>Feature sequence001 266 607 gene locus_tag LOCUS_00010 266 607 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391340.1 protein_id gnl|my_center|LOCUS_00010 764 1126 gene locus_tag LOCUS_00020 764 1126 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_00020 1158 1910 gene locus_tag LOCUS_00030 1158 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2191 2949 gene locus_tag LOCUS_00040 gene modA 2191 2949 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388462.1 protein_id gnl|my_center|LOCUS_00040 2946 3641 gene locus_tag LOCUS_00050 gene modB 2946 3641 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_00050 3641 4732 gene locus_tag LOCUS_00060 gene modC 3641 4732 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388460.1 protein_id gnl|my_center|LOCUS_00060 4797 6092 gene locus_tag LOCUS_00070 4797 6092 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_00070 9263 6366 gene locus_tag LOCUS_00080 9263 6366 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391307.1 protein_id gnl|my_center|LOCUS_00080 10785 9361 gene locus_tag LOCUS_00090 gene ccmI 10785 9361 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532636.1 protein_id gnl|my_center|LOCUS_00090 11285 10782 gene locus_tag LOCUS_00100 11285 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11821 11282 gene locus_tag LOCUS_00110 11821 11282 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387795.1 protein_id gnl|my_center|LOCUS_00110 13821 11821 gene locus_tag LOCUS_00120 13821 11821 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_00120 14291 13818 gene locus_tag LOCUS_00130 gene ccmE 14291 13818 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_00130 14487 14257 gene locus_tag LOCUS_00140 14487 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15251 14484 gene locus_tag LOCUS_00150 15251 14484 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_00150 15407 16726 gene locus_tag LOCUS_00160 15407 16726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16767 17450 gene locus_tag LOCUS_00170 gene ccmA 16767 17450 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_00170 17461 18141 gene locus_tag LOCUS_00180 gene ccmB 17461 18141 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387800.1 protein_id gnl|my_center|LOCUS_00180 19259 18156 gene locus_tag LOCUS_00190 gene lptG 19259 18156 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_00190 19359 19922 gene locus_tag LOCUS_00200 19359 19922 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_00200 19988 20077 gene locus_tag LOCUS_t00010 19988 20077 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21667 20417 gene locus_tag LOCUS_00210 21667 20417 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_00210 21927 22673 gene locus_tag LOCUS_00220 21927 22673 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391306.1 protein_id gnl|my_center|LOCUS_00220 23450 22692 gene locus_tag LOCUS_00230 23450 22692 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_00230 23965 23528 gene locus_tag LOCUS_00240 23965 23528 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_00240 24911 23955 gene locus_tag LOCUS_00250 24911 23955 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228449.1 protein_id gnl|my_center|LOCUS_00250 25525 24908 gene locus_tag LOCUS_00260 25525 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27004 25529 gene locus_tag LOCUS_00270 gene rfaE1 27004 25529 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_00270 27966 27001 gene locus_tag LOCUS_00280 27966 27001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28664 27963 gene locus_tag LOCUS_00290 28664 27963 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389242.1 protein_id gnl|my_center|LOCUS_00290 28768 30108 gene locus_tag LOCUS_00300 28768 30108 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387885.1 protein_id gnl|my_center|LOCUS_00300 30131 31420 gene locus_tag LOCUS_00310 30131 31420 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387885.1 protein_id gnl|my_center|LOCUS_00310 31417 32181 gene locus_tag LOCUS_00320 31417 32181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_00320 32178 32999 gene locus_tag LOCUS_00330 32178 32999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_00330 34049 33030 gene locus_tag LOCUS_00340 gene cobT 34049 33030 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388425.1 protein_id gnl|my_center|LOCUS_00340 34048 34902 gene locus_tag LOCUS_00350 34048 34902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 34899 35510 gene locus_tag LOCUS_00360 34899 35510 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_00360 35507 36034 gene locus_tag LOCUS_00370 gene cobU 35507 36034 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_00370 37001 36003 gene locus_tag LOCUS_00380 gene cbiB 37001 36003 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391129.1 protein_id gnl|my_center|LOCUS_00380 37577 37008 gene locus_tag LOCUS_00390 37577 37008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 37679 38485 gene locus_tag LOCUS_00400 gene cobA 37679 38485 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395418.1 protein_id gnl|my_center|LOCUS_00400 38619 39392 gene locus_tag LOCUS_00410 38619 39392 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391108.1 protein_id gnl|my_center|LOCUS_00410 39385 40023 gene locus_tag LOCUS_00420 39385 40023 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_00420 40020 40580 gene locus_tag LOCUS_00430 40020 40580 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391102.1 protein_id gnl|my_center|LOCUS_00430 40577 41506 gene locus_tag LOCUS_00440 40577 41506 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404185.1 protein_id gnl|my_center|LOCUS_00440 41503 42216 gene locus_tag LOCUS_00450 41503 42216 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_00450 42213 43424 gene locus_tag LOCUS_00460 42213 43424 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092150.1 protein_id gnl|my_center|LOCUS_00460 43434 44048 gene locus_tag LOCUS_00470 43434 44048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46087 44063 gene locus_tag LOCUS_00480 46087 44063 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_00480 46093 46422 gene locus_tag LOCUS_00490 46093 46422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49000 46562 gene locus_tag LOCUS_00500 gene gyrB 49000 46562 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387765.1 protein_id gnl|my_center|LOCUS_00500 49884 48997 gene locus_tag LOCUS_00510 49884 48997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 50198 49788 gene locus_tag LOCUS_00520 50198 49788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00520 51313 50195 gene locus_tag LOCUS_00530 gene dnaN 51313 50195 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_00530 52889 51486 gene locus_tag LOCUS_00540 gene dnaA 52889 51486 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_00540 53694 53431 gene locus_tag LOCUS_00550 gene rpsT 53694 53431 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391549.1 protein_id gnl|my_center|LOCUS_00550 54226 53825 gene locus_tag LOCUS_00560 54226 53825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 55076 54240 gene locus_tag LOCUS_00570 gene mutM 55076 54240 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391546.1 protein_id gnl|my_center|LOCUS_00570 55143 55889 gene locus_tag LOCUS_00580 gene ubiE 55143 55889 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626664.1 protein_id gnl|my_center|LOCUS_00580 55896 57425 gene locus_tag LOCUS_00590 gene ubiB 55896 57425 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391544.1 protein_id gnl|my_center|LOCUS_00590 57552 57430 gene locus_tag LOCUS_00600 57552 57430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 57767 57549 gene locus_tag LOCUS_00610 57767 57549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 57965 59167 gene locus_tag LOCUS_00620 gene coaBC 57965 59167 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391543.1 protein_id gnl|my_center|LOCUS_00620 59164 59613 gene locus_tag LOCUS_00630 gene dut 59164 59613 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_00630 59620 60075 gene locus_tag LOCUS_00640 59620 60075 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_00640 60105 61067 gene locus_tag LOCUS_00650 gene cysK 60105 61067 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626663.1 protein_id gnl|my_center|LOCUS_00650 61072 61866 gene locus_tag LOCUS_00660 gene moeB 61072 61866 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_00660 61853 62302 gene locus_tag LOCUS_00670 61853 62302 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391539.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence002 <1 1008 gene locus_tag LOCUS_00680 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005173037.1:glycine betaine/L-proline ABC transporter ATP-binding protein ProV 1013 1930 gene locus_tag LOCUS_00690 gene choW 1013 1930 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 protein_id gnl|my_center|LOCUS_00690 1973 2851 gene locus_tag LOCUS_00700 1973 2851 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939572.1 protein_id gnl|my_center|LOCUS_00700 2972 3865 gene locus_tag LOCUS_00710 2972 3865 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071494957.1 protein_id gnl|my_center|LOCUS_00710 4009 4833 gene locus_tag LOCUS_00720 4009 4833 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_00720 4845 6506 gene locus_tag LOCUS_00730 4845 6506 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976251.1 protein_id gnl|my_center|LOCUS_00730 6503 7477 gene locus_tag LOCUS_00740 6503 7477 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038688.1 protein_id gnl|my_center|LOCUS_00740 7734 8528 gene locus_tag LOCUS_00750 7734 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 8532 9671 gene locus_tag LOCUS_00760 8532 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 10253 9675 gene locus_tag LOCUS_00770 gene satP 10253 9675 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209246.1 protein_id gnl|my_center|LOCUS_00770 12074 10269 gene locus_tag LOCUS_00780 12074 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 13472 12186 gene locus_tag LOCUS_00790 13472 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 15538 13601 gene locus_tag LOCUS_00800 15538 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 16021 15551 gene locus_tag LOCUS_00810 16021 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 16620 16183 gene locus_tag LOCUS_00820 16620 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 16978 16538 gene locus_tag LOCUS_00830 16978 16538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 17732 16983 gene locus_tag LOCUS_00840 17732 16983 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958530.1 protein_id gnl|my_center|LOCUS_00840 19176 17812 gene locus_tag LOCUS_00850 19176 17812 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 protein_id gnl|my_center|LOCUS_00850 19256 20650 gene locus_tag LOCUS_00860 19256 20650 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390177.1 protein_id gnl|my_center|LOCUS_00860 20678 21829 gene locus_tag LOCUS_00870 20678 21829 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626375.1 protein_id gnl|my_center|LOCUS_00870 21834 23027 gene locus_tag LOCUS_00880 21834 23027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 24811 22985 gene locus_tag LOCUS_00890 24811 22985 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_00890 28211 24825 gene locus_tag LOCUS_00900 28211 24825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 28366 29355 gene locus_tag LOCUS_00910 28366 29355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_00910 29352 30086 gene locus_tag LOCUS_00920 29352 30086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_00920 30086 31963 gene locus_tag LOCUS_00930 30086 31963 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_00930 31986 33116 gene locus_tag LOCUS_00940 31986 33116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 33263 33691 gene locus_tag LOCUS_00950 33263 33691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 34062 34364 gene locus_tag LOCUS_00960 34062 34364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 34496 34771 gene locus_tag LOCUS_00970 34496 34771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 35113 34778 gene locus_tag LOCUS_00980 35113 34778 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257651.1 protein_id gnl|my_center|LOCUS_00980 35155 35940 gene locus_tag LOCUS_00990 35155 35940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 36047 36796 gene locus_tag LOCUS_01000 36047 36796 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_01000 36786 37619 gene locus_tag LOCUS_01010 gene otsB 36786 37619 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390302.1 protein_id gnl|my_center|LOCUS_01010 37630 40077 gene locus_tag LOCUS_01020 37630 40077 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027248.1 protein_id gnl|my_center|LOCUS_01020 40447 40154 gene locus_tag LOCUS_01030 40447 40154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388430.1 protein_id gnl|my_center|LOCUS_01030 41097 40714 gene locus_tag LOCUS_01040 41097 40714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 >Feature sequence003 15060 3031 gene locus_tag LOCUS_01050 15060 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 24866 15057 gene locus_tag LOCUS_01060 24866 15057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 25467 29297 gene locus_tag LOCUS_01070 25467 29297 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530004.1 protein_id gnl|my_center|LOCUS_01070 29290 30330 gene locus_tag LOCUS_01080 29290 30330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 30333 31097 gene locus_tag LOCUS_01090 30333 31097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 33585 31630 gene locus_tag LOCUS_01100 33585 31630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 35140 33590 gene locus_tag LOCUS_01110 35140 33590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 36357 35140 gene locus_tag LOCUS_01120 36357 35140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 37227 36604 gene locus_tag LOCUS_01130 37227 36604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 37688 37224 gene locus_tag LOCUS_01140 37688 37224 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094965.1 protein_id gnl|my_center|LOCUS_01140 38785 37685 gene locus_tag LOCUS_01150 38785 37685 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257104.1 protein_id gnl|my_center|LOCUS_01150 38866 39531 gene locus_tag LOCUS_01160 38866 39531 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088180.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence004 290 102 gene locus_tag LOCUS_01170 290 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 650 363 gene locus_tag LOCUS_01180 650 363 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 protein_id gnl|my_center|LOCUS_01180 1317 610 gene locus_tag LOCUS_01190 gene cysC 1317 610 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_01190 2369 1314 gene locus_tag LOCUS_01200 2369 1314 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391318.1 protein_id gnl|my_center|LOCUS_01200 3387 2371 gene locus_tag LOCUS_01210 gene tsaD 3387 2371 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_01210 3500 3625 gene locus_tag LOCUS_01220 gene ykgO 3500 3625 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626389.1 protein_id gnl|my_center|LOCUS_01220 3655 3969 gene locus_tag LOCUS_01230 3655 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4295 3915 gene locus_tag LOCUS_01240 4295 3915 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_01240 4448 4798 gene locus_tag LOCUS_01250 4448 4798 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 protein_id gnl|my_center|LOCUS_01250 4805 5290 gene locus_tag LOCUS_01260 4805 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 5302 5805 gene locus_tag LOCUS_01270 5302 5805 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_01270 5786 6262 gene locus_tag LOCUS_01280 5786 6262 CDS product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401518.1 protein_id gnl|my_center|LOCUS_01280 6349 6660 gene locus_tag LOCUS_01290 gene rplU 6349 6660 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_01290 6690 6944 gene locus_tag LOCUS_01300 gene rpmA 6690 6944 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003492686.1 protein_id gnl|my_center|LOCUS_01300 7040 8071 gene locus_tag LOCUS_01310 gene obgE 7040 8071 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388995.1 protein_id gnl|my_center|LOCUS_01310 8068 9183 gene locus_tag LOCUS_01320 gene proB 8068 9183 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388994.1 protein_id gnl|my_center|LOCUS_01320 9185 10150 gene locus_tag LOCUS_01330 9185 10150 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_01330 10326 11609 gene locus_tag LOCUS_01340 10326 11609 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388993.1 protein_id gnl|my_center|LOCUS_01340 11717 12247 gene locus_tag LOCUS_01350 11717 12247 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561934.1 protein_id gnl|my_center|LOCUS_01350 12237 12635 gene locus_tag LOCUS_01360 12237 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 12637 13083 gene locus_tag LOCUS_01370 gene rlmH 12637 13083 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388990.1 protein_id gnl|my_center|LOCUS_01370 15210 13105 gene locus_tag LOCUS_01380 15210 13105 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 protein_id gnl|my_center|LOCUS_01380 15827 15243 gene locus_tag LOCUS_01390 15827 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 15976 16542 gene locus_tag LOCUS_01400 15976 16542 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_01400 16644 17846 gene locus_tag LOCUS_01410 16644 17846 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388890.1 protein_id gnl|my_center|LOCUS_01410 19127 18105 gene locus_tag LOCUS_01420 19127 18105 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388951.1 protein_id gnl|my_center|LOCUS_01420 19254 20186 gene locus_tag LOCUS_01430 gene hemC 19254 20186 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_01430 20232 20945 gene locus_tag LOCUS_01440 20232 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 20942 21325 gene locus_tag LOCUS_01450 20942 21325 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_01450 21439 21525 gene locus_tag LOCUS_t00020 21439 21525 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21615 22226 gene locus_tag LOCUS_01460 21615 22226 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921430.1 protein_id gnl|my_center|LOCUS_01460 22445 23437 gene locus_tag LOCUS_01470 22445 23437 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 protein_id gnl|my_center|LOCUS_01470 23454 24110 gene locus_tag LOCUS_01480 gene lptC 23454 24110 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387774.1 protein_id gnl|my_center|LOCUS_01480 24107 25093 gene locus_tag LOCUS_01490 24107 25093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_01490 25090 25869 gene locus_tag LOCUS_01500 gene lptB 25090 25869 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_01500 25897 27441 gene locus_tag LOCUS_01510 gene rpoN 25897 27441 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387771.1 protein_id gnl|my_center|LOCUS_01510 27570 28205 gene locus_tag LOCUS_01520 gene raiA 27570 28205 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_01520 28232 28696 gene locus_tag LOCUS_01530 gene ptsN 28232 28696 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_01530 29164 28697 gene locus_tag LOCUS_01540 29164 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 29353 32307 gene locus_tag LOCUS_01550 29353 32307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 32990 32322 gene locus_tag LOCUS_01560 32990 32322 CDS product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266385.1 protein_id gnl|my_center|LOCUS_01560 33766 32987 gene locus_tag LOCUS_01570 33766 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 35031 34372 gene locus_tag LOCUS_01580 35031 34372 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036586.1 protein_id gnl|my_center|LOCUS_01580 35678 35037 gene locus_tag LOCUS_01590 gene purN 35678 35037 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390017.1 protein_id gnl|my_center|LOCUS_01590 36792 35689 gene locus_tag LOCUS_01600 gene purM 36792 35689 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626325.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence005 370 1482 gene locus_tag LOCUS_01610 gene gcvT 370 1482 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390799.1 protein_id gnl|my_center|LOCUS_01610 1516 1893 gene locus_tag LOCUS_01620 gene gcvH 1516 1893 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390798.1 protein_id gnl|my_center|LOCUS_01620 1898 3241 gene locus_tag LOCUS_01630 gene gcvPA 1898 3241 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390797.1 protein_id gnl|my_center|LOCUS_01630 3241 4746 gene locus_tag LOCUS_01640 gene gcvPB 3241 4746 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390796.1 protein_id gnl|my_center|LOCUS_01640 4769 5620 gene locus_tag LOCUS_01650 4769 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 5651 6658 gene locus_tag LOCUS_01660 5651 6658 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337476.1 protein_id gnl|my_center|LOCUS_01660 6655 6912 gene locus_tag LOCUS_01670 6655 6912 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389863.1 protein_id gnl|my_center|LOCUS_01670 6872 7222 gene locus_tag LOCUS_01680 6872 7222 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_01680 7277 7651 gene locus_tag LOCUS_01690 7277 7651 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_01690 7651 8613 gene locus_tag LOCUS_01700 7651 8613 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 protein_id gnl|my_center|LOCUS_01700 8669 8902 gene locus_tag LOCUS_01710 8669 8902 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_01710 9423 8941 gene locus_tag LOCUS_01720 9423 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 9565 10110 gene locus_tag LOCUS_01730 gene hslV 9565 10110 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391346.1 protein_id gnl|my_center|LOCUS_01730 10107 11420 gene locus_tag LOCUS_01740 gene hslU 10107 11420 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391347.1 protein_id gnl|my_center|LOCUS_01740 11449 12411 gene locus_tag LOCUS_01750 11449 12411 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038348.1 protein_id gnl|my_center|LOCUS_01750 12428 13231 gene locus_tag LOCUS_01760 gene dapB 12428 13231 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_01760 13250 14770 gene locus_tag LOCUS_01770 13250 14770 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 protein_id gnl|my_center|LOCUS_01770 14767 16107 gene locus_tag LOCUS_01780 14767 16107 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_01780 16694 16128 gene locus_tag LOCUS_01790 16694 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 16626 17033 gene locus_tag LOCUS_01800 16626 17033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 17142 18065 gene locus_tag LOCUS_01810 17142 18065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975769.1 protein_id gnl|my_center|LOCUS_01810 18248 18454 gene locus_tag LOCUS_01820 18248 18454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 18451 18735 gene locus_tag LOCUS_01830 18451 18735 CDS product DUF5395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879113.1 protein_id gnl|my_center|LOCUS_01830 18764 20230 gene locus_tag LOCUS_01840 18764 20230 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459002.1 protein_id gnl|my_center|LOCUS_01840 22183 20294 gene locus_tag LOCUS_01850 22183 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 22418 22588 gene locus_tag LOCUS_01860 22418 22588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 22645 22818 gene locus_tag LOCUS_01870 22645 22818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 23936 22905 gene locus_tag LOCUS_01880 gene hypE 23936 22905 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_01880 25063 23933 gene locus_tag LOCUS_01890 gene hypD 25063 23933 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388059.1 protein_id gnl|my_center|LOCUS_01890 25320 25060 gene locus_tag LOCUS_01900 25320 25060 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_01900 26436 25342 gene locus_tag LOCUS_01910 26436 25342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 27230 26433 gene locus_tag LOCUS_01920 gene hypB 27230 26433 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388924.1 protein_id gnl|my_center|LOCUS_01920 27571 27230 gene locus_tag LOCUS_01930 gene hypA 27571 27230 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_01930 27922 27578 gene locus_tag LOCUS_01940 27922 27578 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_01940 28062 28748 gene locus_tag LOCUS_01950 28062 28748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 28764 29306 gene locus_tag LOCUS_01960 28764 29306 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_01960 29485 30702 gene locus_tag LOCUS_01970 29485 30702 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_01970 30866 31273 gene locus_tag LOCUS_01980 30866 31273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 31828 31274 gene locus_tag LOCUS_01990 31828 31274 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149585.1 protein_id gnl|my_center|LOCUS_01990 32294 31845 gene locus_tag LOCUS_02000 32294 31845 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_02000 33185 32373 gene locus_tag LOCUS_02010 gene fetB 33185 32373 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_02010 33811 33182 gene locus_tag LOCUS_02020 33811 33182 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_02020 34704 33811 gene locus_tag LOCUS_02030 34704 33811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 34861 35370 gene locus_tag LOCUS_02040 34861 35370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 35367 35693 gene locus_tag LOCUS_02050 35367 35693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 >Feature sequence006 869 99 gene locus_tag LOCUS_02060 869 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 898 1671 gene locus_tag LOCUS_02070 898 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 2694 1654 gene locus_tag LOCUS_02080 gene cobW 2694 1654 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388429.1 protein_id gnl|my_center|LOCUS_02080 3247 2903 gene locus_tag LOCUS_02090 3247 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 3413 3649 gene locus_tag LOCUS_02100 3413 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 3677 4699 gene locus_tag LOCUS_02110 gene cobD 3677 4699 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390401.1 protein_id gnl|my_center|LOCUS_02110 5975 4683 gene locus_tag LOCUS_02120 5975 4683 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 protein_id gnl|my_center|LOCUS_02120 6386 5979 gene locus_tag LOCUS_02130 6386 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529226.1 protein_id gnl|my_center|LOCUS_02130 6485 7543 gene locus_tag LOCUS_02140 6485 7543 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 protein_id gnl|my_center|LOCUS_02140 7546 8298 gene locus_tag LOCUS_02150 7546 8298 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086052.1 protein_id gnl|my_center|LOCUS_02150 8405 8836 gene locus_tag LOCUS_02160 8405 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 9779 8823 gene locus_tag LOCUS_02170 gene cbiB 9779 8823 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966031.1 protein_id gnl|my_center|LOCUS_02170 9911 10057 gene locus_tag LOCUS_02180 9911 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 10070 10495 gene locus_tag LOCUS_02190 10070 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 12093 10627 gene locus_tag LOCUS_02200 12093 10627 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919619.1 protein_id gnl|my_center|LOCUS_02200 16042 12290 gene locus_tag LOCUS_02210 gene cobN 16042 12290 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391113.1 protein_id gnl|my_center|LOCUS_02210 16524 16120 gene locus_tag LOCUS_02220 16524 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 17639 16623 gene locus_tag LOCUS_02230 17639 16623 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970138.1 protein_id gnl|my_center|LOCUS_02230 19519 17636 gene locus_tag LOCUS_02240 19519 17636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 20120 19551 gene locus_tag LOCUS_02250 20120 19551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 20533 20132 gene locus_tag LOCUS_02260 20533 20132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 20944 20600 gene locus_tag LOCUS_02270 gene trxA 20944 20600 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_02270 21794 21009 gene locus_tag LOCUS_02280 21794 21009 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_02280 21819 23015 gene locus_tag LOCUS_02290 21819 23015 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_02290 23012 23950 gene locus_tag LOCUS_02300 23012 23950 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_02300 25986 24028 gene locus_tag LOCUS_02310 25986 24028 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870173.1 protein_id gnl|my_center|LOCUS_02310 26330 27796 gene locus_tag LOCUS_02320 26330 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 28048 27803 gene locus_tag LOCUS_02330 28048 27803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 27938 28174 gene locus_tag LOCUS_02340 27938 28174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 29700 28342 gene locus_tag LOCUS_02350 29700 28342 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_02350 29744 30721 gene locus_tag LOCUS_02360 29744 30721 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_02360 30944 32533 gene locus_tag LOCUS_02370 30944 32533 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_02370 32602 33081 gene locus_tag LOCUS_02380 32602 33081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence007 760 8 gene locus_tag LOCUS_02390 760 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1681 836 gene locus_tag LOCUS_02400 1681 836 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061879.1 protein_id gnl|my_center|LOCUS_02400 2661 1750 gene locus_tag LOCUS_02410 2661 1750 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_02410 3887 2658 gene locus_tag LOCUS_02420 3887 2658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_02420 4240 3953 gene locus_tag LOCUS_02430 4240 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 5136 4642 gene locus_tag LOCUS_02440 5136 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6986 5214 gene locus_tag LOCUS_02450 6986 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7439 7104 gene locus_tag LOCUS_02460 7439 7104 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 protein_id gnl|my_center|LOCUS_02460 7966 7535 gene locus_tag LOCUS_02470 7966 7535 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_02470 8852 8028 gene locus_tag LOCUS_02480 gene cysE 8852 8028 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_02480 9088 9747 gene locus_tag LOCUS_02490 9088 9747 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_02490 10792 9722 gene locus_tag LOCUS_02500 10792 9722 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_02500 10939 12195 gene locus_tag LOCUS_02510 gene tyrS 10939 12195 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_02510 12301 12879 gene locus_tag LOCUS_02520 12301 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 13287 12880 gene locus_tag LOCUS_02530 13287 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 13781 13365 gene locus_tag LOCUS_02540 13781 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389947.1 protein_id gnl|my_center|LOCUS_02540 14459 13884 gene locus_tag LOCUS_02550 14459 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 14481 15908 gene locus_tag LOCUS_02560 gene argH 14481 15908 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388156.1 protein_id gnl|my_center|LOCUS_02560 15905 16060 gene locus_tag LOCUS_02570 15905 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 16057 17334 gene locus_tag LOCUS_02580 gene lysA 16057 17334 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388155.1 protein_id gnl|my_center|LOCUS_02580 17339 19648 gene locus_tag LOCUS_02590 17339 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 19812 21416 gene locus_tag LOCUS_02600 19812 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 22010 21429 gene locus_tag LOCUS_02610 22010 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 22210 22938 gene locus_tag LOCUS_02620 22210 22938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 23969 22935 gene locus_tag LOCUS_02630 23969 22935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 24570 25409 gene locus_tag LOCUS_02640 24570 25409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 26336 25410 gene locus_tag LOCUS_02650 gene dgcZ 26336 25410 CDS product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592852.1 protein_id gnl|my_center|LOCUS_02650 27009 26464 gene locus_tag LOCUS_02660 27009 26464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 27188 27454 gene locus_tag LOCUS_02670 27188 27454 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_02670 28316 27528 gene locus_tag LOCUS_02680 28316 27528 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence008 5036 2334 gene locus_tag LOCUS_02690 gene topA 5036 2334 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_02690 6319 5165 gene locus_tag LOCUS_02700 gene dprA 6319 5165 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_02700 6467 7726 gene locus_tag LOCUS_02710 6467 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 8484 7660 gene locus_tag LOCUS_02720 8484 7660 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968194.1 protein_id gnl|my_center|LOCUS_02720 9255 8521 gene locus_tag LOCUS_02730 9255 8521 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723488.1 protein_id gnl|my_center|LOCUS_02730 10174 9365 gene locus_tag LOCUS_02740 10174 9365 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 protein_id gnl|my_center|LOCUS_02740 10288 10728 gene locus_tag LOCUS_02750 10288 10728 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_02750 11497 10712 gene locus_tag LOCUS_02760 11497 10712 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_02760 12317 11505 gene locus_tag LOCUS_02770 12317 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 14745 12403 gene locus_tag LOCUS_02780 14745 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 15672 14752 gene locus_tag LOCUS_02790 15672 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 15824 17350 gene locus_tag LOCUS_02800 15824 17350 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976286.1 protein_id gnl|my_center|LOCUS_02800 17396 17716 gene locus_tag LOCUS_02810 17396 17716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 17793 19454 gene locus_tag LOCUS_02820 gene pgi 17793 19454 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_02820 19475 19786 gene locus_tag LOCUS_02830 19475 19786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 19802 21604 gene locus_tag LOCUS_02840 gene mutL 19802 21604 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139982.1 protein_id gnl|my_center|LOCUS_02840 21691 21909 gene locus_tag LOCUS_02850 21691 21909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 22267 22485 gene locus_tag LOCUS_02860 22267 22485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 22724 22649 gene locus_tag LOCUS_t00030 22724 22649 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23040 22735 gene locus_tag LOCUS_02870 23040 22735 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389336.1 protein_id gnl|my_center|LOCUS_02870 23142 23066 gene locus_tag LOCUS_t00040 23142 23066 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24399 23194 gene locus_tag LOCUS_02880 24399 23194 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 protein_id gnl|my_center|LOCUS_02880 24544 25068 gene locus_tag LOCUS_02890 24544 25068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 26559 25099 gene locus_tag LOCUS_02900 26559 25099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 26911 26684 gene locus_tag LOCUS_02910 26911 26684 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_02910 27102 27027 gene locus_tag LOCUS_t00050 27102 27027 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence009 1822 782 gene locus_tag LOCUS_02920 1822 782 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_02920 3438 1882 gene locus_tag LOCUS_02930 3438 1882 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_02930 4597 3578 gene locus_tag LOCUS_02940 gene ilvC 4597 3578 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388228.1 protein_id gnl|my_center|LOCUS_02940 5226 4711 gene locus_tag LOCUS_02950 gene ilvN 5226 4711 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_02950 7114 5345 gene locus_tag LOCUS_02960 7114 5345 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 protein_id gnl|my_center|LOCUS_02960 10118 7518 gene locus_tag LOCUS_02970 gene clpB 10118 7518 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_02970 10793 10380 gene locus_tag LOCUS_02980 10793 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 11095 11802 gene locus_tag LOCUS_02990 11095 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 11827 13788 gene locus_tag LOCUS_03000 11827 13788 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209877314.1 protein_id gnl|my_center|LOCUS_03000 14055 13789 gene locus_tag LOCUS_03010 14055 13789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 14923 14234 gene locus_tag LOCUS_03020 14923 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 15064 16347 gene locus_tag LOCUS_03030 15064 16347 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389343.1 protein_id gnl|my_center|LOCUS_03030 18295 16406 gene locus_tag LOCUS_03040 gene htpG 18295 16406 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387833.1 protein_id gnl|my_center|LOCUS_03040 18817 19185 gene locus_tag LOCUS_03050 18817 19185 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387834.1 protein_id gnl|my_center|LOCUS_03050 19227 19904 gene locus_tag LOCUS_03060 19227 19904 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_03060 20639 19908 gene locus_tag LOCUS_03070 20639 19908 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387998.1 protein_id gnl|my_center|LOCUS_03070 21670 20636 gene locus_tag LOCUS_03080 21670 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 22444 21830 gene locus_tag LOCUS_03090 gene rpsD 22444 21830 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388459.1 protein_id gnl|my_center|LOCUS_03090 22717 23184 gene locus_tag LOCUS_03100 22717 23184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 23181 23660 gene locus_tag LOCUS_03110 23181 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 24515 23760 gene locus_tag LOCUS_03120 24515 23760 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_03120 25230 24508 gene locus_tag LOCUS_03130 25230 24508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03130 26789 25227 gene locus_tag LOCUS_03140 26789 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 26754 27371 gene locus_tag LOCUS_03150 26754 27371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence010 1284 427 gene locus_tag LOCUS_03160 1284 427 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527211.1 protein_id gnl|my_center|LOCUS_03160 1394 2287 gene locus_tag LOCUS_03170 1394 2287 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 protein_id gnl|my_center|LOCUS_03170 2416 3306 gene locus_tag LOCUS_03180 2416 3306 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119656.1 protein_id gnl|my_center|LOCUS_03180 3303 5060 gene locus_tag LOCUS_03190 3303 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6209 5256 gene locus_tag LOCUS_03200 6209 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 6630 8156 gene locus_tag LOCUS_03210 6630 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 8219 8767 gene locus_tag LOCUS_03220 8219 8767 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704792.1 protein_id gnl|my_center|LOCUS_03220 10404 8752 gene locus_tag LOCUS_03230 10404 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 11053 10412 gene locus_tag LOCUS_03240 11053 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 13850 11100 gene locus_tag LOCUS_03250 gene secA 13850 11100 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_03250 14111 14488 gene locus_tag LOCUS_03260 14111 14488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 14578 14964 gene locus_tag LOCUS_03270 14578 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 15203 15517 gene locus_tag LOCUS_03280 15203 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 16534 15530 gene locus_tag LOCUS_03290 16534 15530 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_03290 16663 16875 gene locus_tag LOCUS_03300 16663 16875 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327537.1 protein_id gnl|my_center|LOCUS_03300 16872 17633 gene locus_tag LOCUS_03310 16872 17633 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_03310 17712 18428 gene locus_tag LOCUS_03320 17712 18428 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970505.1 protein_id gnl|my_center|LOCUS_03320 18525 18839 gene locus_tag LOCUS_03330 18525 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 19444 18884 gene locus_tag LOCUS_03340 19444 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 19645 20844 gene locus_tag LOCUS_03350 19645 20844 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640419.1 protein_id gnl|my_center|LOCUS_03350 20961 22172 gene locus_tag LOCUS_03360 gene hybO 20961 22172 CDS product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145410.1 protein_id gnl|my_center|LOCUS_03360 22177 23232 gene locus_tag LOCUS_03370 gene hybA 22177 23232 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706349.1 protein_id gnl|my_center|LOCUS_03370 23229 24386 gene locus_tag LOCUS_03380 gene hybB 23229 24386 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017694.1 protein_id gnl|my_center|LOCUS_03380 24412 26124 gene locus_tag LOCUS_03390 gene hybC 24412 26124 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817177.1 protein_id gnl|my_center|LOCUS_03390 26127 26603 gene locus_tag LOCUS_03400 26127 26603 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221954.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence011 360 79 gene locus_tag LOCUS_03410 360 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1528 368 gene locus_tag LOCUS_03420 gene rlmN 1528 368 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_03420 2111 1578 gene locus_tag LOCUS_03430 2111 1578 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_03430 2789 2160 gene locus_tag LOCUS_03440 2789 2160 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_03440 2877 3854 gene locus_tag LOCUS_03450 2877 3854 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391118.1 protein_id gnl|my_center|LOCUS_03450 3915 4598 gene locus_tag LOCUS_03460 3915 4598 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338508.1 protein_id gnl|my_center|LOCUS_03460 4614 5441 gene locus_tag LOCUS_03470 4614 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5710 6150 gene locus_tag LOCUS_03480 5710 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 6355 6185 gene locus_tag LOCUS_03490 6355 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 6576 7466 gene locus_tag LOCUS_03500 gene htpX 6576 7466 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391326.1 protein_id gnl|my_center|LOCUS_03500 7471 8772 gene locus_tag LOCUS_03510 7471 8772 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_03510 8920 10611 gene locus_tag LOCUS_03520 8920 10611 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_03520 10874 11386 gene locus_tag LOCUS_03530 10874 11386 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389209.1 protein_id gnl|my_center|LOCUS_03530 11450 11983 gene locus_tag LOCUS_03540 11450 11983 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_03540 12009 12557 gene locus_tag LOCUS_03550 12009 12557 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389207.1 protein_id gnl|my_center|LOCUS_03550 12691 13593 gene locus_tag LOCUS_03560 12691 13593 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_03560 13915 18948 gene locus_tag LOCUS_03570 13915 18948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 19006 20640 gene locus_tag LOCUS_03580 19006 20640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 20754 21476 gene locus_tag LOCUS_03590 20754 21476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 21483 22838 gene locus_tag LOCUS_03600 21483 22838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 22840 25011 gene locus_tag LOCUS_03610 22840 25011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 >Feature sequence012 71 565 gene locus_tag LOCUS_03620 71 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 856 1254 gene locus_tag LOCUS_03630 856 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1382 2524 gene locus_tag LOCUS_03640 1382 2524 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967022.1 protein_id gnl|my_center|LOCUS_03640 2661 3773 gene locus_tag LOCUS_03650 2661 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 4920 3784 gene locus_tag LOCUS_03660 gene tgt 4920 3784 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388033.1 protein_id gnl|my_center|LOCUS_03660 5963 4917 gene locus_tag LOCUS_03670 gene queA 5963 4917 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388034.1 protein_id gnl|my_center|LOCUS_03670 6529 5960 gene locus_tag LOCUS_03680 6529 5960 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_03680 7124 6558 gene locus_tag LOCUS_03690 7124 6558 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_03690 8422 7331 gene locus_tag LOCUS_03700 8422 7331 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403058.1 protein_id gnl|my_center|LOCUS_03700 8805 8419 gene locus_tag LOCUS_03710 8805 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 9077 8802 gene locus_tag LOCUS_03720 9077 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 10396 9074 gene locus_tag LOCUS_03730 10396 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 11848 10514 gene locus_tag LOCUS_03740 11848 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 13179 11845 gene locus_tag LOCUS_03750 13179 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 14204 13239 gene locus_tag LOCUS_03760 14204 13239 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388975.1 protein_id gnl|my_center|LOCUS_03760 14941 14201 gene locus_tag LOCUS_03770 14941 14201 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470606.1 protein_id gnl|my_center|LOCUS_03770 15621 14962 gene locus_tag LOCUS_03780 gene fsa 15621 14962 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921441.1 protein_id gnl|my_center|LOCUS_03780 15665 17884 gene locus_tag LOCUS_03790 15665 17884 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529032.1 protein_id gnl|my_center|LOCUS_03790 18133 18693 gene locus_tag LOCUS_03800 18133 18693 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_03800 18693 20222 gene locus_tag LOCUS_03810 gene atpA 18693 20222 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530298.1 protein_id gnl|my_center|LOCUS_03810 20273 21181 gene locus_tag LOCUS_03820 20273 21181 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_03820 21227 22648 gene locus_tag LOCUS_03830 gene atpD 21227 22648 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_03830 22661 23068 gene locus_tag LOCUS_03840 22661 23068 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence013 510 133 gene locus_tag LOCUS_03850 510 133 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_03850 2041 629 gene locus_tag LOCUS_03860 2041 629 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_03860 2432 2055 gene locus_tag LOCUS_03870 2432 2055 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_03870 3741 2578 gene locus_tag LOCUS_03880 3741 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3872 5752 gene locus_tag LOCUS_03890 3872 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 7592 5985 gene locus_tag LOCUS_03900 7592 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 8011 7589 gene locus_tag LOCUS_03910 8011 7589 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814433.1 protein_id gnl|my_center|LOCUS_03910 8267 10420 gene locus_tag LOCUS_03920 gene scpA 8267 10420 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_03920 10701 10303 gene locus_tag LOCUS_03930 10701 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 10700 11641 gene locus_tag LOCUS_03940 10700 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 11823 13646 gene locus_tag LOCUS_03950 11823 13646 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388342.1 protein_id gnl|my_center|LOCUS_03950 13643 14437 gene locus_tag LOCUS_03960 13643 14437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 protein_id gnl|my_center|LOCUS_03960 14434 15189 gene locus_tag LOCUS_03970 14434 15189 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_03970 15194 15535 gene locus_tag LOCUS_03980 15194 15535 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_03980 15673 15960 gene locus_tag LOCUS_03990 gene groES 15673 15960 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530718.1 protein_id gnl|my_center|LOCUS_03990 16018 17673 gene locus_tag LOCUS_04000 gene groL 16018 17673 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387923.1 protein_id gnl|my_center|LOCUS_04000 17942 18799 gene locus_tag LOCUS_04010 gene prmC 17942 18799 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_04010 18889 19518 gene locus_tag LOCUS_04020 gene lipB 18889 19518 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389749.1 protein_id gnl|my_center|LOCUS_04020 20534 19620 gene locus_tag LOCUS_04030 20534 19620 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_04030 21588 20638 gene locus_tag LOCUS_04040 gene trxB 21588 20638 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_04040 22439 21705 gene locus_tag LOCUS_04050 22439 21705 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390647.1 protein_id gnl|my_center|LOCUS_04050 >Feature sequence014 <1 2034 gene locus_tag LOCUS_04060 <1 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262580.1:efflux RND transporter permease subunit 3083 2106 gene locus_tag LOCUS_04070 3083 2106 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 protein_id gnl|my_center|LOCUS_04070 4074 3187 gene locus_tag LOCUS_04080 4074 3187 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_04080 4743 4168 gene locus_tag LOCUS_04090 4743 4168 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391007.1 protein_id gnl|my_center|LOCUS_04090 4837 6009 gene locus_tag LOCUS_04100 4837 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6013 6954 gene locus_tag LOCUS_04110 6013 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7016 8224 gene locus_tag LOCUS_04120 7016 8224 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388321.1 protein_id gnl|my_center|LOCUS_04120 8224 9009 gene locus_tag LOCUS_04130 8224 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9017 10024 gene locus_tag LOCUS_04140 9017 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11122 10028 gene locus_tag LOCUS_04150 11122 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 12286 11228 gene locus_tag LOCUS_04160 12286 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 13574 12279 gene locus_tag LOCUS_04170 gene mtaB 13574 12279 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_04170 14398 13565 gene locus_tag LOCUS_04180 gene dapF 14398 13565 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538114.1 protein_id gnl|my_center|LOCUS_04180 14507 14869 gene locus_tag LOCUS_04190 14507 14869 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_04190 15071 14883 gene locus_tag LOCUS_04200 15071 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 15326 15252 gene locus_tag LOCUS_t00060 15326 15252 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17025 15373 gene locus_tag LOCUS_04210 17025 15373 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_04210 18269 17070 gene locus_tag LOCUS_04220 18269 17070 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_04220 21457 18347 gene locus_tag LOCUS_04230 21457 18347 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_04230 <22444 21454 gene locus_tag LOCUS_04240 <22444 21454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017870666.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence015 1216 95 gene locus_tag LOCUS_04250 1216 95 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_04250 1324 2241 gene locus_tag LOCUS_04260 1324 2241 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090294.1 protein_id gnl|my_center|LOCUS_04260 3104 2316 gene locus_tag LOCUS_04270 3104 2316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_04270 2986 3351 gene locus_tag LOCUS_04280 2986 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3495 5837 gene locus_tag LOCUS_04290 3495 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 5899 7428 gene locus_tag LOCUS_04300 5899 7428 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390363.1 protein_id gnl|my_center|LOCUS_04300 7425 8294 gene locus_tag LOCUS_04310 7425 8294 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_04310 9823 8639 gene locus_tag LOCUS_04320 9823 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 10659 9838 gene locus_tag LOCUS_04330 10659 9838 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_04330 11633 10656 gene locus_tag LOCUS_04340 gene pip 11633 10656 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_04340 11679 12404 gene locus_tag LOCUS_04350 11679 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 12401 13858 gene locus_tag LOCUS_04360 12401 13858 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502938.1 protein_id gnl|my_center|LOCUS_04360 14569 13907 gene locus_tag LOCUS_04370 14569 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 15662 14709 gene locus_tag LOCUS_04380 gene prfB 15662 14709 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04380 18361 15890 gene locus_tag LOCUS_04390 18361 15890 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_04390 19693 18434 gene locus_tag LOCUS_04400 19693 18434 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_04400 19580 19960 gene locus_tag LOCUS_04410 19580 19960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence016 231 3371 gene locus_tag LOCUS_04420 231 3371 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_04420 3368 4855 gene locus_tag LOCUS_04430 3368 4855 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_04430 4830 6053 gene locus_tag LOCUS_04440 4830 6053 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_04440 6050 9187 gene locus_tag LOCUS_04450 6050 9187 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_04450 9770 10633 gene locus_tag LOCUS_04460 9770 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 11431 10646 gene locus_tag LOCUS_04470 11431 10646 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389415.1 protein_id gnl|my_center|LOCUS_04470 11606 16186 gene locus_tag LOCUS_04480 11606 16186 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123147513.1 protein_id gnl|my_center|LOCUS_04480 16191 17438 gene locus_tag LOCUS_04490 16191 17438 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788709.1 protein_id gnl|my_center|LOCUS_04490 18685 17405 gene locus_tag LOCUS_04500 18685 17405 CDS product cyclic nucleotide-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967190.1 protein_id gnl|my_center|LOCUS_04500 19000 19089 gene locus_tag LOCUS_t00070 19000 19089 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 19415 20674 gene locus_tag LOCUS_04510 19415 20674 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_04510 21682 20690 gene locus_tag LOCUS_04520 gene phnD 21682 20690 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence017 92 265 gene locus_tag LOCUS_04530 92 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 454 260 gene locus_tag LOCUS_04540 454 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 1576 620 gene locus_tag LOCUS_04550 gene lpxC 1576 620 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388698.1 protein_id gnl|my_center|LOCUS_04550 3674 1857 gene locus_tag LOCUS_04560 gene ftsZ 3674 1857 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388699.1 protein_id gnl|my_center|LOCUS_04560 5127 3748 gene locus_tag LOCUS_04570 gene ftsA 5127 3748 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_04570 5994 5131 gene locus_tag LOCUS_04580 5994 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 6893 5982 gene locus_tag LOCUS_04590 6893 5982 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388702.1 protein_id gnl|my_center|LOCUS_04590 7831 6890 gene locus_tag LOCUS_04600 gene murB 7831 6890 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 protein_id gnl|my_center|LOCUS_04600 9282 7828 gene locus_tag LOCUS_04610 gene murC 9282 7828 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_04610 10424 9279 gene locus_tag LOCUS_04620 gene murG 10424 9279 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_04620 11560 10421 gene locus_tag LOCUS_04630 11560 10421 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_04630 12954 11557 gene locus_tag LOCUS_04640 gene murD 12954 11557 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388707.1 protein_id gnl|my_center|LOCUS_04640 14048 12960 gene locus_tag LOCUS_04650 gene mraY 14048 12960 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_04650 15478 14063 gene locus_tag LOCUS_04660 gene murF 15478 14063 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_04660 16995 15475 gene locus_tag LOCUS_04670 16995 15475 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920415.1 protein_id gnl|my_center|LOCUS_04670 18757 17024 gene locus_tag LOCUS_04680 18757 17024 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_04680 19137 18754 gene locus_tag LOCUS_04690 19137 18754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 20195 19137 gene locus_tag LOCUS_04700 gene rsmH 20195 19137 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_04700 20659 20192 gene locus_tag LOCUS_04710 20659 20192 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388714.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence018 632 1015 gene locus_tag LOCUS_04720 632 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1053 1436 gene locus_tag LOCUS_04730 gene sdhD 1053 1436 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_04730 1444 3321 gene locus_tag LOCUS_04740 gene sdhA 1444 3321 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_04740 3340 4122 gene locus_tag LOCUS_04750 3340 4122 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388960.1 protein_id gnl|my_center|LOCUS_04750 4241 4924 gene locus_tag LOCUS_04760 gene phaR 4241 4924 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_04760 5192 6856 gene locus_tag LOCUS_04770 gene leuA 5192 6856 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 protein_id gnl|my_center|LOCUS_04770 6977 8410 gene locus_tag LOCUS_04780 gene tldD 6977 8410 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_04780 9622 8417 gene locus_tag LOCUS_04790 9622 8417 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_04790 9706 10338 gene locus_tag LOCUS_04800 9706 10338 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337827.1 protein_id gnl|my_center|LOCUS_04800 11005 10469 gene locus_tag LOCUS_04810 11005 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 11316 11501 gene locus_tag LOCUS_04820 11316 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 12523 11498 gene locus_tag LOCUS_04830 12523 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 13525 12524 gene locus_tag LOCUS_04840 gene glk 13525 12524 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390239.1 protein_id gnl|my_center|LOCUS_04840 15421 13634 gene locus_tag LOCUS_04850 15421 13634 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_04850 15555 16838 gene locus_tag LOCUS_04860 15555 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 16835 17311 gene locus_tag LOCUS_04870 16835 17311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 17308 17643 gene locus_tag LOCUS_04880 17308 17643 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390657.1 protein_id gnl|my_center|LOCUS_04880 17647 18444 gene locus_tag LOCUS_04890 17647 18444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390658.1 protein_id gnl|my_center|LOCUS_04890 18458 19255 gene locus_tag LOCUS_04900 18458 19255 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_04900 19252 20256 gene locus_tag LOCUS_04910 19252 20256 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390660.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence019 <1 650 gene locus_tag LOCUS_04920 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918194.1:ABC transporter ATP-binding protein 647 1537 gene locus_tag LOCUS_04930 647 1537 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 protein_id gnl|my_center|LOCUS_04930 1834 1541 gene locus_tag LOCUS_04940 1834 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2338 1934 gene locus_tag LOCUS_04950 2338 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2736 2350 gene locus_tag LOCUS_04960 2736 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2907 2822 gene locus_tag LOCUS_t00080 2907 2822 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3474 3151 gene locus_tag LOCUS_04970 3474 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4252 3494 gene locus_tag LOCUS_04980 4252 3494 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_04980 4767 4324 gene locus_tag LOCUS_04990 4767 4324 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083039.1 protein_id gnl|my_center|LOCUS_04990 6009 4771 gene locus_tag LOCUS_05000 gene argJ 6009 4771 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_05000 6833 6009 gene locus_tag LOCUS_05010 6833 6009 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175805.1 protein_id gnl|my_center|LOCUS_05010 7841 7044 gene locus_tag LOCUS_05020 7841 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391040.1 protein_id gnl|my_center|LOCUS_05020 8156 9913 gene locus_tag LOCUS_05030 gene thiC 8156 9913 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243935.1 protein_id gnl|my_center|LOCUS_05030 10811 9927 gene locus_tag LOCUS_05040 10811 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 11283 10786 gene locus_tag LOCUS_05050 11283 10786 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387840.1 protein_id gnl|my_center|LOCUS_05050 11796 11467 gene locus_tag LOCUS_05060 11796 11467 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387838.1 protein_id gnl|my_center|LOCUS_05060 12306 11842 gene locus_tag LOCUS_05070 12306 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 12750 12367 gene locus_tag LOCUS_05080 12750 12367 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387836.1 protein_id gnl|my_center|LOCUS_05080 15308 12747 gene locus_tag LOCUS_05090 15308 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 15537 18670 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggttggcccgcaaatccccatcggctacact 19082 18756 gene locus_tag LOCUS_05100 gene cas2 19082 18756 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_05100 19178 19669 gene locus_tag LOCUS_05110 19178 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 20140 19757 gene locus_tag LOCUS_05120 20140 19757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 20439 20140 gene locus_tag LOCUS_05130 20439 20140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence020 1209 133 gene locus_tag LOCUS_05140 1209 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1425 2672 gene locus_tag LOCUS_05150 1425 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3705 2815 gene locus_tag LOCUS_05160 3705 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4302 3841 gene locus_tag LOCUS_05170 4302 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4473 5336 gene locus_tag LOCUS_05180 4473 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 5857 5321 gene locus_tag LOCUS_05190 5857 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 5923 6669 gene locus_tag LOCUS_05200 5923 6669 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_05200 6669 7535 gene locus_tag LOCUS_05210 gene pssA 6669 7535 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_05210 7572 8756 gene locus_tag LOCUS_05220 7572 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 9522 8761 gene locus_tag LOCUS_05230 9522 8761 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_05230 12165 9538 gene locus_tag LOCUS_05240 12165 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 12488 12564 gene locus_tag LOCUS_t00090 12488 12564 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13849 12578 gene locus_tag LOCUS_05250 13849 12578 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_05250 12959 12872 gene locus_tag LOCUS_t00100 12959 12872 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14693 13965 gene locus_tag LOCUS_05260 14693 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 14931 15632 gene locus_tag LOCUS_05270 14931 15632 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626211.1 protein_id gnl|my_center|LOCUS_05270 15951 15643 gene locus_tag LOCUS_05280 15951 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 16457 16038 gene locus_tag LOCUS_05290 16457 16038 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_05290 17648 16578 gene locus_tag LOCUS_05300 17648 16578 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720078.1 protein_id gnl|my_center|LOCUS_05300 17814 19394 gene locus_tag LOCUS_05310 17814 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 19402 19917 gene locus_tag LOCUS_05320 19402 19917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 19914 20333 gene locus_tag LOCUS_05330 19914 20333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence021 611 1021 gene locus_tag LOCUS_05340 611 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1014 2471 gene locus_tag LOCUS_05350 1014 2471 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_05350 2482 3243 gene locus_tag LOCUS_05360 2482 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3500 3425 gene locus_tag LOCUS_t00110 3500 3425 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3919 4683 gene locus_tag LOCUS_05370 3919 4683 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434817.1 protein_id gnl|my_center|LOCUS_05370 4686 5843 gene locus_tag LOCUS_05380 4686 5843 CDS product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463467.1 protein_id gnl|my_center|LOCUS_05380 5840 7984 gene locus_tag LOCUS_05390 5840 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 7974 8423 gene locus_tag LOCUS_05400 7974 8423 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 protein_id gnl|my_center|LOCUS_05400 8468 10537 gene locus_tag LOCUS_05410 8468 10537 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_05410 10709 10560 gene locus_tag LOCUS_05420 10709 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 11601 10993 gene locus_tag LOCUS_05430 11601 10993 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_05430 12432 11659 gene locus_tag LOCUS_05440 12432 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 14349 12487 gene locus_tag LOCUS_05450 gene kefC 14349 12487 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_05450 14965 14342 gene locus_tag LOCUS_05460 14965 14342 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_05460 15911 15039 gene locus_tag LOCUS_05470 15911 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 16443 15982 gene locus_tag LOCUS_05480 gene infC 16443 15982 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_05480 18557 16644 gene locus_tag LOCUS_05490 gene thrS 18557 16644 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_05490 18770 19948 gene locus_tag LOCUS_05500 18770 19948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence022 <1 2153 gene locus_tag LOCUS_05510 <1 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889379.1:class I SAM-dependent DNA methyltransferase 2240 4831 gene locus_tag LOCUS_05520 2240 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6567 5014 gene locus_tag LOCUS_05530 6567 5014 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036788256.1 protein_id gnl|my_center|LOCUS_05530 9670 6686 gene locus_tag LOCUS_05540 9670 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 11606 9735 gene locus_tag LOCUS_05550 gene mnmD 11606 9735 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265612.1 protein_id gnl|my_center|LOCUS_05550 11921 11610 gene locus_tag LOCUS_05560 11921 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 12259 11918 gene locus_tag LOCUS_05570 12259 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 12794 12282 gene locus_tag LOCUS_05580 12794 12282 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390123.1 protein_id gnl|my_center|LOCUS_05580 13459 12959 gene locus_tag LOCUS_05590 13459 12959 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874483.1 protein_id gnl|my_center|LOCUS_05590 13854 14924 gene locus_tag LOCUS_05600 13854 14924 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_05600 15025 15636 gene locus_tag LOCUS_05610 15025 15636 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390739.1 protein_id gnl|my_center|LOCUS_05610 15633 16838 gene locus_tag LOCUS_05620 15633 16838 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 protein_id gnl|my_center|LOCUS_05620 16972 17664 gene locus_tag LOCUS_05630 16972 17664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 17661 19439 gene locus_tag LOCUS_05640 gene cobJ 17661 19439 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105215.1 protein_id gnl|my_center|LOCUS_05640 19436 19636 gene locus_tag LOCUS_05650 19436 19636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence023 40 243 gene locus_tag LOCUS_05660 40 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 346 3147 gene locus_tag LOCUS_05670 346 3147 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_05670 3151 4737 gene locus_tag LOCUS_05680 gene murJ 3151 4737 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_05680 4798 5805 gene locus_tag LOCUS_05690 gene trpS 4798 5805 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391282.1 protein_id gnl|my_center|LOCUS_05690 5881 6429 gene locus_tag LOCUS_05700 5881 6429 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_05700 6548 7606 gene locus_tag LOCUS_05710 6548 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 7614 8330 gene locus_tag LOCUS_05720 7614 8330 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216474.1 protein_id gnl|my_center|LOCUS_05720 8327 8746 gene locus_tag LOCUS_05730 gene arfB 8327 8746 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_05730 8906 11035 gene locus_tag LOCUS_05740 8906 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 11099 12124 gene locus_tag LOCUS_05750 11099 12124 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974905.1 protein_id gnl|my_center|LOCUS_05750 12183 12995 gene locus_tag LOCUS_05760 12183 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 13353 12985 gene locus_tag LOCUS_05770 13353 12985 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085858.1 protein_id gnl|my_center|LOCUS_05770 13419 13937 gene locus_tag LOCUS_05780 13419 13937 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770161.1 protein_id gnl|my_center|LOCUS_05780 15776 13962 gene locus_tag LOCUS_05790 15776 13962 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_05790 15889 16617 gene locus_tag LOCUS_05800 15889 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 17275 16586 gene locus_tag LOCUS_05810 17275 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 17955 17275 gene locus_tag LOCUS_05820 17955 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence024 571 2037 gene locus_tag LOCUS_05830 571 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2153 3130 gene locus_tag LOCUS_05840 2153 3130 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967060.1 protein_id gnl|my_center|LOCUS_05840 3127 3459 gene locus_tag LOCUS_05850 3127 3459 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970032.1 protein_id gnl|my_center|LOCUS_05850 3463 4275 gene locus_tag LOCUS_05860 3463 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4365 4724 gene locus_tag LOCUS_05870 4365 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6819 4747 gene locus_tag LOCUS_05880 6819 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 7764 7138 gene locus_tag LOCUS_05890 gene cobO 7764 7138 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391114.1 protein_id gnl|my_center|LOCUS_05890 7870 8631 gene locus_tag LOCUS_05900 7870 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8628 9287 gene locus_tag LOCUS_05910 8628 9287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339131.1 protein_id gnl|my_center|LOCUS_05910 9320 10318 gene locus_tag LOCUS_05920 9320 10318 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729990.1 protein_id gnl|my_center|LOCUS_05920 10399 10665 gene locus_tag LOCUS_05930 10399 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 10688 13840 gene locus_tag LOCUS_05940 10688 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 13837 15981 gene locus_tag LOCUS_05950 13837 15981 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_05950 15981 16772 gene locus_tag LOCUS_05960 15981 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 16832 17431 gene locus_tag LOCUS_05970 16832 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence025 2412 910 gene locus_tag LOCUS_05980 2412 910 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_05980 2475 3344 gene locus_tag LOCUS_05990 2475 3344 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391304.1 protein_id gnl|my_center|LOCUS_05990 4543 3341 gene locus_tag LOCUS_06000 4543 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5887 4619 gene locus_tag LOCUS_06010 5887 4619 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_06010 6545 5868 gene locus_tag LOCUS_06020 6545 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 7658 6546 gene locus_tag LOCUS_06030 gene hrcA 7658 6546 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 protein_id gnl|my_center|LOCUS_06030 7796 8515 gene locus_tag LOCUS_06040 gene rph 7796 8515 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391388.1 protein_id gnl|my_center|LOCUS_06040 8519 9127 gene locus_tag LOCUS_06050 gene rdgB 8519 9127 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_06050 9124 10236 gene locus_tag LOCUS_06060 gene hemW 9124 10236 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172453.1 protein_id gnl|my_center|LOCUS_06060 11757 10303 gene locus_tag LOCUS_06070 11757 10303 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626639.1 protein_id gnl|my_center|LOCUS_06070 11978 11754 gene locus_tag LOCUS_06080 11978 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 11859 12680 gene locus_tag LOCUS_06090 gene rsmI 11859 12680 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391440.1 protein_id gnl|my_center|LOCUS_06090 12677 13018 gene locus_tag LOCUS_06100 12677 13018 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918032.1 protein_id gnl|my_center|LOCUS_06100 13088 13735 gene locus_tag LOCUS_06110 13088 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 13732 14676 gene locus_tag LOCUS_06120 gene gshB 13732 14676 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_06120 14686 15330 gene locus_tag LOCUS_06130 14686 15330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 15422 16942 gene locus_tag LOCUS_06140 15422 16942 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_06140 16952 17515 gene locus_tag LOCUS_06150 16952 17515 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085436.1 protein_id gnl|my_center|LOCUS_06150 17764 17525 gene locus_tag LOCUS_06160 17764 17525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 18376 17783 gene locus_tag LOCUS_06170 18376 17783 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence026 23 679 gene locus_tag LOCUS_06180 23 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 738 1835 gene locus_tag LOCUS_06190 738 1835 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390958.1 protein_id gnl|my_center|LOCUS_06190 2322 1849 gene locus_tag LOCUS_06200 2322 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3040 2498 gene locus_tag LOCUS_06210 3040 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4765 3188 gene locus_tag LOCUS_06220 gene lnt 4765 3188 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_06220 5660 4752 gene locus_tag LOCUS_06230 5660 4752 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_06230 6184 5657 gene locus_tag LOCUS_06240 6184 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 7152 6181 gene locus_tag LOCUS_06250 7152 6181 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391518.1 protein_id gnl|my_center|LOCUS_06250 8531 7149 gene locus_tag LOCUS_06260 gene miaB 8531 7149 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_06260 9396 8551 gene locus_tag LOCUS_06270 9396 8551 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_06270 10193 9402 gene locus_tag LOCUS_06280 10193 9402 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_06280 10770 10276 gene locus_tag LOCUS_06290 10770 10276 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_06290 10842 11096 gene locus_tag LOCUS_06300 10842 11096 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391512.1 protein_id gnl|my_center|LOCUS_06300 11351 11103 gene locus_tag LOCUS_06310 11351 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 12970 11348 gene locus_tag LOCUS_06320 12970 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 12890 13174 gene locus_tag LOCUS_06330 12890 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 13875 13123 gene locus_tag LOCUS_06340 13875 13123 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_06340 14720 13875 gene locus_tag LOCUS_06350 14720 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 15723 14980 gene locus_tag LOCUS_06360 15723 14980 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390265.1 protein_id gnl|my_center|LOCUS_06360 15805 16398 gene locus_tag LOCUS_06370 15805 16398 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_06370 17279 16395 gene locus_tag LOCUS_06380 17279 16395 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_06380 <18504 17526 gene locus_tag LOCUS_06390 <18504 17526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389289.1:UvrD-helicase domain-containing protein >Feature sequence027 324 133 gene locus_tag LOCUS_06400 324 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 393 1331 gene locus_tag LOCUS_06410 393 1331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_06410 1328 2305 gene locus_tag LOCUS_06420 1328 2305 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_06420 2346 2834 gene locus_tag LOCUS_06430 2346 2834 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_06430 2848 3537 gene locus_tag LOCUS_06440 2848 3537 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 protein_id gnl|my_center|LOCUS_06440 3555 4862 gene locus_tag LOCUS_06450 3555 4862 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_06450 5989 4913 gene locus_tag LOCUS_06460 5989 4913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 protein_id gnl|my_center|LOCUS_06460 7513 6008 gene locus_tag LOCUS_06470 7513 6008 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_06470 8556 7510 gene locus_tag LOCUS_06480 8556 7510 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902651.1 protein_id gnl|my_center|LOCUS_06480 9347 8559 gene locus_tag LOCUS_06490 9347 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 9961 9512 gene locus_tag LOCUS_06500 9961 9512 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_06500 11512 10103 gene locus_tag LOCUS_06510 11512 10103 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939666.1 protein_id gnl|my_center|LOCUS_06510 13476 11575 gene locus_tag LOCUS_06520 13476 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 16495 14021 gene locus_tag LOCUS_06530 16495 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 17210 16767 gene locus_tag LOCUS_06540 17210 16767 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence028 <1 2581 gene locus_tag LOCUS_06550 <1 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390784.1:ATP-dependent DNA helicase 3226 2789 gene locus_tag LOCUS_06560 gene trxC 3226 2789 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_06560 3378 3560 gene locus_tag LOCUS_06570 3378 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3877 3671 gene locus_tag LOCUS_06580 3877 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 4959 3967 gene locus_tag LOCUS_06590 gene xerD 4959 3967 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_06590 5539 5087 gene locus_tag LOCUS_06600 gene moaE 5539 5087 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093025.1 protein_id gnl|my_center|LOCUS_06600 5795 5544 gene locus_tag LOCUS_06610 gene moaD 5795 5544 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_06610 7036 5792 gene locus_tag LOCUS_06620 7036 5792 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 protein_id gnl|my_center|LOCUS_06620 7545 7033 gene locus_tag LOCUS_06630 gene mobB 7545 7033 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_06630 8111 7548 gene locus_tag LOCUS_06640 gene pgsA 8111 7548 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_06640 10040 8148 gene locus_tag LOCUS_06650 gene uvrC 10040 8148 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_06650 10943 10524 gene locus_tag LOCUS_06660 10943 10524 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_06660 11803 10976 gene locus_tag LOCUS_06670 11803 10976 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_06670 11837 12670 gene locus_tag LOCUS_06680 11837 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 13611 12676 gene locus_tag LOCUS_06690 13611 12676 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_06690 14542 13592 gene locus_tag LOCUS_06700 gene thyX 14542 13592 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_06700 16661 14661 gene locus_tag LOCUS_06710 gene betT 16661 14661 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040260.1 protein_id gnl|my_center|LOCUS_06710 16805 17005 gene locus_tag LOCUS_06720 16805 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence029 2719 449 gene locus_tag LOCUS_06730 2719 449 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391289.1 protein_id gnl|my_center|LOCUS_06730 3289 2756 gene locus_tag LOCUS_06740 3289 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 3395 6052 gene locus_tag LOCUS_06750 gene mutS 3395 6052 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_06750 7172 6072 gene locus_tag LOCUS_06760 7172 6072 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_06760 7578 7249 gene locus_tag LOCUS_06770 7578 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 8621 7767 gene locus_tag LOCUS_06780 gene nadC 8621 7767 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533323.1 protein_id gnl|my_center|LOCUS_06780 10235 8643 gene locus_tag LOCUS_06790 10235 8643 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389187.1 protein_id gnl|my_center|LOCUS_06790 11223 10237 gene locus_tag LOCUS_06800 gene nadA 11223 10237 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206696170.1 protein_id gnl|my_center|LOCUS_06800 11583 13094 gene locus_tag LOCUS_06810 11583 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 13894 13091 gene locus_tag LOCUS_06820 13894 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 13982 15772 gene locus_tag LOCUS_06830 13982 15772 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_06830 15790 17016 gene locus_tag LOCUS_06840 15790 17016 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence030 126 2006 gene locus_tag LOCUS_06850 gene mrdA 126 2006 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_06850 2006 3148 gene locus_tag LOCUS_06860 gene rodA 2006 3148 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719488.1 protein_id gnl|my_center|LOCUS_06860 3570 3235 gene locus_tag LOCUS_06870 3570 3235 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967294.1 protein_id gnl|my_center|LOCUS_06870 3797 3567 gene locus_tag LOCUS_06880 3797 3567 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402169.1 protein_id gnl|my_center|LOCUS_06880 4802 3846 gene locus_tag LOCUS_06890 4802 3846 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391485.1 protein_id gnl|my_center|LOCUS_06890 6725 4878 gene locus_tag LOCUS_06900 6725 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 6846 6706 gene locus_tag LOCUS_06910 6846 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6992 7546 gene locus_tag LOCUS_06920 6992 7546 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529357.1 protein_id gnl|my_center|LOCUS_06920 7543 8652 gene locus_tag LOCUS_06930 gene aroB 7543 8652 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391488.1 protein_id gnl|my_center|LOCUS_06930 8656 9951 gene locus_tag LOCUS_06940 8656 9951 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_06940 10327 13923 gene locus_tag LOCUS_06950 10327 13923 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063869.1 protein_id gnl|my_center|LOCUS_06950 14848 14003 gene locus_tag LOCUS_06960 14848 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 15621 14845 gene locus_tag LOCUS_06970 gene pgeF 15621 14845 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388401.1 protein_id gnl|my_center|LOCUS_06970 16703 15618 gene locus_tag LOCUS_06980 16703 15618 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 protein_id gnl|my_center|LOCUS_06980 <17287 16700 gene locus_tag LOCUS_06990 <17287 16700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388399.1:prolipoprotein diacylglyceryl transferase >Feature sequence031 657 289 gene locus_tag LOCUS_07000 657 289 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640094.1 protein_id gnl|my_center|LOCUS_07000 1714 1121 gene locus_tag LOCUS_07010 1714 1121 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083483.1 protein_id gnl|my_center|LOCUS_07010 1775 2251 gene locus_tag LOCUS_07020 1775 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2248 3066 gene locus_tag LOCUS_07030 2248 3066 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892441.1 protein_id gnl|my_center|LOCUS_07030 3053 3520 gene locus_tag LOCUS_07040 3053 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3606 5069 gene locus_tag LOCUS_07050 gene guaB 3606 5069 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387997.1 protein_id gnl|my_center|LOCUS_07050 5083 6408 gene locus_tag LOCUS_07060 5083 6408 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_07060 7368 6427 gene locus_tag LOCUS_07070 gene miaA 7368 6427 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_07070 8848 7589 gene locus_tag LOCUS_07080 8848 7589 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_07080 9072 9275 gene locus_tag LOCUS_07090 9072 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 9364 10374 gene locus_tag LOCUS_07100 9364 10374 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_07100 11461 10409 gene locus_tag LOCUS_07110 11461 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 protein_id gnl|my_center|LOCUS_07110 11627 12406 gene locus_tag LOCUS_07120 gene truA 11627 12406 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_07120 12409 13500 gene locus_tag LOCUS_07130 12409 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 14257 13799 gene locus_tag LOCUS_07140 14257 13799 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_07140 15661 14405 gene locus_tag LOCUS_07150 15661 14405 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390184.1 protein_id gnl|my_center|LOCUS_07150 16823 15825 gene locus_tag LOCUS_07160 gene thiS 16823 15825 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence032 <1 610 gene locus_tag LOCUS_07170 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391131.1:precorrin-4 C(11)-methyltransferase 903 607 gene locus_tag LOCUS_07180 903 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1781 900 gene locus_tag LOCUS_07190 1781 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2313 1789 gene locus_tag LOCUS_07200 2313 1789 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389584.1 protein_id gnl|my_center|LOCUS_07200 2954 2310 gene locus_tag LOCUS_07210 gene queE 2954 2310 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931061.1 protein_id gnl|my_center|LOCUS_07210 3508 2957 gene locus_tag LOCUS_07220 3508 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 3756 3520 gene locus_tag LOCUS_07230 3756 3520 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640672.1 protein_id gnl|my_center|LOCUS_07230 3956 3774 gene locus_tag LOCUS_07240 3956 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4718 4002 gene locus_tag LOCUS_07250 gene queC 4718 4002 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929689.1 protein_id gnl|my_center|LOCUS_07250 4873 5640 gene locus_tag LOCUS_07260 4873 5640 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975434.1 protein_id gnl|my_center|LOCUS_07260 6116 5628 gene locus_tag LOCUS_07270 6116 5628 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_07270 6222 7028 gene locus_tag LOCUS_07280 6222 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7546 7022 gene locus_tag LOCUS_07290 7546 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 protein_id gnl|my_center|LOCUS_07290 9038 7635 gene locus_tag LOCUS_07300 9038 7635 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 protein_id gnl|my_center|LOCUS_07300 9197 12571 gene locus_tag LOCUS_07310 9197 12571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626538.1 protein_id gnl|my_center|LOCUS_07310 12771 13901 gene locus_tag LOCUS_07320 12771 13901 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931321.1 protein_id gnl|my_center|LOCUS_07320 14043 15980 gene locus_tag LOCUS_07330 gene asnB 14043 15980 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_07330 16155 16391 gene locus_tag LOCUS_07340 16155 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence033 1607 876 gene locus_tag LOCUS_07350 1607 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1773 2171 gene locus_tag LOCUS_07360 1773 2171 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390484.1 protein_id gnl|my_center|LOCUS_07360 2158 2580 gene locus_tag LOCUS_07370 gene flaF 2158 2580 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626463.1 protein_id gnl|my_center|LOCUS_07370 2605 5151 gene locus_tag LOCUS_07380 2605 5151 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390482.1 protein_id gnl|my_center|LOCUS_07380 5148 6680 gene locus_tag LOCUS_07390 5148 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7318 6689 gene locus_tag LOCUS_07400 7318 6689 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_07400 8765 7887 gene locus_tag LOCUS_07410 gene galU 8765 7887 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_07410 9579 8848 gene locus_tag LOCUS_07420 9579 8848 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531778.1 protein_id gnl|my_center|LOCUS_07420 10289 9576 gene locus_tag LOCUS_07430 10289 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_07430 11083 10289 gene locus_tag LOCUS_07440 11083 10289 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_07440 13169 11109 gene locus_tag LOCUS_07450 13169 11109 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389968.1 protein_id gnl|my_center|LOCUS_07450 14364 13249 gene locus_tag LOCUS_07460 14364 13249 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_07460 16078 14351 gene locus_tag LOCUS_07470 16078 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 <16967 16146 gene locus_tag LOCUS_07480 <16967 16146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389878.1:branched-chain amino acid aminotransferase >Feature sequence034 1273 974 gene locus_tag LOCUS_07490 1273 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2073 1273 gene locus_tag LOCUS_07500 2073 1273 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215829472.1 protein_id gnl|my_center|LOCUS_07500 2506 2078 gene locus_tag LOCUS_07510 2506 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2989 2690 gene locus_tag LOCUS_07520 2989 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4487 3333 gene locus_tag LOCUS_07530 4487 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4857 4543 gene locus_tag LOCUS_07540 4857 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5442 5729 gene locus_tag LOCUS_07550 5442 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6032 5751 gene locus_tag LOCUS_07560 6032 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6068 6805 gene locus_tag LOCUS_07570 6068 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 6802 7245 gene locus_tag LOCUS_07580 6802 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7490 7870 gene locus_tag LOCUS_07590 7490 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 7888 8766 gene locus_tag LOCUS_07600 7888 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8831 9205 gene locus_tag LOCUS_07610 8831 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 9202 9399 gene locus_tag LOCUS_07620 9202 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 9396 9908 gene locus_tag LOCUS_07630 9396 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 9905 10360 gene locus_tag LOCUS_07640 9905 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 10378 10632 gene locus_tag LOCUS_07650 10378 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 10622 10996 gene locus_tag LOCUS_07660 10622 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 10993 12498 gene locus_tag LOCUS_07670 10993 12498 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_07670 12485 13612 gene locus_tag LOCUS_07680 gene alr 12485 13612 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388168.1 protein_id gnl|my_center|LOCUS_07680 13615 14388 gene locus_tag LOCUS_07690 13615 14388 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_07690 14385 15155 gene locus_tag LOCUS_07700 14385 15155 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_07700 15576 15208 gene locus_tag LOCUS_07710 15576 15208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence035 3225 79 gene locus_tag LOCUS_07720 3225 79 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706767.1 protein_id gnl|my_center|LOCUS_07720 4418 3222 gene locus_tag LOCUS_07730 4418 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 <16561 4837 gene locus_tag LOCUS_07740 <16561 4837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147443659.1:non-ribosomal peptide synthetase >Feature sequence036 924 262 gene locus_tag LOCUS_07750 gene feuP 924 262 CDS product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974832.1 protein_id gnl|my_center|LOCUS_07750 1286 924 gene locus_tag LOCUS_07760 1286 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1423 2562 gene locus_tag LOCUS_07770 1423 2562 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337165.1 protein_id gnl|my_center|LOCUS_07770 2573 2998 gene locus_tag LOCUS_07780 2573 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3022 3282 gene locus_tag LOCUS_07790 3022 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3275 3739 gene locus_tag LOCUS_07800 3275 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3732 4385 gene locus_tag LOCUS_07810 3732 4385 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388998.1 protein_id gnl|my_center|LOCUS_07810 5243 4554 gene locus_tag LOCUS_07820 5243 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 6595 5240 gene locus_tag LOCUS_07830 6595 5240 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_07830 7514 6543 gene locus_tag LOCUS_07840 gene accD 7514 6543 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626593.1 protein_id gnl|my_center|LOCUS_07840 8344 7511 gene locus_tag LOCUS_07850 gene trpA 8344 7511 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391175.1 protein_id gnl|my_center|LOCUS_07850 9597 8341 gene locus_tag LOCUS_07860 gene trpB 9597 8341 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391174.1 protein_id gnl|my_center|LOCUS_07860 11021 9642 gene locus_tag LOCUS_07870 11021 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 12434 11046 gene locus_tag LOCUS_07880 12434 11046 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_07880 13618 12431 gene locus_tag LOCUS_07890 13618 12431 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_07890 15177 13624 gene locus_tag LOCUS_07900 gene gpmI 15177 13624 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_07900 15302 16291 gene locus_tag LOCUS_07910 gene akrN 15302 16291 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence037 <1 3084 gene locus_tag LOCUS_07920 <1 3084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704393.1:response regulator 3889 3224 gene locus_tag LOCUS_07930 gene gph 3889 3224 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390779.1 protein_id gnl|my_center|LOCUS_07930 3981 5339 gene locus_tag LOCUS_07940 gene glmU 3981 5339 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_07940 5352 7175 gene locus_tag LOCUS_07950 gene glmS 5352 7175 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_07950 7188 7568 gene locus_tag LOCUS_07960 7188 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 7595 7927 gene locus_tag LOCUS_07970 7595 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7972 8334 gene locus_tag LOCUS_07980 7972 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 8349 8774 gene locus_tag LOCUS_07990 8349 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9828 8899 gene locus_tag LOCUS_08000 9828 8899 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388266.1 protein_id gnl|my_center|LOCUS_08000 10122 13610 gene locus_tag LOCUS_08010 10122 13610 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389864.1 protein_id gnl|my_center|LOCUS_08010 13701 16073 gene locus_tag LOCUS_08020 13701 16073 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089908.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence038 364 1071 gene locus_tag LOCUS_08030 364 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2184 1075 gene locus_tag LOCUS_08040 gene queG 2184 1075 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_08040 2502 3797 gene locus_tag LOCUS_08050 gene egtB 2502 3797 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_08050 3797 4783 gene locus_tag LOCUS_08060 gene egtD 3797 4783 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 protein_id gnl|my_center|LOCUS_08060 4883 6958 gene locus_tag LOCUS_08070 4883 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 6974 7276 gene locus_tag LOCUS_08080 6974 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 8581 7379 gene locus_tag LOCUS_08090 8581 7379 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_08090 9306 8578 gene locus_tag LOCUS_08100 9306 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9601 9299 gene locus_tag LOCUS_08110 9601 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 9913 10200 gene locus_tag LOCUS_08120 9913 10200 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259116.1 protein_id gnl|my_center|LOCUS_08120 10623 10898 gene locus_tag LOCUS_08130 10623 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 10922 12424 gene locus_tag LOCUS_08140 gene kaiC 10922 12424 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_08140 12421 14316 gene locus_tag LOCUS_08150 12421 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 14322 14585 gene locus_tag LOCUS_08160 14322 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 14661 15941 gene locus_tag LOCUS_08170 14661 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence039 136 1311 gene locus_tag LOCUS_08180 136 1311 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 protein_id gnl|my_center|LOCUS_08180 2259 1369 gene locus_tag LOCUS_08190 2259 1369 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_08190 3856 2483 gene locus_tag LOCUS_08200 3856 2483 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_08200 4170 3940 gene locus_tag LOCUS_08210 4170 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4169 4558 gene locus_tag LOCUS_08220 4169 4558 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388728.1 protein_id gnl|my_center|LOCUS_08220 4570 5382 gene locus_tag LOCUS_08230 4570 5382 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388729.1 protein_id gnl|my_center|LOCUS_08230 6099 5560 gene locus_tag LOCUS_08240 6099 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6976 6272 gene locus_tag LOCUS_08250 6976 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 8309 7035 gene locus_tag LOCUS_08260 gene glgC 8309 7035 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_08260 8562 10055 gene locus_tag LOCUS_08270 gene glgA 8562 10055 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_08270 9668 9759 gene locus_tag LOCUS_t00120 9668 9759 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10092 11561 gene locus_tag LOCUS_08280 10092 11561 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_08280 11745 11671 gene locus_tag LOCUS_t00130 11745 11671 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12057 12449 gene locus_tag LOCUS_08290 12057 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 12373 12630 gene locus_tag LOCUS_08300 12373 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 14321 12912 gene locus_tag LOCUS_08310 gene glnA 14321 12912 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_08310 14732 14394 gene locus_tag LOCUS_08320 14732 14394 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence040 <1 1096 gene locus_tag LOCUS_08330 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001256602.1:response regulator 1167 1928 gene locus_tag LOCUS_08340 1167 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2054 2521 gene locus_tag LOCUS_08350 2054 2521 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566035.1 protein_id gnl|my_center|LOCUS_08350 2610 3527 gene locus_tag LOCUS_08360 2610 3527 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_08360 5138 3543 gene locus_tag LOCUS_08370 5138 3543 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_08370 5249 6061 gene locus_tag LOCUS_08380 5249 6061 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529874.1 protein_id gnl|my_center|LOCUS_08380 6562 6101 gene locus_tag LOCUS_08390 gene msrA 6562 6101 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390115.1 protein_id gnl|my_center|LOCUS_08390 6660 7562 gene locus_tag LOCUS_08400 6660 7562 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120072.1 protein_id gnl|my_center|LOCUS_08400 7578 7652 gene locus_tag LOCUS_t00140 7578 7652 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7729 9093 gene locus_tag LOCUS_08410 7729 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 9099 9521 gene locus_tag LOCUS_08420 9099 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 9888 11033 gene locus_tag LOCUS_08430 9888 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 11974 11081 gene locus_tag LOCUS_08440 11974 11081 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035563.1 protein_id gnl|my_center|LOCUS_08440 12938 11991 gene locus_tag LOCUS_08450 12938 11991 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_08450 13427 13032 gene locus_tag LOCUS_08460 gene hisI 13427 13032 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_08460 14602 13424 gene locus_tag LOCUS_08470 gene metC 14602 13424 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_08470 15083 14607 gene locus_tag LOCUS_08480 15083 14607 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 protein_id gnl|my_center|LOCUS_08480 15945 15073 gene locus_tag LOCUS_08490 gene sseA 15945 15073 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389305.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence041 1961 501 gene locus_tag LOCUS_08500 1961 501 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_08500 2343 1987 gene locus_tag LOCUS_08510 2343 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2810 2580 gene locus_tag LOCUS_08520 2810 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3465 2866 gene locus_tag LOCUS_08530 3465 2866 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992314.1 protein_id gnl|my_center|LOCUS_08530 4172 3462 gene locus_tag LOCUS_08540 gene cobB 4172 3462 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_08540 4250 4720 gene locus_tag LOCUS_08550 4250 4720 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_08550 4753 5598 gene locus_tag LOCUS_08560 4753 5598 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 protein_id gnl|my_center|LOCUS_08560 6569 5670 gene locus_tag LOCUS_08570 6569 5670 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093032126.1 protein_id gnl|my_center|LOCUS_08570 6917 8230 gene locus_tag LOCUS_08580 6917 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 8236 10263 gene locus_tag LOCUS_08590 gene pabB 8236 10263 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_08590 11091 10282 gene locus_tag LOCUS_08600 11091 10282 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_08600 11768 11091 gene locus_tag LOCUS_08610 11768 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 12412 12086 gene locus_tag LOCUS_08620 12412 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 12673 12419 gene locus_tag LOCUS_08630 12673 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 12825 13826 gene locus_tag LOCUS_08640 12825 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence042 3385 1124 gene locus_tag LOCUS_08650 gene ptsP 3385 1124 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 protein_id gnl|my_center|LOCUS_08650 4446 3382 gene locus_tag LOCUS_08660 4446 3382 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_08660 5682 4462 gene locus_tag LOCUS_08670 5682 4462 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_08670 5829 6572 gene locus_tag LOCUS_08680 5829 6572 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388500.1 protein_id gnl|my_center|LOCUS_08680 7038 6670 gene locus_tag LOCUS_08690 7038 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7173 7751 gene locus_tag LOCUS_08700 7173 7751 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_08700 7839 8240 gene locus_tag LOCUS_08710 7839 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 8354 9334 gene locus_tag LOCUS_08720 8354 9334 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_08720 9465 11138 gene locus_tag LOCUS_08730 9465 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 11131 12708 gene locus_tag LOCUS_08740 11131 12708 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_08740 12904 13329 gene locus_tag LOCUS_08750 12904 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08750 13446 14198 gene locus_tag LOCUS_08760 13446 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence043 318 527 gene locus_tag LOCUS_08770 gene rpmI 318 527 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391268.1 protein_id gnl|my_center|LOCUS_08770 540 902 gene locus_tag LOCUS_08780 gene rplT 540 902 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_08780 975 2054 gene locus_tag LOCUS_08790 gene pheS 975 2054 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_08790 2051 4453 gene locus_tag LOCUS_08800 gene pheT 2051 4453 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 protein_id gnl|my_center|LOCUS_08800 5774 4518 gene locus_tag LOCUS_08810 5774 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 7162 5771 gene locus_tag LOCUS_08820 7162 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 7561 7190 gene locus_tag LOCUS_08830 7561 7190 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_08830 9409 7718 gene locus_tag LOCUS_08840 9409 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 10321 9467 gene locus_tag LOCUS_08850 10321 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 10481 11611 gene locus_tag LOCUS_08860 10481 11611 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_08860 11674 12048 gene locus_tag LOCUS_08870 11674 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 12149 13285 gene locus_tag LOCUS_08880 12149 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence044 1073 1465 gene locus_tag LOCUS_08890 gene trxA 1073 1465 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_08890 2000 3541 gene locus_tag LOCUS_08900 2000 3541 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390107.1 protein_id gnl|my_center|LOCUS_08900 4124 3549 gene locus_tag LOCUS_08910 4124 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4529 4128 gene locus_tag LOCUS_08920 4529 4128 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262479.1 protein_id gnl|my_center|LOCUS_08920 4941 4540 gene locus_tag LOCUS_08930 4941 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 5576 4941 gene locus_tag LOCUS_08940 5576 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 7304 5586 gene locus_tag LOCUS_08950 7304 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 7880 7308 gene locus_tag LOCUS_08960 7880 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 8302 7892 gene locus_tag LOCUS_08970 8302 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 8735 8313 gene locus_tag LOCUS_08980 8735 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 8930 8760 gene locus_tag LOCUS_08990 8930 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 9239 8931 gene locus_tag LOCUS_09000 9239 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 9397 9254 gene locus_tag LOCUS_09010 9397 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 9818 9402 gene locus_tag LOCUS_09020 9818 9402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 11029 9896 gene locus_tag LOCUS_09030 11029 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 12082 11171 gene locus_tag LOCUS_09040 12082 11171 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941223.1 protein_id gnl|my_center|LOCUS_09040 12480 12079 gene locus_tag LOCUS_09050 12480 12079 CDS product IS3 family transposase ISGsu7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941222.1 protein_id gnl|my_center|LOCUS_09050 13131 12544 gene locus_tag LOCUS_09060 13131 12544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 14294 13650 gene locus_tag LOCUS_09070 14294 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 14983 14291 gene locus_tag LOCUS_09080 14983 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence045 586 110 gene locus_tag LOCUS_09090 586 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1948 620 gene locus_tag LOCUS_09100 1948 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2969 1953 gene locus_tag LOCUS_09110 2969 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4222 2975 gene locus_tag LOCUS_09120 4222 2975 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_09120 4410 4222 gene locus_tag LOCUS_09130 4410 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 6068 4410 gene locus_tag LOCUS_09140 6068 4410 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140144.1 protein_id gnl|my_center|LOCUS_09140 6468 6049 gene locus_tag LOCUS_09150 6468 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 7497 6946 gene locus_tag LOCUS_09160 7497 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 7526 8349 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cacgacccgccaaatggcgagtctccacacc 10447 8369 gene locus_tag LOCUS_09170 10447 8369 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_09170 11454 10444 gene locus_tag LOCUS_09180 11454 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12008 11451 gene locus_tag LOCUS_09190 12008 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 12748 12008 gene locus_tag LOCUS_09200 12748 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 13427 12741 gene locus_tag LOCUS_09210 13427 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 13724 13482 gene locus_tag LOCUS_09220 13724 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 13982 13791 gene locus_tag LOCUS_09230 13982 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 14358 14071 gene locus_tag LOCUS_09240 14358 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 15153 14407 gene locus_tag LOCUS_09250 15153 14407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence046 1032 784 gene locus_tag LOCUS_09260 1032 784 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390667.1 protein_id gnl|my_center|LOCUS_09260 1261 1016 gene locus_tag LOCUS_09270 1261 1016 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_09270 2243 1305 gene locus_tag LOCUS_09280 gene mshM 2243 1305 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_09280 2701 2414 gene locus_tag LOCUS_09290 2701 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4421 2712 gene locus_tag LOCUS_09300 4421 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5229 4627 gene locus_tag LOCUS_09310 5229 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6164 6532 gene locus_tag LOCUS_09320 6164 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 6444 7595 gene locus_tag LOCUS_09330 6444 7595 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_09330 7819 8994 gene locus_tag LOCUS_09340 7819 8994 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389134.1 protein_id gnl|my_center|LOCUS_09340 9029 9754 gene locus_tag LOCUS_09350 gene phbB 9029 9754 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_09350 9864 10397 gene locus_tag LOCUS_09360 9864 10397 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_09360 11234 10485 gene locus_tag LOCUS_09370 gene phoB 11234 10485 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_09370 11541 11272 gene locus_tag LOCUS_09380 11541 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 11808 13559 gene locus_tag LOCUS_09390 11808 13559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09390 13556 13921 gene locus_tag LOCUS_09400 13556 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 14612 13959 gene locus_tag LOCUS_09410 14612 13959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence047 688 113 gene locus_tag LOCUS_09420 688 113 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_09420 1171 842 gene locus_tag LOCUS_09430 1171 842 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085147429.1 protein_id gnl|my_center|LOCUS_09430 1422 1168 gene locus_tag LOCUS_09440 1422 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2811 1567 gene locus_tag LOCUS_09450 2811 1567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_09450 7616 2808 gene locus_tag LOCUS_09460 7616 2808 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_09460 7714 8400 gene locus_tag LOCUS_09470 7714 8400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085971.1 protein_id gnl|my_center|LOCUS_09470 8462 8833 gene locus_tag LOCUS_09480 8462 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 8976 8902 gene locus_tag LOCUS_t00150 8976 8902 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9078 9638 gene locus_tag LOCUS_09490 9078 9638 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067251.1 protein_id gnl|my_center|LOCUS_09490 9706 10626 gene locus_tag LOCUS_09500 9706 10626 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391458.1 protein_id gnl|my_center|LOCUS_09500 10643 11308 gene locus_tag LOCUS_09510 10643 11308 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_09510 11316 11558 gene locus_tag LOCUS_09520 11316 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 11555 11926 gene locus_tag LOCUS_09530 11555 11926 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844515.1 protein_id gnl|my_center|LOCUS_09530 12525 11968 gene locus_tag LOCUS_09540 12525 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 12860 12522 gene locus_tag LOCUS_09550 12860 12522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 14153 12939 gene locus_tag LOCUS_09560 14153 12939 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence048 1521 349 gene locus_tag LOCUS_09570 gene tcmP 1521 349 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102968.1 protein_id gnl|my_center|LOCUS_09570 1789 1529 gene locus_tag LOCUS_09580 1789 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2675 2442 gene locus_tag LOCUS_09590 2675 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2915 2733 gene locus_tag LOCUS_09600 2915 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3202 4374 gene locus_tag LOCUS_09610 3202 4374 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_09610 4504 5886 gene locus_tag LOCUS_09620 4504 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 7249 5891 gene locus_tag LOCUS_09630 7249 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 9367 8039 gene locus_tag LOCUS_09640 9367 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470612.1 protein_id gnl|my_center|LOCUS_09640 9801 9367 gene locus_tag LOCUS_09650 9801 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9952 10530 gene locus_tag LOCUS_09660 9952 10530 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330142.1 protein_id gnl|my_center|LOCUS_09660 10549 14085 gene locus_tag LOCUS_09670 10549 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence049 1912 98 gene locus_tag LOCUS_09680 1912 98 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_09680 2537 1971 gene locus_tag LOCUS_09690 2537 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3651 2584 gene locus_tag LOCUS_09700 3651 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 4671 3709 gene locus_tag LOCUS_09710 4671 3709 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 protein_id gnl|my_center|LOCUS_09710 4998 4684 gene locus_tag LOCUS_09720 4998 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 5836 5009 gene locus_tag LOCUS_09730 5836 5009 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083150.1 protein_id gnl|my_center|LOCUS_09730 6777 5833 gene locus_tag LOCUS_09740 6777 5833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083149.1 protein_id gnl|my_center|LOCUS_09740 8114 6774 gene locus_tag LOCUS_09750 8114 6774 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 protein_id gnl|my_center|LOCUS_09750 10252 8324 gene locus_tag LOCUS_09760 gene nosZ 10252 8324 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967622.1 protein_id gnl|my_center|LOCUS_09760 12548 10272 gene locus_tag LOCUS_09770 12548 10272 CDS product NosR/NirI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083146.1 protein_id gnl|my_center|LOCUS_09770 12739 13674 gene locus_tag LOCUS_09780 12739 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 13757 14248 gene locus_tag LOCUS_09790 13757 14248 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence050 <1 1869 gene locus_tag LOCUS_09800 <1 1869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390820.1:mechanosensitive ion channel 2176 1829 gene locus_tag LOCUS_09810 2176 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2344 2766 gene locus_tag LOCUS_09820 2344 2766 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881117.1 protein_id gnl|my_center|LOCUS_09820 3959 2790 gene locus_tag LOCUS_09830 3959 2790 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_09830 4688 4029 gene locus_tag LOCUS_09840 4688 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5410 4688 gene locus_tag LOCUS_09850 5410 4688 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390386.1 protein_id gnl|my_center|LOCUS_09850 6128 5415 gene locus_tag LOCUS_09860 6128 5415 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390385.1 protein_id gnl|my_center|LOCUS_09860 6450 7970 gene locus_tag LOCUS_09870 6450 7970 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_09870 7970 9052 gene locus_tag LOCUS_09880 gene gmd 7970 9052 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388006.1 protein_id gnl|my_center|LOCUS_09880 9342 9091 gene locus_tag LOCUS_09890 9342 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 9345 9665 gene locus_tag LOCUS_09900 9345 9665 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_09900 9662 9988 gene locus_tag LOCUS_09910 9662 9988 CDS product DUF167 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391273.1 protein_id gnl|my_center|LOCUS_09910 9988 10902 gene locus_tag LOCUS_09920 gene folD 9988 10902 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_09920 11014 12141 gene locus_tag LOCUS_09930 11014 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 12188 14020 gene locus_tag LOCUS_09940 12188 14020 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391207.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence051 <1 736 gene locus_tag LOCUS_09950 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388802.1:ATP-dependent 6-phosphofructokinase 906 1400 gene locus_tag LOCUS_09960 906 1400 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_09960 1419 1649 gene locus_tag LOCUS_09970 gene tusA 1419 1649 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_09970 2300 1725 gene locus_tag LOCUS_09980 2300 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 3458 2319 gene locus_tag LOCUS_09990 3458 2319 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_09990 3842 3612 gene locus_tag LOCUS_10000 3842 3612 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_10000 4884 4090 gene locus_tag LOCUS_10010 4884 4090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_10010 5858 4881 gene locus_tag LOCUS_10020 5858 4881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390251.1 protein_id gnl|my_center|LOCUS_10020 6439 5873 gene locus_tag LOCUS_10030 6439 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 7806 6436 gene locus_tag LOCUS_10040 gene cobB 7806 6436 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_10040 8821 7817 gene locus_tag LOCUS_10050 8821 7817 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108776.1 protein_id gnl|my_center|LOCUS_10050 10093 8837 gene locus_tag LOCUS_10060 gene hmeB 10093 8837 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_10060 10929 10153 gene locus_tag LOCUS_10070 gene hmeA 10929 10153 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_10070 11354 10926 gene locus_tag LOCUS_10080 11354 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 13316 11361 gene locus_tag LOCUS_10090 13316 11361 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_10090 <13938 13335 gene locus_tag LOCUS_10100 <13938 13335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393112.1:(Fe-S)-binding protein >Feature sequence052 769 362 gene locus_tag LOCUS_10110 769 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2094 895 gene locus_tag LOCUS_10120 2094 895 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112101.1 protein_id gnl|my_center|LOCUS_10120 3019 2105 gene locus_tag LOCUS_10130 3019 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4201 3407 gene locus_tag LOCUS_10140 4201 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 4303 5085 gene locus_tag LOCUS_10150 gene hpnC 4303 5085 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_10150 5082 5933 gene locus_tag LOCUS_10160 5082 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5930 7138 gene locus_tag LOCUS_10170 gene hpnE 5930 7138 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_10170 7230 7829 gene locus_tag LOCUS_10180 7230 7829 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_10180 8292 7918 gene locus_tag LOCUS_10190 8292 7918 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_10190 9241 8297 gene locus_tag LOCUS_10200 gene secF 9241 8297 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087502.1 protein_id gnl|my_center|LOCUS_10200 10865 9264 gene locus_tag LOCUS_10210 10865 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10210 11411 10875 gene locus_tag LOCUS_10220 11411 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 11568 12434 gene locus_tag LOCUS_10230 11568 12434 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389519.1 protein_id gnl|my_center|LOCUS_10230 13479 12451 gene locus_tag LOCUS_10240 13479 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence053 <1 3726 gene locus_tag LOCUS_10250 <1 3726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015508323.1:type I polyketide synthase 3746 10327 gene locus_tag LOCUS_10260 3746 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 10327 12582 gene locus_tag LOCUS_10270 10327 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence054 <1 1573 gene locus_tag LOCUS_10280 <1 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389505.1:excinuclease ABC subunit UvrA 1665 3005 gene locus_tag LOCUS_10290 1665 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3030 3731 gene locus_tag LOCUS_10300 3030 3731 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_10300 3876 6824 gene locus_tag LOCUS_10310 3876 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7806 6886 gene locus_tag LOCUS_10320 7806 6886 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388199.1 protein_id gnl|my_center|LOCUS_10320 7905 8813 gene locus_tag LOCUS_10330 7905 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 9318 9130 gene locus_tag LOCUS_10340 9318 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 12886 9398 gene locus_tag LOCUS_10350 gene mfd 12886 9398 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 protein_id gnl|my_center|LOCUS_10350 13143 12883 gene locus_tag LOCUS_10360 13143 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence055 1258 731 gene locus_tag LOCUS_10370 1258 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1637 1275 gene locus_tag LOCUS_10380 1637 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4540 1736 gene locus_tag LOCUS_10390 gene polA 4540 1736 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_10390 4706 7687 gene locus_tag LOCUS_10400 4706 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 7742 8416 gene locus_tag LOCUS_10410 7742 8416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_10410 8573 8878 gene locus_tag LOCUS_10420 8573 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 9231 9542 gene locus_tag LOCUS_10430 9231 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 9628 10263 gene locus_tag LOCUS_10440 9628 10263 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_10440 10260 11048 gene locus_tag LOCUS_10450 10260 11048 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_10450 11053 11469 gene locus_tag LOCUS_10460 11053 11469 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704912.1 protein_id gnl|my_center|LOCUS_10460 12637 11510 gene locus_tag LOCUS_10470 12637 11510 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846808.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence056 173 430 gene locus_tag LOCUS_10480 173 430 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626422.1 protein_id gnl|my_center|LOCUS_10480 427 1314 gene locus_tag LOCUS_10490 427 1314 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_10490 1358 3274 gene locus_tag LOCUS_10500 gene dxs 1358 3274 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577275.1 protein_id gnl|my_center|LOCUS_10500 3278 4024 gene locus_tag LOCUS_10510 3278 4024 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_10510 4162 4437 gene locus_tag LOCUS_10520 4162 4437 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_10520 4437 4751 gene locus_tag LOCUS_10530 4437 4751 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188824681.1 protein_id gnl|my_center|LOCUS_10530 4825 7419 gene locus_tag LOCUS_10540 4825 7419 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_10540 9317 7515 gene locus_tag LOCUS_10550 gene lepA 9317 7515 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626581.1 protein_id gnl|my_center|LOCUS_10550 11092 9389 gene locus_tag LOCUS_10560 11092 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 11537 11932 gene locus_tag LOCUS_10570 11537 11932 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688312.1 protein_id gnl|my_center|LOCUS_10570 12006 12368 gene locus_tag LOCUS_10580 12006 12368 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_10580 12746 12576 gene locus_tag LOCUS_10590 gene rpmG 12746 12576 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390953.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence057 440 982 gene locus_tag LOCUS_10600 440 982 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389313.1 protein_id gnl|my_center|LOCUS_10600 1028 1567 gene locus_tag LOCUS_10610 1028 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3502 1619 gene locus_tag LOCUS_10620 gene cobT 3502 1619 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_10620 4517 3507 gene locus_tag LOCUS_10630 gene cobS 4517 3507 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_10630 5185 4586 gene locus_tag LOCUS_10640 5185 4586 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_10640 5660 6247 gene locus_tag LOCUS_10650 5660 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 6919 6515 gene locus_tag LOCUS_10660 6919 6515 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_10660 7154 6930 gene locus_tag LOCUS_10670 7154 6930 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_10670 7285 8541 gene locus_tag LOCUS_10680 7285 8541 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 protein_id gnl|my_center|LOCUS_10680 8538 11405 gene locus_tag LOCUS_10690 8538 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 11526 12368 gene locus_tag LOCUS_10700 11526 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence058 1407 19 gene locus_tag LOCUS_10710 1407 19 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_10710 1643 2806 gene locus_tag LOCUS_10720 1643 2806 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390928.1 protein_id gnl|my_center|LOCUS_10720 2830 5520 gene locus_tag LOCUS_10730 2830 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 6148 5597 gene locus_tag LOCUS_10740 6148 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 6835 6215 gene locus_tag LOCUS_10750 6835 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 7673 7038 gene locus_tag LOCUS_10760 7673 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 10603 7670 gene locus_tag LOCUS_10770 10603 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 11535 10600 gene locus_tag LOCUS_10780 11535 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 12182 11628 gene locus_tag LOCUS_10790 12182 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 12919 12410 gene locus_tag LOCUS_10800 12919 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence059 <1 913 gene locus_tag LOCUS_10810 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037398328.1:CpaF family protein 950 1942 gene locus_tag LOCUS_10820 950 1942 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533679.1 protein_id gnl|my_center|LOCUS_10820 1949 2923 gene locus_tag LOCUS_10830 1949 2923 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 protein_id gnl|my_center|LOCUS_10830 3250 2957 gene locus_tag LOCUS_10840 3250 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5507 4131 gene locus_tag LOCUS_10850 5507 4131 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665631.1 protein_id gnl|my_center|LOCUS_10850 6057 5512 gene locus_tag LOCUS_10860 6057 5512 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_10860 6459 6229 gene locus_tag LOCUS_10870 6459 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 7366 6593 gene locus_tag LOCUS_10880 7366 6593 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_10880 7725 7408 gene locus_tag LOCUS_10890 7725 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 8080 7733 gene locus_tag LOCUS_10900 8080 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 8874 8194 gene locus_tag LOCUS_10910 8874 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 9171 9467 gene locus_tag LOCUS_10920 9171 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 9537 10100 gene locus_tag LOCUS_10930 9537 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 10110 10634 gene locus_tag LOCUS_10940 gene mobB 10110 10634 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039619.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence060 3 709 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaacgaggccggggcgctgaggccccggatac 1241 945 gene locus_tag LOCUS_10950 gene cas2 1241 945 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_10950 3011 1269 gene locus_tag LOCUS_10960 gene cas1 3011 1269 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_10960 3126 4322 gene locus_tag LOCUS_10970 gene cas7u 3126 4322 CDS product type I-U CRISPR-associated RAMP protein Csb1/Cas7u inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940731.1 protein_id gnl|my_center|LOCUS_10970 4322 5812 gene locus_tag LOCUS_10980 4322 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5809 8682 gene locus_tag LOCUS_10990 5809 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 8679 9644 gene locus_tag LOCUS_11000 8679 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 9710 10213 gene locus_tag LOCUS_11010 9710 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 11096 10269 gene locus_tag LOCUS_11020 11096 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 11258 11668 gene locus_tag LOCUS_11030 11258 11668 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383671.1 protein_id gnl|my_center|LOCUS_11030 11665 12369 gene locus_tag LOCUS_11040 11665 12369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence061 2185 1970 gene locus_tag LOCUS_11050 2185 1970 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140566.1 protein_id gnl|my_center|LOCUS_11050 2634 2951 gene locus_tag LOCUS_11060 2634 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3361 2966 gene locus_tag LOCUS_11070 3361 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3589 3365 gene locus_tag LOCUS_11080 3589 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3740 4432 gene locus_tag LOCUS_11090 3740 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4452 5972 gene locus_tag LOCUS_11100 4452 5972 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921045.1 protein_id gnl|my_center|LOCUS_11100 6018 6347 gene locus_tag LOCUS_11110 6018 6347 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390183.1 protein_id gnl|my_center|LOCUS_11110 6377 9667 gene locus_tag LOCUS_11120 6377 9667 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970470.1 protein_id gnl|my_center|LOCUS_11120 9878 9672 gene locus_tag LOCUS_11130 9878 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 10942 9878 gene locus_tag LOCUS_11140 10942 9878 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_11140 11214 10939 gene locus_tag LOCUS_11150 11214 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 12187 11255 gene locus_tag LOCUS_11160 12187 11255 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391155.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence062 426 97 gene locus_tag LOCUS_11170 426 97 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_11170 1125 538 gene locus_tag LOCUS_11180 1125 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2344 1397 gene locus_tag LOCUS_11190 2344 1397 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_11190 3126 2377 gene locus_tag LOCUS_11200 3126 2377 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_11200 5959 3128 gene locus_tag LOCUS_11210 5959 3128 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_11210 7092 6127 gene locus_tag LOCUS_11220 7092 6127 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_11220 7641 7150 gene locus_tag LOCUS_11230 7641 7150 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_11230 8419 7652 gene locus_tag LOCUS_11240 8419 7652 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440275.1 protein_id gnl|my_center|LOCUS_11240 9336 8419 gene locus_tag LOCUS_11250 9336 8419 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_11250 9335 9673 gene locus_tag LOCUS_11260 9335 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 9715 11505 gene locus_tag LOCUS_11270 9715 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 11498 11941 gene locus_tag LOCUS_11280 11498 11941 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence063 505 2 gene locus_tag LOCUS_11290 505 2 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_11290 812 543 gene locus_tag LOCUS_11300 812 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 947 1837 gene locus_tag LOCUS_11310 947 1837 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_11310 1851 2492 gene locus_tag LOCUS_11320 gene gmk 1851 2492 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388188.1 protein_id gnl|my_center|LOCUS_11320 2654 2851 gene locus_tag LOCUS_11330 2654 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2848 2967 gene locus_tag LOCUS_11340 2848 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3972 3157 gene locus_tag LOCUS_11350 gene rsmA 3972 3157 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388190.1 protein_id gnl|my_center|LOCUS_11350 4994 3996 gene locus_tag LOCUS_11360 gene pdxA 4994 3996 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388191.1 protein_id gnl|my_center|LOCUS_11360 6283 5000 gene locus_tag LOCUS_11370 6283 5000 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625938.1 protein_id gnl|my_center|LOCUS_11370 7432 6326 gene locus_tag LOCUS_11380 gene lptF 7432 6326 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 protein_id gnl|my_center|LOCUS_11380 8033 7464 gene locus_tag LOCUS_11390 8033 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 9205 8030 gene locus_tag LOCUS_11400 gene dapE 9205 8030 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391227.1 protein_id gnl|my_center|LOCUS_11400 10116 9202 gene locus_tag LOCUS_11410 gene dapD 10116 9202 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_11410 10615 10142 gene locus_tag LOCUS_11420 10615 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 10926 10615 gene locus_tag LOCUS_11430 10926 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 11728 10997 gene locus_tag LOCUS_11440 11728 10997 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence064 1512 109 gene locus_tag LOCUS_11450 gene lpdA 1512 109 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_11450 2205 1576 gene locus_tag LOCUS_11460 2205 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3539 2274 gene locus_tag LOCUS_11470 3539 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11470 6513 3574 gene locus_tag LOCUS_11480 6513 3574 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_11480 7463 6588 gene locus_tag LOCUS_11490 gene sucD 7463 6588 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_11490 8665 7466 gene locus_tag LOCUS_11500 gene sucC 8665 7466 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_11500 9643 8690 gene locus_tag LOCUS_11510 gene mdh 9643 8690 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388965.1 protein_id gnl|my_center|LOCUS_11510 11088 10054 gene locus_tag LOCUS_11520 11088 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 <12387 11321 gene locus_tag LOCUS_11530 <12387 11321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388963.1:cell division protein ZapE >Feature sequence065 497 1030 gene locus_tag LOCUS_11540 gene napF 497 1030 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 protein_id gnl|my_center|LOCUS_11540 1011 1325 gene locus_tag LOCUS_11550 gene napD 1011 1325 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165688.1 protein_id gnl|my_center|LOCUS_11550 1325 3817 gene locus_tag LOCUS_11560 gene napA 1325 3817 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_11560 3890 4729 gene locus_tag LOCUS_11570 gene napG 3890 4729 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_11570 4726 5655 gene locus_tag LOCUS_11580 gene napH 4726 5655 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_11580 5705 6151 gene locus_tag LOCUS_11590 gene napB 5705 6151 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081760.1 protein_id gnl|my_center|LOCUS_11590 6228 6875 gene locus_tag LOCUS_11600 gene napC 6228 6875 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 protein_id gnl|my_center|LOCUS_11600 7414 7052 gene locus_tag LOCUS_11610 7414 7052 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388049.1 protein_id gnl|my_center|LOCUS_11610 7574 8914 gene locus_tag LOCUS_11620 gene aroA 7574 8914 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388048.1 protein_id gnl|my_center|LOCUS_11620 9022 9561 gene locus_tag LOCUS_11630 gene cmk 9022 9561 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388047.1 protein_id gnl|my_center|LOCUS_11630 9664 11388 gene locus_tag LOCUS_11640 gene rpsA 9664 11388 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_11640 11562 11858 gene locus_tag LOCUS_11650 gene ihfB 11562 11858 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence066 1239 67 gene locus_tag LOCUS_11660 1239 67 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_11660 1771 1466 gene locus_tag LOCUS_11670 1771 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2036 1737 gene locus_tag LOCUS_11680 2036 1737 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968707.1 protein_id gnl|my_center|LOCUS_11680 3923 2088 gene locus_tag LOCUS_11690 3923 2088 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_11690 4634 3924 gene locus_tag LOCUS_11700 4634 3924 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186399.1 protein_id gnl|my_center|LOCUS_11700 5434 4631 gene locus_tag LOCUS_11710 5434 4631 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_11710 5632 5456 gene locus_tag LOCUS_11720 5632 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5729 7111 gene locus_tag LOCUS_11730 5729 7111 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390789.1 protein_id gnl|my_center|LOCUS_11730 8767 7130 gene locus_tag LOCUS_11740 8767 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 9411 8980 gene locus_tag LOCUS_11750 9411 8980 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_11750 9542 10537 gene locus_tag LOCUS_11760 9542 10537 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_11760 11037 10534 gene locus_tag LOCUS_11770 11037 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11770 11899 11261 gene locus_tag LOCUS_11780 11899 11261 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391172.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence067 182 802 gene locus_tag LOCUS_11790 182 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 818 1846 gene locus_tag LOCUS_11800 gene lpxD 818 1846 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087620.1 protein_id gnl|my_center|LOCUS_11800 1910 2377 gene locus_tag LOCUS_11810 gene fabZ 1910 2377 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_11810 2385 3185 gene locus_tag LOCUS_11820 gene lpxA 2385 3185 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_11820 3175 4020 gene locus_tag LOCUS_11830 gene lpxI 3175 4020 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_11830 4014 5216 gene locus_tag LOCUS_11840 gene lpxB 4014 5216 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_11840 5213 5620 gene locus_tag LOCUS_11850 gene gloA 5213 5620 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_11850 6775 5675 gene locus_tag LOCUS_11860 6775 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 8208 6871 gene locus_tag LOCUS_11870 8208 6871 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390989.1 protein_id gnl|my_center|LOCUS_11870 8422 8507 gene locus_tag LOCUS_t00160 8422 8507 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8588 9913 gene locus_tag LOCUS_11880 gene tig 8588 9913 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 protein_id gnl|my_center|LOCUS_11880 9985 10608 gene locus_tag LOCUS_11890 gene clpP 9985 10608 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_11890 10718 11995 gene locus_tag LOCUS_11900 gene clpX 10718 11995 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389426.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence068 <1 721 gene locus_tag LOCUS_11910 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391025.1:aspartate aminotransferase family protein 718 1623 gene locus_tag LOCUS_11920 gene argF 718 1623 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470667.1 protein_id gnl|my_center|LOCUS_11920 1648 2568 gene locus_tag LOCUS_11930 1648 2568 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391023.1 protein_id gnl|my_center|LOCUS_11930 2568 3158 gene locus_tag LOCUS_11940 2568 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3177 4049 gene locus_tag LOCUS_11950 3177 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4046 4852 gene locus_tag LOCUS_11960 4046 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6685 4886 gene locus_tag LOCUS_11970 gene asnB 6685 4886 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_11970 7707 6685 gene locus_tag LOCUS_11980 7707 6685 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_11980 8753 7698 gene locus_tag LOCUS_11990 8753 7698 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390689.1 protein_id gnl|my_center|LOCUS_11990 9517 8756 gene locus_tag LOCUS_12000 9517 8756 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_12000 10485 9514 gene locus_tag LOCUS_12010 10485 9514 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_12010 11849 10818 gene locus_tag LOCUS_12020 11849 10818 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390689.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence069 664 2061 gene locus_tag LOCUS_12030 gene radA 664 2061 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_12030 2067 2783 gene locus_tag LOCUS_12040 2067 2783 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388164.1 protein_id gnl|my_center|LOCUS_12040 2824 4290 gene locus_tag LOCUS_12050 gene purF 2824 4290 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388163.1 protein_id gnl|my_center|LOCUS_12050 4298 5029 gene locus_tag LOCUS_12060 4298 5029 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_12060 5043 6182 gene locus_tag LOCUS_12070 5043 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 8386 6752 gene locus_tag LOCUS_12080 8386 6752 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_12080 8440 9639 gene locus_tag LOCUS_12090 8440 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10301 9567 gene locus_tag LOCUS_12100 10301 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 10466 11239 gene locus_tag LOCUS_12110 10466 11239 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877187.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence070 1685 2746 gene locus_tag LOCUS_12120 1685 2746 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088171.1 protein_id gnl|my_center|LOCUS_12120 2743 3684 gene locus_tag LOCUS_12130 2743 3684 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967057.1 protein_id gnl|my_center|LOCUS_12130 3674 4507 gene locus_tag LOCUS_12140 3674 4507 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088174.1 protein_id gnl|my_center|LOCUS_12140 4507 5424 gene locus_tag LOCUS_12150 4507 5424 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088175.1 protein_id gnl|my_center|LOCUS_12150 5436 6506 gene locus_tag LOCUS_12160 5436 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 6523 8454 gene locus_tag LOCUS_12170 6523 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 10006 8471 gene locus_tag LOCUS_12180 10006 8471 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_12180 10728 10006 gene locus_tag LOCUS_12190 10728 10006 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_12190 10979 10725 gene locus_tag LOCUS_12200 10979 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 11901 10987 gene locus_tag LOCUS_12210 11901 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence071 199 429 gene locus_tag LOCUS_12220 gene rpmE 199 429 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388827.1 protein_id gnl|my_center|LOCUS_12220 563 2617 gene locus_tag LOCUS_12230 563 2617 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388826.1 protein_id gnl|my_center|LOCUS_12230 2746 3243 gene locus_tag LOCUS_12240 2746 3243 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_12240 3537 3292 gene locus_tag LOCUS_12250 3537 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 5270 3543 gene locus_tag LOCUS_12260 gene acsA 5270 3543 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862102.1 protein_id gnl|my_center|LOCUS_12260 5454 8165 gene locus_tag LOCUS_12270 5454 8165 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_12270 8252 9385 gene locus_tag LOCUS_12280 8252 9385 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_12280 9382 9831 gene locus_tag LOCUS_12290 9382 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 9873 11210 gene locus_tag LOCUS_12300 9873 11210 CDS product IS66-like element ISRhru2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389933.1 protein_id gnl|my_center|LOCUS_12300 11273 11491 gene locus_tag LOCUS_12310 11273 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence072 255 1727 gene locus_tag LOCUS_12320 gene fumC 255 1727 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389978.1 protein_id gnl|my_center|LOCUS_12320 3563 1731 gene locus_tag LOCUS_12330 3563 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3797 4168 gene locus_tag LOCUS_12340 3797 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 6131 4569 gene locus_tag LOCUS_12350 6131 4569 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_12350 7136 6141 gene locus_tag LOCUS_12360 7136 6141 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_12360 8364 7159 gene locus_tag LOCUS_12370 8364 7159 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626653.1 protein_id gnl|my_center|LOCUS_12370 8566 10752 gene locus_tag LOCUS_12380 gene lptD 8566 10752 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_12380 11015 10830 gene locus_tag LOCUS_12390 11015 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 <11820 11152 gene locus_tag LOCUS_12400 <11820 11152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence073 724 56 gene locus_tag LOCUS_12410 724 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 947 1924 gene locus_tag LOCUS_12420 gene moaA 947 1924 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642813.1 protein_id gnl|my_center|LOCUS_12420 2941 2006 gene locus_tag LOCUS_12430 2941 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4376 2958 gene locus_tag LOCUS_12440 4376 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 4448 5266 gene locus_tag LOCUS_12450 4448 5266 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625959.1 protein_id gnl|my_center|LOCUS_12450 5329 6342 gene locus_tag LOCUS_12460 5329 6342 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_12460 7198 6320 gene locus_tag LOCUS_12470 7198 6320 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388273.1 protein_id gnl|my_center|LOCUS_12470 8268 7195 gene locus_tag LOCUS_12480 8268 7195 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_12480 8447 8659 gene locus_tag LOCUS_12490 8447 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 8831 9595 gene locus_tag LOCUS_12500 8831 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 9595 10356 gene locus_tag LOCUS_12510 9595 10356 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 protein_id gnl|my_center|LOCUS_12510 <11608 10472 gene locus_tag LOCUS_12520 <11608 10472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388801.1:propionyl-CoA synthetase >Feature sequence074 1541 483 gene locus_tag LOCUS_12530 1541 483 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_12530 1515 1706 gene locus_tag LOCUS_12540 1515 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3031 1745 gene locus_tag LOCUS_12550 3031 1745 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_12550 4177 3254 gene locus_tag LOCUS_12560 4177 3254 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390277.1 protein_id gnl|my_center|LOCUS_12560 5142 4174 gene locus_tag LOCUS_12570 5142 4174 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390278.1 protein_id gnl|my_center|LOCUS_12570 5771 5139 gene locus_tag LOCUS_12580 5771 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 6152 5844 gene locus_tag LOCUS_12590 6152 5844 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971832.1 protein_id gnl|my_center|LOCUS_12590 6387 6112 gene locus_tag LOCUS_12600 6387 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6556 7161 gene locus_tag LOCUS_12610 6556 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 7161 7709 gene locus_tag LOCUS_12620 7161 7709 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_12620 9190 8036 gene locus_tag LOCUS_12630 gene nirJ 9190 8036 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_12630 9726 9208 gene locus_tag LOCUS_12640 9726 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12640 10157 9699 gene locus_tag LOCUS_12650 10157 9699 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_12650 10712 10167 gene locus_tag LOCUS_12660 10712 10167 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_12660 11194 10730 gene locus_tag LOCUS_12670 11194 10730 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence075 2431 500 gene locus_tag LOCUS_12680 gene nuoL 2431 500 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_12680 2746 2438 gene locus_tag LOCUS_12690 gene nuoK 2746 2438 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389440.1 protein_id gnl|my_center|LOCUS_12690 3357 2746 gene locus_tag LOCUS_12700 3357 2746 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389439.1 protein_id gnl|my_center|LOCUS_12700 3876 3367 gene locus_tag LOCUS_12710 gene nuoI 3876 3367 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719675.1 protein_id gnl|my_center|LOCUS_12710 4906 3896 gene locus_tag LOCUS_12720 gene nuoH 4906 3896 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_12720 6974 4899 gene locus_tag LOCUS_12730 gene nuoG 6974 4899 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_12730 8261 6984 gene locus_tag LOCUS_12740 gene nuoF 8261 6984 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_12740 8863 8261 gene locus_tag LOCUS_12750 8863 8261 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_12750 10038 8860 gene locus_tag LOCUS_12760 10038 8860 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087682.1 protein_id gnl|my_center|LOCUS_12760 10666 10040 gene locus_tag LOCUS_12770 10666 10040 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389432.1 protein_id gnl|my_center|LOCUS_12770 11169 10690 gene locus_tag LOCUS_12780 11169 10690 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719665.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence076 2364 1942 gene locus_tag LOCUS_12790 gene aprB 2364 1942 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_12790 2586 2945 gene locus_tag LOCUS_12800 2586 2945 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_12800 3260 4435 gene locus_tag LOCUS_12810 gene sat 3260 4435 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_12810 4528 5802 gene locus_tag LOCUS_12820 4528 5802 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_12820 5824 8079 gene locus_tag LOCUS_12830 5824 8079 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_12830 8083 8706 gene locus_tag LOCUS_12840 8083 8706 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392330.1 protein_id gnl|my_center|LOCUS_12840 8710 9609 gene locus_tag LOCUS_12850 8710 9609 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence077 141 407 gene locus_tag LOCUS_12860 141 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 394 939 gene locus_tag LOCUS_12870 394 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1182 1691 gene locus_tag LOCUS_12880 1182 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2217 3032 gene locus_tag LOCUS_12890 2217 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3082 4071 gene locus_tag LOCUS_12900 3082 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390337.1 protein_id gnl|my_center|LOCUS_12900 4489 4671 gene locus_tag LOCUS_12910 4489 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4668 5453 gene locus_tag LOCUS_12920 4668 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 5479 5985 gene locus_tag LOCUS_12930 5479 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390335.1 protein_id gnl|my_center|LOCUS_12930 5982 6347 gene locus_tag LOCUS_12940 5982 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 6376 6765 gene locus_tag LOCUS_12950 6376 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6762 7283 gene locus_tag LOCUS_12960 6762 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390332.1 protein_id gnl|my_center|LOCUS_12960 7287 9188 gene locus_tag LOCUS_12970 7287 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390331.1 protein_id gnl|my_center|LOCUS_12970 9199 9714 gene locus_tag LOCUS_12980 9199 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence078 81 791 gene locus_tag LOCUS_12990 81 791 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_12990 798 1622 gene locus_tag LOCUS_13000 798 1622 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_13000 1585 1935 gene locus_tag LOCUS_13010 1585 1935 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_13010 1932 2375 gene locus_tag LOCUS_13020 1932 2375 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_13020 2561 2689 gene locus_tag LOCUS_13030 2561 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4042 2792 gene locus_tag LOCUS_13040 4042 2792 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_13040 4123 5247 gene locus_tag LOCUS_13050 4123 5247 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_13050 5360 5824 gene locus_tag LOCUS_13060 5360 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 6056 6955 gene locus_tag LOCUS_13070 6056 6955 CDS product initiation factor 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257268.1 protein_id gnl|my_center|LOCUS_13070 7093 9486 gene locus_tag LOCUS_13080 7093 9486 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_13080 9832 10455 gene locus_tag LOCUS_13090 9832 10455 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_13090 <11192 10489 gene locus_tag LOCUS_13100 <11192 10489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388854.1:dihydropteroate synthase >Feature sequence079 1388 1071 gene locus_tag LOCUS_13110 1388 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 2253 1468 gene locus_tag LOCUS_13120 2253 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3949 2315 gene locus_tag LOCUS_13130 gene nirN 3949 2315 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_13130 5879 4338 gene locus_tag LOCUS_13140 5879 4338 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142585345.1 protein_id gnl|my_center|LOCUS_13140 6723 5887 gene locus_tag LOCUS_13150 6723 5887 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267270.1 protein_id gnl|my_center|LOCUS_13150 9005 6729 gene locus_tag LOCUS_13160 9005 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 10670 9177 gene locus_tag LOCUS_13170 10670 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence080 1287 559 gene locus_tag LOCUS_13180 gene hisA 1287 559 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_13180 1945 1301 gene locus_tag LOCUS_13190 gene hisH 1945 1301 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391343.1 protein_id gnl|my_center|LOCUS_13190 2544 1942 gene locus_tag LOCUS_13200 gene hisB 2544 1942 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_13200 2696 2971 gene locus_tag LOCUS_13210 2696 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 3036 3392 gene locus_tag LOCUS_13220 3036 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4405 3419 gene locus_tag LOCUS_13230 4405 3419 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_13230 4570 5049 gene locus_tag LOCUS_13240 4570 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 5654 5169 gene locus_tag LOCUS_13250 5654 5169 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_13250 7117 5720 gene locus_tag LOCUS_13260 7117 5720 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_13260 7916 7179 gene locus_tag LOCUS_13270 7916 7179 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391533.1 protein_id gnl|my_center|LOCUS_13270 10061 7923 gene locus_tag LOCUS_13280 gene pnp 10061 7923 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391532.1 protein_id gnl|my_center|LOCUS_13280 10424 10155 gene locus_tag LOCUS_13290 gene rpsO 10424 10155 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_13290 <11031 10444 gene locus_tag LOCUS_13300 <11031 10444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391530.1:tRNA pseudouridine(55) synthase TruB >Feature sequence081 505 1275 gene locus_tag LOCUS_13310 505 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1262 1537 gene locus_tag LOCUS_13320 1262 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1954 1742 gene locus_tag LOCUS_13330 1954 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2884 2117 gene locus_tag LOCUS_13340 2884 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3075 3293 gene locus_tag LOCUS_13350 gene infA 3075 3293 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006200926.1 protein_id gnl|my_center|LOCUS_13350 3307 3900 gene locus_tag LOCUS_13360 3307 3900 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390578.1 protein_id gnl|my_center|LOCUS_13360 3897 5195 gene locus_tag LOCUS_13370 gene rng 3897 5195 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 protein_id gnl|my_center|LOCUS_13370 5262 5669 gene locus_tag LOCUS_13380 5262 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 5666 5911 gene locus_tag LOCUS_13390 5666 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6939 5935 gene locus_tag LOCUS_13400 6939 5935 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_13400 8852 6936 gene locus_tag LOCUS_13410 gene ftsH 8852 6936 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941840.1 protein_id gnl|my_center|LOCUS_13410 10298 8874 gene locus_tag LOCUS_13420 10298 8874 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089246.1 protein_id gnl|my_center|LOCUS_13420 10461 10865 gene locus_tag LOCUS_13430 10461 10865 CDS product DUF3775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530064.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence082 1042 215 gene locus_tag LOCUS_13440 1042 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1054 2508 gene locus_tag LOCUS_13450 1054 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3845 2499 gene locus_tag LOCUS_13460 3845 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3838 5499 gene locus_tag LOCUS_13470 3838 5499 CDS product tetratricopeptide repeat-containing glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388308.1 protein_id gnl|my_center|LOCUS_13470 5584 6795 gene locus_tag LOCUS_13480 5584 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6853 7254 gene locus_tag LOCUS_13490 6853 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7256 8800 gene locus_tag LOCUS_13500 7256 8800 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625965.1 protein_id gnl|my_center|LOCUS_13500 8823 9842 gene locus_tag LOCUS_13510 8823 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence083 682 2997 gene locus_tag LOCUS_13520 682 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 3075 4562 gene locus_tag LOCUS_13530 3075 4562 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_13530 6023 4587 gene locus_tag LOCUS_13540 6023 4587 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202621.1 protein_id gnl|my_center|LOCUS_13540 6334 7503 gene locus_tag LOCUS_13550 6334 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 9119 7692 gene locus_tag LOCUS_13560 9119 7692 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939629.1 protein_id gnl|my_center|LOCUS_13560 9258 10154 gene locus_tag LOCUS_13570 9258 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 <10689 10060 gene locus_tag LOCUS_13580 <10689 10060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence084 458 9 gene locus_tag LOCUS_13590 458 9 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_13590 1977 481 gene locus_tag LOCUS_13600 1977 481 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_13600 2970 2023 gene locus_tag LOCUS_13610 2970 2023 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_13610 4067 2970 gene locus_tag LOCUS_13620 gene amrS 4067 2970 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_13620 4194 5030 gene locus_tag LOCUS_13630 gene amrB 4194 5030 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_13630 5525 6853 gene locus_tag LOCUS_13640 gene ltrA 5525 6853 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090914.1 protein_id gnl|my_center|LOCUS_13640 8040 7078 gene locus_tag LOCUS_13650 8040 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 8180 8758 gene locus_tag LOCUS_13660 8180 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 9308 8823 gene locus_tag LOCUS_13670 9308 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 <10580 9418 gene locus_tag LOCUS_13680 <10580 9418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein >Feature sequence085 612 1037 gene locus_tag LOCUS_13690 gene rplQ 612 1037 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390413.1 protein_id gnl|my_center|LOCUS_13690 1938 1207 gene locus_tag LOCUS_13700 1938 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2015 3328 gene locus_tag LOCUS_13710 2015 3328 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_13710 3325 3714 gene locus_tag LOCUS_13720 gene crcB 3325 3714 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 protein_id gnl|my_center|LOCUS_13720 3725 4717 gene locus_tag LOCUS_13730 3725 4717 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_13730 5491 4757 gene locus_tag LOCUS_13740 5491 4757 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533476.1 protein_id gnl|my_center|LOCUS_13740 5636 6319 gene locus_tag LOCUS_13750 5636 6319 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_13750 6310 8619 gene locus_tag LOCUS_13760 6310 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 8616 9338 gene locus_tag LOCUS_13770 8616 9338 CDS product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969202.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence086 <1 992 gene locus_tag LOCUS_13780 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083152.1:FAD:protein FMN transferase 993 1448 gene locus_tag LOCUS_13790 993 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3161 1458 gene locus_tag LOCUS_13800 3161 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3696 4277 gene locus_tag LOCUS_13810 gene rsxA 3696 4277 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_13810 4280 4831 gene locus_tag LOCUS_13820 4280 4831 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339116.1 protein_id gnl|my_center|LOCUS_13820 4828 6360 gene locus_tag LOCUS_13830 gene rsxC 4828 6360 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_13830 6357 7430 gene locus_tag LOCUS_13840 6357 7430 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_13840 7427 8104 gene locus_tag LOCUS_13850 gene rsxG 7427 8104 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_13850 8101 8793 gene locus_tag LOCUS_13860 8101 8793 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119632344.1 protein_id gnl|my_center|LOCUS_13860 8790 9074 gene locus_tag LOCUS_13870 8790 9074 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723777.1 protein_id gnl|my_center|LOCUS_13870 9127 9711 gene locus_tag LOCUS_13880 9127 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 9858 10067 gene locus_tag LOCUS_13890 9858 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 10067 10336 gene locus_tag LOCUS_13900 10067 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence087 1483 62 gene locus_tag LOCUS_13910 1483 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3373 1511 gene locus_tag LOCUS_13920 3373 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 7584 3370 gene locus_tag LOCUS_13930 7584 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 7834 10053 gene locus_tag LOCUS_13940 7834 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence088 111 1631 gene locus_tag LOCUS_13950 111 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1677 2084 gene locus_tag LOCUS_13960 1677 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2107 3063 gene locus_tag LOCUS_13970 2107 3063 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258773.1 protein_id gnl|my_center|LOCUS_13970 3583 3065 gene locus_tag LOCUS_13980 3583 3065 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_13980 3722 5890 gene locus_tag LOCUS_13990 3722 5890 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 protein_id gnl|my_center|LOCUS_13990 5912 7450 gene locus_tag LOCUS_14000 gene ppx 5912 7450 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_14000 7591 7451 gene locus_tag LOCUS_14010 7591 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7705 8235 gene locus_tag LOCUS_14020 7705 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 9223 8318 gene locus_tag LOCUS_14030 9223 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 9729 9220 gene locus_tag LOCUS_14040 9729 9220 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199294.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence089 <1 2190 gene locus_tag LOCUS_14050 <1 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256730.1:N-6 DNA methylase 2652 2194 gene locus_tag LOCUS_14060 gene queF 2652 2194 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920506.1 protein_id gnl|my_center|LOCUS_14060 3305 2847 gene locus_tag LOCUS_14070 gene rnhA 3305 2847 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_14070 4267 3302 gene locus_tag LOCUS_14080 4267 3302 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_14080 5249 4269 gene locus_tag LOCUS_14090 gene ispH 5249 4269 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921190.1 protein_id gnl|my_center|LOCUS_14090 5356 5595 gene locus_tag LOCUS_14100 5356 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 5599 6111 gene locus_tag LOCUS_14110 5599 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470665.1 protein_id gnl|my_center|LOCUS_14110 6214 9696 gene locus_tag LOCUS_14120 6214 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14120 <10198 9674 gene locus_tag LOCUS_14130 <10198 9674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893951.1:gamma-glutamyl-gamma-aminobutyrate hydrolase family protein >Feature sequence090 251 841 gene locus_tag LOCUS_14140 251 841 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086312.1 protein_id gnl|my_center|LOCUS_14140 838 1491 gene locus_tag LOCUS_14150 838 1491 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527560.1 protein_id gnl|my_center|LOCUS_14150 1647 4682 gene locus_tag LOCUS_14160 1647 4682 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 protein_id gnl|my_center|LOCUS_14160 4813 5178 gene locus_tag LOCUS_14170 4813 5178 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_14170 5193 6404 gene locus_tag LOCUS_14180 5193 6404 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388281.1 protein_id gnl|my_center|LOCUS_14180 6409 7242 gene locus_tag LOCUS_14190 6409 7242 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_14190 7298 8071 gene locus_tag LOCUS_14200 7298 8071 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388469.1 protein_id gnl|my_center|LOCUS_14200 8083 8340 gene locus_tag LOCUS_14210 gene purS 8083 8340 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_14210 8344 9036 gene locus_tag LOCUS_14220 gene purQ 8344 9036 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388467.1 protein_id gnl|my_center|LOCUS_14220 9098 9397 gene locus_tag LOCUS_14230 9098 9397 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_14230 9412 9717 gene locus_tag LOCUS_14240 gene higA 9412 9717 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920873.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence091 2501 555 gene locus_tag LOCUS_14250 gene ftsH 2501 555 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388853.1 protein_id gnl|my_center|LOCUS_14250 3882 2506 gene locus_tag LOCUS_14260 gene tilS 3882 2506 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388852.1 protein_id gnl|my_center|LOCUS_14260 4936 3896 gene locus_tag LOCUS_14270 gene ybgF 4936 3896 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_14270 5521 5018 gene locus_tag LOCUS_14280 gene pal 5521 5018 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 protein_id gnl|my_center|LOCUS_14280 7018 5696 gene locus_tag LOCUS_14290 gene tolB 7018 5696 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_14290 7506 7093 gene locus_tag LOCUS_14300 7506 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 8649 7621 gene locus_tag LOCUS_14310 8649 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 9123 8671 gene locus_tag LOCUS_14320 gene tolR 9123 8671 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_14320 9861 9127 gene locus_tag LOCUS_14330 9861 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence092 661 14 gene locus_tag LOCUS_14340 gene rpe 661 14 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 protein_id gnl|my_center|LOCUS_14340 1834 770 gene locus_tag LOCUS_14350 gene fba 1834 770 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388354.1 protein_id gnl|my_center|LOCUS_14350 3941 1965 gene locus_tag LOCUS_14360 gene tkt 3941 1965 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388353.1 protein_id gnl|my_center|LOCUS_14360 4932 3991 gene locus_tag LOCUS_14370 4932 3991 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_14370 5919 4957 gene locus_tag LOCUS_14380 gene glpX 5919 4957 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_14380 6761 6108 gene locus_tag LOCUS_14390 6761 6108 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329401.1 protein_id gnl|my_center|LOCUS_14390 6952 8070 gene locus_tag LOCUS_14400 6952 8070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938039.1 protein_id gnl|my_center|LOCUS_14400 8094 9797 gene locus_tag LOCUS_14410 8094 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence093 1086 52 gene locus_tag LOCUS_14420 1086 52 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_14420 3358 1133 gene locus_tag LOCUS_14430 3358 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 4187 3387 gene locus_tag LOCUS_14440 gene pcaD 4187 3387 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_14440 4095 4394 gene locus_tag LOCUS_14450 4095 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 4349 4903 gene locus_tag LOCUS_14460 4349 4903 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_14460 4912 5310 gene locus_tag LOCUS_14470 gene siaC 4912 5310 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_14470 5607 5320 gene locus_tag LOCUS_14480 5607 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 8922 5710 gene locus_tag LOCUS_14490 8922 5710 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_14490 9699 9019 gene locus_tag LOCUS_14500 9699 9019 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence094 55 1410 gene locus_tag LOCUS_14510 55 1410 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_14510 1434 1628 gene locus_tag LOCUS_14520 1434 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2969 1743 gene locus_tag LOCUS_14530 2969 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3438 3094 gene locus_tag LOCUS_14540 3438 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3595 4233 gene locus_tag LOCUS_14550 3595 4233 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063867.1 protein_id gnl|my_center|LOCUS_14550 4252 5157 gene locus_tag LOCUS_14560 4252 5157 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_14560 6659 5166 gene locus_tag LOCUS_14570 6659 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 7131 6670 gene locus_tag LOCUS_14580 7131 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388287.1 protein_id gnl|my_center|LOCUS_14580 8977 7148 gene locus_tag LOCUS_14590 8977 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 9768 8974 gene locus_tag LOCUS_14600 9768 8974 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440322.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence095 1361 255 gene locus_tag LOCUS_14610 gene hisC 1361 255 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391012.1 protein_id gnl|my_center|LOCUS_14610 2248 1379 gene locus_tag LOCUS_14620 2248 1379 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_14620 2414 3580 gene locus_tag LOCUS_14630 2414 3580 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_14630 3577 4212 gene locus_tag LOCUS_14640 gene metW 3577 4212 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_14640 4978 4220 gene locus_tag LOCUS_14650 4978 4220 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391017.1 protein_id gnl|my_center|LOCUS_14650 5046 5846 gene locus_tag LOCUS_14660 gene gloB 5046 5846 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_14660 5846 6649 gene locus_tag LOCUS_14670 5846 6649 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_14670 7547 6639 gene locus_tag LOCUS_14680 7547 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 7933 8859 gene locus_tag LOCUS_14690 gene ubiA 7933 8859 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388330.1 protein_id gnl|my_center|LOCUS_14690 8849 9514 gene locus_tag LOCUS_14700 8849 9514 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388331.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence096 1653 379 gene locus_tag LOCUS_14710 1653 379 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390375.1 protein_id gnl|my_center|LOCUS_14710 1782 2594 gene locus_tag LOCUS_14720 gene fabI 1782 2594 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532347.1 protein_id gnl|my_center|LOCUS_14720 2601 3689 gene locus_tag LOCUS_14730 gene aroC 2601 3689 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390373.1 protein_id gnl|my_center|LOCUS_14730 3710 5479 gene locus_tag LOCUS_14740 3710 5479 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_14740 5486 6319 gene locus_tag LOCUS_14750 5486 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7263 6418 gene locus_tag LOCUS_14760 7263 6418 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_14760 7800 7543 gene locus_tag LOCUS_14770 gene grxC 7800 7543 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_14770 8597 7851 gene locus_tag LOCUS_14780 8597 7851 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_14780 8681 9475 gene locus_tag LOCUS_14790 8681 9475 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529447.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence097 <1 1653 gene locus_tag LOCUS_14800 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388197.1:ATP-binding protein 1774 2709 gene locus_tag LOCUS_14810 1774 2709 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388403.1 protein_id gnl|my_center|LOCUS_14810 2806 3402 gene locus_tag LOCUS_14820 2806 3402 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 protein_id gnl|my_center|LOCUS_14820 3408 3974 gene locus_tag LOCUS_14830 gene pth 3408 3974 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972157.1 protein_id gnl|my_center|LOCUS_14830 3996 5096 gene locus_tag LOCUS_14840 gene ychF 3996 5096 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_14840 5144 5887 gene locus_tag LOCUS_14850 5144 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5889 6254 gene locus_tag LOCUS_14860 5889 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 8291 6261 gene locus_tag LOCUS_14870 gene parE 8291 6261 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_14870 <9608 8323 gene locus_tag LOCUS_14880 <9608 8323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920606.1:sensor histidine kinase >Feature sequence098 32 1657 gene locus_tag LOCUS_14890 32 1657 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626330.1 protein_id gnl|my_center|LOCUS_14890 1968 1774 gene locus_tag LOCUS_14900 1968 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 2118 2996 gene locus_tag LOCUS_14910 2118 2996 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388114.1 protein_id gnl|my_center|LOCUS_14910 2993 4093 gene locus_tag LOCUS_14920 gene mtnA 2993 4093 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083782.1 protein_id gnl|my_center|LOCUS_14920 4090 4749 gene locus_tag LOCUS_14930 4090 4749 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_14930 4746 5537 gene locus_tag LOCUS_14940 4746 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5830 5648 gene locus_tag LOCUS_14950 5830 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 6202 6654 gene locus_tag LOCUS_14960 6202 6654 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973802.1 protein_id gnl|my_center|LOCUS_14960 6703 8037 gene locus_tag LOCUS_14970 6703 8037 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 protein_id gnl|my_center|LOCUS_14970 8236 9048 gene locus_tag LOCUS_14980 8236 9048 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086000.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence099 1372 107 gene locus_tag LOCUS_14990 gene purD 1372 107 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_14990 1435 3000 gene locus_tag LOCUS_15000 gene xseA 1435 3000 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387920.1 protein_id gnl|my_center|LOCUS_15000 2997 3833 gene locus_tag LOCUS_15010 2997 3833 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_15010 4820 3837 gene locus_tag LOCUS_15020 gene lpxK 4820 3837 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_15020 6265 4988 gene locus_tag LOCUS_15030 6265 4988 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_15030 6996 6262 gene locus_tag LOCUS_15040 6996 6262 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_15040 9159 7150 gene locus_tag LOCUS_15050 9159 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence100 <1 1478 gene locus_tag LOCUS_15060 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088515.1:efflux RND transporter permease subunit 2483 1491 gene locus_tag LOCUS_15070 2483 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4033 2534 gene locus_tag LOCUS_15080 4033 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6254 4062 gene locus_tag LOCUS_15090 gene flgK 6254 4062 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390479.1 protein_id gnl|my_center|LOCUS_15090 6712 6269 gene locus_tag LOCUS_15100 6712 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 7041 6715 gene locus_tag LOCUS_15110 7041 6715 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 protein_id gnl|my_center|LOCUS_15110 8183 7041 gene locus_tag LOCUS_15120 8183 7041 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390476.1 protein_id gnl|my_center|LOCUS_15120 8452 8886 gene locus_tag LOCUS_15130 gene fliX 8452 8886 CDS product flagellar assembly regulator FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920437.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence101 <1 988 gene locus_tag LOCUS_15140 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088212.1:GDP-L-fucose synthase 1139 1065 gene locus_tag LOCUS_t00170 1139 1065 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2879 1200 gene locus_tag LOCUS_15150 gene ettA 2879 1200 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_15150 3044 4036 gene locus_tag LOCUS_15160 3044 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4046 5014 gene locus_tag LOCUS_15170 4046 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5028 6203 gene locus_tag LOCUS_15180 5028 6203 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_15180 6242 7441 gene locus_tag LOCUS_15190 6242 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 7507 7902 gene locus_tag LOCUS_15200 7507 7902 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 protein_id gnl|my_center|LOCUS_15200 8476 8003 gene locus_tag LOCUS_15210 8476 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 8743 8483 gene locus_tag LOCUS_15220 8743 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence102 <1 901 gene locus_tag LOCUS_15230 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113216.1:EAL domain-containing protein 952 1416 gene locus_tag LOCUS_15240 952 1416 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_15240 1534 2007 gene locus_tag LOCUS_15250 1534 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 2090 4372 gene locus_tag LOCUS_15260 gene glgB 2090 4372 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_15260 4369 6564 gene locus_tag LOCUS_15270 gene glgX 4369 6564 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_15270 6575 8728 gene locus_tag LOCUS_15280 gene malQ 6575 8728 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389297.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence103 <1 945 gene locus_tag LOCUS_15290 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403392.1:NAD-dependent epimerase/dehydratase family protein 954 1760 gene locus_tag LOCUS_15300 954 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1836 3200 gene locus_tag LOCUS_15310 gene aglM 1836 3200 CDS product UDP-glucose 6-dehydrogenase AglM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901982.1 protein_id gnl|my_center|LOCUS_15310 3197 4405 gene locus_tag LOCUS_15320 3197 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4411 5628 gene locus_tag LOCUS_15330 4411 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5625 6638 gene locus_tag LOCUS_15340 5625 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 6860 8011 gene locus_tag LOCUS_15350 6860 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence104 74 1375 gene locus_tag LOCUS_15360 gene hemA 74 1375 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390261.1 protein_id gnl|my_center|LOCUS_15360 1398 1946 gene locus_tag LOCUS_15370 1398 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390263.1 protein_id gnl|my_center|LOCUS_15370 2007 2210 gene locus_tag LOCUS_15380 2007 2210 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_15380 2850 2347 gene locus_tag LOCUS_15390 2850 2347 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_15390 3290 2880 gene locus_tag LOCUS_15400 3290 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 4295 3300 gene locus_tag LOCUS_15410 4295 3300 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229262.1 protein_id gnl|my_center|LOCUS_15410 4462 4386 gene locus_tag LOCUS_t00180 4462 4386 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4993 4682 gene locus_tag LOCUS_15420 4993 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 5211 5615 gene locus_tag LOCUS_15430 5211 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 6816 5617 gene locus_tag LOCUS_15440 6816 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 7122 6955 gene locus_tag LOCUS_15450 7122 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 7343 7894 gene locus_tag LOCUS_15460 7343 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 8049 8225 gene locus_tag LOCUS_15470 8049 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence105 <1 2547 gene locus_tag LOCUS_15480 <1 2547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246488.1:class I SAM-dependent methyltransferase 3185 2667 gene locus_tag LOCUS_15490 3185 2667 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390998.1 protein_id gnl|my_center|LOCUS_15490 3216 4268 gene locus_tag LOCUS_15500 gene mutY 3216 4268 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_15500 5283 4309 gene locus_tag LOCUS_15510 5283 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 5754 5482 gene locus_tag LOCUS_15520 5754 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 6038 5751 gene locus_tag LOCUS_15530 6038 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 6037 6495 gene locus_tag LOCUS_15540 gene rplM 6037 6495 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720164.1 protein_id gnl|my_center|LOCUS_15540 6499 6990 gene locus_tag LOCUS_15550 gene rpsI 6499 6990 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_15550 7556 8614 gene locus_tag LOCUS_15560 7556 8614 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391323.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence106 1266 544 gene locus_tag LOCUS_15570 gene rplC 1266 544 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969195.1 protein_id gnl|my_center|LOCUS_15570 1588 1280 gene locus_tag LOCUS_15580 gene rpsJ 1588 1280 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_15580 2935 1661 gene locus_tag LOCUS_15590 gene tuf 2935 1661 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390512.1 protein_id gnl|my_center|LOCUS_15590 3104 3019 gene locus_tag LOCUS_t00190 3104 3019 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3568 6843 gene locus_tag LOCUS_15600 3568 6843 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_15600 6840 8594 gene locus_tag LOCUS_15610 6840 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence107 612 118 gene locus_tag LOCUS_15620 612 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1639 620 gene locus_tag LOCUS_15630 1639 620 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_15630 3648 1636 gene locus_tag LOCUS_15640 3648 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4457 3645 gene locus_tag LOCUS_15650 4457 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5332 4454 gene locus_tag LOCUS_15660 5332 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 7247 5340 gene locus_tag LOCUS_15670 7247 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 8308 7244 gene locus_tag LOCUS_15680 8308 7244 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence108 494 1192 gene locus_tag LOCUS_15690 494 1192 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391004.1 protein_id gnl|my_center|LOCUS_15690 1192 1980 gene locus_tag LOCUS_15700 1192 1980 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_15700 1980 4277 gene locus_tag LOCUS_15710 1980 4277 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_15710 4270 4998 gene locus_tag LOCUS_15720 4270 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5319 5609 gene locus_tag LOCUS_15730 5319 5609 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046798522.1 protein_id gnl|my_center|LOCUS_15730 5914 7602 gene locus_tag LOCUS_15740 5914 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7894 7670 gene locus_tag LOCUS_15750 7894 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 8126 7896 gene locus_tag LOCUS_15760 8126 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence109 582 370 gene locus_tag LOCUS_15770 582 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 764 3433 gene locus_tag LOCUS_15780 gene acnA 764 3433 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_15780 3665 3486 gene locus_tag LOCUS_15790 3665 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3773 4531 gene locus_tag LOCUS_15800 3773 4531 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140056.1 protein_id gnl|my_center|LOCUS_15800 4524 5699 gene locus_tag LOCUS_15810 4524 5699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140055.1 protein_id gnl|my_center|LOCUS_15810 5865 5790 gene locus_tag LOCUS_t00200 5865 5790 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6256 6041 gene locus_tag LOCUS_15820 6256 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6485 6243 gene locus_tag LOCUS_15830 6485 6243 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626599.1 protein_id gnl|my_center|LOCUS_15830 7103 6633 gene locus_tag LOCUS_15840 7103 6633 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_15840 7676 7206 gene locus_tag LOCUS_15850 7676 7206 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_15850 8365 7697 gene locus_tag LOCUS_15860 gene parA 8365 7697 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence110 1414 914 gene locus_tag LOCUS_15870 1414 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5043 1441 gene locus_tag LOCUS_15880 5043 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5282 5040 gene locus_tag LOCUS_15890 5282 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 5665 5306 gene locus_tag LOCUS_15900 5665 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6155 5700 gene locus_tag LOCUS_15910 6155 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 6551 6168 gene locus_tag LOCUS_15920 6551 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 7006 6548 gene locus_tag LOCUS_15930 7006 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 7335 7003 gene locus_tag LOCUS_15940 7335 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 7699 7346 gene locus_tag LOCUS_15950 7699 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 8176 7715 gene locus_tag LOCUS_15960 8176 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence111 63 1478 gene locus_tag LOCUS_15970 63 1478 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389451.1 protein_id gnl|my_center|LOCUS_15970 1489 2733 gene locus_tag LOCUS_15980 1489 2733 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_15980 2726 3406 gene locus_tag LOCUS_15990 2726 3406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216122.1 protein_id gnl|my_center|LOCUS_15990 3415 6882 gene locus_tag LOCUS_16000 gene dnaE 3415 6882 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389457.1 protein_id gnl|my_center|LOCUS_16000 7052 7846 gene locus_tag LOCUS_16010 gene rpsB 7052 7846 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence112 65 1453 gene locus_tag LOCUS_16020 gene cysS 65 1453 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_16020 1467 2198 gene locus_tag LOCUS_16030 1467 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3418 2186 gene locus_tag LOCUS_16040 3418 2186 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_16040 3864 3448 gene locus_tag LOCUS_16050 3864 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4007 4813 gene locus_tag LOCUS_16060 4007 4813 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_16060 6580 4910 gene locus_tag LOCUS_16070 6580 4910 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529948.1 protein_id gnl|my_center|LOCUS_16070 6764 7429 gene locus_tag LOCUS_16080 6764 7429 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337086.1 protein_id gnl|my_center|LOCUS_16080 7533 8147 gene locus_tag LOCUS_16090 gene mobA 7533 8147 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence113 712 1242 gene locus_tag LOCUS_16100 712 1242 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_16100 3150 1309 gene locus_tag LOCUS_16110 3150 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4187 3246 gene locus_tag LOCUS_16120 4187 3246 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_16120 6850 4184 gene locus_tag LOCUS_16130 gene ppdK 6850 4184 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_16130 <8304 6856 gene locus_tag LOCUS_16140 <8304 6856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390705.1:glycine--tRNA ligase subunit beta >Feature sequence114 484 1350 gene locus_tag LOCUS_16150 484 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3387 1651 gene locus_tag LOCUS_16160 3387 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3599 4273 gene locus_tag LOCUS_16170 3599 4273 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_16170 4748 4323 gene locus_tag LOCUS_16180 4748 4323 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_16180 5299 5775 gene locus_tag LOCUS_16190 5299 5775 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389345.1 protein_id gnl|my_center|LOCUS_16190 5876 7087 gene locus_tag LOCUS_16200 5876 7087 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence115 645 3989 gene locus_tag LOCUS_16210 645 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4210 4767 gene locus_tag LOCUS_16220 4210 4767 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_16220 4767 5702 gene locus_tag LOCUS_16230 4767 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 6002 5688 gene locus_tag LOCUS_16240 6002 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 6580 6299 gene locus_tag LOCUS_16250 6580 6299 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066783.1 protein_id gnl|my_center|LOCUS_16250 6485 6868 gene locus_tag LOCUS_16260 6485 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 7389 6787 gene locus_tag LOCUS_16270 7389 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 <8080 7441 gene locus_tag LOCUS_16280 <8080 7441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190664.1:heterodisulfide reductase-related iron-sulfur binding cluster >Feature sequence116 646 50 gene locus_tag LOCUS_16290 646 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1033 713 gene locus_tag LOCUS_16300 1033 713 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626074.1 protein_id gnl|my_center|LOCUS_16300 1248 988 gene locus_tag LOCUS_16310 1248 988 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_16310 3747 1258 gene locus_tag LOCUS_16320 3747 1258 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_16320 4031 3825 gene locus_tag LOCUS_16330 4031 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4979 4773 gene locus_tag LOCUS_16340 4979 4773 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_16340 5131 6153 gene locus_tag LOCUS_16350 5131 6153 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967177.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence117 147 743 gene locus_tag LOCUS_16360 147 743 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_16360 743 1783 gene locus_tag LOCUS_16370 gene trpD 743 1783 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_16370 1780 2580 gene locus_tag LOCUS_16380 gene trpC 1780 2580 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383898.1 protein_id gnl|my_center|LOCUS_16380 2577 3053 gene locus_tag LOCUS_16390 gene moaC 2577 3053 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390440.1 protein_id gnl|my_center|LOCUS_16390 3053 4261 gene locus_tag LOCUS_16400 3053 4261 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_16400 4694 4299 gene locus_tag LOCUS_16410 4694 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4850 5566 gene locus_tag LOCUS_16420 gene lexA 4850 5566 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389651.1 protein_id gnl|my_center|LOCUS_16420 7668 5572 gene locus_tag LOCUS_16430 7668 5572 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence118 3805 2636 gene locus_tag LOCUS_16440 gene carA 3805 2636 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_16440 4020 4478 gene locus_tag LOCUS_16450 4020 4478 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_16450 4518 6380 gene locus_tag LOCUS_16460 gene dnaG 4518 6380 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence119 1296 742 gene locus_tag LOCUS_16470 1296 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1912 1355 gene locus_tag LOCUS_16480 1912 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16480 2392 2009 gene locus_tag LOCUS_16490 2392 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16490 4652 2826 gene locus_tag LOCUS_16500 4652 2826 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391207.1 protein_id gnl|my_center|LOCUS_16500 5282 4728 gene locus_tag LOCUS_16510 5282 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339129.1 protein_id gnl|my_center|LOCUS_16510 5898 5275 gene locus_tag LOCUS_16520 gene cbiM 5898 5275 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391247.1 protein_id gnl|my_center|LOCUS_16520 6063 7004 gene locus_tag LOCUS_16530 6063 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 <7774 7179 gene locus_tag LOCUS_16540 <7774 7179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389162.1:HAMP domain-containing methyl-accepting chemotaxis protein >Feature sequence120 334 549 gene locus_tag LOCUS_16550 334 549 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_16550 1318 590 gene locus_tag LOCUS_16560 1318 590 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_16560 1492 2004 gene locus_tag LOCUS_16570 gene purE 1492 2004 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077767952.1 protein_id gnl|my_center|LOCUS_16570 2020 3102 gene locus_tag LOCUS_16580 2020 3102 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388806.1 protein_id gnl|my_center|LOCUS_16580 4071 3130 gene locus_tag LOCUS_16590 4071 3130 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_16590 4931 4071 gene locus_tag LOCUS_16600 4931 4071 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_16600 5642 4935 gene locus_tag LOCUS_16610 5642 4935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_16610 6442 5639 gene locus_tag LOCUS_16620 6442 5639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_16620 6757 7329 gene locus_tag LOCUS_16630 6757 7329 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence121 1018 29 gene locus_tag LOCUS_16640 gene bioB 1018 29 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125254.1 protein_id gnl|my_center|LOCUS_16640 2418 1093 gene locus_tag LOCUS_16650 gene bioA 2418 1093 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_16650 3050 2418 gene locus_tag LOCUS_16660 3050 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16660 3901 3047 gene locus_tag LOCUS_16670 3901 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16670 4359 3898 gene locus_tag LOCUS_16680 4359 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 4525 4382 gene locus_tag LOCUS_16690 4525 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5715 4522 gene locus_tag LOCUS_16700 gene bioF 5715 4522 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449714.1 protein_id gnl|my_center|LOCUS_16700 6399 5893 gene locus_tag LOCUS_16710 6399 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 6610 6377 gene locus_tag LOCUS_16720 6610 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 7061 7462 gene locus_tag LOCUS_16730 7061 7462 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence122 <1 626 gene locus_tag LOCUS_16740 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550079.1:SDR family oxidoreductase 707 2293 gene locus_tag LOCUS_16750 gene purH 707 2293 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391402.1 protein_id gnl|my_center|LOCUS_16750 2297 4816 gene locus_tag LOCUS_16760 gene hrpB 2297 4816 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440436.1 protein_id gnl|my_center|LOCUS_16760 6022 4874 gene locus_tag LOCUS_16770 gene dnaJ 6022 4874 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 protein_id gnl|my_center|LOCUS_16770 <7642 6119 gene locus_tag LOCUS_16780 <7642 6119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391302.1:molecular chaperone DnaK >Feature sequence123 1036 461 gene locus_tag LOCUS_16790 1036 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1241 1477 gene locus_tag LOCUS_16800 1241 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2336 1848 gene locus_tag LOCUS_16810 2336 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5307 2419 gene locus_tag LOCUS_16820 gene treY 5307 2419 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014454409.1 protein_id gnl|my_center|LOCUS_16820 7134 5323 gene locus_tag LOCUS_16830 gene treZ 7134 5323 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence124 2190 1588 gene locus_tag LOCUS_16840 gene folE 2190 1588 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_16840 3191 2346 gene locus_tag LOCUS_16850 3191 2346 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391075.1 protein_id gnl|my_center|LOCUS_16850 3503 5233 gene locus_tag LOCUS_16860 3503 5233 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 protein_id gnl|my_center|LOCUS_16860 5230 6069 gene locus_tag LOCUS_16870 5230 6069 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 protein_id gnl|my_center|LOCUS_16870 6066 6611 gene locus_tag LOCUS_16880 6066 6611 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390533.1 protein_id gnl|my_center|LOCUS_16880 6772 7050 gene locus_tag LOCUS_16890 6772 7050 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_16890 7069 7371 gene locus_tag LOCUS_16900 7069 7371 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence125 775 1779 gene locus_tag LOCUS_16910 775 1779 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 protein_id gnl|my_center|LOCUS_16910 1761 2645 gene locus_tag LOCUS_16920 1761 2645 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_16920 2642 5338 gene locus_tag LOCUS_16930 2642 5338 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388124.1 protein_id gnl|my_center|LOCUS_16930 5343 7418 gene locus_tag LOCUS_16940 5343 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018183745.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence126 2560 206 gene locus_tag LOCUS_16950 2560 206 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_16950 3064 2576 gene locus_tag LOCUS_16960 3064 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4585 3125 gene locus_tag LOCUS_16970 gene ccoG 4585 3125 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626568.1 protein_id gnl|my_center|LOCUS_16970 6003 5125 gene locus_tag LOCUS_16980 gene ccoP 6003 5125 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391077.1 protein_id gnl|my_center|LOCUS_16980 6165 6007 gene locus_tag LOCUS_16990 6165 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6960 6181 gene locus_tag LOCUS_17000 gene ccoO 6960 6181 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391078.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence127 1951 1283 gene locus_tag LOCUS_17010 1951 1283 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721612.1 protein_id gnl|my_center|LOCUS_17010 3492 1948 gene locus_tag LOCUS_17020 gene nusA 3492 1948 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_17020 4052 3504 gene locus_tag LOCUS_17030 4052 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 4857 4138 gene locus_tag LOCUS_17040 gene trmB 4857 4138 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_17040 6028 4862 gene locus_tag LOCUS_17050 gene metK 6028 4862 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_17050 6154 6801 gene locus_tag LOCUS_17060 gene nth 6154 6801 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_17060 6857 7246 gene locus_tag LOCUS_17070 6857 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence128 2870 2493 gene locus_tag LOCUS_17080 gene rplL 2870 2493 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975165.1 protein_id gnl|my_center|LOCUS_17080 3428 2910 gene locus_tag LOCUS_17090 gene rplJ 3428 2910 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_17090 4430 3735 gene locus_tag LOCUS_17100 gene rplA 4430 3735 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390508.1 protein_id gnl|my_center|LOCUS_17100 4862 4434 gene locus_tag LOCUS_17110 gene rplK 4862 4434 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 protein_id gnl|my_center|LOCUS_17110 5515 4985 gene locus_tag LOCUS_17120 gene nusG 5515 4985 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_17120 5698 5564 gene locus_tag LOCUS_17130 5698 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 6582 5695 gene locus_tag LOCUS_17140 6582 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 <7410 6587 gene locus_tag LOCUS_17150 <7410 6587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939231.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence129 <1 1870 gene locus_tag LOCUS_17160 <1 1870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390996.1:chromosome segregation protein SMC 2003 2428 gene locus_tag LOCUS_17170 2003 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2441 3169 gene locus_tag LOCUS_17180 2441 3169 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_17180 3217 3444 gene locus_tag LOCUS_17190 3217 3444 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390993.1 protein_id gnl|my_center|LOCUS_17190 3579 4073 gene locus_tag LOCUS_17200 3579 4073 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563084.1 protein_id gnl|my_center|LOCUS_17200 4073 4621 gene locus_tag LOCUS_17210 gene atpF 4073 4621 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552096.1 protein_id gnl|my_center|LOCUS_17210 4643 5311 gene locus_tag LOCUS_17220 4643 5311 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_17220 5722 5312 gene locus_tag LOCUS_17230 gene vapC 5722 5312 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_17230 5946 5722 gene locus_tag LOCUS_17240 gene vapB 5946 5722 CDS product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450524.1 protein_id gnl|my_center|LOCUS_17240 6661 6404 gene locus_tag LOCUS_17250 6661 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence130 1268 1501 gene locus_tag LOCUS_17260 1268 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1597 2091 gene locus_tag LOCUS_17270 1597 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2182 3108 gene locus_tag LOCUS_17280 2182 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3111 4592 gene locus_tag LOCUS_17290 3111 4592 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173504.1 protein_id gnl|my_center|LOCUS_17290 4607 5251 gene locus_tag LOCUS_17300 4607 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5278 6474 gene locus_tag LOCUS_17310 5278 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence131 501 983 gene locus_tag LOCUS_17320 gene nrdR 501 983 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389579.1 protein_id gnl|my_center|LOCUS_17320 973 2112 gene locus_tag LOCUS_17330 gene ribD 973 2112 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_17330 2094 2681 gene locus_tag LOCUS_17340 2094 2681 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_17340 2684 3823 gene locus_tag LOCUS_17350 gene ribB 2684 3823 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_17350 3830 4282 gene locus_tag LOCUS_17360 3830 4282 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389575.1 protein_id gnl|my_center|LOCUS_17360 4288 4848 gene locus_tag LOCUS_17370 gene nusB 4288 4848 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389574.1 protein_id gnl|my_center|LOCUS_17370 4829 5842 gene locus_tag LOCUS_17380 gene thiL 4829 5842 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_17380 5864 6331 gene locus_tag LOCUS_17390 5864 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence132 290 754 gene locus_tag LOCUS_17400 290 754 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_17400 1561 758 gene locus_tag LOCUS_17410 1561 758 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392992.1 protein_id gnl|my_center|LOCUS_17410 1868 1551 gene locus_tag LOCUS_17420 1868 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2442 1966 gene locus_tag LOCUS_17430 2442 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17430 5453 2439 gene locus_tag LOCUS_17440 5453 2439 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 protein_id gnl|my_center|LOCUS_17440 6127 5537 gene locus_tag LOCUS_17450 6127 5537 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809263.1 protein_id gnl|my_center|LOCUS_17450 6450 6145 gene locus_tag LOCUS_17460 6450 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 7040 6450 gene locus_tag LOCUS_17470 7040 6450 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence133 170 676 gene locus_tag LOCUS_17480 gene ssb1 170 676 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 protein_id gnl|my_center|LOCUS_17480 843 1241 gene locus_tag LOCUS_17490 843 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1243 2208 gene locus_tag LOCUS_17500 1243 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2219 3490 gene locus_tag LOCUS_17510 2219 3490 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444660.1 protein_id gnl|my_center|LOCUS_17510 3524 3874 gene locus_tag LOCUS_17520 3524 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3982 4245 gene locus_tag LOCUS_17530 3982 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 4235 5842 gene locus_tag LOCUS_17540 4235 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence134 <1 3889 gene locus_tag LOCUS_17550 <1 3889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:type I polyketide synthase 3886 4689 gene locus_tag LOCUS_17560 3886 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 5117 4734 gene locus_tag LOCUS_17570 5117 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5245 5988 gene locus_tag LOCUS_17580 gene pchC 5245 5988 CDS product pyochelin biosynthesis editing thioesterase PchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114687.1 protein_id gnl|my_center|LOCUS_17580 <7063 6197 gene locus_tag LOCUS_17590 <7063 6197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228635.1:cytochrome P450 >Feature sequence135 1831 377 gene locus_tag LOCUS_17600 1831 377 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933527.1 protein_id gnl|my_center|LOCUS_17600 1965 2041 gene locus_tag LOCUS_t00210 1965 2041 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2126 3040 gene locus_tag LOCUS_17610 2126 3040 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 protein_id gnl|my_center|LOCUS_17610 3468 3037 gene locus_tag LOCUS_17620 3468 3037 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943273.1 protein_id gnl|my_center|LOCUS_17620 3968 4645 gene locus_tag LOCUS_17630 3968 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_17630 6738 4642 gene locus_tag LOCUS_17640 gene ligA 6738 4642 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence136 1231 287 gene locus_tag LOCUS_17650 1231 287 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_17650 1262 1555 gene locus_tag LOCUS_17660 1262 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1468 1998 gene locus_tag LOCUS_17670 1468 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2270 2345 gene locus_tag LOCUS_t00220 2270 2345 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2630 4918 gene locus_tag LOCUS_17680 2630 4918 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 protein_id gnl|my_center|LOCUS_17680 4945 5622 gene locus_tag LOCUS_17690 gene cas5c 4945 5622 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_17690 5619 6845 gene locus_tag LOCUS_17700 5619 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence137 2787 1123 gene locus_tag LOCUS_17710 2787 1123 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_17710 3032 4051 gene locus_tag LOCUS_17720 3032 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence138 350 1612 gene locus_tag LOCUS_17730 350 1612 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389421.1 protein_id gnl|my_center|LOCUS_17730 1638 3215 gene locus_tag LOCUS_17740 1638 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3399 4334 gene locus_tag LOCUS_17750 3399 4334 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_17750 4338 5618 gene locus_tag LOCUS_17760 4338 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 6732 5596 gene locus_tag LOCUS_17770 6732 5596 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence139 1320 343 gene locus_tag LOCUS_17780 1320 343 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812183.1 protein_id gnl|my_center|LOCUS_17780 3517 1328 gene locus_tag LOCUS_17790 3517 1328 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_17790 3990 3517 gene locus_tag LOCUS_17800 3990 3517 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_17800 4193 5704 gene locus_tag LOCUS_17810 4193 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 6387 5677 gene locus_tag LOCUS_17820 6387 5677 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085173.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence140 1387 341 gene locus_tag LOCUS_17830 gene ruvB 1387 341 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_17830 2019 1384 gene locus_tag LOCUS_17840 gene ruvA 2019 1384 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388843.1 protein_id gnl|my_center|LOCUS_17840 2519 2016 gene locus_tag LOCUS_17850 gene ruvC 2519 2016 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_17850 2439 2630 gene locus_tag LOCUS_17860 2439 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3386 2640 gene locus_tag LOCUS_17870 3386 2640 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388841.1 protein_id gnl|my_center|LOCUS_17870 3901 3512 gene locus_tag LOCUS_17880 3901 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4055 3979 gene locus_tag LOCUS_t00230 4055 3979 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5214 4096 gene locus_tag LOCUS_17890 gene mnmA 5214 4096 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389777.1 protein_id gnl|my_center|LOCUS_17890 5931 5215 gene locus_tag LOCUS_17900 5931 5215 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389778.1 protein_id gnl|my_center|LOCUS_17900 6268 5948 gene locus_tag LOCUS_17910 6268 5948 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_17910 6379 6618 gene locus_tag LOCUS_17920 6379 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence141 302 949 gene locus_tag LOCUS_17930 302 949 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626629.1 protein_id gnl|my_center|LOCUS_17930 1440 934 gene locus_tag LOCUS_17940 1440 934 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_17940 2501 1437 gene locus_tag LOCUS_17950 2501 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3776 2649 gene locus_tag LOCUS_17960 gene ribA 3776 2649 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_17960 3893 4561 gene locus_tag LOCUS_17970 3893 4561 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505216.1 protein_id gnl|my_center|LOCUS_17970 5345 4542 gene locus_tag LOCUS_17980 5345 4542 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391443.1 protein_id gnl|my_center|LOCUS_17980 6028 5342 gene locus_tag LOCUS_17990 6028 5342 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_17990 <6852 6339 gene locus_tag LOCUS_18000 <6852 6339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391445.1:outer membrane lipoprotein carrier protein LolA >Feature sequence142 1604 390 gene locus_tag LOCUS_18010 1604 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2422 1637 gene locus_tag LOCUS_18020 gene flgG 2422 1637 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 protein_id gnl|my_center|LOCUS_18020 3204 2467 gene locus_tag LOCUS_18030 gene flgF 3204 2467 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_18030 3423 5666 gene locus_tag LOCUS_18040 3423 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence143 1533 3014 gene locus_tag LOCUS_18050 1533 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3059 4303 gene locus_tag LOCUS_18060 3059 4303 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_18060 4300 5592 gene locus_tag LOCUS_18070 4300 5592 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence144 495 2303 gene locus_tag LOCUS_18080 495 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2366 4936 gene locus_tag LOCUS_18090 2366 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4958 5584 gene locus_tag LOCUS_18100 4958 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5724 6188 gene locus_tag LOCUS_18110 5724 6188 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531529.1 protein_id gnl|my_center|LOCUS_18110 6376 6657 gene locus_tag LOCUS_18120 6376 6657 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042653643.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence145 <1 2879 gene locus_tag LOCUS_18130 <1 2879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463552.1:PAS domain-containing protein 4055 3093 gene locus_tag LOCUS_18140 4055 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4999 4052 gene locus_tag LOCUS_18150 4999 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 5936 5094 gene locus_tag LOCUS_18160 5936 5094 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390485.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence146 1101 31 gene locus_tag LOCUS_18170 1101 31 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_18170 2977 1193 gene locus_tag LOCUS_18180 2977 1193 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_18180 3754 3116 gene locus_tag LOCUS_18190 3754 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 4361 3909 gene locus_tag LOCUS_18200 4361 3909 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531247.1 protein_id gnl|my_center|LOCUS_18200 5642 4911 gene locus_tag LOCUS_18210 5642 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6521 5658 gene locus_tag LOCUS_18220 gene proC 6521 5658 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence147 1357 305 gene locus_tag LOCUS_18230 1357 305 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_18230 2213 1458 gene locus_tag LOCUS_18240 2213 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170101.1 protein_id gnl|my_center|LOCUS_18240 3124 2276 gene locus_tag LOCUS_18250 3124 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3723 3121 gene locus_tag LOCUS_18260 3723 3121 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_18260 4235 3720 gene locus_tag LOCUS_18270 4235 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4420 4977 gene locus_tag LOCUS_18280 4420 4977 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_18280 5112 6002 gene locus_tag LOCUS_18290 5112 6002 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence148 2626 1262 gene locus_tag LOCUS_18300 2626 1262 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_18300 4070 2655 gene locus_tag LOCUS_18310 4070 2655 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087550.1 protein_id gnl|my_center|LOCUS_18310 5115 4087 gene locus_tag LOCUS_18320 gene pdhA 5115 4087 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_18320 5651 5304 gene locus_tag LOCUS_18330 5651 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence149 294 1742 gene locus_tag LOCUS_18340 gene sufB 294 1742 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_18340 1877 2596 gene locus_tag LOCUS_18350 gene sufC 1877 2596 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_18350 2607 3911 gene locus_tag LOCUS_18360 gene sufD 2607 3911 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087113.1 protein_id gnl|my_center|LOCUS_18360 3901 5151 gene locus_tag LOCUS_18370 3901 5151 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390320.1 protein_id gnl|my_center|LOCUS_18370 5148 5537 gene locus_tag LOCUS_18380 5148 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 5693 5992 gene locus_tag LOCUS_18390 5693 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence150 53 2836 gene locus_tag LOCUS_18400 53 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2912 4996 gene locus_tag LOCUS_18410 2912 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5062 5340 gene locus_tag LOCUS_18420 5062 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence151 2305 1013 gene locus_tag LOCUS_18430 2305 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2960 2652 gene locus_tag LOCUS_18440 2960 2652 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_18440 5059 3191 gene locus_tag LOCUS_18450 5059 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5792 5427 gene locus_tag LOCUS_18460 5792 5427 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_18460 6113 5793 gene locus_tag LOCUS_18470 6113 5793 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence152 4600 35 gene locus_tag LOCUS_18480 gene gltB 4600 35 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_18480 6054 4618 gene locus_tag LOCUS_18490 6054 4618 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence153 <1 767 gene locus_tag LOCUS_18500 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390812.1:acyl-CoA dehydrogenase family protein 2078 804 gene locus_tag LOCUS_18510 2078 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2858 2340 gene locus_tag LOCUS_18520 2858 2340 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206776.1 protein_id gnl|my_center|LOCUS_18520 3108 4862 gene locus_tag LOCUS_18530 3108 4862 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391220.1 protein_id gnl|my_center|LOCUS_18530 4899 5228 gene locus_tag LOCUS_18540 4899 5228 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391219.1 protein_id gnl|my_center|LOCUS_18540 5251 5856 gene locus_tag LOCUS_18550 gene recR 5251 5856 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391218.1 protein_id gnl|my_center|LOCUS_18550 5928 6221 gene locus_tag LOCUS_18560 5928 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence154 64 483 gene locus_tag LOCUS_18570 64 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2233 530 gene locus_tag LOCUS_18580 gene ade 2233 530 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338640.1 protein_id gnl|my_center|LOCUS_18580 2379 2903 gene locus_tag LOCUS_18590 2379 2903 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388365.1 protein_id gnl|my_center|LOCUS_18590 3478 2891 gene locus_tag LOCUS_18600 gene rsmD 3478 2891 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 protein_id gnl|my_center|LOCUS_18600 4433 3654 gene locus_tag LOCUS_18610 4433 3654 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388410.1 protein_id gnl|my_center|LOCUS_18610 5178 4444 gene locus_tag LOCUS_18620 5178 4444 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_18620 5459 5256 gene locus_tag LOCUS_18630 5459 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5882 5472 gene locus_tag LOCUS_18640 5882 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence155 3452 1161 gene locus_tag LOCUS_18650 3452 1161 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_18650 4897 3449 gene locus_tag LOCUS_18660 gene ntrC 4897 3449 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_18660 5997 4894 gene locus_tag LOCUS_18670 5997 4894 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389367.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence156 247 1614 gene locus_tag LOCUS_18680 247 1614 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_18680 1604 2719 gene locus_tag LOCUS_18690 1604 2719 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405523.1 protein_id gnl|my_center|LOCUS_18690 3160 2930 gene locus_tag LOCUS_18700 3160 2930 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_18700 3576 3157 gene locus_tag LOCUS_18710 3576 3157 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_18710 4362 3622 gene locus_tag LOCUS_18720 4362 3622 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044343538.1 protein_id gnl|my_center|LOCUS_18720 4826 4359 gene locus_tag LOCUS_18730 4826 4359 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_18730 4926 5852 gene locus_tag LOCUS_18740 4926 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence157 1731 715 gene locus_tag LOCUS_18750 1731 715 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_18750 1793 1981 gene locus_tag LOCUS_18760 1793 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4424 2016 gene locus_tag LOCUS_18770 4424 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4613 4915 gene locus_tag LOCUS_18780 4613 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence158 <1 848 gene locus_tag LOCUS_18790 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391778.1:ATP-binding cassette domain-containing protein 845 1963 gene locus_tag LOCUS_18800 845 1963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529050.1 protein_id gnl|my_center|LOCUS_18800 1967 3082 gene locus_tag LOCUS_18810 1967 3082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529052.1 protein_id gnl|my_center|LOCUS_18810 3454 4608 gene locus_tag LOCUS_18820 3454 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 5145 4609 gene locus_tag LOCUS_18830 5145 4609 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence159 1929 1642 gene locus_tag LOCUS_18840 1929 1642 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390404.1 protein_id gnl|my_center|LOCUS_18840 3933 1945 gene locus_tag LOCUS_18850 3933 1945 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_18850 5538 3958 gene locus_tag LOCUS_18860 5538 3958 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_18860 <6158 5637 gene locus_tag LOCUS_18870 <6158 5637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125677.1:ion transporter >Feature sequence160 1401 649 gene locus_tag LOCUS_18880 gene cbiQ 1401 649 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030565.1 protein_id gnl|my_center|LOCUS_18880 1685 1398 gene locus_tag LOCUS_18890 1685 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2356 1682 gene locus_tag LOCUS_18900 2356 1682 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030567.1 protein_id gnl|my_center|LOCUS_18900 2819 4177 gene locus_tag LOCUS_18910 gene glmM 2819 4177 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388855.1 protein_id gnl|my_center|LOCUS_18910 4174 4977 gene locus_tag LOCUS_18920 gene thiD 4174 4977 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_18920 6013 5075 gene locus_tag LOCUS_18930 6013 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence161 526 1083 gene locus_tag LOCUS_18940 gene petA 526 1083 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_18940 1095 2315 gene locus_tag LOCUS_18950 1095 2315 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_18950 2345 3040 gene locus_tag LOCUS_18960 2345 3040 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388115.1 protein_id gnl|my_center|LOCUS_18960 3179 4894 gene locus_tag LOCUS_18970 3179 4894 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943382.1 protein_id gnl|my_center|LOCUS_18970 5474 4863 gene locus_tag LOCUS_18980 5474 4863 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_18980 5925 5506 gene locus_tag LOCUS_18990 5925 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence162 301 3108 gene locus_tag LOCUS_19000 301 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 3184 3648 gene locus_tag LOCUS_19010 gene sixA 3184 3648 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947703.1 protein_id gnl|my_center|LOCUS_19010 3694 4548 gene locus_tag LOCUS_19020 3694 4548 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_19020 4673 5650 gene locus_tag LOCUS_19030 4673 5650 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence163 <1 1237 gene locus_tag LOCUS_19040 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389811.1:ATP-binding protein 1701 3734 gene locus_tag LOCUS_19050 1701 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 4128 4451 gene locus_tag LOCUS_19060 4128 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5132 4470 gene locus_tag LOCUS_19070 5132 4470 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390353.1 protein_id gnl|my_center|LOCUS_19070 <5995 5287 gene locus_tag LOCUS_19080 <5995 5287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389628.1:PAS domain-containing sensor histidine kinase >Feature sequence164 553 1011 gene locus_tag LOCUS_19090 553 1011 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090228.1 protein_id gnl|my_center|LOCUS_19090 1153 2037 gene locus_tag LOCUS_19100 1153 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2948 2046 gene locus_tag LOCUS_19110 2948 2046 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_19110 3011 3991 gene locus_tag LOCUS_19120 3011 3991 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_19120 4445 3906 gene locus_tag LOCUS_19130 4445 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4580 5143 gene locus_tag LOCUS_19140 4580 5143 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_19140 5140 5856 gene locus_tag LOCUS_19150 5140 5856 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329180.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence165 1013 177 gene locus_tag LOCUS_19160 1013 177 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390960.1 protein_id gnl|my_center|LOCUS_19160 1191 2771 gene locus_tag LOCUS_19170 1191 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 4823 3129 gene locus_tag LOCUS_19180 4823 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence166 <1 707 gene locus_tag LOCUS_19190 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388504.1:helix-turn-helix domain-containing protein note possible pseudo, internal stop codon, frameshifted 704 1915 gene locus_tag LOCUS_19200 gene ispG 704 1915 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918736.1 protein_id gnl|my_center|LOCUS_19200 1915 3324 gene locus_tag LOCUS_19210 1915 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 3388 4629 gene locus_tag LOCUS_19220 gene hisS 3388 4629 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 protein_id gnl|my_center|LOCUS_19220 4644 5171 gene locus_tag LOCUS_19230 4644 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5184 5516 gene locus_tag LOCUS_19240 5184 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence167 3 599 gene locus_tag LOCUS_19250 3 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2122 653 gene locus_tag LOCUS_19260 gene glgA 2122 653 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_19260 5223 2572 gene locus_tag LOCUS_19270 5223 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence168 434 544 gene locus_tag LOCUS_r00010 434 544 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 618 694 gene locus_tag LOCUS_t00240 618 694 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 833 2887 gene locus_tag LOCUS_19280 833 2887 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919291.1 protein_id gnl|my_center|LOCUS_19280 2961 4778 gene locus_tag LOCUS_19290 2961 4778 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence169 855 118 gene locus_tag LOCUS_19300 855 118 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389598.1 protein_id gnl|my_center|LOCUS_19300 1851 931 gene locus_tag LOCUS_19310 1851 931 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_19310 2733 1870 gene locus_tag LOCUS_19320 gene motA 2733 1870 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_19320 3099 2824 gene locus_tag LOCUS_19330 3099 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2981 3433 gene locus_tag LOCUS_19340 2981 3433 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389594.1 protein_id gnl|my_center|LOCUS_19340 4677 3421 gene locus_tag LOCUS_19350 4677 3421 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_19350 <5804 4701 gene locus_tag LOCUS_19360 <5804 4701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390218.1:pyruvate kinase >Feature sequence170 3256 2081 gene locus_tag LOCUS_19370 3256 2081 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626642.1 protein_id gnl|my_center|LOCUS_19370 3397 4203 gene locus_tag LOCUS_19380 3397 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5723 4410 gene locus_tag LOCUS_19390 gene amt 5723 4410 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence171 1735 77 gene locus_tag LOCUS_19400 1735 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2115 1732 gene locus_tag LOCUS_19410 2115 1732 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_19410 4787 2112 gene locus_tag LOCUS_19420 4787 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 5280 4816 gene locus_tag LOCUS_19430 5280 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence172 <1 1865 gene locus_tag LOCUS_19440 <1 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:PAS domain S-box protein 2774 1971 gene locus_tag LOCUS_19450 2774 1971 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626297.1 protein_id gnl|my_center|LOCUS_19450 4693 2840 gene locus_tag LOCUS_19460 gene aspS 4693 2840 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_19460 4817 5554 gene locus_tag LOCUS_19470 4817 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence173 1896 1066 gene locus_tag LOCUS_19480 1896 1066 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_19480 2760 1987 gene locus_tag LOCUS_19490 2760 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3168 2797 gene locus_tag LOCUS_19500 3168 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3279 5069 gene locus_tag LOCUS_19510 3279 5069 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_19510 5073 5261 gene locus_tag LOCUS_19520 5073 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence174 1888 1619 gene locus_tag LOCUS_19530 1888 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2996 2070 gene locus_tag LOCUS_19540 2996 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3507 4757 gene locus_tag LOCUS_19550 gene dsrA 3507 4757 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence175 <1 1977 gene locus_tag LOCUS_19560 <1 1977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391182.1:double-strand break repair protein AddB 1974 5387 gene locus_tag LOCUS_19570 gene addA 1974 5387 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence176 35 328 gene locus_tag LOCUS_19580 35 328 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_19580 332 1162 gene locus_tag LOCUS_19590 gene rplB 332 1162 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390435.1 protein_id gnl|my_center|LOCUS_19590 1175 1456 gene locus_tag LOCUS_19600 gene rpsS 1175 1456 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_19600 1459 1839 gene locus_tag LOCUS_19610 gene rplV 1459 1839 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390433.1 protein_id gnl|my_center|LOCUS_19610 1839 2516 gene locus_tag LOCUS_19620 gene rpsC 1839 2516 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_19620 2535 2954 gene locus_tag LOCUS_19630 gene rplP 2535 2954 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_19630 2959 3168 gene locus_tag LOCUS_19640 gene rpmC 2959 3168 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_19640 3184 3432 gene locus_tag LOCUS_19650 3184 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3465 3833 gene locus_tag LOCUS_19660 gene rplN 3465 3833 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538009.1 protein_id gnl|my_center|LOCUS_19660 3833 4153 gene locus_tag LOCUS_19670 gene rplX 3833 4153 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_19670 4168 4707 gene locus_tag LOCUS_19680 gene rplE 4168 4707 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390426.1 protein_id gnl|my_center|LOCUS_19680 4732 5037 gene locus_tag LOCUS_19690 gene rpsN 4732 5037 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390425.1 protein_id gnl|my_center|LOCUS_19690 5051 5449 gene locus_tag LOCUS_19700 gene rpsH 5051 5449 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence177 174 620 gene locus_tag LOCUS_19710 gene aroQ 174 620 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_19710 627 1100 gene locus_tag LOCUS_19720 627 1100 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390187.1 protein_id gnl|my_center|LOCUS_19720 1121 2467 gene locus_tag LOCUS_19730 gene accC 1121 2467 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390188.1 protein_id gnl|my_center|LOCUS_19730 2470 3120 gene locus_tag LOCUS_19740 gene aat 2470 3120 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390189.1 protein_id gnl|my_center|LOCUS_19740 4086 3133 gene locus_tag LOCUS_19750 4086 3133 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625895.1 protein_id gnl|my_center|LOCUS_19750 4665 4153 gene locus_tag LOCUS_19760 4665 4153 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_19760 <5620 4682 gene locus_tag LOCUS_19770 <5620 4682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103065.1:XRE family transcriptional regulator >Feature sequence178 1336 896 gene locus_tag LOCUS_19780 gene rpiB 1336 896 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_19780 1705 1481 gene locus_tag LOCUS_19790 1705 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2814 1723 gene locus_tag LOCUS_19800 2814 1723 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_19800 3488 4405 gene locus_tag LOCUS_19810 3488 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19810 4439 5455 gene locus_tag LOCUS_19820 gene hemB 4439 5455 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389590.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence179 1355 1573 gene locus_tag LOCUS_19830 1355 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2091 1570 gene locus_tag LOCUS_19840 2091 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2955 2344 gene locus_tag LOCUS_19850 gene plsY 2955 2344 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390940.1 protein_id gnl|my_center|LOCUS_19850 4269 2959 gene locus_tag LOCUS_19860 gene pyrC 4269 2959 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 protein_id gnl|my_center|LOCUS_19860 5225 4266 gene locus_tag LOCUS_19870 5225 4266 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence180 2 238 gene locus_tag LOCUS_19880 2 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 235 879 gene locus_tag LOCUS_19890 235 879 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389613.1 protein_id gnl|my_center|LOCUS_19890 1380 904 gene locus_tag LOCUS_19900 gene smpB 1380 904 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_19900 2305 1427 gene locus_tag LOCUS_19910 gene dapA 2305 1427 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_19910 2454 4415 gene locus_tag LOCUS_19920 2454 4415 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_19920 5026 4466 gene locus_tag LOCUS_19930 5026 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 5441 5007 gene locus_tag LOCUS_19940 5441 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence181 3255 1483 gene locus_tag LOCUS_19950 3255 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3690 4607 gene locus_tag LOCUS_19960 3690 4607 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence182 1774 137 gene locus_tag LOCUS_19970 gene fliF 1774 137 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388303.1 protein_id gnl|my_center|LOCUS_19970 3450 1903 gene locus_tag LOCUS_19980 3450 1903 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393354.1 protein_id gnl|my_center|LOCUS_19980 4573 3452 gene locus_tag LOCUS_19990 4573 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence183 2193 1102 gene locus_tag LOCUS_20000 2193 1102 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 protein_id gnl|my_center|LOCUS_20000 2738 2190 gene locus_tag LOCUS_20010 2738 2190 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395734.1 protein_id gnl|my_center|LOCUS_20010 3461 2874 gene locus_tag LOCUS_20020 3461 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 <5441 3516 gene locus_tag LOCUS_20030 <5441 3516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_183090287.1:EAL domain-containing protein >Feature sequence184 1588 1166 gene locus_tag LOCUS_20040 gene ndk 1588 1166 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390018.1 protein_id gnl|my_center|LOCUS_20040 1732 3633 gene locus_tag LOCUS_20050 1732 3633 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_20050 5409 3661 gene locus_tag LOCUS_20060 5409 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence185 1588 161 gene locus_tag LOCUS_20070 1588 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1676 3448 gene locus_tag LOCUS_20080 1676 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4024 4887 gene locus_tag LOCUS_20090 4024 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence186 580 206 gene locus_tag LOCUS_20100 580 206 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_20100 783 707 gene locus_tag LOCUS_t00250 783 707 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2391 1000 gene locus_tag LOCUS_20110 2391 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2551 3624 gene locus_tag LOCUS_20120 2551 3624 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389542.1 protein_id gnl|my_center|LOCUS_20120 5188 3707 gene locus_tag LOCUS_20130 5188 3707 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence187 1020 1310 gene locus_tag LOCUS_20140 1020 1310 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_20140 2485 1706 gene locus_tag LOCUS_20150 2485 1706 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_20150 3486 2461 gene locus_tag LOCUS_20160 3486 2461 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_20160 3980 3483 gene locus_tag LOCUS_20170 gene tsaE 3980 3483 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_20170 5190 4027 gene locus_tag LOCUS_20180 5190 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence188 501 1349 gene locus_tag LOCUS_20190 gene speE 501 1349 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114619.1 protein_id gnl|my_center|LOCUS_20190 1888 1322 gene locus_tag LOCUS_20200 1888 1322 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_20200 2831 1896 gene locus_tag LOCUS_20210 gene msrP 2831 1896 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401748.1 protein_id gnl|my_center|LOCUS_20210 2967 4760 gene locus_tag LOCUS_20220 2967 4760 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852913.1 protein_id gnl|my_center|LOCUS_20220 <5340 4773 gene locus_tag LOCUS_20230 <5340 4773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389481.1:ATP-dependent DNA helicase RecG >Feature sequence189 2 331 gene locus_tag LOCUS_20240 2 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 342 1052 gene locus_tag LOCUS_20250 342 1052 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389444.1 protein_id gnl|my_center|LOCUS_20250 1056 1859 gene locus_tag LOCUS_20260 1056 1859 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_20260 1843 3507 gene locus_tag LOCUS_20270 1843 3507 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_20270 3544 3948 gene locus_tag LOCUS_20280 gene mce 3544 3948 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_20280 3945 4499 gene locus_tag LOCUS_20290 3945 4499 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389448.1 protein_id gnl|my_center|LOCUS_20290 4606 4400 gene locus_tag LOCUS_20300 4606 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4819 5298 gene locus_tag LOCUS_20310 4819 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence190 1238 573 gene locus_tag LOCUS_20320 1238 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389320.1 protein_id gnl|my_center|LOCUS_20320 1301 1474 gene locus_tag LOCUS_20330 1301 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1471 3966 gene locus_tag LOCUS_20340 1471 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 3969 4157 gene locus_tag LOCUS_20350 3969 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4182 4553 gene locus_tag LOCUS_20360 4182 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4743 4558 gene locus_tag LOCUS_20370 4743 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 <5281 4743 gene locus_tag LOCUS_20380 <5281 4743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390362.1:universal stress protein >Feature sequence191 29 703 gene locus_tag LOCUS_20390 29 703 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_20390 1787 708 gene locus_tag LOCUS_20400 1787 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1922 2170 gene locus_tag LOCUS_20410 1922 2170 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388797.1 protein_id gnl|my_center|LOCUS_20410 2333 2761 gene locus_tag LOCUS_20420 2333 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3769 2789 gene locus_tag LOCUS_20430 3769 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 <5243 3766 gene locus_tag LOCUS_20440 <5243 3766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390040.1:AMP-dependent synthetase/ligase >Feature sequence192 <1 672 gene locus_tag LOCUS_20450 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197535747.1:YdcF family protein 745 1752 gene locus_tag LOCUS_20460 745 1752 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_20460 1991 2965 gene locus_tag LOCUS_20470 1991 2965 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 protein_id gnl|my_center|LOCUS_20470 3003 4172 gene locus_tag LOCUS_20480 3003 4172 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_20480 4181 4813 gene locus_tag LOCUS_20490 gene tmk 4181 4813 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626229.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence193 <1 1346 gene locus_tag LOCUS_20500 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004201193.1:PilN family type IVB pilus formation outer membrane protein 1351 2652 gene locus_tag LOCUS_20510 1351 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2627 3178 gene locus_tag LOCUS_20520 2627 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3178 4896 gene locus_tag LOCUS_20530 3178 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence194 291 626 gene locus_tag LOCUS_20540 291 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20540 783 1022 gene locus_tag LOCUS_20550 783 1022 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_20550 1066 2331 gene locus_tag LOCUS_20560 gene fabF 1066 2331 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388177.1 protein_id gnl|my_center|LOCUS_20560 2342 3325 gene locus_tag LOCUS_20570 2342 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3407 5113 gene locus_tag LOCUS_20580 3407 5113 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389349.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence195 <1 769 gene locus_tag LOCUS_20590 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211993.1:DNA helicase Rep 872 1408 gene locus_tag LOCUS_20600 872 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2058 1429 gene locus_tag LOCUS_20610 2058 1429 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_20610 2581 2081 gene locus_tag LOCUS_20620 2581 2081 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_20620 3384 2818 gene locus_tag LOCUS_20630 gene rplI 3384 2818 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625933.1 protein_id gnl|my_center|LOCUS_20630 4289 3384 gene locus_tag LOCUS_20640 4289 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 4565 4320 gene locus_tag LOCUS_20650 gene rpsR 4565 4320 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_20650 4978 4562 gene locus_tag LOCUS_20660 4978 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence196 417 782 gene locus_tag LOCUS_20670 gene rplR 417 782 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603036.1 protein_id gnl|my_center|LOCUS_20670 802 1413 gene locus_tag LOCUS_20680 gene rpsE 802 1413 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390421.1 protein_id gnl|my_center|LOCUS_20680 1420 1614 gene locus_tag LOCUS_20690 gene rpmD 1420 1614 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_20690 1688 2149 gene locus_tag LOCUS_20700 gene rplO 1688 2149 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390419.1 protein_id gnl|my_center|LOCUS_20700 2227 3570 gene locus_tag LOCUS_20710 gene secY 2227 3570 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_20710 3586 4242 gene locus_tag LOCUS_20720 3586 4242 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_20720 4333 4710 gene locus_tag LOCUS_20730 gene rpsM 4333 4710 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_20730 4729 5121 gene locus_tag LOCUS_20740 gene rpsK 4729 5121 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390415.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence197 1593 277 gene locus_tag LOCUS_20750 1593 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3385 1586 gene locus_tag LOCUS_20760 3385 1586 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193739.1 protein_id gnl|my_center|LOCUS_20760 3551 3369 gene locus_tag LOCUS_20770 3551 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 4246 3629 gene locus_tag LOCUS_20780 4246 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence198 259 921 gene locus_tag LOCUS_20790 gene elbB 259 921 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_20790 2230 929 gene locus_tag LOCUS_20800 2230 929 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389860.1 protein_id gnl|my_center|LOCUS_20800 2620 2309 gene locus_tag LOCUS_20810 2620 2309 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084888.1 protein_id gnl|my_center|LOCUS_20810 2909 2640 gene locus_tag LOCUS_20820 2909 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 4090 2966 gene locus_tag LOCUS_20830 4090 2966 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_20830 5153 4083 gene locus_tag LOCUS_20840 5153 4083 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence199 1008 85 gene locus_tag LOCUS_20850 gene znuA 1008 85 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_20850 1122 1628 gene locus_tag LOCUS_20860 gene zur 1122 1628 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_20860 1612 2403 gene locus_tag LOCUS_20870 1612 2403 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240527.1 protein_id gnl|my_center|LOCUS_20870 2396 3202 gene locus_tag LOCUS_20880 gene znuB 2396 3202 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975837.1 protein_id gnl|my_center|LOCUS_20880 3271 3630 gene locus_tag LOCUS_20890 3271 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3640 4164 gene locus_tag LOCUS_20900 3640 4164 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221471091.1 protein_id gnl|my_center|LOCUS_20900 4232 4993 gene locus_tag LOCUS_20910 4232 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence200 2145 358 gene locus_tag LOCUS_20920 gene ptsP 2145 358 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_20920 2420 2142 gene locus_tag LOCUS_20930 2420 2142 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626594.1 protein_id gnl|my_center|LOCUS_20930 2827 2417 gene locus_tag LOCUS_20940 2827 2417 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_20940 3712 2846 gene locus_tag LOCUS_20950 gene rapZ 3712 2846 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_20950 4167 3733 gene locus_tag LOCUS_20960 4167 3733 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_20960 4729 4229 gene locus_tag LOCUS_20970 4729 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence201 302 3643 gene locus_tag LOCUS_20980 302 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4658 3846 gene locus_tag LOCUS_20990 4658 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence202 2916 2215 gene locus_tag LOCUS_21000 2916 2215 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_21000 4007 2913 gene locus_tag LOCUS_21010 4007 2913 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_21010 4546 4007 gene locus_tag LOCUS_21020 4546 4007 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence203 2353 35 gene locus_tag LOCUS_21030 2353 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2748 2350 gene locus_tag LOCUS_21040 2748 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 3977 2847 gene locus_tag LOCUS_21050 3977 2847 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763705.1 protein_id gnl|my_center|LOCUS_21050 4803 4036 gene locus_tag LOCUS_21060 4803 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence204 <1 777 gene locus_tag LOCUS_21070 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391225.1:diguanylate cyclase 774 2120 gene locus_tag LOCUS_21080 774 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2177 3334 gene locus_tag LOCUS_21090 2177 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 4862 3387 gene locus_tag LOCUS_21100 4862 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence205 <1 1955 gene locus_tag LOCUS_21110 <1 1955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388466.1:phosphoribosylformylglycinamidine synthase subunit PurL 1982 2218 gene locus_tag LOCUS_21120 1982 2218 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_21120 2302 3177 gene locus_tag LOCUS_21130 gene rarD 2302 3177 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_21130 3174 3509 gene locus_tag LOCUS_21140 gene grxD 3174 3509 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388463.1 protein_id gnl|my_center|LOCUS_21140 3923 3537 gene locus_tag LOCUS_21150 3923 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence206 4182 2284 gene locus_tag LOCUS_21160 4182 2284 CDS product MASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941143.1 protein_id gnl|my_center|LOCUS_21160 4268 4615 gene locus_tag LOCUS_21170 4268 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence207 <1 703 gene locus_tag LOCUS_21180 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390466.1:DUF6468 domain-containing protein 721 1455 gene locus_tag LOCUS_21190 721 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 protein_id gnl|my_center|LOCUS_21190 1608 1994 gene locus_tag LOCUS_21200 1608 1994 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_21200 2012 2680 gene locus_tag LOCUS_21210 2012 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2701 3459 gene locus_tag LOCUS_21220 2701 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3462 4184 gene locus_tag LOCUS_21230 3462 4184 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460802.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence208 141 1301 gene locus_tag LOCUS_21240 141 1301 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_21240 1288 2523 gene locus_tag LOCUS_21250 1288 2523 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence209 396 1448 gene locus_tag LOCUS_21260 396 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1925 2434 gene locus_tag LOCUS_21270 1925 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2431 3780 gene locus_tag LOCUS_21280 gene terL 2431 3780 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023725.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence210 >Feature sequence211 76 1377 gene locus_tag LOCUS_21290 76 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1390 2079 gene locus_tag LOCUS_21300 1390 2079 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_21300 2139 2588 gene locus_tag LOCUS_21310 2139 2588 CDS product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090683.1 protein_id gnl|my_center|LOCUS_21310 3287 2619 gene locus_tag LOCUS_21320 3287 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3568 3335 gene locus_tag LOCUS_21330 3568 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 <4879 3685 gene locus_tag LOCUS_21340 <4879 3685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389601.1:DNA topoisomerase IV subunit A >Feature sequence212 1252 134 gene locus_tag LOCUS_21350 1252 134 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_21350 1625 4855 gene locus_tag LOCUS_21360 1625 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence213 370 1395 gene locus_tag LOCUS_21370 370 1395 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_21370 1531 2913 gene locus_tag LOCUS_21380 gene pstC 1531 2913 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_21380 2906 4225 gene locus_tag LOCUS_21390 gene pstA 2906 4225 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence214 187 1341 gene locus_tag LOCUS_21400 187 1341 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_21400 1347 1790 gene locus_tag LOCUS_21410 1347 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1806 3209 gene locus_tag LOCUS_21420 1806 3209 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_21420 4003 3299 gene locus_tag LOCUS_21430 4003 3299 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence215 427 1161 gene locus_tag LOCUS_21440 427 1161 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_21440 1520 1433 gene locus_tag LOCUS_t00260 1520 1433 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1628 2212 gene locus_tag LOCUS_21450 1628 2212 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_21450 2226 2723 gene locus_tag LOCUS_21460 2226 2723 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391244.1 protein_id gnl|my_center|LOCUS_21460 2720 3325 gene locus_tag LOCUS_21470 2720 3325 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_21470 3336 3599 gene locus_tag LOCUS_21480 3336 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 4172 3618 gene locus_tag LOCUS_21490 4172 3618 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_21490 4623 4186 gene locus_tag LOCUS_21500 4623 4186 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence216 91 660 gene locus_tag LOCUS_21510 91 660 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389865.1 protein_id gnl|my_center|LOCUS_21510 1001 645 gene locus_tag LOCUS_21520 1001 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1944 1081 gene locus_tag LOCUS_21530 1944 1081 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388016.1 protein_id gnl|my_center|LOCUS_21530 3470 1941 gene locus_tag LOCUS_21540 3470 1941 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21540 4655 3681 gene locus_tag LOCUS_21550 4655 3681 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932127.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence217 >Feature sequence218 <1 943 gene locus_tag LOCUS_21560 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391290.1:ATP-binding protein 940 1689 gene locus_tag LOCUS_21570 gene phoU 940 1689 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_21570 1686 2741 gene locus_tag LOCUS_21580 1686 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2743 3294 gene locus_tag LOCUS_21590 2743 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3831 3301 gene locus_tag LOCUS_21600 3831 3301 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_21600 4394 3858 gene locus_tag LOCUS_21610 gene ppa 4394 3858 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917937.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence219 544 1536 gene locus_tag LOCUS_21620 544 1536 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_21620 1648 4224 gene locus_tag LOCUS_21630 1648 4224 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067553987.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence220 1216 125 gene locus_tag LOCUS_21640 1216 125 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_21640 2031 1240 gene locus_tag LOCUS_21650 2031 1240 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389466.1 protein_id gnl|my_center|LOCUS_21650 2776 2045 gene locus_tag LOCUS_21660 2776 2045 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_21660 3364 2795 gene locus_tag LOCUS_21670 gene frr 3364 2795 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_21670 4093 3368 gene locus_tag LOCUS_21680 gene pyrH 4093 3368 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389463.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence221 252 872 gene locus_tag LOCUS_21690 gene leuD 252 872 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 protein_id gnl|my_center|LOCUS_21690 1121 2242 gene locus_tag LOCUS_21700 gene leuB 1121 2242 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388946.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence222 806 1006 gene locus_tag LOCUS_21710 806 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1084 1731 gene locus_tag LOCUS_21720 1084 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1744 2760 gene locus_tag LOCUS_21730 1744 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2757 4418 gene locus_tag LOCUS_21740 2757 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence223 3147 1750 gene locus_tag LOCUS_21750 3147 1750 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388298.1 protein_id gnl|my_center|LOCUS_21750 4038 3274 gene locus_tag LOCUS_21760 4038 3274 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence224 1072 290 gene locus_tag LOCUS_21770 gene surE 1072 290 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389522.1 protein_id gnl|my_center|LOCUS_21770 2342 1065 gene locus_tag LOCUS_21780 gene serS 2342 1065 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534571.1 protein_id gnl|my_center|LOCUS_21780 3230 2397 gene locus_tag LOCUS_21790 gene tatC 3230 2397 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389524.1 protein_id gnl|my_center|LOCUS_21790 3706 3227 gene locus_tag LOCUS_21800 gene tatB 3706 3227 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389525.1 protein_id gnl|my_center|LOCUS_21800 4003 3776 gene locus_tag LOCUS_21810 4003 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4347 4117 gene locus_tag LOCUS_21820 4347 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence225 2044 863 gene locus_tag LOCUS_21830 2044 863 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390673.1 protein_id gnl|my_center|LOCUS_21830 2175 2462 gene locus_tag LOCUS_21840 2175 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390672.1 protein_id gnl|my_center|LOCUS_21840 3008 2478 gene locus_tag LOCUS_21850 3008 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 <4451 3005 gene locus_tag LOCUS_21860 <4451 3005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein >Feature sequence226 2169 85 gene locus_tag LOCUS_21870 2169 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2383 3375 gene locus_tag LOCUS_21880 2383 3375 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391000.1 protein_id gnl|my_center|LOCUS_21880 3477 3851 gene locus_tag LOCUS_21890 3477 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 4274 3954 gene locus_tag LOCUS_21900 gene rpmB 4274 3954 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387963.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence227 <1 1098 gene locus_tag LOCUS_21910 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388197.1:ATP-binding protein 1095 2681 gene locus_tag LOCUS_21920 1095 2681 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707269.1 protein_id gnl|my_center|LOCUS_21920 2681 3535 gene locus_tag LOCUS_21930 2681 3535 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_21930 3586 4341 gene locus_tag LOCUS_21940 3586 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence228 <4422 1763 gene locus_tag LOCUS_21950 <4422 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704238.1:DEAD/DEAH box helicase family protein >Feature sequence229 1396 2043 gene locus_tag LOCUS_21960 1396 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2276 2593 gene locus_tag LOCUS_21970 gene clpS 2276 2593 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence230 3146 666 gene locus_tag LOCUS_21980 3146 666 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920277.1 protein_id gnl|my_center|LOCUS_21980 3483 3148 gene locus_tag LOCUS_21990 3483 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3844 3494 gene locus_tag LOCUS_22000 3844 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence231 362 667 gene locus_tag LOCUS_22010 362 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 1308 664 gene locus_tag LOCUS_22020 1308 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256711.1 protein_id gnl|my_center|LOCUS_22020 2597 1305 gene locus_tag LOCUS_22030 2597 1305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_22030 2721 4307 gene locus_tag LOCUS_22040 2721 4307 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence232 <1 2253 gene locus_tag LOCUS_22050 <1 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389497.1:DNA gyrase subunit A note possible pseudo, frameshifted 2250 2777 gene locus_tag LOCUS_22060 gene coaD 2250 2777 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389496.1 protein_id gnl|my_center|LOCUS_22060 2975 3724 gene locus_tag LOCUS_22070 2975 3724 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391142.1 protein_id gnl|my_center|LOCUS_22070 3910 4125 gene locus_tag LOCUS_22080 3910 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence233 1230 1382 gene locus_tag LOCUS_22090 1230 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3166 1874 gene locus_tag LOCUS_22100 3166 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence234 2853 1171 gene locus_tag LOCUS_22110 2853 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 3530 2883 gene locus_tag LOCUS_22120 gene nudF 3530 2883 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence235 304 2466 gene locus_tag LOCUS_22130 304 2466 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390447.1 protein_id gnl|my_center|LOCUS_22130 2594 3688 gene locus_tag LOCUS_22140 gene recA 2594 3688 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence236 <1 804 gene locus_tag LOCUS_22150 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141384.1:tetratricopeptide repeat protein 837 1067 gene locus_tag LOCUS_22160 837 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3392 1770 gene locus_tag LOCUS_22170 3392 1770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390917.1 protein_id gnl|my_center|LOCUS_22170 <4244 3389 gene locus_tag LOCUS_22180 <4244 3389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390916.1:ABC transporter permease >Feature sequence237 <1 657 gene locus_tag LOCUS_22190 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387778.1:undecaprenyl-diphosphate phosphatase 668 1015 gene locus_tag LOCUS_22200 668 1015 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 protein_id gnl|my_center|LOCUS_22200 1416 2138 gene locus_tag LOCUS_22210 1416 2138 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_22210 2509 2144 gene locus_tag LOCUS_22220 2509 2144 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141056643.1 protein_id gnl|my_center|LOCUS_22220 2798 2499 gene locus_tag LOCUS_22230 2798 2499 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_22230 3832 2810 gene locus_tag LOCUS_22240 3832 2810 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387777.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence238 78 902 gene locus_tag LOCUS_22250 gene sfsA 78 902 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_22250 880 1704 gene locus_tag LOCUS_22260 gene map 880 1704 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 protein_id gnl|my_center|LOCUS_22260 1712 2428 gene locus_tag LOCUS_22270 gene radC 1712 2428 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388490.1 protein_id gnl|my_center|LOCUS_22270 3802 2438 gene locus_tag LOCUS_22280 3802 2438 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence239 998 2989 gene locus_tag LOCUS_22290 998 2989 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_22290 3058 3789 gene locus_tag LOCUS_22300 gene ftsE 3058 3789 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence240 658 2361 gene locus_tag LOCUS_22310 658 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2399 3550 gene locus_tag LOCUS_22320 2399 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence241 <1 1117 gene locus_tag LOCUS_22330 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389549.1:valine--tRNA ligase 1264 1809 gene locus_tag LOCUS_22340 1264 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1844 3706 gene locus_tag LOCUS_22350 gene ilvD 1844 3706 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626247.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence242 190 1953 gene locus_tag LOCUS_22360 190 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2436 2191 gene locus_tag LOCUS_22370 2436 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3038 2469 gene locus_tag LOCUS_22380 3038 2469 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence243 <1 822 gene locus_tag LOCUS_22390 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390356.1:cache domain-containing protein 2025 808 gene locus_tag LOCUS_22400 2025 808 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_22400 3867 2485 gene locus_tag LOCUS_22410 3867 2485 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence244 2866 1439 gene locus_tag LOCUS_22420 2866 1439 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_22420 3452 2898 gene locus_tag LOCUS_22430 3452 2898 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_22430 3928 3449 gene locus_tag LOCUS_22440 gene lspA 3928 3449 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence245 198 1022 gene locus_tag LOCUS_22450 gene mazG 198 1022 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_22450 1019 1633 gene locus_tag LOCUS_22460 1019 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2586 1792 gene locus_tag LOCUS_22470 2586 1792 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389377.1 protein_id gnl|my_center|LOCUS_22470 <4072 2700 gene locus_tag LOCUS_22480 <4072 2700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387923.1:chaperonin GroEL >Feature sequence246 2212 917 gene locus_tag LOCUS_22490 gene ccrA 2212 917 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390811.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence247 3074 1647 gene locus_tag LOCUS_22500 3074 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence248 2718 1408 gene locus_tag LOCUS_22510 gene mnmE 2718 1408 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 protein_id gnl|my_center|LOCUS_22510 3044 2715 gene locus_tag LOCUS_22520 3044 2715 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_22520 3286 3041 gene locus_tag LOCUS_22530 3286 3041 CDS product DUF6489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 protein_id gnl|my_center|LOCUS_22530 3403 3867 gene locus_tag LOCUS_22540 3403 3867 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence249 <1 983 gene locus_tag LOCUS_22550 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945875.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB 1154 2089 gene locus_tag LOCUS_22560 1154 2089 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_22560 3975 2182 gene locus_tag LOCUS_22570 3975 2182 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence250 374 1411 gene locus_tag LOCUS_22580 374 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3050 1431 gene locus_tag LOCUS_22590 3050 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3255 3180 gene locus_tag LOCUS_t00270 3255 3180 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence251 145 1443 gene locus_tag LOCUS_22600 gene hisD 145 1443 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390581.1 protein_id gnl|my_center|LOCUS_22600 1447 1923 gene locus_tag LOCUS_22610 1447 1923 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390580.1 protein_id gnl|my_center|LOCUS_22610 1928 2374 gene locus_tag LOCUS_22620 1928 2374 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_22620 2653 2399 gene locus_tag LOCUS_22630 gene yefM 2653 2399 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815401.1 protein_id gnl|my_center|LOCUS_22630 2863 3303 gene locus_tag LOCUS_22640 2863 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence252 28 681 gene locus_tag LOCUS_22650 28 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 796 1950 gene locus_tag LOCUS_22660 gene argE 796 1950 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064838.1 protein_id gnl|my_center|LOCUS_22660 2793 1981 gene locus_tag LOCUS_22670 2793 1981 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929674.1 protein_id gnl|my_center|LOCUS_22670 2987 3181 gene locus_tag LOCUS_22680 2987 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3326 3251 gene locus_tag LOCUS_t00280 3326 3251 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3903 3433 gene locus_tag LOCUS_22690 3903 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence253 <1 1644 gene locus_tag LOCUS_22700 <1 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390459.1:tetratricopeptide repeat protein 2459 1710 gene locus_tag LOCUS_22710 gene fliP 2459 1710 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390457.1 protein_id gnl|my_center|LOCUS_22710 2740 2456 gene locus_tag LOCUS_22720 2740 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3070 2750 gene locus_tag LOCUS_22730 3070 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3402 3067 gene locus_tag LOCUS_22740 3402 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence254 624 2312 gene locus_tag LOCUS_22750 624 2312 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 protein_id gnl|my_center|LOCUS_22750 2309 3601 gene locus_tag LOCUS_22760 2309 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence255 2053 2145 gene locus_tag LOCUS_t00290 2053 2145 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3776 2388 gene locus_tag LOCUS_22770 3776 2388 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence256 1 351 gene locus_tag LOCUS_22780 1 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 426 776 gene locus_tag LOCUS_22790 426 776 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_22790 780 1157 gene locus_tag LOCUS_22800 780 1157 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_22800 1295 3106 gene locus_tag LOCUS_22810 1295 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence257 572 2509 gene locus_tag LOCUS_22820 gene acs 572 2509 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_22820 2671 2952 gene locus_tag LOCUS_22830 2671 2952 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928690.1 protein_id gnl|my_center|LOCUS_22830 2939 3217 gene locus_tag LOCUS_22840 2939 3217 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081705261.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence258 1838 444 gene locus_tag LOCUS_22850 1838 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2977 1826 gene locus_tag LOCUS_22860 2977 1826 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_22860 3742 3011 gene locus_tag LOCUS_22870 3742 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence259 477 1232 gene locus_tag LOCUS_22880 477 1232 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 protein_id gnl|my_center|LOCUS_22880 1229 1636 gene locus_tag LOCUS_22890 gene acpS 1229 1636 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 protein_id gnl|my_center|LOCUS_22890 1689 2450 gene locus_tag LOCUS_22900 gene lepB 1689 2450 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_22900 2453 3142 gene locus_tag LOCUS_22910 gene rnc 2453 3142 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence260 <1 1097 gene locus_tag LOCUS_22920 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525348.1:YaiO family outer membrane beta-barrel protein 1107 2150 gene locus_tag LOCUS_22930 1107 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2147 3583 gene locus_tag LOCUS_22940 2147 3583 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525350.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence261 147 833 gene locus_tag LOCUS_22950 147 833 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_22950 933 2759 gene locus_tag LOCUS_22960 933 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3014 2760 gene locus_tag LOCUS_22970 3014 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 <3779 3011 gene locus_tag LOCUS_22980 <3779 3011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767925.1:ferrous iron transport protein B >Feature sequence262 3247 1955 gene locus_tag LOCUS_22990 3247 1955 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_22990 <3758 3254 gene locus_tag LOCUS_23000 <3758 3254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388860.1:ATP phosphoribosyltransferase regulatory subunit >Feature sequence263 <1 805 gene locus_tag LOCUS_23010 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967037.1:DegT/DnrJ/EryC1/StrS family aminotransferase 818 1900 gene locus_tag LOCUS_23020 818 1900 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_23020 1961 3133 gene locus_tag LOCUS_23030 gene wecB 1961 3133 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence264 826 116 gene locus_tag LOCUS_23040 gene yihA 826 116 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_23040 2692 836 gene locus_tag LOCUS_23050 gene yidC 2692 836 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_23050 2977 2738 gene locus_tag LOCUS_23060 gene yidD 2977 2738 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_23060 3384 2974 gene locus_tag LOCUS_23070 gene rnpA 3384 2974 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721421.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence265 1524 1264 gene locus_tag LOCUS_23080 1524 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 1740 3404 gene locus_tag LOCUS_23090 1740 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence266 173 448 gene locus_tag LOCUS_23100 173 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1169 2539 gene locus_tag LOCUS_23110 1169 2539 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203961.1 protein_id gnl|my_center|LOCUS_23110 3411 2524 gene locus_tag LOCUS_23120 3411 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence267 1062 673 gene locus_tag LOCUS_23130 1062 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3079 2228 gene locus_tag LOCUS_23140 gene phoB 3079 2228 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143479.1 protein_id gnl|my_center|LOCUS_23140 3493 3110 gene locus_tag LOCUS_23150 3493 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence268 764 615 gene locus_tag LOCUS_23160 764 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1092 841 gene locus_tag LOCUS_23170 1092 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1814 1224 gene locus_tag LOCUS_23180 gene phnN 1814 1224 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391674.1 protein_id gnl|my_center|LOCUS_23180 2526 1807 gene locus_tag LOCUS_23190 gene phoB 2526 1807 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_23190 3229 2504 gene locus_tag LOCUS_23200 gene phoU 3229 2504 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence269 367 1047 gene locus_tag LOCUS_23210 gene dnaQ 367 1047 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_23210 1561 1067 gene locus_tag LOCUS_23220 gene secB 1561 1067 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391357.1 protein_id gnl|my_center|LOCUS_23220 2157 1633 gene locus_tag LOCUS_23230 2157 1633 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391356.1 protein_id gnl|my_center|LOCUS_23230 2282 2992 gene locus_tag LOCUS_23240 2282 2992 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence270 >Feature sequence271 1604 654 gene locus_tag LOCUS_23250 1604 654 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_23250 2147 1692 gene locus_tag LOCUS_23260 2147 1692 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_23260 3609 2284 gene locus_tag LOCUS_23270 3609 2284 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence272 1133 2071 gene locus_tag LOCUS_23280 1133 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23280 2545 2078 gene locus_tag LOCUS_23290 2545 2078 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_23290 3495 2551 gene locus_tag LOCUS_23300 gene lipA 3495 2551 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389630.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence273 167 1726 gene locus_tag LOCUS_23310 gene guaA 167 1726 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388108.1 protein_id gnl|my_center|LOCUS_23310 1769 2758 gene locus_tag LOCUS_23320 1769 2758 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence274 511 1308 gene locus_tag LOCUS_23330 gene xth 511 1308 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967248.1 protein_id gnl|my_center|LOCUS_23330 2192 1377 gene locus_tag LOCUS_23340 2192 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2716 2321 gene locus_tag LOCUS_23350 2716 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3241 2741 gene locus_tag LOCUS_23360 3241 2741 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence275 3005 1209 gene locus_tag LOCUS_23370 3005 1209 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence276 1 1233 gene locus_tag LOCUS_23380 1 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1217 1642 gene locus_tag LOCUS_23390 1217 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 1639 2508 gene locus_tag LOCUS_23400 1639 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3015 3467 gene locus_tag LOCUS_23410 3015 3467 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265919.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence277 1581 2615 gene locus_tag LOCUS_23420 gene speB 1581 2615 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence278 1 399 gene locus_tag LOCUS_23430 1 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1861 470 gene locus_tag LOCUS_23440 1861 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3446 1980 gene locus_tag LOCUS_23450 3446 1980 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence279 <1 1397 gene locus_tag LOCUS_23460 <1 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011342568.1:DUF4139 domain-containing protein 1497 2015 gene locus_tag LOCUS_23470 gene def 1497 2015 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 protein_id gnl|my_center|LOCUS_23470 2019 2939 gene locus_tag LOCUS_23480 gene fmt 2019 2939 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383426.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence280 <1 1383 gene locus_tag LOCUS_23490 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931548.1:ABC transporter substrate-binding protein 1480 2349 gene locus_tag LOCUS_23500 1480 2349 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_23500 2349 3371 gene locus_tag LOCUS_23510 2349 3371 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435245.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence281 551 1201 gene locus_tag LOCUS_23520 gene rsmG 551 1201 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391373.1 protein_id gnl|my_center|LOCUS_23520 1155 1979 gene locus_tag LOCUS_23530 1155 1979 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_23530 1976 3049 gene locus_tag LOCUS_23540 1976 3049 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence282 >Feature sequence283 1090 1536 gene locus_tag LOCUS_23550 1090 1536 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256137.1 protein_id gnl|my_center|LOCUS_23550 1543 2280 gene locus_tag LOCUS_23560 gene recO 1543 2280 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640273.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence284 3329 621 gene locus_tag LOCUS_23570 3329 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence285 2593 1397 gene locus_tag LOCUS_23580 2593 1397 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 protein_id gnl|my_center|LOCUS_23580 2712 3047 gene locus_tag LOCUS_23590 gene erpA 2712 3047 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence286 1221 457 gene locus_tag LOCUS_23600 1221 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 1859 1323 gene locus_tag LOCUS_23610 1859 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 2866 1850 gene locus_tag LOCUS_23620 2866 1850 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence287 <1 1197 gene locus_tag LOCUS_23630 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387964.1:protein phosphatase CheZ 1314 1389 gene locus_tag LOCUS_t00300 1314 1389 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1561 2562 gene locus_tag LOCUS_23640 1561 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence288 904 440 gene locus_tag LOCUS_23650 904 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625939.1 protein_id gnl|my_center|LOCUS_23650 1427 1032 gene locus_tag LOCUS_23660 1427 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2862 1447 gene locus_tag LOCUS_23670 gene mgtE 2862 1447 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_23670 3080 2993 gene locus_tag LOCUS_t00310 3080 2993 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence289 <1 614 gene locus_tag LOCUS_23680 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391333.1:LysM peptidoglycan-binding domain-containing protein 1141 641 gene locus_tag LOCUS_23690 1141 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2030 1254 gene locus_tag LOCUS_23700 2030 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2299 2643 gene locus_tag LOCUS_23710 2299 2643 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_23710 <3291 2752 gene locus_tag LOCUS_23720 <3291 2752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403445.1:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence290 2766 1435 gene locus_tag LOCUS_23730 2766 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence291 <1 629 gene locus_tag LOCUS_23740 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951368.1:type IV pilus twitching motility protein PilT 687 1055 gene locus_tag LOCUS_23750 687 1055 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_23750 1052 2677 gene locus_tag LOCUS_23760 gene cimA 1052 2677 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence292 2895 1432 gene locus_tag LOCUS_23770 gene gatA 2895 1432 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390924.1 protein_id gnl|my_center|LOCUS_23770 3218 2931 gene locus_tag LOCUS_23780 gene gatC 3218 2931 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence293 3058 14 gene locus_tag LOCUS_23790 3058 14 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772627.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence294 1338 757 gene locus_tag LOCUS_23800 1338 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence295 1890 664 gene locus_tag LOCUS_23810 1890 664 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_23810 3048 1900 gene locus_tag LOCUS_23820 3048 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence296 1684 413 gene locus_tag LOCUS_23830 1684 413 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_23830 3075 1681 gene locus_tag LOCUS_23840 gene thrC 3075 1681 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence297 1981 602 gene locus_tag LOCUS_23850 1981 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2117 2860 gene locus_tag LOCUS_23860 2117 2860 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173811.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence298 <1 1217 gene locus_tag LOCUS_23870 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626057.1:caspase family protein 3094 1343 gene locus_tag LOCUS_23880 3094 1343 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009950383.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence299 822 1781 gene locus_tag LOCUS_23890 822 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1778 1984 gene locus_tag LOCUS_23900 1778 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 <3167 1995 gene locus_tag LOCUS_23910 <3167 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389644.1:anthranilate synthase component I >Feature sequence300 4 1221 gene locus_tag LOCUS_23920 4 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1506 1778 gene locus_tag LOCUS_23930 1506 1778 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_23930 1827 1902 gene locus_tag LOCUS_t00320 1827 1902 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1992 2081 gene locus_tag LOCUS_t00330 1992 2081 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2284 2937 gene locus_tag LOCUS_23940 gene maiA 2284 2937 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence301 1569 526 gene locus_tag LOCUS_23950 1569 526 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 protein_id gnl|my_center|LOCUS_23950 2459 1716 gene locus_tag LOCUS_23960 gene traT 2459 1716 CDS product conjugal transfer complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782438.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence302 269 856 gene locus_tag LOCUS_23970 gene pdxH 269 856 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390377.1 protein_id gnl|my_center|LOCUS_23970 1346 912 gene locus_tag LOCUS_23980 1346 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2105 1671 gene locus_tag LOCUS_23990 2105 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 <3113 2200 gene locus_tag LOCUS_24000 <3113 2200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528006.1:Mrp/NBP35 family ATP-binding protein >Feature sequence303 422 237 gene locus_tag LOCUS_24010 422 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1869 427 gene locus_tag LOCUS_24020 1869 427 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440399.1 protein_id gnl|my_center|LOCUS_24020 <3110 1866 gene locus_tag LOCUS_24030 <3110 1866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966309.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase >Feature sequence304 1408 1484 gene locus_tag LOCUS_t00340 1408 1484 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2231 1998 gene locus_tag LOCUS_24040 2231 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2572 2282 gene locus_tag LOCUS_24050 2572 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence305 2444 1632 gene locus_tag LOCUS_24060 2444 1632 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_24060 2874 2527 gene locus_tag LOCUS_24070 2874 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence306 998 222 gene locus_tag LOCUS_24080 gene hisN 998 222 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_24080 1650 1000 gene locus_tag LOCUS_24090 1650 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 1797 2540 gene locus_tag LOCUS_24100 1797 2540 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence307 509 1051 gene locus_tag LOCUS_24110 509 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 1541 1080 gene locus_tag LOCUS_24120 1541 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2337 1633 gene locus_tag LOCUS_24130 2337 1633 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 protein_id gnl|my_center|LOCUS_24130 2879 2334 gene locus_tag LOCUS_24140 2879 2334 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence308 1238 369 gene locus_tag LOCUS_24150 gene panC 1238 369 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626566.1 protein_id gnl|my_center|LOCUS_24150 2062 1235 gene locus_tag LOCUS_24160 gene panB 2062 1235 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391068.1 protein_id gnl|my_center|LOCUS_24160 2702 2145 gene locus_tag LOCUS_24170 2702 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2903 2709 gene locus_tag LOCUS_24180 2903 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence309 <1 1237 gene locus_tag LOCUS_24190 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256148.1:ATPase domain-containing protein 1256 2377 gene locus_tag LOCUS_24200 1256 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence310 >Feature sequence311 <1 763 gene locus_tag LOCUS_24210 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391186.1:NAD(P)/FAD-dependent oxidoreductase <2999 1023 gene locus_tag LOCUS_24220 <2999 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112435.1:cation-transporting P-type ATPase >Feature sequence312 >Feature sequence313 <1 1493 gene locus_tag LOCUS_24230 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393458.1:xanthine dehydrogenase molybdenum-binding subunit XdhA <2984 1700 gene locus_tag LOCUS_24240 <2984 1700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404491.1:spore maturation protein >Feature sequence314 1509 718 gene locus_tag LOCUS_24250 1509 718 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_24250 2369 1512 gene locus_tag LOCUS_24260 2369 1512 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_24260 2871 2386 gene locus_tag LOCUS_24270 2871 2386 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence315 656 252 gene locus_tag LOCUS_24280 656 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 931 758 gene locus_tag LOCUS_24290 931 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1753 1013 gene locus_tag LOCUS_24300 1753 1013 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_24300 1855 2220 gene locus_tag LOCUS_24310 1855 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence316 665 2578 gene locus_tag LOCUS_24320 665 2578 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389643.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence317 354 632 gene locus_tag LOCUS_24330 gene hupB 354 632 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208639.1 protein_id gnl|my_center|LOCUS_24330 795 2345 gene locus_tag LOCUS_24340 795 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2896 2381 gene locus_tag LOCUS_24350 2896 2381 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967578.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence318 854 471 gene locus_tag LOCUS_24360 854 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2607 1006 gene locus_tag LOCUS_24370 gene pckA 2607 1006 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404573.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence319 995 258 gene locus_tag LOCUS_24380 995 258 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_24380 1315 1788 gene locus_tag LOCUS_24390 1315 1788 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566035.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence320 962 1969 gene locus_tag LOCUS_24400 gene hlyD 962 1969 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389546.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence321 1088 669 gene locus_tag LOCUS_24410 1088 669 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_24410 1411 1256 gene locus_tag LOCUS_24420 1411 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1878 1462 gene locus_tag LOCUS_24430 1878 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence322 1129 791 gene locus_tag LOCUS_24440 gene fliN 1129 791 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388300.1 protein_id gnl|my_center|LOCUS_24440 1986 1171 gene locus_tag LOCUS_24450 1986 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 <2884 1996 gene locus_tag LOCUS_24460 <2884 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388302.1:flagellar motor switch protein FliG >Feature sequence323 1458 811 gene locus_tag LOCUS_24470 1458 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2582 1470 gene locus_tag LOCUS_24480 2582 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence324 303 55 gene locus_tag LOCUS_24490 303 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2199 619 gene locus_tag LOCUS_24500 2199 619 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328096.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence325 202 372 gene locus_tag LOCUS_24510 202 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 380 1237 gene locus_tag LOCUS_24520 380 1237 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence326 <1 889 gene locus_tag LOCUS_24530 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444621.1:circadian clock protein KaiC 886 1194 gene locus_tag LOCUS_24540 886 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1208 2245 gene locus_tag LOCUS_24550 1208 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence327 947 1183 gene locus_tag LOCUS_24560 947 1183 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_24560 2057 1383 gene locus_tag LOCUS_24570 2057 1383 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_24570 <2840 2054 gene locus_tag LOCUS_24580 <2840 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011216362.1:O-acetylserine/cysteine exporter >Feature sequence328 1281 487 gene locus_tag LOCUS_24590 1281 487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_24590 2837 1443 gene locus_tag LOCUS_24600 2837 1443 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence329 >Feature sequence330 549 220 gene locus_tag LOCUS_24610 549 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 925 542 gene locus_tag LOCUS_24620 925 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1211 915 gene locus_tag LOCUS_24630 1211 915 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920916.1 protein_id gnl|my_center|LOCUS_24630 2625 1291 gene locus_tag LOCUS_24640 2625 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence331 <1 2364 gene locus_tag LOCUS_24650 <1 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389786.1:ATP-binding protein >Feature sequence332 1842 559 gene locus_tag LOCUS_24660 gene murA 1842 559 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390681.1 protein_id gnl|my_center|LOCUS_24660 <2750 1853 gene locus_tag LOCUS_24670 <2750 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192666.1:dCTP deaminase >Feature sequence333 2 895 gene locus_tag LOCUS_24680 2 895 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975705.1 protein_id gnl|my_center|LOCUS_24680 1022 2215 gene locus_tag LOCUS_24690 1022 2215 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 protein_id gnl|my_center|LOCUS_24690 <2749 2231 gene locus_tag LOCUS_24700 <2749 2231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390306.1:class I SAM-dependent methyltransferase >Feature sequence334 1983 1910 gene locus_tag LOCUS_t00350 1983 1910 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2132 2056 gene locus_tag LOCUS_t00360 2132 2056 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2218 2144 gene locus_tag LOCUS_t00370 2218 2144 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence335 1631 978 gene locus_tag LOCUS_24710 1631 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2251 1730 gene locus_tag LOCUS_24720 2251 1730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence336 881 108 gene locus_tag LOCUS_24730 gene fabI 881 108 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_24730 <2698 981 gene locus_tag LOCUS_24740 <2698 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390528.1:DEAD/DEAH box helicase >Feature sequence337 1931 1131 gene locus_tag LOCUS_24750 1931 1131 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_24750 2512 1943 gene locus_tag LOCUS_24760 gene efp 2512 1943 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence338 2539 1781 gene locus_tag LOCUS_24770 2539 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence339 322 471 gene locus_tag LOCUS_24780 322 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 912 478 gene locus_tag LOCUS_24790 912 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1296 922 gene locus_tag LOCUS_24800 1296 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2473 1421 gene locus_tag LOCUS_24810 2473 1421 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence340 <1 627 gene locus_tag LOCUS_24820 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720843.1:formate--tetrahydrofolate ligase 711 1718 gene locus_tag LOCUS_24830 711 1718 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence341 211 1374 gene locus_tag LOCUS_24840 211 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1384 2052 gene locus_tag LOCUS_24850 1384 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence342 1694 264 gene locus_tag LOCUS_24860 1694 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1940 2269 gene locus_tag LOCUS_24870 1940 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence343 <2620 1311 gene locus_tag LOCUS_24880 <2620 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389476.1:glutamate--tRNA ligase >Feature sequence344 <2615 193 gene locus_tag LOCUS_24890 <2615 193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193385014.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence345 3 236 gene locus_tag LOCUS_24900 3 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 265 2058 gene locus_tag LOCUS_24910 265 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence346 2324 2407 gene locus_tag LOCUS_t00380 2324 2407 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence347 159 692 gene locus_tag LOCUS_24920 159 692 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_24920 1773 706 gene locus_tag LOCUS_24930 1773 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 2179 1760 gene locus_tag LOCUS_24940 2179 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence348 87 1427 gene locus_tag LOCUS_24950 87 1427 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_24950 1424 2215 gene locus_tag LOCUS_24960 1424 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2247 2534 gene locus_tag LOCUS_24970 2247 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence349 131 1030 gene locus_tag LOCUS_24980 gene fabD 131 1030 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_24980 1048 1785 gene locus_tag LOCUS_24990 gene fabG 1048 1785 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388175.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence350 >Feature sequence351 1568 774 gene locus_tag LOCUS_25000 gene ccsA 1568 774 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626222.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence352 411 665 gene locus_tag LOCUS_25010 411 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 672 1994 gene locus_tag LOCUS_25020 672 1994 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625924.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence353 199 1029 gene locus_tag LOCUS_25030 gene kdsA 199 1029 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389639.1 protein_id gnl|my_center|LOCUS_25030 1047 2330 gene locus_tag LOCUS_25040 gene eno 1047 2330 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence354 481 263 gene locus_tag LOCUS_25050 481 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1052 516 gene locus_tag LOCUS_25060 1052 516 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220370.1 protein_id gnl|my_center|LOCUS_25060 1963 1100 gene locus_tag LOCUS_25070 1963 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence355 820 71 gene locus_tag LOCUS_25080 820 71 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_25080 1134 1619 gene locus_tag LOCUS_25090 1134 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 1609 2025 gene locus_tag LOCUS_25100 1609 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence356 249 1916 gene locus_tag LOCUS_25110 249 1916 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence357 >Feature sequence358 43 432 gene locus_tag LOCUS_25120 43 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 416 1591 gene locus_tag LOCUS_25130 416 1591 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393422.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence359 1468 758 gene locus_tag LOCUS_25140 1468 758 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 protein_id gnl|my_center|LOCUS_25140 1994 1515 gene locus_tag LOCUS_25150 1994 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence360 88 13 gene locus_tag LOCUS_t00390 88 13 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 518 177 gene locus_tag LOCUS_25160 518 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2395 593 gene locus_tag LOCUS_25170 gene recJ 2395 593 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence361 97 390 gene locus_tag LOCUS_25180 97 390 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938667.1 protein_id gnl|my_center|LOCUS_25180 397 705 gene locus_tag LOCUS_25190 397 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1941 748 gene locus_tag LOCUS_25200 1941 748 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 protein_id gnl|my_center|LOCUS_25200 <2416 1916 gene locus_tag LOCUS_25210 <2416 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966415.1:glycosyltransferase family 1 protein >Feature sequence362 591 1067 gene locus_tag LOCUS_25220 591 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence363 <1 629 gene locus_tag LOCUS_25230 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106006557.1:thiamine phosphate synthase 697 2397 gene locus_tag LOCUS_25240 697 2397 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence364 828 385 gene locus_tag LOCUS_25250 gene rbfA 828 385 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 protein_id gnl|my_center|LOCUS_25250 <2374 871 gene locus_tag LOCUS_25260 <2374 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626661.1:translation initiation factor IF-2 >Feature sequence365 464 207 gene locus_tag LOCUS_25270 464 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 682 1908 gene locus_tag LOCUS_25280 682 1908 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence366 2103 202 gene locus_tag LOCUS_25290 2103 202 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence367 1738 1274 gene locus_tag LOCUS_25300 1738 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 <2330 1735 gene locus_tag LOCUS_25310 <2330 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388942.1:tRNA (guanosine(37)-N1)-methyltransferase TrmD >Feature sequence368 284 1003 gene locus_tag LOCUS_25320 284 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1000 1827 gene locus_tag LOCUS_25330 1000 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence369 <1 614 gene locus_tag LOCUS_25340 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403127.1:nicotinate phosphoribosyltransferase >Feature sequence370 <1 707 gene locus_tag LOCUS_25350 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971815.1:SPOR domain-containing protein 694 1728 gene locus_tag LOCUS_25360 gene nagZ 694 1728 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence371 378 1046 gene locus_tag LOCUS_25370 gene tsaB 378 1046 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_25370 1043 1516 gene locus_tag LOCUS_25380 gene rimI 1043 1516 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056042.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence372 62 1468 gene locus_tag LOCUS_25390 62 1468 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence373 <2226 895 gene locus_tag LOCUS_25400 <2226 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864485.1:type II CRISPR RNA-guided endonuclease Cas9 >Feature sequence374 1 684 gene locus_tag LOCUS_25410 1 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence375 <2169 1100 gene locus_tag LOCUS_25420 <2169 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384150.1:PQQ-like beta-propeller repeat protein >Feature sequence376 310 588 gene locus_tag LOCUS_25430 310 588 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816743.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence377 151 774 gene locus_tag LOCUS_25440 151 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence378 <1 625 gene locus_tag LOCUS_25450 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114424.1:PhzF family phenazine biosynthesis protein 1394 567 gene locus_tag LOCUS_25460 1394 567 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082680.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence379 >Feature sequence380 501 79 gene locus_tag LOCUS_25470 501 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1504 584 gene locus_tag LOCUS_25480 1504 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence381 250 50 gene locus_tag LOCUS_25490 250 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1125 1715 gene locus_tag LOCUS_25500 1125 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence382 1378 41 gene locus_tag LOCUS_25510 gene fliI 1378 41 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence383 >Feature sequence384 <1 884 gene locus_tag LOCUS_25520 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388939.1:signal recognition particle protein 932 1306 gene locus_tag LOCUS_25530 gene rpsP 932 1306 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388940.1 protein_id gnl|my_center|LOCUS_25530 1349 1903 gene locus_tag LOCUS_25540 gene rimM 1349 1903 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388941.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence385 1158 187 gene locus_tag LOCUS_25550 1158 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1646 1335 gene locus_tag LOCUS_25560 1646 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence386 1286 201 gene locus_tag LOCUS_25570 gene prfA 1286 201 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388508.1 protein_id gnl|my_center|LOCUS_25570 <2046 1283 gene locus_tag LOCUS_25580 <2046 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626014.1:glutamyl-tRNA reductase >Feature sequence387 <1 928 gene locus_tag LOCUS_25590 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390826.1:FAD-binding protein 960 1832 gene locus_tag LOCUS_25600 960 1832 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence388 1367 228 gene locus_tag LOCUS_25610 1367 228 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808460.1 protein_id gnl|my_center|LOCUS_25610 <2027 1428 gene locus_tag LOCUS_25620 <2027 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063859.1:Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB >Feature sequence389 388 1266 gene locus_tag LOCUS_25630 388 1266 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_25630 1382 1308 gene locus_tag LOCUS_t00400 1382 1308 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence390 621 884 gene locus_tag LOCUS_25640 gene hfq 621 884 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence391 1269 883 gene locus_tag LOCUS_25650 1269 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1459 1298 gene locus_tag LOCUS_25660 1459 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence392 478 885 gene locus_tag LOCUS_25670 478 885 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388775.1 protein_id gnl|my_center|LOCUS_25670 1423 1812 gene locus_tag LOCUS_25680 1423 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence393 215 778 gene locus_tag LOCUS_25690 gene pilS 215 778 CDS product type 4a pilus major pilin PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203188.1 protein_id gnl|my_center|LOCUS_25690 784 1248 gene locus_tag LOCUS_25700 784 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700