_10320 3151 2729 gene locus_tag LOCUS_10330 3151 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence253 984 1286 gene locus_tag LOCUS_10340 984 1286 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117857.1 protein_id gnl|my_center|LOCUS_10340 1739 1359 gene locus_tag LOCUS_10350 1739 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2796 1885 gene locus_tag LOCUS_10360 2796 1885 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268819.1 protein_id gnl|my_center|LOCUS_10360 2886 3398 gene locus_tag LOCUS_10370 2886 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence254 823 188 gene locus_tag LOCUS_10380 823 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2162 825 gene locus_tag LOCUS_10390 gene sufD 2162 825 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_10390 2911 2159 gene locus_tag LOCUS_10400 gene sufC 2911 2159 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence255 1070 2053 gene locus_tag LOCUS_10410 1070 2053 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_10410 2777 2166 gene locus_tag LOCUS_10420 2777 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3125 3341 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaccgatgctaataaaaaaactgg >Feature sequence256 1352 888 gene locus_tag LOCUS_10430 1352 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10430 1855 1349 gene locus_tag LOCUS_10440 1855 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2811 1852 gene locus_tag LOCUS_10450 2811 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence257 843 526 gene locus_tag LOCUS_10460 843 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1858 818 gene locus_tag LOCUS_10470 1858 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2281 3414 gene locus_tag LOCUS_10480 2281 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence258 135 1721 gene locus_tag LOCUS_10490 135 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2939 1722 gene locus_tag LOCUS_10500 2939 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence259 3023 1842 gene locus_tag LOCUS_10510 gene carA 3023 1842 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400160.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence260 110 979 gene locus_tag LOCUS_10520 110 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10520 1911 1168 gene locus_tag LOCUS_10530 1911 1168 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927020.1 protein_id gnl|my_center|LOCUS_10530 2293 2003 gene locus_tag LOCUS_10540 gene catC 2293 2003 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897236.1 protein_id gnl|my_center|LOCUS_10540 2633 2337 gene locus_tag LOCUS_10550 2633 2337 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807672.1 protein_id gnl|my_center|LOCUS_10550 <3400 2660 gene locus_tag LOCUS_10560 <3400 2660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033446639.1:TIGR00366 family protein >Feature sequence261 466 89 gene locus_tag LOCUS_10570 466 89 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_10570 735 1691 gene locus_tag LOCUS_10580 gene pip 735 1691 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211090.1 protein_id gnl|my_center|LOCUS_10580 2921 1731 gene locus_tag LOCUS_10590 2921 1731 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104091.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence262 1029 97 gene locus_tag LOCUS_10600 1029 97 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_10600 1400 1675 gene locus_tag LOCUS_10610 1400 1675 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929971.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence263 717 1028 gene locus_tag LOCUS_10620 717 1028 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 protein_id gnl|my_center|LOCUS_10620 1133 1411 gene locus_tag LOCUS_10630 1133 1411 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101349.1 protein_id gnl|my_center|LOCUS_10630 1693 1881 gene locus_tag LOCUS_10640 1693 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3191 2007 gene locus_tag LOCUS_10650 3191 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence264 2253 1849 gene locus_tag LOCUS_10660 gene gcvH 2253 1849 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 protein_id gnl|my_center|LOCUS_10660 2756 3169 gene locus_tag LOCUS_10670 2756 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence265 495 635 gene locus_tag LOCUS_10680 495 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 639 1817 gene locus_tag LOCUS_10690 639 1817 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_10690 1814 2902 gene locus_tag LOCUS_10700 1814 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence266 807 1397 gene locus_tag LOCUS_10710 807 1397 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 protein_id gnl|my_center|LOCUS_10710 2147 1500 gene locus_tag LOCUS_10720 gene rutR 2147 1500 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097192.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence267 940 275 gene locus_tag LOCUS_10730 940 275 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_10730 950 1117 gene locus_tag LOCUS_10740 950 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2180 1236 gene locus_tag LOCUS_10750 2180 1236 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence268 383 54 gene locus_tag LOCUS_10760 383 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1431 523 gene locus_tag LOCUS_10770 1431 523 CDS product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268701.1 protein_id gnl|my_center|LOCUS_10770 1849 3162 gene locus_tag LOCUS_10780 1849 3162 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707414.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence269 359 42 gene locus_tag LOCUS_10790 359 42 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402017.1 protein_id gnl|my_center|LOCUS_10790 1458 340 gene locus_tag LOCUS_10800 1458 340 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808671.1 protein_id gnl|my_center|LOCUS_10800 1551 2465 gene locus_tag LOCUS_10810 1551 2465 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083069.1 protein_id gnl|my_center|LOCUS_10810 2554 2901 gene locus_tag LOCUS_10820 2554 2901 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089924.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence270 2150 1140 gene locus_tag LOCUS_10830 gene gguC 2150 1140 CDS product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267192.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence271 475 1269 gene locus_tag LOCUS_10840 475 1269 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388722.1 protein_id gnl|my_center|LOCUS_10840 1378 2304 gene locus_tag LOCUS_10850 1378 2304 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388723.1 protein_id gnl|my_center|LOCUS_10850 2315 3025 gene locus_tag LOCUS_10860 2315 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence272 377 27 gene locus_tag LOCUS_10870 377 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1509 358 gene locus_tag LOCUS_10880 1509 358 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_10880 2260 1514 gene locus_tag LOCUS_10890 2260 1514 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_10890 2937 2260 gene locus_tag LOCUS_10900 2937 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence273 <3307 1996 gene locus_tag LOCUS_10910 <3307 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256867.1:multicopper oxidase domain-containing protein >Feature sequence274 1334 2797 gene locus_tag LOCUS_10920 1334 2797 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729105.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence275 139 564 gene locus_tag LOCUS_10930 139 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 815 480 gene locus_tag LOCUS_10940 815 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1128 919 gene locus_tag LOCUS_10950 1128 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 <3296 1284 gene locus_tag LOCUS_10960 <3296 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003101982.1:endopeptidase La >Feature sequence276 457 1620 gene locus_tag LOCUS_10970 gene flhB 457 1620 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence277 1437 889 gene locus_tag LOCUS_10980 1437 889 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_10980 1639 2325 gene locus_tag LOCUS_10990 1639 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 <3292 2433 gene locus_tag LOCUS_11000 <3292 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812060.1:FAD-dependent oxidoreductase >Feature sequence278 365 877 gene locus_tag LOCUS_11010 365 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1724 1206 gene locus_tag LOCUS_11020 1724 1206 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_11020 2689 1913 gene locus_tag LOCUS_11030 2689 1913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 protein_id gnl|my_center|LOCUS_11030 2960 2682 gene locus_tag LOCUS_11040 2960 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11040 >Feature sequence279 1194 205 gene locus_tag LOCUS_11050 1194 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2149 1382 gene locus_tag LOCUS_11060 2149 1382 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307174.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence280 1273 365 gene locus_tag LOCUS_11070 1273 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2099 1524 gene locus_tag LOCUS_11080 2099 1524 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728973.1 protein_id gnl|my_center|LOCUS_11080 2330 2626 gene locus_tag LOCUS_11090 2330 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2634 2978 gene locus_tag LOCUS_11100 2634 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence281 1629 625 gene locus_tag LOCUS_11110 1629 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2635 1793 gene locus_tag LOCUS_11120 2635 1793 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816194.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence282 665 1708 gene locus_tag LOCUS_11130 gene pstS 665 1708 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965256.1 protein_id gnl|my_center|LOCUS_11130 1815 2759 gene locus_tag LOCUS_11140 gene pstC 1815 2759 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770815.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence283 1144 221 gene locus_tag LOCUS_11150 1144 221 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257820.1 protein_id gnl|my_center|LOCUS_11150 2129 1362 gene locus_tag LOCUS_11160 2129 1362 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389976.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence284 <1 1121 gene locus_tag LOCUS_11170 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003904641.1:DNA polymerase IV 1476 1661 gene locus_tag LOCUS_11180 1476 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence285 948 1214 gene locus_tag LOCUS_11190 948 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1211 1447 gene locus_tag LOCUS_11200 1211 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1516 2520 gene locus_tag LOCUS_11210 1516 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2533 3018 gene locus_tag LOCUS_11220 2533 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence286 426 94 gene locus_tag LOCUS_11230 426 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1202 441 gene locus_tag LOCUS_11240 1202 441 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence287 584 1624 gene locus_tag LOCUS_11250 584 1624 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_11250 2282 1752 gene locus_tag LOCUS_11260 gene ppa 2282 1752 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093248.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence288 3032 969 gene locus_tag LOCUS_11270 gene metG 3032 969 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence289 557 69 gene locus_tag LOCUS_11280 557 69 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275291.1 protein_id gnl|my_center|LOCUS_11280 835 1041 gene locus_tag LOCUS_11290 835 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1224 2084 gene locus_tag LOCUS_11300 1224 2084 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227634.1 protein_id gnl|my_center|LOCUS_11300 2844 2209 gene locus_tag LOCUS_11310 2844 2209 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence290 649 1551 gene locus_tag LOCUS_11320 gene htpX 649 1551 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_11320 1749 2171 gene locus_tag LOCUS_11330 1749 2171 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065598186.1 protein_id gnl|my_center|LOCUS_11330 2183 2953 gene locus_tag LOCUS_11340 2183 2953 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146406780.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence291 852 1580 gene locus_tag LOCUS_11350 852 1580 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_11350 1787 2740 gene locus_tag LOCUS_11360 gene panS 1787 2740 CDS product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence292 <1 1223 gene locus_tag LOCUS_11370 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388774.1:FAD-binding oxidoreductase 1253 2392 gene locus_tag LOCUS_11380 1253 2392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence293 1975 938 gene locus_tag LOCUS_11390 gene mreB 1975 938 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_11390 2234 2551 gene locus_tag LOCUS_11400 gene gatC 2234 2551 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence294 706 1866 gene locus_tag LOCUS_11410 706 1866 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_11410 1878 2531 gene locus_tag LOCUS_11420 1878 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence295 1517 1996 gene locus_tag LOCUS_11430 1517 1996 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence296 1767 2360 gene locus_tag LOCUS_11440 gene hisB 1767 2360 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence297 213 2060 gene locus_tag LOCUS_11450 213 2060 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584026.1 protein_id gnl|my_center|LOCUS_11450 2077 2979 gene locus_tag LOCUS_11460 2077 2979 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190154.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence298 172 642 gene locus_tag LOCUS_11470 172 642 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_11470 1747 662 gene locus_tag LOCUS_11480 1747 662 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_11480 1995 1744 gene locus_tag LOCUS_11490 1995 1744 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence299 729 142 gene locus_tag LOCUS_11500 729 142 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_11500 1374 820 gene locus_tag LOCUS_11510 1374 820 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_11510 <3170 1960 gene locus_tag LOCUS_11520 <3170 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113933.1:O-succinylhomoserine sulfhydrylase >Feature sequence300 764 111 gene locus_tag LOCUS_11530 gene queE 764 111 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085270.1 protein_id gnl|my_center|LOCUS_11530 1527 880 gene locus_tag LOCUS_11540 gene queC 1527 880 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_11540 2697 1639 gene locus_tag LOCUS_11550 gene ansA 2697 1639 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072398.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence301 1516 194 gene locus_tag LOCUS_11560 1516 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2788 1784 gene locus_tag LOCUS_11570 gene rhuM 2788 1784 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence302 183 2675 gene locus_tag LOCUS_11580 183 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence303 1278 361 gene locus_tag LOCUS_11590 1278 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2234 1275 gene locus_tag LOCUS_11600 2234 1275 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 protein_id gnl|my_center|LOCUS_11600 <3143 2231 gene locus_tag LOCUS_11610 <3143 2231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004406660.1:phosphogluconate dehydratase >Feature sequence304 1553 393 gene locus_tag LOCUS_11620 1553 393 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554312.1 protein_id gnl|my_center|LOCUS_11620 1692 2105 gene locus_tag LOCUS_11630 1692 2105 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_11630 <3142 2391 gene locus_tag LOCUS_11640 <3142 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113980.1:transcription-repair coupling factor >Feature sequence305 985 53 gene locus_tag LOCUS_11650 985 53 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_11650 2288 1152 gene locus_tag LOCUS_11660 gene pqqE 2288 1152 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532078.1 protein_id gnl|my_center|LOCUS_11660 2611 2285 gene locus_tag LOCUS_11670 gene pqqD 2611 2285 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391417.1 protein_id gnl|my_center|LOCUS_11670 <3141 2608 gene locus_tag LOCUS_11680 <3141 2608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038061.1:pyrroloquinoline-quinone synthase PqqC >Feature sequence306 <1 869 gene locus_tag LOCUS_11690 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112542.1:thiolase 1036 1656 gene locus_tag LOCUS_11700 1036 1656 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 protein_id gnl|my_center|LOCUS_11700 1744 2442 gene locus_tag LOCUS_11710 1744 2442 CDS product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040504.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence307 2139 868 gene locus_tag LOCUS_11720 gene ftsA 2139 868 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_11720 <3135 2477 gene locus_tag LOCUS_11730 <3135 2477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094118.1:cell division protein FtsQ/DivIB >Feature sequence308 <1 627 gene locus_tag LOCUS_11740 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096914.1:AEC family transporter 1661 933 gene locus_tag LOCUS_11750 gene trmB 1661 933 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411920.1 protein_id gnl|my_center|LOCUS_11750 2534 1737 gene locus_tag LOCUS_11760 2534 1737 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154366.1 protein_id gnl|my_center|LOCUS_11760 2766 2566 gene locus_tag LOCUS_11770 gene thiS 2766 2566 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence309 790 338 gene locus_tag LOCUS_11780 gene rovA 790 338 CDS product virulence master transcriptional regulator RovA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706617.1 protein_id gnl|my_center|LOCUS_11780 2004 868 gene locus_tag LOCUS_11790 2004 868 CDS product DUF5924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266162.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence310 519 214 gene locus_tag LOCUS_11800 519 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1060 2205 gene locus_tag LOCUS_11810 gene argE 1060 2205 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_11810 2247 2639 gene locus_tag LOCUS_11820 2247 2639 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454676.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence311 53 880 gene locus_tag LOCUS_11830 53 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1056 2276 gene locus_tag LOCUS_11840 1056 2276 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_11840 <3123 2388 gene locus_tag LOCUS_11850 <3123 2388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123692.1:alpha-amylase family glycosyl hydrolase >Feature sequence312 292 798 gene locus_tag LOCUS_11860 292 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1805 903 gene locus_tag LOCUS_11870 1805 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2371 1802 gene locus_tag LOCUS_11880 2371 1802 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765503.1 protein_id gnl|my_center|LOCUS_11880 <3118 2368 gene locus_tag LOCUS_11890 <3118 2368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105329.1:pilus assembly protein PilM >Feature sequence313 244 1473 gene locus_tag LOCUS_11900 244 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1538 1849 gene locus_tag LOCUS_11910 1538 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 <3118 2002 gene locus_tag LOCUS_11920 <3118 2002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022389.1:DEAD/DEAH box helicase family protein >Feature sequence314 281 1246 gene locus_tag LOCUS_11930 281 1246 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528834.1 protein_id gnl|my_center|LOCUS_11930 2132 1260 gene locus_tag LOCUS_11940 2132 1260 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_11940 <3117 2083 gene locus_tag LOCUS_11950 <3117 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071668.1:monovalent cation:proton antiporter-2 (CPA2) family protein >Feature sequence315 1955 429 gene locus_tag LOCUS_11960 gene glpD 1955 429 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098460.1 protein_id gnl|my_center|LOCUS_11960 2953 2147 gene locus_tag LOCUS_11970 2953 2147 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705542.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence316 204 815 gene locus_tag LOCUS_11980 204 815 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508435.1 protein_id gnl|my_center|LOCUS_11980 1275 841 gene locus_tag LOCUS_11990 1275 841 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275140.1 protein_id gnl|my_center|LOCUS_11990 <3101 1403 gene locus_tag LOCUS_12000 <3101 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162006391.1:heavy metal translocating P-type ATPase >Feature sequence317 2045 915 gene locus_tag LOCUS_12010 2045 915 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549948.1 protein_id gnl|my_center|LOCUS_12010 2227 2967 gene locus_tag LOCUS_12020 2227 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence318 1604 468 gene locus_tag LOCUS_12030 1604 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1591 1728 gene locus_tag LOCUS_12040 1591 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1805 2503 gene locus_tag LOCUS_12050 1805 2503 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967085.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence319 1221 664 gene locus_tag LOCUS_12060 gene folK 1221 664 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103182.1 protein_id gnl|my_center|LOCUS_12060 1574 1221 gene locus_tag LOCUS_12070 gene folB 1574 1221 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_12070 1727 2410 gene locus_tag LOCUS_12080 gene plsY 1727 2410 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703522.1 protein_id gnl|my_center|LOCUS_12080 <3081 2391 gene locus_tag LOCUS_12090 <3081 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071502.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD >Feature sequence320 138 1724 gene locus_tag LOCUS_12100 138 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1861 2934 gene locus_tag LOCUS_12110 1861 2934 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence321 1291 38 gene locus_tag LOCUS_12120 1291 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1983 1411 gene locus_tag LOCUS_12130 1983 1411 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162526859.1 protein_id gnl|my_center|LOCUS_12130 <3068 1993 gene locus_tag LOCUS_12140 <3068 1993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267029.1:transglycosylase SLT domain-containing protein >Feature sequence322 2386 1505 gene locus_tag LOCUS_12150 2386 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3065 2784 gene locus_tag LOCUS_12160 3065 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence323 1242 760 gene locus_tag LOCUS_12170 1242 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2263 1598 gene locus_tag LOCUS_12180 2263 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3064 2273 gene locus_tag LOCUS_12190 3064 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence324 71 1540 gene locus_tag LOCUS_12200 gene astD 71 1540 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150128.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence325 1330 359 gene locus_tag LOCUS_12210 1330 359 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338543.1 protein_id gnl|my_center|LOCUS_12210 2174 1524 gene locus_tag LOCUS_12220 2174 1524 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105536.1 protein_id gnl|my_center|LOCUS_12220 <3058 2177 gene locus_tag LOCUS_12230 <3058 2177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338511.1:GNAT family protein >Feature sequence326 457 1314 gene locus_tag LOCUS_12240 gene fghA 457 1314 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113869.1 protein_id gnl|my_center|LOCUS_12240 1540 2481 gene locus_tag LOCUS_12250 1540 2481 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975284.1 protein_id gnl|my_center|LOCUS_12250 <3057 2530 gene locus_tag LOCUS_12260 <3057 2530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066879732.1:alpha/beta hydrolase >Feature sequence327 <1 501 gene locus_tag LOCUS_12270 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268140.1:malto-oligosyltrehalose synthase 610 1074 gene locus_tag LOCUS_12280 610 1074 CDS product DUF2934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104398.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence328 932 165 gene locus_tag LOCUS_12290 932 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1162 1797 gene locus_tag LOCUS_12300 gene ribA 1162 1797 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412070.1 protein_id gnl|my_center|LOCUS_12300 1947 2657 gene locus_tag LOCUS_12310 1947 2657 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence329 1093 821 gene locus_tag LOCUS_12320 gene hupB 1093 821 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_12320 1918 1271 gene locus_tag LOCUS_12330 1918 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1880 2419 gene locus_tag LOCUS_12340 1880 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence330 <1 576 gene locus_tag LOCUS_12350 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407723.1:RNA pseudouridine synthase 663 2759 gene locus_tag LOCUS_12360 gene fusA 663 2759 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence331 743 522 gene locus_tag LOCUS_12370 743 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2450 759 gene locus_tag LOCUS_12380 gene gatB 2450 759 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_12380 <3049 2495 gene locus_tag LOCUS_12390 <3049 2495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459730.1:carbohydrate ABC transporter permease >Feature sequence332 127 1041 gene locus_tag LOCUS_12400 127 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence333 812 1267 gene locus_tag LOCUS_12410 812 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2144 1359 gene locus_tag LOCUS_12420 2144 1359 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_12420 2719 2372 gene locus_tag LOCUS_12430 2719 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480013.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence334 931 332 gene locus_tag LOCUS_12440 931 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1347 1081 gene locus_tag LOCUS_12450 1347 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1673 1353 gene locus_tag LOCUS_12460 1673 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2209 1805 gene locus_tag LOCUS_12470 2209 1805 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902377.1 protein_id gnl|my_center|LOCUS_12470 2666 2184 gene locus_tag LOCUS_12480 2666 2184 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence335 747 148 gene locus_tag LOCUS_12490 747 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1610 744 gene locus_tag LOCUS_12500 1610 744 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_12500 2428 1622 gene locus_tag LOCUS_12510 2428 1622 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087496.1 protein_id gnl|my_center|LOCUS_12510 2647 2862 gene locus_tag LOCUS_12520 2647 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence336 112 1221 gene locus_tag LOCUS_12530 112 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1218 1985 gene locus_tag LOCUS_12540 gene yehW 1218 1985 CDS product glycine betaine ABC transporter permease YehW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783125.1 protein_id gnl|my_center|LOCUS_12540 2815 2054 gene locus_tag LOCUS_12550 2815 2054 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705502.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence337 <1 583 gene locus_tag LOCUS_12560 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815863.1:nucleotidyltransferase family protein 1643 648 gene locus_tag LOCUS_12570 1643 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence338 <1 852 gene locus_tag LOCUS_12580 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478418.1:aminomethyl-transferring glycine dehydrogenase 1895 957 gene locus_tag LOCUS_12590 1895 957 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933929.1 protein_id gnl|my_center|LOCUS_12590 2185 2472 gene locus_tag LOCUS_12600 2185 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence339 1410 799 gene locus_tag LOCUS_12610 gene imuA 1410 799 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762447.1 protein_id gnl|my_center|LOCUS_12610 2463 1606 gene locus_tag LOCUS_12620 gene hexR 2463 1606 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence340 102 554 gene locus_tag LOCUS_12630 102 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 810 1367 gene locus_tag LOCUS_12640 gene folE 810 1367 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_12640 1461 1907 gene locus_tag LOCUS_12650 1461 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence341 409 221 gene locus_tag LOCUS_12660 409 221 CDS product DUF3008 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061312.1 protein_id gnl|my_center|LOCUS_12660 691 1278 gene locus_tag LOCUS_12670 691 1278 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_12670 2109 1381 gene locus_tag LOCUS_12680 2109 1381 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence342 658 92 gene locus_tag LOCUS_12690 658 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2307 655 gene locus_tag LOCUS_12700 gene pqiB 2307 655 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457973.1 protein_id gnl|my_center|LOCUS_12700 <2995 2300 gene locus_tag LOCUS_12710 <2995 2300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707506.1:paraquat-inducible protein A >Feature sequence343 150 464 gene locus_tag LOCUS_12720 150 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 648 451 gene locus_tag LOCUS_12730 648 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 857 1630 gene locus_tag LOCUS_12740 857 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12740 1643 1897 gene locus_tag LOCUS_12750 1643 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2683 1913 gene locus_tag LOCUS_12760 2683 1913 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095486.1 protein_id gnl|my_center|LOCUS_12760 2986 2687 gene locus_tag LOCUS_12770 2986 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence344 586 86 gene locus_tag LOCUS_12780 586 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 718 1824 gene locus_tag LOCUS_12790 718 1824 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_12790 1859 2062 gene locus_tag LOCUS_12800 1859 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence345 <2981 2200 gene locus_tag LOCUS_12810 <2981 2200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066717.1:TonB-dependent receptor >Feature sequence346 389 84 gene locus_tag LOCUS_12820 389 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1253 468 gene locus_tag LOCUS_12830 1253 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1602 2930 gene locus_tag LOCUS_12840 1602 2930 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence347 920 9 gene locus_tag LOCUS_12850 920 9 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764458.1 protein_id gnl|my_center|LOCUS_12850 1103 2122 gene locus_tag LOCUS_12860 1103 2122 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400830.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence348 >Feature sequence349 276 1214 gene locus_tag LOCUS_12870 276 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1237 1560 gene locus_tag LOCUS_12880 1237 1560 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391219.1 protein_id gnl|my_center|LOCUS_12880 1576 1860 gene locus_tag LOCUS_12890 1576 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence350 217 2463 gene locus_tag LOCUS_12900 217 2463 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267646.1 protein_id gnl|my_center|LOCUS_12900 2963 2610 gene locus_tag LOCUS_12910 2963 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence351 1043 1819 gene locus_tag LOCUS_12920 1043 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 <2964 1915 gene locus_tag LOCUS_12930 <2964 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926542.1:NAD+ synthase >Feature sequence352 <1 1155 gene locus_tag LOCUS_12940 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000193219.1:mercury(II) reductase >Feature sequence353 <1 601 gene locus_tag LOCUS_12950 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000283242.1:tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO 690 1256 gene locus_tag LOCUS_12960 690 1256 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_12960 2218 1508 gene locus_tag LOCUS_12970 2218 1508 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_12970 <2955 2314 gene locus_tag LOCUS_12980 <2955 2314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112544.1:MBL fold metallo-hydrolase >Feature sequence354 242 1063 gene locus_tag LOCUS_12990 242 1063 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092207.1 protein_id gnl|my_center|LOCUS_12990 2096 1065 gene locus_tag LOCUS_13000 2096 1065 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926366.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence355 <1 979 gene locus_tag LOCUS_13010 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532971.1:ABC transporter substrate-binding protein 1073 2209 gene locus_tag LOCUS_13020 1073 2209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966039.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence356 2302 713 gene locus_tag LOCUS_13030 2302 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2633 2289 gene locus_tag LOCUS_13040 gene arsC 2633 2289 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103671.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence357 1709 462 gene locus_tag LOCUS_13050 1709 462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930671.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence358 249 683 gene locus_tag LOCUS_13060 249 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 847 1572 gene locus_tag LOCUS_13070 847 1572 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198629.1 protein_id gnl|my_center|LOCUS_13070 2598 1645 gene locus_tag LOCUS_13080 2598 1645 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112461.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence359 2011 1220 gene locus_tag LOCUS_13090 gene map 2011 1220 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018214.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence360 2700 973 gene locus_tag LOCUS_13100 gene pilB 2700 973 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence361 437 174 gene locus_tag LOCUS_13110 437 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 914 2011 gene locus_tag LOCUS_13120 gene mtnA 914 2011 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_13120 2020 2796 gene locus_tag LOCUS_13130 2020 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence362 1183 158 gene locus_tag LOCUS_13140 1183 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence363 <1 611 gene locus_tag LOCUS_13150 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005169305.1:UDP-glucose/GDP-mannose dehydrogenase family protein 769 2415 gene locus_tag LOCUS_13160 gene alg8 769 2415 CDS product mannuronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119545.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence364 <1 542 gene locus_tag LOCUS_13170 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222287.1:hydroxyacid-oxoacid transhydrogenase 710 985 gene locus_tag LOCUS_13180 710 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1053 1952 gene locus_tag LOCUS_13190 1053 1952 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence365 358 1125 gene locus_tag LOCUS_13200 gene ygaZ 358 1125 CDS product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445659.1 protein_id gnl|my_center|LOCUS_13200 1122 1469 gene locus_tag LOCUS_13210 1122 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 <2916 1583 gene locus_tag LOCUS_13220 <2916 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941614.1:EAL domain-containing protein >Feature sequence366 269 661 gene locus_tag LOCUS_13230 269 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 848 1789 gene locus_tag LOCUS_13240 gene ilvE 848 1789 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930783.1 protein_id gnl|my_center|LOCUS_13240 1831 2436 gene locus_tag LOCUS_13250 gene plsY 1831 2436 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085061.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence367 <1 764 gene locus_tag LOCUS_13260 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090432.1:ATP-dependent Clp protease ATP-binding subunit ClpA 1165 947 gene locus_tag LOCUS_13270 gene infA 1165 947 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947496.1 protein_id gnl|my_center|LOCUS_13270 2203 1445 gene locus_tag LOCUS_13280 2203 1445 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767401.1 protein_id gnl|my_center|LOCUS_13280 <2909 2200 gene locus_tag LOCUS_13290 <2909 2200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405081.1:leucyl/phenylalanyl-tRNA--protein transferase >Feature sequence368 <1 636 gene locus_tag LOCUS_13300 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400772.1:LysR family transcriptional regulator 894 1091 gene locus_tag LOCUS_13310 894 1091 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400770.1 protein_id gnl|my_center|LOCUS_13310 2084 1233 gene locus_tag LOCUS_13320 2084 1233 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067128.1 protein_id gnl|my_center|LOCUS_13320 <2906 2081 gene locus_tag LOCUS_13330 <2906 2081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970362.1:metal ABC transporter permease >Feature sequence369 617 348 gene locus_tag LOCUS_13340 617 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 797 2314 gene locus_tag LOCUS_13350 gene thiI 797 2314 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096011.1 protein_id gnl|my_center|LOCUS_13350 <2903 2346 gene locus_tag LOCUS_13360 <2903 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895586.1:DNA polymerase II >Feature sequence370 2724 1030 gene locus_tag LOCUS_13370 2724 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence371 1260 268 gene locus_tag LOCUS_13380 gene cysD 1260 268 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_13380 2054 1332 gene locus_tag LOCUS_13390 gene cpdA 2054 1332 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056616.1 protein_id gnl|my_center|LOCUS_13390 2518 2054 gene locus_tag LOCUS_13400 2518 2054 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_13400 2499 2651 gene locus_tag LOCUS_13410 2499 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence372 1171 503 gene locus_tag LOCUS_13420 gene psrA 1171 503 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 protein_id gnl|my_center|LOCUS_13420 1409 2062 gene locus_tag LOCUS_13430 gene lexA 1409 2062 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554100.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence373 538 966 gene locus_tag LOCUS_13440 538 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1033 1938 gene locus_tag LOCUS_13450 gene fabD 1033 1938 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_13450 2455 2066 gene locus_tag LOCUS_13460 2455 2066 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence374 1610 174 gene locus_tag LOCUS_13470 gene selA 1610 174 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703787.1 protein_id gnl|my_center|LOCUS_13470 2623 1745 gene locus_tag LOCUS_13480 gene fdhE 2623 1745 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551971.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence375 1183 98 gene locus_tag LOCUS_13490 gene recF 1183 98 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377871.1 protein_id gnl|my_center|LOCUS_13490 2528 1425 gene locus_tag LOCUS_13500 gene dnaN 2528 1425 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence376 213 986 gene locus_tag LOCUS_13510 gene hisF 213 986 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_13510 1883 1110 gene locus_tag LOCUS_13520 1883 1110 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102069.1 protein_id gnl|my_center|LOCUS_13520 2619 2029 gene locus_tag LOCUS_13530 2619 2029 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940106.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence377 1130 834 gene locus_tag LOCUS_13540 1130 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence378 707 468 gene locus_tag LOCUS_13550 707 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1503 736 gene locus_tag LOCUS_13560 gene soj 1503 736 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_13560 2279 1632 gene locus_tag LOCUS_13570 gene rsmG 2279 1632 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 protein_id gnl|my_center|LOCUS_13570 2725 2276 gene locus_tag LOCUS_13580 2725 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence379 <1 1112 gene locus_tag LOCUS_13590 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388895.1:elongation factor G 2730 1147 gene locus_tag LOCUS_13600 2730 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence380 2 1498 gene locus_tag LOCUS_13610 gene aprA 2 1498 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_13610 1555 2340 gene locus_tag LOCUS_13620 1555 2340 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531095.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence381 998 339 gene locus_tag LOCUS_13630 998 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1913 1128 gene locus_tag LOCUS_13640 1913 1128 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807682.1 protein_id gnl|my_center|LOCUS_13640 2389 2210 gene locus_tag LOCUS_13650 2389 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13650 >Feature sequence382 880 668 gene locus_tag LOCUS_13660 880 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2001 877 gene locus_tag LOCUS_13670 gene mnmA 2001 877 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 protein_id gnl|my_center|LOCUS_13670 2394 2242 gene locus_tag LOCUS_13680 2394 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence383 <1 745 gene locus_tag LOCUS_13690 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389005.1:serine hydrolase 742 2382 gene locus_tag LOCUS_13700 742 2382 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368434.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence384 518 162 gene locus_tag LOCUS_13710 518 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 661 1398 gene locus_tag LOCUS_13720 661 1398 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 protein_id gnl|my_center|LOCUS_13720 1553 2542 gene locus_tag LOCUS_13730 1553 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence385 1587 1066 gene locus_tag LOCUS_13740 1587 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13740 >Feature sequence386 203 607 gene locus_tag LOCUS_13750 gene nrdI 203 607 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815706.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence387 <1 590 gene locus_tag LOCUS_13760 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005765872.1:ribosome maturation factor RimM 672 1451 gene locus_tag LOCUS_13770 gene trmD 672 1451 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 protein_id gnl|my_center|LOCUS_13770 1614 1970 gene locus_tag LOCUS_13780 gene rplS 1614 1970 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence388 <1 707 gene locus_tag LOCUS_13790 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939331.1:VTT domain-containing protein 713 1984 gene locus_tag LOCUS_13800 713 1984 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_13800 <2826 1915 gene locus_tag LOCUS_13810 <2826 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048382.1:peptidylprolyl isomerase >Feature sequence389 <1 613 gene locus_tag LOCUS_13820 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002050104.1:redox-regulated ATPase YchF 731 807 gene locus_tag LOCUS_t00100 731 807 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2059 893 gene locus_tag LOCUS_13830 gene argE 2059 893 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_13830 <2818 2056 gene locus_tag LOCUS_13840 <2818 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969279.1:FadR/GntR family transcriptional regulator >Feature sequence390 597 1247 gene locus_tag LOCUS_13850 597 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1385 2308 gene locus_tag LOCUS_13860 gene ubiA 1385 2308 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401244.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence391 972 1295 gene locus_tag LOCUS_13870 972 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence392 90 890 gene locus_tag LOCUS_13880 90 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1545 937 gene locus_tag LOCUS_13890 1545 937 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073456.1 protein_id gnl|my_center|LOCUS_13890 1726 2049 gene locus_tag LOCUS_13900 1726 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2207 2617 gene locus_tag LOCUS_13910 2207 2617 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209805.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence393 1152 358 gene locus_tag LOCUS_13920 1152 358 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_13920 2072 1266 gene locus_tag LOCUS_13930 gene lgt 2072 1266 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_13930 2799 2260 gene locus_tag LOCUS_13940 2799 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence394 <1 742 gene locus_tag LOCUS_13950 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092205.1:carbon-nitrogen hydrolase family protein 849 2168 gene locus_tag LOCUS_13960 849 2168 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence395 656 2419 gene locus_tag LOCUS_13970 656 2419 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence396 838 53 gene locus_tag LOCUS_13980 838 53 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_13980 1667 987 gene locus_tag LOCUS_13990 1667 987 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707785.1 protein_id gnl|my_center|LOCUS_13990 1950 2243 gene locus_tag LOCUS_14000 1950 2243 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261241.1 protein_id gnl|my_center|LOCUS_14000 <2795 2289 gene locus_tag LOCUS_14010 <2795 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005694402.1:protease SohB >Feature sequence397 1214 1654 gene locus_tag LOCUS_14020 1214 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 <2795 2200 gene locus_tag LOCUS_14030 <2795 2200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531025.1:molybdenum ABC transporter ATP-binding protein >Feature sequence398 1056 871 gene locus_tag LOCUS_14040 1056 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 994 1452 gene locus_tag LOCUS_14050 994 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1738 1493 gene locus_tag LOCUS_14060 1738 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence399 64 1428 gene locus_tag LOCUS_14070 64 1428 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707799.1 protein_id gnl|my_center|LOCUS_14070 1438 2625 gene locus_tag LOCUS_14080 1438 2625 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887947.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence400 1030 266 gene locus_tag LOCUS_14090 1030 266 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192955.1 protein_id gnl|my_center|LOCUS_14090 2475 1084 gene locus_tag LOCUS_14100 2475 1084 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040457.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence401 649 1017 gene locus_tag LOCUS_14110 649 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1014 2777 gene locus_tag LOCUS_14120 1014 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence402 355 1557 gene locus_tag LOCUS_14130 355 1557 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_14130 1585 1920 gene locus_tag LOCUS_14140 1585 1920 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040743.1 protein_id gnl|my_center|LOCUS_14140 2016 2450 gene locus_tag LOCUS_14150 2016 2450 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence403 1836 1177 gene locus_tag LOCUS_14160 1836 1177 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186405.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence404 176 658 gene locus_tag LOCUS_14170 gene ribE 176 658 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 protein_id gnl|my_center|LOCUS_14170 655 1155 gene locus_tag LOCUS_14180 gene nusB 655 1155 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_14180 1157 2128 gene locus_tag LOCUS_14190 gene thiL 1157 2128 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_14190 2125 2598 gene locus_tag LOCUS_14200 2125 2598 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence405 1493 906 gene locus_tag LOCUS_14210 1493 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1822 2616 gene locus_tag LOCUS_14220 1822 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence406 1690 296 gene locus_tag LOCUS_14230 1690 296 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_14230 2772 1690 gene locus_tag LOCUS_14240 2772 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence407 <2771 759 gene locus_tag LOCUS_14250 <2771 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994691.1:rhamnan synthesis F family protein >Feature sequence408 1898 738 gene locus_tag LOCUS_14260 1898 738 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461767.1 protein_id gnl|my_center|LOCUS_14260 2587 2354 gene locus_tag LOCUS_14270 2587 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence409 2219 1137 gene locus_tag LOCUS_14280 gene serC 2219 1137 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence410 1913 2584 gene locus_tag LOCUS_14290 1913 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence411 609 31 gene locus_tag LOCUS_14300 609 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1821 844 gene locus_tag LOCUS_14310 1821 844 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111202.1 protein_id gnl|my_center|LOCUS_14310 2508 1936 gene locus_tag LOCUS_14320 2508 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence412 603 142 gene locus_tag LOCUS_14330 603 142 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 protein_id gnl|my_center|LOCUS_14330 1351 836 gene locus_tag LOCUS_14340 gene luxS 1351 836 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130208.1 protein_id gnl|my_center|LOCUS_14340 2330 1413 gene locus_tag LOCUS_14350 2330 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2487 2335 gene locus_tag LOCUS_14360 2487 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence413 2404 152 gene locus_tag LOCUS_14370 gene ppk1 2404 152 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_14370 2755 2444 gene locus_tag LOCUS_14380 2755 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence414 1321 98 gene locus_tag LOCUS_14390 1321 98 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_14390 <2753 1364 gene locus_tag LOCUS_14400 <2753 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114595.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence415 913 1188 gene locus_tag LOCUS_14410 913 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 2581 1247 gene locus_tag LOCUS_14420 2581 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence416 <1 515 gene locus_tag LOCUS_14430 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971443.1:LysE family translocator 1577 597 gene locus_tag LOCUS_14440 1577 597 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence417 <1 2720 gene locus_tag LOCUS_14450 <1 2720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000573945.1:Cu(+)/Ag(+) efflux RND transporter permease subunit CusA >Feature sequence418 2333 138 gene locus_tag LOCUS_14460 2333 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence419 1412 591 gene locus_tag LOCUS_14470 1412 591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 protein_id gnl|my_center|LOCUS_14470 2207 1476 gene locus_tag LOCUS_14480 2207 1476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705577.1 protein_id gnl|my_center|LOCUS_14480 <2747 2195 gene locus_tag LOCUS_14490 <2747 2195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456256.1:ABC transporter permease >Feature sequence420 241 1161 gene locus_tag LOCUS_14500 gene puuE 241 1161 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193045.1 protein_id gnl|my_center|LOCUS_14500 1179 2033 gene locus_tag LOCUS_14510 1179 2033 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528244.1 protein_id gnl|my_center|LOCUS_14510 2569 2030 gene locus_tag LOCUS_14520 2569 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence421 179 613 gene locus_tag LOCUS_14530 179 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 705 1205 gene locus_tag LOCUS_14540 705 1205 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993958.1 protein_id gnl|my_center|LOCUS_14540 2444 1212 gene locus_tag LOCUS_14550 2444 1212 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385652.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence422 748 44 gene locus_tag LOCUS_14560 748 44 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967032.1 protein_id gnl|my_center|LOCUS_14560 944 1618 gene locus_tag LOCUS_14570 gene radC 944 1618 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_14570 2034 2270 gene locus_tag LOCUS_14580 gene rpmB 2034 2270 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467944.1 protein_id gnl|my_center|LOCUS_14580 2282 2437 gene locus_tag LOCUS_14590 gene rpmG 2282 2437 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094893.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence423 <1 1420 gene locus_tag LOCUS_14600 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462890.1:L-lactate permease >Feature sequence424 <1 607 gene locus_tag LOCUS_14610 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384138.1:ABC transporter ATP-binding protein 604 1413 gene locus_tag LOCUS_14620 gene phnC 604 1413 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_14620 1410 2225 gene locus_tag LOCUS_14630 gene phnE 1410 2225 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524368.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence425 1224 1943 gene locus_tag LOCUS_14640 gene gcvA 1224 1943 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389870.1 protein_id gnl|my_center|LOCUS_14640 <2731 2183 gene locus_tag LOCUS_14650 <2731 2183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002232768.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence426 299 1798 gene locus_tag LOCUS_14660 299 1798 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704251.1 protein_id gnl|my_center|LOCUS_14660 2412 1861 gene locus_tag LOCUS_14670 2412 1861 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence427 819 1394 gene locus_tag LOCUS_14680 819 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1656 2084 gene locus_tag LOCUS_14690 1656 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence428 363 82 gene locus_tag LOCUS_14700 363 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1184 2584 gene locus_tag LOCUS_14710 1184 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence429 786 472 gene locus_tag LOCUS_14720 786 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2081 1128 gene locus_tag LOCUS_14730 gene cydB 2081 1128 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388319.1 protein_id gnl|my_center|LOCUS_14730 <2723 2081 gene locus_tag LOCUS_14740 <2723 2081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000393706.1:cytochrome ubiquinol oxidase subunit I >Feature sequence430 2721 1459 gene locus_tag LOCUS_14750 2721 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence431 <1 1264 gene locus_tag LOCUS_14760 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114994.1:SbcC/MukB-like Walker B domain-containing protein 2168 1293 gene locus_tag LOCUS_14770 2168 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence432 652 26 gene locus_tag LOCUS_14780 652 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2307 679 gene locus_tag LOCUS_14790 2307 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence433 163 753 gene locus_tag LOCUS_14800 163 753 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918270.1 protein_id gnl|my_center|LOCUS_14800 946 1305 gene locus_tag LOCUS_14810 946 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1554 2555 gene locus_tag LOCUS_14820 1554 2555 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897538.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence434 522 274 gene locus_tag LOCUS_14830 522 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 547 1476 gene locus_tag LOCUS_14840 547 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2707 1535 gene locus_tag LOCUS_14850 2707 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence435 895 1368 gene locus_tag LOCUS_14860 895 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1458 2069 gene locus_tag LOCUS_14870 1458 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 <2705 2090 gene locus_tag LOCUS_14880 <2705 2090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339095.1:GntR family transcriptional regulator >Feature sequence436 512 105 gene locus_tag LOCUS_14890 512 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 773 1363 gene locus_tag LOCUS_14900 gene rlmE 773 1363 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313635.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence437 127 429 gene locus_tag LOCUS_14910 127 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 438 1469 gene locus_tag LOCUS_14920 438 1469 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence438 1762 1433 gene locus_tag LOCUS_14930 1762 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence439 171 590 gene locus_tag LOCUS_14940 171 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 668 2017 gene locus_tag LOCUS_14950 668 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence440 910 1443 gene locus_tag LOCUS_14960 910 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1440 1886 gene locus_tag LOCUS_14970 1440 1886 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 protein_id gnl|my_center|LOCUS_14970 1886 2653 gene locus_tag LOCUS_14980 1886 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence441 557 2233 gene locus_tag LOCUS_14990 557 2233 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence442 308 1015 gene locus_tag LOCUS_15000 gene mtgA 308 1015 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103140.1 protein_id gnl|my_center|LOCUS_15000 1724 1026 gene locus_tag LOCUS_15010 1724 1026 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815471.1 protein_id gnl|my_center|LOCUS_15010 1944 2579 gene locus_tag LOCUS_15020 1944 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence443 724 1101 gene locus_tag LOCUS_15030 724 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1094 2296 gene locus_tag LOCUS_15040 1094 2296 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113500.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence444 1149 2489 gene locus_tag LOCUS_15050 1149 2489 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence445 574 158 gene locus_tag LOCUS_15060 574 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2217 844 gene locus_tag LOCUS_15070 2217 844 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098233.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence446 786 58 gene locus_tag LOCUS_15080 786 58 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 protein_id gnl|my_center|LOCUS_15080 1835 1221 gene locus_tag LOCUS_15090 1835 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 <2675 2011 gene locus_tag LOCUS_15100 <2675 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018210119.1:glycosyltransferase family 4 protein >Feature sequence447 704 396 gene locus_tag LOCUS_15110 704 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1222 827 gene locus_tag LOCUS_15120 1222 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1865 1305 gene locus_tag LOCUS_15130 1865 1305 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 protein_id gnl|my_center|LOCUS_15130 2116 1862 gene locus_tag LOCUS_15140 2116 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence448 343 534 gene locus_tag LOCUS_15150 343 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1274 675 gene locus_tag LOCUS_15160 gene smrA 1274 675 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046828.1 protein_id gnl|my_center|LOCUS_15160 1447 1875 gene locus_tag LOCUS_15170 1447 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2027 2371 gene locus_tag LOCUS_15180 gene arsC 2027 2371 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence449 2152 407 gene locus_tag LOCUS_15190 2152 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence450 427 1725 gene locus_tag LOCUS_15200 427 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence451 1591 1037 gene locus_tag LOCUS_15210 1591 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2474 1851 gene locus_tag LOCUS_15220 2474 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence452 737 222 gene locus_tag LOCUS_15230 737 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1629 766 gene locus_tag LOCUS_15240 1629 766 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190155.1 protein_id gnl|my_center|LOCUS_15240 1806 2423 gene locus_tag LOCUS_15250 1806 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence453 392 1681 gene locus_tag LOCUS_15260 392 1681 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763027.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence454 820 1050 gene locus_tag LOCUS_15270 820 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1450 1079 gene locus_tag LOCUS_15280 1450 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 <2663 1447 gene locus_tag LOCUS_15290 <2663 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246323.1:pyoverdine-tailoring dipeptidase-like protein PvdM >Feature sequence455 599 315 gene locus_tag LOCUS_15300 599 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 703 1590 gene locus_tag LOCUS_15310 703 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1684 2442 gene locus_tag LOCUS_15320 1684 2442 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463915.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence456 82 327 gene locus_tag LOCUS_15330 82 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 504 1328 gene locus_tag LOCUS_15340 504 1328 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_15340 1526 1909 gene locus_tag LOCUS_15350 1526 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15350 1906 2466 gene locus_tag LOCUS_15360 1906 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence457 364 1182 gene locus_tag LOCUS_15370 364 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1322 1705 gene locus_tag LOCUS_15380 1322 1705 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463876.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence458 1252 2157 gene locus_tag LOCUS_15390 1252 2157 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035553.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence459 2137 1292 gene locus_tag LOCUS_15400 2137 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence460 882 94 gene locus_tag LOCUS_15410 882 94 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087141.1 protein_id gnl|my_center|LOCUS_15410 2210 924 gene locus_tag LOCUS_15420 2210 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2297 2602 gene locus_tag LOCUS_15430 2297 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence461 406 209 gene locus_tag LOCUS_15440 406 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1585 482 gene locus_tag LOCUS_15450 gene prfA 1585 482 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 protein_id gnl|my_center|LOCUS_15450 <2641 1614 gene locus_tag LOCUS_15460 <2641 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095001.1:glutamyl-tRNA reductase >Feature sequence462 2040 271 gene locus_tag LOCUS_15470 2040 271 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355198.1 protein_id gnl|my_center|LOCUS_15470 2357 2037 gene locus_tag LOCUS_15480 2357 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence463 <1 756 gene locus_tag LOCUS_15490 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015878.1:short-chain fatty acid transporter 789 1613 gene locus_tag LOCUS_15500 789 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 2547 2017 gene locus_tag LOCUS_15510 2547 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence464 531 995 gene locus_tag LOCUS_15520 531 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2187 1228 gene locus_tag LOCUS_15530 2187 1228 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113628.1 protein_id gnl|my_center|LOCUS_15530 2098 2316 gene locus_tag LOCUS_15540 2098 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence465 395 748 gene locus_tag LOCUS_15550 395 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 867 1817 gene locus_tag LOCUS_15560 867 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 <2630 1953 gene locus_tag LOCUS_15570 <2630 1953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039947.1:capsular biosynthesis protein >Feature sequence466 1562 1215 gene locus_tag LOCUS_15580 1562 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 <2630 1786 gene locus_tag LOCUS_15590 <2630 1786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241926.1:sulfate adenylyltransferase subunit CysN >Feature sequence467 1829 1347 gene locus_tag LOCUS_15600 1829 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2560 2027 gene locus_tag LOCUS_15610 2560 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence468 <2626 1573 gene locus_tag LOCUS_15620 <2626 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176146113.1:VCBS repeat-containing protein >Feature sequence469 >Feature sequence470 1934 798 gene locus_tag LOCUS_15630 1934 798 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148055.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence471 <2618 993 gene locus_tag LOCUS_15640 <2618 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036630.1:efflux RND transporter permease subunit >Feature sequence472 452 1486 gene locus_tag LOCUS_15650 452 1486 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_15650 1625 2575 gene locus_tag LOCUS_15660 1625 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence473 611 1096 gene locus_tag LOCUS_15670 611 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2191 1157 gene locus_tag LOCUS_15680 2191 1157 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210980.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence474 962 240 gene locus_tag LOCUS_15690 gene lpxH 962 240 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769188.1 protein_id gnl|my_center|LOCUS_15690 1503 1009 gene locus_tag LOCUS_15700 1503 1009 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence475 >Feature sequence476 224 703 gene locus_tag LOCUS_15710 224 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 890 2278 gene locus_tag LOCUS_15720 890 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence477 1364 684 gene locus_tag LOCUS_15730 1364 684 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_15730 1552 2124 gene locus_tag LOCUS_15740 1552 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence478 214 855 gene locus_tag LOCUS_15750 214 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1134 1931 gene locus_tag LOCUS_15760 gene soj 1134 1931 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence479 <1 683 gene locus_tag LOCUS_15770 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016326291.1:lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein >Feature sequence480 2429 1467 gene locus_tag LOCUS_15780 2429 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence481 1234 1611 gene locus_tag LOCUS_15790 gene sdhC 1234 1611 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 protein_id gnl|my_center|LOCUS_15790 1605 1952 gene locus_tag LOCUS_15800 gene sdhD 1605 1952 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104386.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence482 >Feature sequence483 1238 744 gene locus_tag LOCUS_15810 1238 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence484 1949 102 gene locus_tag LOCUS_15820 1949 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2410 1985 gene locus_tag LOCUS_15830 2410 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence485 1137 88 gene locus_tag LOCUS_15840 1137 88 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537704.1 protein_id gnl|my_center|LOCUS_15840 1961 1350 gene locus_tag LOCUS_15850 1961 1350 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037422.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence486 1033 164 gene locus_tag LOCUS_15860 1033 164 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527953.1 protein_id gnl|my_center|LOCUS_15860 2232 1210 gene locus_tag LOCUS_15870 2232 1210 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971233.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence487 >Feature sequence488 430 1413 gene locus_tag LOCUS_15880 430 1413 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence489 <1 935 gene locus_tag LOCUS_15890 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085519.1:tripartite tricarboxylate transporter substrate binding protein 932 1390 gene locus_tag LOCUS_15900 932 1390 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764744.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence490 239 511 gene locus_tag LOCUS_15910 239 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1166 516 gene locus_tag LOCUS_15920 1166 516 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031342.1 protein_id gnl|my_center|LOCUS_15920 1373 1948 gene locus_tag LOCUS_15930 1373 1948 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 protein_id gnl|my_center|LOCUS_15930 2557 1991 gene locus_tag LOCUS_15940 2557 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence491 <1 512 gene locus_tag LOCUS_15950 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003110260.1:acetate--CoA ligase 901 1566 gene locus_tag LOCUS_15960 901 1566 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092229.1 protein_id gnl|my_center|LOCUS_15960 2377 1739 gene locus_tag LOCUS_15970 2377 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence492 64 624 gene locus_tag LOCUS_15980 64 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2110 677 gene locus_tag LOCUS_15990 2110 677 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence493 <1 712 gene locus_tag LOCUS_16000 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103107.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase 702 2156 gene locus_tag LOCUS_16010 gene murC 702 2156 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence494 801 316 gene locus_tag LOCUS_16020 801 316 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038715.1 protein_id gnl|my_center|LOCUS_16020 1349 864 gene locus_tag LOCUS_16030 1349 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence495 1 558 gene locus_tag LOCUS_16040 1 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 877 1131 gene locus_tag LOCUS_16050 877 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1133 1666 gene locus_tag LOCUS_16060 1133 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1855 1571 gene locus_tag LOCUS_16070 1855 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2256 2005 gene locus_tag LOCUS_16080 2256 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence496 1222 1959 gene locus_tag LOCUS_16090 1222 1959 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036197.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence497 228 974 gene locus_tag LOCUS_16100 228 974 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016858.1 protein_id gnl|my_center|LOCUS_16100 971 1933 gene locus_tag LOCUS_16110 971 1933 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266752.1 protein_id gnl|my_center|LOCUS_16110 2466 1915 gene locus_tag LOCUS_16120 gene sutR 2466 1915 CDS product DNA-binding transcriptional regulator SutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429141.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence498 1334 1726 gene locus_tag LOCUS_16130 1334 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 <2535 1875 gene locus_tag LOCUS_16140 <2535 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816851.1:alkene reductase >Feature sequence499 <2534 1548 gene locus_tag LOCUS_16150 <2534 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972789.1:D-galactarolactone cycloisomerase >Feature sequence500 249 428 gene locus_tag LOCUS_16160 249 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1248 436 gene locus_tag LOCUS_16170 1248 436 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524357.1 protein_id gnl|my_center|LOCUS_16170 1945 1301 gene locus_tag LOCUS_16180 1945 1301 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244129.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence501 540 1322 gene locus_tag LOCUS_16190 540 1322 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_16190 2379 1693 gene locus_tag LOCUS_16200 2379 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence502 1737 673 gene locus_tag LOCUS_16210 1737 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2078 1779 gene locus_tag LOCUS_16220 2078 1779 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008539997.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence503 1924 995 gene locus_tag LOCUS_16230 1924 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2519 1902 gene locus_tag LOCUS_16240 2519 1902 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390578.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence504 208 1308 gene locus_tag LOCUS_16250 208 1308 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073420.1 protein_id gnl|my_center|LOCUS_16250 1416 2009 gene locus_tag LOCUS_16260 1416 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence505 <1 565 gene locus_tag LOCUS_16270 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087400.1:citrate synthase 1027 952 gene locus_tag LOCUS_t00110 1027 952 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1122 1048 gene locus_tag LOCUS_t00120 1122 1048 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1734 1186 gene locus_tag LOCUS_16280 gene pgsA 1734 1186 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268070.1 protein_id gnl|my_center|LOCUS_16280 <2516 1796 gene locus_tag LOCUS_16290 <2516 1796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113354.1:excinuclease ABC subunit UvrC >Feature sequence506 853 1548 gene locus_tag LOCUS_16300 853 1548 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence507 175 1065 gene locus_tag LOCUS_16310 175 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1174 1863 gene locus_tag LOCUS_16320 1174 1863 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 protein_id gnl|my_center|LOCUS_16320 2282 1956 gene locus_tag LOCUS_16330 2282 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence508 3 839 gene locus_tag LOCUS_16340 3 839 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263088.1 protein_id gnl|my_center|LOCUS_16340 851 2179 gene locus_tag LOCUS_16350 851 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence509 317 1303 gene locus_tag LOCUS_16360 317 1303 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113741.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence510 1257 565 gene locus_tag LOCUS_16370 1257 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 <2496 1309 gene locus_tag LOCUS_16380 <2496 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087413.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence511 <1 1784 gene locus_tag LOCUS_16390 <1 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:DUF1553 domain-containing protein >Feature sequence512 524 87 gene locus_tag LOCUS_16400 524 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 910 521 gene locus_tag LOCUS_16410 gene queD 910 521 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_16410 1609 935 gene locus_tag LOCUS_16420 gene queE 1609 935 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_16420 2128 1628 gene locus_tag LOCUS_16430 2128 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence513 143 763 gene locus_tag LOCUS_16440 143 763 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406312.1 protein_id gnl|my_center|LOCUS_16440 1185 2063 gene locus_tag LOCUS_16450 1185 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence514 1284 1781 gene locus_tag LOCUS_16460 1284 1781 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence515 1303 608 gene locus_tag LOCUS_16470 1303 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence516 478 855 gene locus_tag LOCUS_16480 478 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1077 2201 gene locus_tag LOCUS_16490 1077 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence517 <1 1005 gene locus_tag LOCUS_16500 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082931.1:FMN-binding glutamate synthase family protein 1119 1292 gene locus_tag LOCUS_16510 1119 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1701 1219 gene locus_tag LOCUS_16520 1701 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 <2468 1754 gene locus_tag LOCUS_16530 <2468 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886741.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence518 181 1182 gene locus_tag LOCUS_16540 gene istA 181 1182 CDS product IS21-like element ISPsy4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551322.1 protein_id gnl|my_center|LOCUS_16540 1179 1958 gene locus_tag LOCUS_16550 gene istB 1179 1958 CDS product IS21-like element ISPsy4 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005741073.1 protein_id gnl|my_center|LOCUS_16550 2029 2247 gene locus_tag LOCUS_16560 2029 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence519 1058 567 gene locus_tag LOCUS_16570 1058 567 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_16570 1909 1157 gene locus_tag LOCUS_16580 gene cysE 1909 1157 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence520 1513 215 gene locus_tag LOCUS_16590 1513 215 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence521 62 370 gene locus_tag LOCUS_16600 62 370 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172486.1 protein_id gnl|my_center|LOCUS_16600 429 878 gene locus_tag LOCUS_16610 429 878 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 protein_id gnl|my_center|LOCUS_16610 971 1399 gene locus_tag LOCUS_16620 971 1399 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817404.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence522 635 1726 gene locus_tag LOCUS_16630 gene queG 635 1726 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_16630 2276 1767 gene locus_tag LOCUS_16640 gene orn 2276 1767 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence523 508 1767 gene locus_tag LOCUS_16650 508 1767 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 protein_id gnl|my_center|LOCUS_16650 <2442 1810 gene locus_tag LOCUS_16660 <2442 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537707.1:ABC transporter ATP-binding protein >Feature sequence524 <1 749 gene locus_tag LOCUS_16670 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266560.1:LysR family transcriptional regulator 1673 753 gene locus_tag LOCUS_16680 1673 753 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812099.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence525 724 443 gene locus_tag LOCUS_16690 724 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2192 729 gene locus_tag LOCUS_16700 gene rng 2192 729 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence526 1262 312 gene locus_tag LOCUS_16710 1262 312 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_16710 <2426 1504 gene locus_tag LOCUS_16720 <2426 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228694.1:SDR family oxidoreductase >Feature sequence527 1332 721 gene locus_tag LOCUS_16730 1332 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_16730 1735 1532 gene locus_tag LOCUS_16740 1735 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2170 1886 gene locus_tag LOCUS_16750 2170 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence528 698 2137 gene locus_tag LOCUS_16760 698 2137 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103740.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence529 <2422 591 gene locus_tag LOCUS_16770 <2422 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705487.1:catalase/peroxidase HPI >Feature sequence530 2290 509 gene locus_tag LOCUS_16780 gene ptsP 2290 509 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence531 484 1011 gene locus_tag LOCUS_16790 484 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence532 1496 426 gene locus_tag LOCUS_16800 1496 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence533 71 361 gene locus_tag LOCUS_16810 71 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 355 1335 gene locus_tag LOCUS_16820 355 1335 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 protein_id gnl|my_center|LOCUS_16820 1445 2053 gene locus_tag LOCUS_16830 1445 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence534 1915 1337 gene locus_tag LOCUS_16840 1915 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence535 1619 675 gene locus_tag LOCUS_16850 gene ylqF 1619 675 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247909.1 protein_id gnl|my_center|LOCUS_16850 2173 1775 gene locus_tag LOCUS_16860 gene msrB 2173 1775 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence536 865 206 gene locus_tag LOCUS_16870 865 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1391 873 gene locus_tag LOCUS_16880 1391 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1887 1513 gene locus_tag LOCUS_16890 gene rplL 1887 1513 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_16890 2124 1945 gene locus_tag LOCUS_16900 2124 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence537 <1 1588 gene locus_tag LOCUS_16910 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113216.1:EAL domain-containing protein >Feature sequence538 2 796 gene locus_tag LOCUS_16920 2 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 851 1756 gene locus_tag LOCUS_16930 851 1756 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067374.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence539 504 1877 gene locus_tag LOCUS_16940 504 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence540 <1 741 gene locus_tag LOCUS_16950 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109478.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit B 741 1517 gene locus_tag LOCUS_16960 741 1517 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_16960 1520 2200 gene locus_tag LOCUS_16970 1520 2200 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208714.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence541 <1 907 gene locus_tag LOCUS_16980 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530942.1:nitrite reductase large subunit NirB >Feature sequence542 <2385 1749 gene locus_tag LOCUS_16990 <2385 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268074.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence543 988 912 gene locus_tag LOCUS_t00130 988 912 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence544 <1 737 gene locus_tag LOCUS_17000 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121670.1:sodium:calcium antiporter 822 1268 gene locus_tag LOCUS_17010 822 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1409 1603 gene locus_tag LOCUS_17020 1409 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence545 603 301 gene locus_tag LOCUS_17030 603 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 922 1956 gene locus_tag LOCUS_17040 922 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence546 <1 727 gene locus_tag LOCUS_17050 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772517.1:asparagine synthase (glutamine-hydrolyzing) 724 1986 gene locus_tag LOCUS_17060 724 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence547 904 1776 gene locus_tag LOCUS_17070 904 1776 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035561.1 protein_id gnl|my_center|LOCUS_17070 <2374 1832 gene locus_tag LOCUS_17080 <2374 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245422.1:aldo/keto reductase AkrN >Feature sequence548 1116 376 gene locus_tag LOCUS_17090 1116 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1980 1213 gene locus_tag LOCUS_17100 gene purQ 1980 1213 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975654.1 protein_id gnl|my_center|LOCUS_17100 2232 1987 gene locus_tag LOCUS_17110 gene purS 2232 1987 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence549 677 96 gene locus_tag LOCUS_17120 677 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1509 793 gene locus_tag LOCUS_17130 1509 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 <2373 1548 gene locus_tag LOCUS_17140 <2373 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042510573.1:pitrilysin family protein >Feature sequence550 160 405 gene locus_tag LOCUS_17150 160 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 402 1157 gene locus_tag LOCUS_17160 gene phnP 402 1157 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059960.1 protein_id gnl|my_center|LOCUS_17160 2093 1173 gene locus_tag LOCUS_17170 2093 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence551 421 924 gene locus_tag LOCUS_17180 421 924 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931713.1 protein_id gnl|my_center|LOCUS_17180 <2357 1140 gene locus_tag LOCUS_17190 <2357 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941019.1:NADH-quinone oxidoreductase subunit N >Feature sequence552 367 864 gene locus_tag LOCUS_17200 367 864 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_17200 861 1130 gene locus_tag LOCUS_17210 861 1130 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_17210 1142 1534 gene locus_tag LOCUS_17220 1142 1534 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051234295.1 protein_id gnl|my_center|LOCUS_17220 <2355 1588 gene locus_tag LOCUS_17230 <2355 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927663.1:ferrochelatase >Feature sequence553 <1 2234 gene locus_tag LOCUS_17240 <1 2234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041602000.1:CocE/NonD family hydrolase >Feature sequence554 2268 1657 gene locus_tag LOCUS_17250 2268 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence555 239 1222 gene locus_tag LOCUS_17260 239 1222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_17260 1219 1992 gene locus_tag LOCUS_17270 1219 1992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence556 525 833 gene locus_tag LOCUS_17280 525 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 934 1635 gene locus_tag LOCUS_17290 gene fsa 934 1635 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_17290 1925 2281 gene locus_tag LOCUS_17300 1925 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence557 <1 1532 gene locus_tag LOCUS_17310 <1 1532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111156.1:mechanosensitive ion channel family protein >Feature sequence558 1587 877 gene locus_tag LOCUS_17320 1587 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1901 1623 gene locus_tag LOCUS_17330 1901 1623 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_17330 2165 1920 gene locus_tag LOCUS_17340 2165 1920 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545388.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence559 2166 832 gene locus_tag LOCUS_17350 2166 832 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence560 788 1885 gene locus_tag LOCUS_17360 788 1885 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence561 >Feature sequence562 1298 336 gene locus_tag LOCUS_17370 1298 336 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329802.1 protein_id gnl|my_center|LOCUS_17370 1469 1918 gene locus_tag LOCUS_17380 1469 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1921 2241 gene locus_tag LOCUS_17390 1921 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence563 1006 119 gene locus_tag LOCUS_17400 gene rfbA 1006 119 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 protein_id gnl|my_center|LOCUS_17400 2013 1126 gene locus_tag LOCUS_17410 gene rfbD 2013 1126 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_17410 2279 2010 gene locus_tag LOCUS_17420 2279 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence564 <1 854 gene locus_tag LOCUS_17430 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084266.1:urea ABC transporter permease subunit UrtB 851 1942 gene locus_tag LOCUS_17440 gene urtC 851 1942 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence565 497 421 gene locus_tag LOCUS_t00140 497 421 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1569 535 gene locus_tag LOCUS_17450 gene argC 1569 535 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_17450 2244 1648 gene locus_tag LOCUS_17460 2244 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence566 1705 116 gene locus_tag LOCUS_17470 1705 116 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 protein_id gnl|my_center|LOCUS_17470 1867 2262 gene locus_tag LOCUS_17480 1867 2262 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence567 <1 530 gene locus_tag LOCUS_17490 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337852.1:branched-chain amino acid ABC transporter permease 1870 668 gene locus_tag LOCUS_17500 1870 668 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence568 292 77 gene locus_tag LOCUS_17510 292 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 500 2068 gene locus_tag LOCUS_17520 500 2068 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence569 <1 594 gene locus_tag LOCUS_17530 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_100003378.1:Ldh family oxidoreductase 637 1821 gene locus_tag LOCUS_17540 637 1821 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205727.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence570 488 793 gene locus_tag LOCUS_17550 488 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence571 1211 768 gene locus_tag LOCUS_17560 1211 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence572 1827 1444 gene locus_tag LOCUS_17570 1827 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2025 1837 gene locus_tag LOCUS_17580 2025 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence573 1505 2110 gene locus_tag LOCUS_17590 gene rpoE 1505 2110 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence574 849 1739 gene locus_tag LOCUS_17600 849 1739 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence575 1033 2151 gene locus_tag LOCUS_17610 1033 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence576 1718 426 gene locus_tag LOCUS_17620 1718 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence577 1194 454 gene locus_tag LOCUS_17630 gene lolB 1194 454 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365627.1 protein_id gnl|my_center|LOCUS_17630 2184 1243 gene locus_tag LOCUS_17640 2184 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence578 1163 207 gene locus_tag LOCUS_17650 gene tal 1163 207 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072436.1 protein_id gnl|my_center|LOCUS_17650 <2286 1457 gene locus_tag LOCUS_17660 <2286 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005762617.1:xylulokinase >Feature sequence579 1928 1629 gene locus_tag LOCUS_17670 1928 1629 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence580 1128 439 gene locus_tag LOCUS_17680 1128 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1118 1450 gene locus_tag LOCUS_17690 1118 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 <2285 1548 gene locus_tag LOCUS_17700 <2285 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969261.1:NADH-quinone oxidoreductase subunit N >Feature sequence581 411 169 gene locus_tag LOCUS_17710 411 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 311 1648 gene locus_tag LOCUS_17720 gene argE 311 1648 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106035.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence582 2274 361 gene locus_tag LOCUS_17730 gene mutL 2274 361 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence583 794 1180 gene locus_tag LOCUS_17740 794 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17740 1153 1458 gene locus_tag LOCUS_17750 1153 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17750 1522 2217 gene locus_tag LOCUS_17760 1522 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence584 991 611 gene locus_tag LOCUS_17770 991 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1409 996 gene locus_tag LOCUS_17780 gene fliS 1409 996 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 protein_id gnl|my_center|LOCUS_17780 2165 1422 gene locus_tag LOCUS_17790 2165 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence585 2220 1069 gene locus_tag LOCUS_17800 2220 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence586 220 1011 gene locus_tag LOCUS_17810 220 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 <2267 1490 gene locus_tag LOCUS_17820 <2267 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615995.1:c-type cytochrome >Feature sequence587 <2267 990 gene locus_tag LOCUS_17830 <2267 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089914.1:multidrug efflux RND transporter permease subunit MuxC >Feature sequence588 372 127 gene locus_tag LOCUS_17840 372 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence589 >Feature sequence590 1588 800 gene locus_tag LOCUS_17850 1588 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 <2259 1588 gene locus_tag LOCUS_17860 <2259 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524099.1:ABC transporter permease subunit >Feature sequence591 93 518 gene locus_tag LOCUS_17870 93 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 664 1491 gene locus_tag LOCUS_17880 664 1491 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105183.1 protein_id gnl|my_center|LOCUS_17880 1494 2204 gene locus_tag LOCUS_17890 gene thiE 1494 2204 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence592 1497 679 gene locus_tag LOCUS_17900 1497 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence593 42 230 gene locus_tag LOCUS_17910 42 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 241 2184 gene locus_tag LOCUS_17920 241 2184 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence594 89 661 gene locus_tag LOCUS_17930 89 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1240 683 gene locus_tag LOCUS_17940 1240 683 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210265.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence595 565 1482 gene locus_tag LOCUS_17950 gene kdgD 565 1482 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206148.1 protein_id gnl|my_center|LOCUS_17950 1597 2232 gene locus_tag LOCUS_17960 1597 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence596 <1 1131 gene locus_tag LOCUS_17970 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092382.1:outer membrane protein assembly factor BamA 1224 1727 gene locus_tag LOCUS_17980 1224 1727 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554721.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence597 14 1606 gene locus_tag LOCUS_17990 14 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 <2249 1698 gene locus_tag LOCUS_18000 <2249 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109525.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence598 1262 747 gene locus_tag LOCUS_18010 gene fabA 1262 747 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379759.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence599 880 227 gene locus_tag LOCUS_18020 880 227 CDS product DUF2291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533075.1 protein_id gnl|my_center|LOCUS_18020 2090 978 gene locus_tag LOCUS_18030 2090 978 CDS product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209403.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence600 <1 757 gene locus_tag LOCUS_18040 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921285.1:YgcG family protein 933 1559 gene locus_tag LOCUS_18050 933 1559 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 protein_id gnl|my_center|LOCUS_18050 <2243 1655 gene locus_tag LOCUS_18060 <2243 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073558.1:DEAD/DEAH box helicase >Feature sequence601 3 1427 gene locus_tag LOCUS_18070 3 1427 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_18070 <2238 1596 gene locus_tag LOCUS_18080 <2238 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767891.1:indole-3-glycerol phosphate synthase TrpC >Feature sequence602 119 1444 gene locus_tag LOCUS_18090 119 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1587 2168 gene locus_tag LOCUS_18100 1587 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence603 1017 139 gene locus_tag LOCUS_18110 1017 139 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_18110 <2227 1208 gene locus_tag LOCUS_18120 <2227 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103349.1:type II secretion system F family protein >Feature sequence604 505 960 gene locus_tag LOCUS_18130 505 960 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 protein_id gnl|my_center|LOCUS_18130 957 1370 gene locus_tag LOCUS_18140 957 1370 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389405.1 protein_id gnl|my_center|LOCUS_18140 1464 2159 gene locus_tag LOCUS_18150 1464 2159 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence605 2130 988 gene locus_tag LOCUS_18160 2130 988 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence606 784 188 gene locus_tag LOCUS_18170 784 188 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721449.1 protein_id gnl|my_center|LOCUS_18170 1859 822 gene locus_tag LOCUS_18180 1859 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence607 <1 716 gene locus_tag LOCUS_18190 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538272.1:EboA domain-containing protein 718 1653 gene locus_tag LOCUS_18200 718 1653 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_18200 1758 2135 gene locus_tag LOCUS_18210 1758 2135 CDS product DUF4870 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265546.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence608 673 1107 gene locus_tag LOCUS_18220 673 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1471 1094 gene locus_tag LOCUS_18230 1471 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence609 <1 903 gene locus_tag LOCUS_18240 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256395.1:peptide chain release factor 1 900 1658 gene locus_tag LOCUS_18250 900 1658 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence610 <1 541 gene locus_tag LOCUS_18260 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033449110.1:cytochrome o ubiquinol oxidase subunit I 538 1200 gene locus_tag LOCUS_18270 538 1200 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704586.1 protein_id gnl|my_center|LOCUS_18270 1197 1544 gene locus_tag LOCUS_18280 1197 1544 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 protein_id gnl|my_center|LOCUS_18280 2051 1647 gene locus_tag LOCUS_18290 2051 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence611 1115 336 gene locus_tag LOCUS_18300 1115 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 <2212 1112 gene locus_tag LOCUS_18310 <2212 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089915.1:hydantoinase/oxoprolinase family protein >Feature sequence612 >Feature sequence613 1678 863 gene locus_tag LOCUS_18320 1678 863 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112786.1 protein_id gnl|my_center|LOCUS_18320 <2211 1671 gene locus_tag LOCUS_18330 <2211 1671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003101181.1:glycosyltransferase family 1 protein >Feature sequence614 <1 582 gene locus_tag LOCUS_18340 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272653.1:bifunctional 3'-5' exonuclease/DNA polymerase >Feature sequence615 893 363 gene locus_tag LOCUS_18350 893 363 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766018.1 protein_id gnl|my_center|LOCUS_18350 1243 2136 gene locus_tag LOCUS_18360 1243 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence616 <1 1176 gene locus_tag LOCUS_18370 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104464.1:nitrite reductase large subunit NirB 1173 1589 gene locus_tag LOCUS_18380 gene nirD 1173 1589 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268220.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence617 250 8 gene locus_tag LOCUS_18390 250 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 630 259 gene locus_tag LOCUS_18400 630 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2073 820 gene locus_tag LOCUS_18410 2073 820 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103683.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence618 253 1173 gene locus_tag LOCUS_18420 253 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1282 1647 gene locus_tag LOCUS_18430 1282 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence619 <1 816 gene locus_tag LOCUS_18440 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005171330.1:colicin FY TonB-dependent receptor YuiR 922 1854 gene locus_tag LOCUS_18450 922 1854 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence620 <1 948 gene locus_tag LOCUS_18460 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103968835.1:2-octaprenyl-6-methoxyphenyl hydroxylase >Feature sequence621 1724 423 gene locus_tag LOCUS_18470 1724 423 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061452.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence622 1990 920 gene locus_tag LOCUS_18480 1990 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence623 2 385 gene locus_tag LOCUS_18490 2 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1364 453 gene locus_tag LOCUS_18500 1364 453 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392225.1 protein_id gnl|my_center|LOCUS_18500 1976 1443 gene locus_tag LOCUS_18510 gene uraD 1976 1443 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence624 1657 341 gene locus_tag LOCUS_18520 1657 341 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence625 1442 549 gene locus_tag LOCUS_18530 1442 549 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence626 716 886 gene locus_tag LOCUS_18540 716 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence627 1706 1509 gene locus_tag LOCUS_18550 1706 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1644 1955 gene locus_tag LOCUS_18560 1644 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence628 1330 827 gene locus_tag LOCUS_18570 1330 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 <2186 1395 gene locus_tag LOCUS_18580 <2186 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006310926.1:TRAP transporter substrate-binding protein >Feature sequence629 1649 1377 gene locus_tag LOCUS_18590 1649 1377 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376264.1 protein_id gnl|my_center|LOCUS_18590 <2183 1679 gene locus_tag LOCUS_18600 <2183 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267210.1:carbohydrate ABC transporter permease >Feature sequence630 1658 1978 gene locus_tag LOCUS_18610 1658 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence631 <1 1017 gene locus_tag LOCUS_18620 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529979.1:ABC transporter ATP-binding protein 1542 1036 gene locus_tag LOCUS_18630 1542 1036 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_18630 1643 2065 gene locus_tag LOCUS_18640 1643 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence632 1509 163 gene locus_tag LOCUS_18650 1509 163 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence633 <2177 1555 gene locus_tag LOCUS_18660 <2177 1555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104114.1:TIGR03915 family putative DNA repair protein >Feature sequence634 >Feature sequence635 688 209 gene locus_tag LOCUS_18670 688 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 817 1779 gene locus_tag LOCUS_18680 817 1779 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence636 >Feature sequence637 530 309 gene locus_tag LOCUS_18690 530 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2140 533 gene locus_tag LOCUS_18700 2140 533 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167540391.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence638 2053 299 gene locus_tag LOCUS_18710 2053 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence639 2155 1145 gene locus_tag LOCUS_18720 2155 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence640 >Feature sequence641 1340 282 gene locus_tag LOCUS_18730 1340 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence642 1912 1163 gene locus_tag LOCUS_18740 gene dsbC 1912 1163 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406382.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence643 <1 814 gene locus_tag LOCUS_18750 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268234.1:glucarate dehydratase 1118 2122 gene locus_tag LOCUS_18760 1118 2122 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529042.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence644 1095 1631 gene locus_tag LOCUS_18770 1095 1631 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208449.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence645 <1 1504 gene locus_tag LOCUS_18780 <1 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404732.1:sodium:solute symporter family protein >Feature sequence646 23 481 gene locus_tag LOCUS_18790 23 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 669 1406 gene locus_tag LOCUS_18800 669 1406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124301.1 protein_id gnl|my_center|LOCUS_18800 1436 1915 gene locus_tag LOCUS_18810 1436 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence647 <2151 729 gene locus_tag LOCUS_18820 <2151 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262580.1:efflux RND transporter permease subunit >Feature sequence648 1294 1563 gene locus_tag LOCUS_18830 1294 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence649 <1 1141 gene locus_tag LOCUS_18840 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103491.1:NAD-glutamate dehydrogenase GdhB >Feature sequence650 >Feature sequence651 368 1873 gene locus_tag LOCUS_18850 368 1873 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence652 1160 1705 gene locus_tag LOCUS_18860 gene rsmD 1160 1705 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883606.1 protein_id gnl|my_center|LOCUS_18860 1861 2076 gene locus_tag LOCUS_18870 1861 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence653 217 1035 gene locus_tag LOCUS_18880 217 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1032 1724 gene locus_tag LOCUS_18890 gene folM 1032 1724 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091895.1 protein_id gnl|my_center|LOCUS_18890 2100 1741 gene locus_tag LOCUS_18900 2100 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence654 1700 834 gene locus_tag LOCUS_18910 1700 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence655 569 174 gene locus_tag LOCUS_18920 569 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 949 566 gene locus_tag LOCUS_18930 gene rsfS 949 566 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_18930 1674 1018 gene locus_tag LOCUS_18940 gene nadD 1674 1018 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_18940 1894 2103 gene locus_tag LOCUS_18950 1894 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence656 193 1212 gene locus_tag LOCUS_18960 193 1212 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807202.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence657 477 1115 gene locus_tag LOCUS_18970 gene msrA 477 1115 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083656.1 protein_id gnl|my_center|LOCUS_18970 <2135 1175 gene locus_tag LOCUS_18980 <2135 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000627574.1:hydrolase >Feature sequence658 <1 672 gene locus_tag LOCUS_18990 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404084.1:succinylglutamate desuccinylase 1021 1803 gene locus_tag LOCUS_19000 1021 1803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262157.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence659 <2126 1420 gene locus_tag LOCUS_19010 <2126 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098088.1:tripartite tricarboxylate transporter substrate binding protein >Feature sequence660 99 575 gene locus_tag LOCUS_19020 99 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 786 1697 gene locus_tag LOCUS_19030 786 1697 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010216200.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence661 1497 889 gene locus_tag LOCUS_19040 1497 889 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_19040 1749 1501 gene locus_tag LOCUS_19050 1749 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2043 1807 gene locus_tag LOCUS_19060 2043 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19060 >Feature sequence662 1300 167 gene locus_tag LOCUS_19070 1300 167 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 protein_id gnl|my_center|LOCUS_19070 1450 1797 gene locus_tag LOCUS_19080 1450 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence663 1646 2041 gene locus_tag LOCUS_19090 1646 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence664 2102 846 gene locus_tag LOCUS_19100 2102 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence665 1847 1524 gene locus_tag LOCUS_19110 1847 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence666 134 445 gene locus_tag LOCUS_19120 134 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 510 902 gene locus_tag LOCUS_19130 510 902 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368415.1 protein_id gnl|my_center|LOCUS_19130 1651 1127 gene locus_tag LOCUS_19140 1651 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence667 172 1752 gene locus_tag LOCUS_19150 172 1752 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086531.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence668 943 101 gene locus_tag LOCUS_19160 943 101 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099685.1 protein_id gnl|my_center|LOCUS_19160 1892 1110 gene locus_tag LOCUS_19170 gene yaaA 1892 1110 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence669 1954 545 gene locus_tag LOCUS_19180 1954 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence670 1355 33 gene locus_tag LOCUS_19190 1355 33 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447772.1 protein_id gnl|my_center|LOCUS_19190 <2097 1352 gene locus_tag LOCUS_19200 <2097 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063855.1:type I polyketide synthase >Feature sequence671 224 1264 gene locus_tag LOCUS_19210 224 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1380 1553 gene locus_tag LOCUS_19220 1380 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1932 1546 gene locus_tag LOCUS_19230 1932 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence672 799 158 gene locus_tag LOCUS_19240 gene coq7 799 158 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085224.1 protein_id gnl|my_center|LOCUS_19240 1221 877 gene locus_tag LOCUS_19250 1221 877 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767882.1 protein_id gnl|my_center|LOCUS_19250 <2090 1255 gene locus_tag LOCUS_19260 <2090 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085368.1:phosphoribulokinase >Feature sequence673 516 40 gene locus_tag LOCUS_19270 gene greA 516 40 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210184.1 protein_id gnl|my_center|LOCUS_19270 1840 509 gene locus_tag LOCUS_19280 1840 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence674 663 67 gene locus_tag LOCUS_19290 663 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2044 746 gene locus_tag LOCUS_19300 2044 746 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence675 <1 1452 gene locus_tag LOCUS_19310 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149496819.1:SEL1-like repeat protein >Feature sequence676 240 1490 gene locus_tag LOCUS_19320 240 1490 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_19320 1672 1409 gene locus_tag LOCUS_19330 1672 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1945 1676 gene locus_tag LOCUS_19340 1945 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence677 1617 268 gene locus_tag LOCUS_19350 1617 268 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence678 539 381 gene locus_tag LOCUS_19360 539 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1597 683 gene locus_tag LOCUS_19370 1597 683 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_19370 2052 1669 gene locus_tag LOCUS_19380 2052 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence679 1977 244 gene locus_tag LOCUS_19390 1977 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence680 <1 835 gene locus_tag LOCUS_19400 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455219.1:ABC transporter permease 832 1773 gene locus_tag LOCUS_19410 832 1773 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence681 453 1667 gene locus_tag LOCUS_19420 453 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence682 539 748 gene locus_tag LOCUS_19430 539 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 1962 763 gene locus_tag LOCUS_19440 1962 763 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615740.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence683 >Feature sequence684 984 49 gene locus_tag LOCUS_19450 984 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1423 986 gene locus_tag LOCUS_19460 1423 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 <2080 1474 gene locus_tag LOCUS_19470 <2080 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814852.1:tripartite tricarboxylate transporter substrate binding protein >Feature sequence685 375 794 gene locus_tag LOCUS_19480 375 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376614.1 protein_id gnl|my_center|LOCUS_19480 2016 826 gene locus_tag LOCUS_19490 2016 826 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816265.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence686 1537 557 gene locus_tag LOCUS_19500 1537 557 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence687 1667 546 gene locus_tag LOCUS_19510 1667 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence688 141 494 gene locus_tag LOCUS_19520 141 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 500 1732 gene locus_tag LOCUS_19530 500 1732 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728213.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence689 1505 651 gene locus_tag LOCUS_19540 gene cysT 1505 651 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073418.1 protein_id gnl|my_center|LOCUS_19540 <2071 1502 gene locus_tag LOCUS_19550 <2071 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208512.1:sulfate ABC transporter substrate-binding protein >Feature sequence690 1907 27 gene locus_tag LOCUS_19560 1907 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence691 409 134 gene locus_tag LOCUS_19570 409 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1310 438 gene locus_tag LOCUS_19580 1310 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 <2069 1336 gene locus_tag LOCUS_19590 <2069 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921757.1:efflux RND transporter permease subunit >Feature sequence692 1216 5 gene locus_tag LOCUS_19600 1216 5 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275363.1 protein_id gnl|my_center|LOCUS_19600 <2067 1297 gene locus_tag LOCUS_19610 <2067 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072047.1:gamma-glutamyltransferase >Feature sequence693 <1 972 gene locus_tag LOCUS_19620 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895548.1:ribonuclease D 972 1262 gene locus_tag LOCUS_19630 972 1262 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_19630 1259 1780 gene locus_tag LOCUS_19640 1259 1780 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119281.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence694 <1 645 gene locus_tag LOCUS_19650 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963217.1:M42 family metallopeptidase 1696 752 gene locus_tag LOCUS_19660 1696 752 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091654.1 protein_id gnl|my_center|LOCUS_19660 1925 1710 gene locus_tag LOCUS_19670 1925 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence695 >Feature sequence696 876 1688 gene locus_tag LOCUS_19680 gene dkgB 876 1688 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035524.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence697 554 21 gene locus_tag LOCUS_19690 554 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 649 1770 gene locus_tag LOCUS_19700 649 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence698 1422 520 gene locus_tag LOCUS_19710 gene gnd 1422 520 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038537.1 protein_id gnl|my_center|LOCUS_19710 <2056 1503 gene locus_tag LOCUS_19720 <2056 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037777.1:5-demethoxyubiquinol-8 5-hydroxylase UbiM >Feature sequence699 1957 959 gene locus_tag LOCUS_19730 1957 959 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence700 914 18 gene locus_tag LOCUS_19740 914 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence701 1801 452 gene locus_tag LOCUS_19750 1801 452 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence702 <1 1289 gene locus_tag LOCUS_19760 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403054.1:transketolase >Feature sequence703 1712 753 gene locus_tag LOCUS_19770 1712 753 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084270.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence704 784 476 gene locus_tag LOCUS_19780 784 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1815 781 gene locus_tag LOCUS_19790 gene dusB 1815 781 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399694.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence705 143 397 gene locus_tag LOCUS_19800 143 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 407 2014 gene locus_tag LOCUS_19810 407 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence706 434 1828 gene locus_tag LOCUS_19820 434 1828 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence707 1941 1006 gene locus_tag LOCUS_19830 gene accD 1941 1006 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence708 1890 25 gene locus_tag LOCUS_19840 1890 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence709 50 1210 gene locus_tag LOCUS_19850 50 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1256 2008 gene locus_tag LOCUS_19860 1256 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence710 1696 884 gene locus_tag LOCUS_19870 1696 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence711 915 352 gene locus_tag LOCUS_19880 gene lspA 915 352 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_19880 <2021 929 gene locus_tag LOCUS_19890 <2021 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546193.1:isoleucine--tRNA ligase >Feature sequence712 <2020 153 gene locus_tag LOCUS_19900 <2020 153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103761.1:NAD-dependent malic enzyme >Feature sequence713 158 694 gene locus_tag LOCUS_19910 158 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 800 1132 gene locus_tag LOCUS_19920 gene yajC 800 1132 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence714 150 872 gene locus_tag LOCUS_19930 150 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 872 1810 gene locus_tag LOCUS_19940 872 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence715 <2016 991 gene locus_tag LOCUS_19950 <2016 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037399686.1:GlxA family transcriptional regulator >Feature sequence716 299 1348 gene locus_tag LOCUS_19960 299 1348 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816290.1 protein_id gnl|my_center|LOCUS_19960 <2011 1442 gene locus_tag LOCUS_19970 <2011 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014330387.1:altronate dehydratase family protein >Feature sequence717 1857 1600 gene locus_tag LOCUS_19980 1857 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence718 995 48 gene locus_tag LOCUS_19990 995 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1035 1934 gene locus_tag LOCUS_20000 1035 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence719 987 493 gene locus_tag LOCUS_20010 987 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1128 1472 gene locus_tag LOCUS_20020 1128 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence720 775 1311 gene locus_tag LOCUS_20030 775 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1397 1795 gene locus_tag LOCUS_20040 1397 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence721 606 190 gene locus_tag LOCUS_20050 gene arsC 606 190 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 protein_id gnl|my_center|LOCUS_20050 964 614 gene locus_tag LOCUS_20060 964 614 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969026.1 protein_id gnl|my_center|LOCUS_20060 1414 1067 gene locus_tag LOCUS_20070 1414 1067 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425054.1 protein_id gnl|my_center|LOCUS_20070 1812 1411 gene locus_tag LOCUS_20080 gene crcB 1812 1411 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence722 <2002 391 gene locus_tag LOCUS_20090 <2002 391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113940.1:aminopeptidase N >Feature sequence723 <1 1533 gene locus_tag LOCUS_20100 <1 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103493.1:valine--tRNA ligase