>Feature sequence01 789 1556 gene locus_tag LOCUS_00010 789 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1655 2797 gene locus_tag LOCUS_00020 1655 2797 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_00020 3550 2915 gene locus_tag LOCUS_00030 gene ribE 3550 2915 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 protein_id gnl|my_center|LOCUS_00030 4661 3552 gene locus_tag LOCUS_00040 gene ribD 4661 3552 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932429.1 protein_id gnl|my_center|LOCUS_00040 6087 4666 gene locus_tag LOCUS_00050 6087 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8022 6100 gene locus_tag LOCUS_00060 gene dxs 8022 6100 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_00060 8282 8049 gene locus_tag LOCUS_00070 8282 8049 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965381.1 protein_id gnl|my_center|LOCUS_00070 9534 8263 gene locus_tag LOCUS_00080 gene xseA 9534 8263 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_00080 11177 9558 gene locus_tag LOCUS_00090 gene nadB 11177 9558 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932248.1 protein_id gnl|my_center|LOCUS_00090 11797 11174 gene locus_tag LOCUS_00100 gene coaE 11797 11174 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173002.1 protein_id gnl|my_center|LOCUS_00100 13399 11831 gene locus_tag LOCUS_00110 gene rny 13399 11831 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_00110 13942 13655 gene locus_tag LOCUS_00120 13942 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14370 14008 gene locus_tag LOCUS_00130 14370 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16778 14400 gene locus_tag LOCUS_00140 gene pheT 16778 14400 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405510.1 protein_id gnl|my_center|LOCUS_00140 17797 16781 gene locus_tag LOCUS_00150 gene pheS 17797 16781 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933784.1 protein_id gnl|my_center|LOCUS_00150 18242 17895 gene locus_tag LOCUS_00160 gene rplT 18242 17895 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933783.1 protein_id gnl|my_center|LOCUS_00160 18453 18265 gene locus_tag LOCUS_00170 gene rpmI 18453 18265 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_00170 19021 18527 gene locus_tag LOCUS_00180 gene infC 19021 18527 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951024.1 protein_id gnl|my_center|LOCUS_00180 21064 19142 gene locus_tag LOCUS_00190 gene thrS 21064 19142 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213295.1 protein_id gnl|my_center|LOCUS_00190 21197 21121 gene locus_tag LOCUS_t00010 21197 21121 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22028 21270 gene locus_tag LOCUS_00200 22028 21270 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957522.1 protein_id gnl|my_center|LOCUS_00200 22479 22000 gene locus_tag LOCUS_00210 22479 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23599 22439 gene locus_tag LOCUS_00220 23599 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24412 23702 gene locus_tag LOCUS_00230 24412 23702 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_00230 25310 24486 gene locus_tag LOCUS_00240 25310 24486 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403704.1 protein_id gnl|my_center|LOCUS_00240 26274 25324 gene locus_tag LOCUS_00250 gene porQ 26274 25324 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714810.1 protein_id gnl|my_center|LOCUS_00250 27308 26346 gene locus_tag LOCUS_00260 27308 26346 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202434.1 protein_id gnl|my_center|LOCUS_00260 28809 27310 gene locus_tag LOCUS_00270 28809 27310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29220 28837 gene locus_tag LOCUS_00280 gene acpS 29220 28837 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873555.1 protein_id gnl|my_center|LOCUS_00280 29906 29217 gene locus_tag LOCUS_00290 29906 29217 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870955.1 protein_id gnl|my_center|LOCUS_00290 30691 29903 gene locus_tag LOCUS_00300 30691 29903 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_00300 30963 30688 gene locus_tag LOCUS_00310 30963 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403268.1 protein_id gnl|my_center|LOCUS_00310 31679 30966 gene locus_tag LOCUS_00320 31679 30966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33057 31687 gene locus_tag LOCUS_00330 gene hslU 33057 31687 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404390.1 protein_id gnl|my_center|LOCUS_00330 33604 33050 gene locus_tag LOCUS_00340 gene hslV 33604 33050 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_00340 35131 33623 gene locus_tag LOCUS_00350 gene rpoN 35131 33623 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_00350 35575 35135 gene locus_tag LOCUS_00360 35575 35135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35849 36976 gene locus_tag LOCUS_00370 gene dprA 35849 36976 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403940.1 protein_id gnl|my_center|LOCUS_00370 37035 38315 gene locus_tag LOCUS_00380 37035 38315 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971885.1 protein_id gnl|my_center|LOCUS_00380 38317 39624 gene locus_tag LOCUS_00390 38317 39624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_00390 39617 41131 gene locus_tag LOCUS_00400 39617 41131 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760594.1 protein_id gnl|my_center|LOCUS_00400 41246 42634 gene locus_tag LOCUS_00410 41246 42634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42642 44678 gene locus_tag LOCUS_00420 gene ligA 42642 44678 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_00420 44675 45019 gene locus_tag LOCUS_00430 44675 45019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 45089 46582 gene locus_tag LOCUS_00440 45089 46582 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_00440 46579 48357 gene locus_tag LOCUS_00450 46579 48357 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403150.1 protein_id gnl|my_center|LOCUS_00450 48341 49222 gene locus_tag LOCUS_00460 48341 49222 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268135.1 protein_id gnl|my_center|LOCUS_00460 49236 51590 gene locus_tag LOCUS_00470 49236 51590 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404269.1 protein_id gnl|my_center|LOCUS_00470 51590 52495 gene locus_tag LOCUS_00480 gene xerD 51590 52495 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932289.1 protein_id gnl|my_center|LOCUS_00480 52516 53157 gene locus_tag LOCUS_00490 gene tmk 52516 53157 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405407.1 protein_id gnl|my_center|LOCUS_00490 53154 54803 gene locus_tag LOCUS_00500 53154 54803 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403544.1 protein_id gnl|my_center|LOCUS_00500 55500 54874 gene locus_tag LOCUS_00510 55500 54874 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_00510 56021 55665 gene locus_tag LOCUS_00520 56021 55665 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_00520 56445 56119 gene locus_tag LOCUS_00530 56445 56119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 56577 57182 gene locus_tag LOCUS_00540 gene purN 56577 57182 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404384.1 protein_id gnl|my_center|LOCUS_00540 57193 58728 gene locus_tag LOCUS_00550 gene purH 57193 58728 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_00550 58744 59769 gene locus_tag LOCUS_00560 58744 59769 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404386.1 protein_id gnl|my_center|LOCUS_00560 59795 60637 gene locus_tag LOCUS_00570 59795 60637 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839060.1 protein_id gnl|my_center|LOCUS_00570 60637 61143 gene locus_tag LOCUS_00580 60637 61143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 61159 62997 gene locus_tag LOCUS_00590 gene mrdA 61159 62997 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932253.1 protein_id gnl|my_center|LOCUS_00590 62994 64226 gene locus_tag LOCUS_00600 gene rodA 62994 64226 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926830.1 protein_id gnl|my_center|LOCUS_00600 64468 65433 gene locus_tag LOCUS_00610 64468 65433 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_00610 65430 66686 gene locus_tag LOCUS_00620 65430 66686 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_00620 66698 67759 gene locus_tag LOCUS_00630 gene waaF 66698 67759 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_00630 67756 68148 gene locus_tag LOCUS_00640 67756 68148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 68253 68507 gene locus_tag LOCUS_00650 68253 68507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 69981 68560 gene locus_tag LOCUS_00660 69981 68560 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_00660 70391 69978 gene locus_tag LOCUS_00670 70391 69978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 71671 70391 gene locus_tag LOCUS_00680 gene hisS 71671 70391 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590826.1 protein_id gnl|my_center|LOCUS_00680 72237 71767 gene locus_tag LOCUS_00690 72237 71767 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926822.1 protein_id gnl|my_center|LOCUS_00690 74799 72280 gene locus_tag LOCUS_00700 74799 72280 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_00700 75446 74961 gene locus_tag LOCUS_00710 75446 74961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 77513 75462 gene locus_tag LOCUS_00720 gene metG 77513 75462 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404304.1 protein_id gnl|my_center|LOCUS_00720 77852 78463 gene locus_tag LOCUS_00730 77852 78463 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_00730 78444 79142 gene locus_tag LOCUS_00740 78444 79142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 79150 79641 gene locus_tag LOCUS_00750 79150 79641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 79694 81880 gene locus_tag LOCUS_00760 79694 81880 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_00760 81908 82729 gene locus_tag LOCUS_00770 81908 82729 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_00770 82730 83347 gene locus_tag LOCUS_00780 82730 83347 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641564.1 protein_id gnl|my_center|LOCUS_00780 83440 84489 gene locus_tag LOCUS_00790 83440 84489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84517 85167 gene locus_tag LOCUS_00800 84517 85167 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_00800 85185 85877 gene locus_tag LOCUS_00810 85185 85877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 85881 87173 gene locus_tag LOCUS_00820 85881 87173 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926922.1 protein_id gnl|my_center|LOCUS_00820 87973 87251 gene locus_tag LOCUS_00830 gene radC 87973 87251 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405057.1 protein_id gnl|my_center|LOCUS_00830 89701 88004 gene locus_tag LOCUS_00840 89701 88004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 90593 89712 gene locus_tag LOCUS_00850 90593 89712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 92137 90596 gene locus_tag LOCUS_00860 gene guaA 92137 90596 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_00860 92598 92221 gene locus_tag LOCUS_00870 gene gcvH 92598 92221 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_00870 93973 92639 gene locus_tag LOCUS_00880 gene accC 93973 92639 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_00880 94507 94013 gene locus_tag LOCUS_00890 gene accB 94507 94013 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_00890 95099 94539 gene locus_tag LOCUS_00900 gene efp 95099 94539 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_00900 95371 96333 gene locus_tag LOCUS_00910 95371 96333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 96333 97355 gene locus_tag LOCUS_00920 96333 97355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 97369 98364 gene locus_tag LOCUS_00930 97369 98364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 98361 100517 gene locus_tag LOCUS_00940 98361 100517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 100614 101798 gene locus_tag LOCUS_00950 gene megL 100614 101798 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_00950 103031 101844 gene locus_tag LOCUS_00960 103031 101844 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903808.1 protein_id gnl|my_center|LOCUS_00960 103374 103565 gene locus_tag LOCUS_00970 gene rpsU 103374 103565 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933577.1 protein_id gnl|my_center|LOCUS_00970 103663 104988 gene locus_tag LOCUS_00980 103663 104988 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 protein_id gnl|my_center|LOCUS_00980 104993 106021 gene locus_tag LOCUS_00990 gene tsaD 104993 106021 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_00990 106008 107006 gene locus_tag LOCUS_01000 gene mltG 106008 107006 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_01000 107058 108713 gene locus_tag LOCUS_01010 107058 108713 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838192.1 protein_id gnl|my_center|LOCUS_01010 108825 109274 gene locus_tag LOCUS_01020 108825 109274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 109849 109370 gene locus_tag LOCUS_01030 109849 109370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 110497 109931 gene locus_tag LOCUS_01040 110497 109931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 111193 110510 gene locus_tag LOCUS_01050 gene deoC 111193 110510 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964853.1 protein_id gnl|my_center|LOCUS_01050 112039 111233 gene locus_tag LOCUS_01060 112039 111233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 112836 112057 gene locus_tag LOCUS_01070 112836 112057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 113695 112904 gene locus_tag LOCUS_01080 113695 112904 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_01080 115527 113692 gene locus_tag LOCUS_01090 115527 113692 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_01090 116386 115538 gene locus_tag LOCUS_01100 116386 115538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 117442 116393 gene locus_tag LOCUS_01110 117442 116393 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_01110 118474 117476 gene locus_tag LOCUS_01120 118474 117476 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_01120 119501 118467 gene locus_tag LOCUS_01130 119501 118467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 120376 119501 gene locus_tag LOCUS_01140 120376 119501 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_01140 121412 120423 gene locus_tag LOCUS_01150 121412 120423 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_01150 122642 121674 gene locus_tag LOCUS_01160 122642 121674 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143760.1 protein_id gnl|my_center|LOCUS_01160 122778 123422 gene locus_tag LOCUS_01170 122778 123422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 123496 123569 gene locus_tag LOCUS_t00020 123496 123569 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 123621 124040 gene locus_tag LOCUS_01180 gene cdd 123621 124040 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_01180 124237 125142 gene locus_tag LOCUS_01190 124237 125142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 125160 126683 gene locus_tag LOCUS_01200 125160 126683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 127208 126738 gene locus_tag LOCUS_01210 127208 126738 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932428.1 protein_id gnl|my_center|LOCUS_01210 127357 128688 gene locus_tag LOCUS_01220 127357 128688 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_01220 128923 129558 gene locus_tag LOCUS_01230 128923 129558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 129548 131257 gene locus_tag LOCUS_01240 129548 131257 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943356.1 protein_id gnl|my_center|LOCUS_01240 131250 131972 gene locus_tag LOCUS_01250 gene hoxU 131250 131972 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_01250 131969 132493 gene locus_tag LOCUS_01260 131969 132493 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_01260 132486 133940 gene locus_tag LOCUS_01270 132486 133940 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_01270 134022 134819 gene locus_tag LOCUS_01280 134022 134819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 134968 137184 gene locus_tag LOCUS_01290 gene glgB 134968 137184 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_01290 139494 137266 gene locus_tag LOCUS_01300 gene pulA 139494 137266 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082389.1 protein_id gnl|my_center|LOCUS_01300 139631 140359 gene locus_tag LOCUS_01310 139631 140359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 140644 140420 gene locus_tag LOCUS_01320 140644 140420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 140603 142144 gene locus_tag LOCUS_01330 140603 142144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 142173 143069 gene locus_tag LOCUS_01340 gene speB 142173 143069 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_01340 144232 143198 gene locus_tag LOCUS_01350 144232 143198 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_01350 144803 144225 gene locus_tag LOCUS_01360 144803 144225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 145994 144831 gene locus_tag LOCUS_01370 145994 144831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 149245 146039 gene locus_tag LOCUS_01380 gene ileS 149245 146039 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932003.1 protein_id gnl|my_center|LOCUS_01380 149490 149257 gene locus_tag LOCUS_01390 149490 149257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 150326 149499 gene locus_tag LOCUS_01400 150326 149499 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_01400 150948 150319 gene locus_tag LOCUS_01410 150948 150319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 151720 150959 gene locus_tag LOCUS_01420 151720 150959 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_01420 151904 152869 gene locus_tag LOCUS_01430 151904 152869 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083014.1 protein_id gnl|my_center|LOCUS_01430 153539 152961 gene locus_tag LOCUS_01440 gene aat 153539 152961 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141036.1 protein_id gnl|my_center|LOCUS_01440 154423 153539 gene locus_tag LOCUS_01450 154423 153539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 154355 154561 gene locus_tag LOCUS_01460 154355 154561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 154659 157127 gene locus_tag LOCUS_01470 gene gyrA 154659 157127 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_01470 157420 157938 gene locus_tag LOCUS_01480 157420 157938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 158009 158419 gene locus_tag LOCUS_01490 158009 158419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 158468 159418 gene locus_tag LOCUS_01500 158468 159418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 159618 160022 gene locus_tag LOCUS_01510 gene mce 159618 160022 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_01510 160046 162061 gene locus_tag LOCUS_01520 gene uvrC 160046 162061 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933467.1 protein_id gnl|my_center|LOCUS_01520 162058 163122 gene locus_tag LOCUS_01530 162058 163122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 165408 163252 gene locus_tag LOCUS_01540 165408 163252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 167277 166333 gene locus_tag LOCUS_01550 gene trxB 167277 166333 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_01550 168265 167309 gene locus_tag LOCUS_01560 gene queG 168265 167309 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_01560 168600 168259 gene locus_tag LOCUS_01570 168600 168259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 169479 168601 gene locus_tag LOCUS_01580 169479 168601 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_01580 169888 169556 gene locus_tag LOCUS_01590 169888 169556 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_01590 170241 171869 gene locus_tag LOCUS_01600 gene bshC 170241 171869 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933222.1 protein_id gnl|my_center|LOCUS_01600 171945 172253 gene locus_tag LOCUS_01610 171945 172253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 173401 172307 gene locus_tag LOCUS_01620 173401 172307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 174069 173404 gene locus_tag LOCUS_01630 174069 173404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 174963 174115 gene locus_tag LOCUS_01640 174963 174115 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933461.1 protein_id gnl|my_center|LOCUS_01640 175230 174970 gene locus_tag LOCUS_01650 175230 174970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 176539 175349 gene locus_tag LOCUS_01660 176539 175349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_01660 177808 176582 gene locus_tag LOCUS_01670 177808 176582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405554.1 protein_id gnl|my_center|LOCUS_01670 178526 177816 gene locus_tag LOCUS_01680 178526 177816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_01680 179852 178539 gene locus_tag LOCUS_01690 179852 178539 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840043.1 protein_id gnl|my_center|LOCUS_01690 181202 179874 gene locus_tag LOCUS_01700 181202 179874 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_01700 182778 181291 gene locus_tag LOCUS_01710 182778 181291 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932670.1 protein_id gnl|my_center|LOCUS_01710 183116 183553 gene locus_tag LOCUS_01720 183116 183553 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023498.1 protein_id gnl|my_center|LOCUS_01720 183611 185548 gene locus_tag LOCUS_01730 gene dnaK 183611 185548 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_01730 185611 185865 gene locus_tag LOCUS_01740 185611 185865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 186484 192948 gene locus_tag LOCUS_01750 186484 192948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 194026 193100 gene locus_tag LOCUS_01760 194026 193100 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_01760 194870 194043 gene locus_tag LOCUS_01770 194870 194043 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_01770 195253 194912 gene locus_tag LOCUS_01780 195253 194912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_01780 196616 195255 gene locus_tag LOCUS_01790 196616 195255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 196871 198286 gene locus_tag LOCUS_01800 196871 198286 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_01800 201094 198425 gene locus_tag LOCUS_01810 201094 198425 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_01810 201292 201849 gene locus_tag LOCUS_01820 201292 201849 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_01820 201846 202688 gene locus_tag LOCUS_01830 gene amrB 201846 202688 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869902.1 protein_id gnl|my_center|LOCUS_01830 202712 203581 gene locus_tag LOCUS_01840 202712 203581 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958357.1 protein_id gnl|my_center|LOCUS_01840 205043 203634 gene locus_tag LOCUS_01850 205043 203634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 205966 205049 gene locus_tag LOCUS_01860 gene porV 205966 205049 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_01860 206989 205985 gene locus_tag LOCUS_01870 206989 205985 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840096.1 protein_id gnl|my_center|LOCUS_01870 208686 207118 gene locus_tag LOCUS_01880 208686 207118 CDS product FlgD immunoglobulin-like domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838502.1 protein_id gnl|my_center|LOCUS_01880 209504 208686 gene locus_tag LOCUS_01890 209504 208686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 210693 209668 gene locus_tag LOCUS_01900 210693 209668 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_01900 211467 210718 gene locus_tag LOCUS_01910 211467 210718 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_01910 212939 211464 gene locus_tag LOCUS_01920 gene gatA 212939 211464 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_01920 213194 212997 gene locus_tag LOCUS_01930 213194 212997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 213924 213205 gene locus_tag LOCUS_01940 gene purQ 213924 213205 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403297.1 protein_id gnl|my_center|LOCUS_01940 214175 213921 gene locus_tag LOCUS_01950 gene purS 214175 213921 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_01950 214976 214185 gene locus_tag LOCUS_01960 gene pssA 214976 214185 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933008.1 protein_id gnl|my_center|LOCUS_01960 215657 215007 gene locus_tag LOCUS_01970 215657 215007 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933279.1 protein_id gnl|my_center|LOCUS_01970 215844 216416 gene locus_tag LOCUS_01980 215844 216416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 216466 217599 gene locus_tag LOCUS_01990 gene lpxB 216466 217599 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_01990 218606 217680 gene locus_tag LOCUS_02000 gene fmt 218606 217680 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404897.1 protein_id gnl|my_center|LOCUS_02000 219175 218615 gene locus_tag LOCUS_02010 gene def 219175 218615 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404043.1 protein_id gnl|my_center|LOCUS_02010 219306 220097 gene locus_tag LOCUS_02020 219306 220097 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391645.1 protein_id gnl|my_center|LOCUS_02020 220252 222189 gene locus_tag LOCUS_02030 220252 222189 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479713.1 protein_id gnl|my_center|LOCUS_02030 223259 222309 gene locus_tag LOCUS_02040 223259 222309 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225563.1 protein_id gnl|my_center|LOCUS_02040 224291 223443 gene locus_tag LOCUS_02050 224291 223443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 224232 224396 gene locus_tag LOCUS_02060 224232 224396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 225092 224772 gene locus_tag LOCUS_02070 225092 224772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 225699 225772 gene locus_tag LOCUS_t00030 225699 225772 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 225836 226084 gene locus_tag LOCUS_02080 225836 226084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 226733 226371 gene locus_tag LOCUS_02090 226733 226371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 227006 233032 gene locus_tag LOCUS_02100 227006 233032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 233128 233664 gene locus_tag LOCUS_02110 233128 233664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 233774 234430 gene locus_tag LOCUS_02120 233774 234430 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 protein_id gnl|my_center|LOCUS_02120 234562 234957 gene locus_tag LOCUS_02130 234562 234957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 234970 237933 gene locus_tag LOCUS_02140 234970 237933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 238223 240007 gene locus_tag LOCUS_02150 238223 240007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 240022 242139 gene locus_tag LOCUS_02160 240022 242139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 242185 244494 gene locus_tag LOCUS_02170 242185 244494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 245549 247795 gene locus_tag LOCUS_02180 245549 247795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 250348 247805 gene locus_tag LOCUS_02190 250348 247805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 250756 252942 gene locus_tag LOCUS_02200 gene katG 250756 252942 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942744.1 protein_id gnl|my_center|LOCUS_02200 255439 253091 gene locus_tag LOCUS_02210 255439 253091 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840170.1 protein_id gnl|my_center|LOCUS_02210 257374 255704 gene locus_tag LOCUS_02220 257374 255704 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_02220 262590 257590 gene locus_tag LOCUS_02230 262590 257590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 264258 262795 gene locus_tag LOCUS_02240 264258 262795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 265576 264266 gene locus_tag LOCUS_02250 265576 264266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 267047 265608 gene locus_tag LOCUS_02260 267047 265608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 269277 267049 gene locus_tag LOCUS_02270 269277 267049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 269887 269312 gene locus_tag LOCUS_02280 269887 269312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 270129 271109 gene locus_tag LOCUS_02290 270129 271109 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_02290 271338 272372 gene locus_tag LOCUS_02300 271338 272372 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_02300 272391 275174 gene locus_tag LOCUS_02310 272391 275174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 275218 278985 gene locus_tag LOCUS_02320 275218 278985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 279004 280023 gene locus_tag LOCUS_02330 279004 280023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 280150 283905 gene locus_tag LOCUS_02340 280150 283905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 285480 284026 gene locus_tag LOCUS_02350 285480 284026 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964550.1 protein_id gnl|my_center|LOCUS_02350 288259 285497 gene locus_tag LOCUS_02360 288259 285497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 288422 288495 gene locus_tag LOCUS_t00040 288422 288495 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 288512 289171 gene locus_tag LOCUS_02370 gene trmH 288512 289171 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_02370 291251 289194 gene locus_tag LOCUS_02380 291251 289194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 293410 291248 gene locus_tag LOCUS_02390 293410 291248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 295135 293564 gene locus_tag LOCUS_02400 295135 293564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 295963 295175 gene locus_tag LOCUS_02410 295963 295175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 295990 296217 gene locus_tag LOCUS_02420 295990 296217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 297517 296204 gene locus_tag LOCUS_02430 297517 296204 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_02430 298674 297559 gene locus_tag LOCUS_02440 298674 297559 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403664.1 protein_id gnl|my_center|LOCUS_02440 299640 298747 gene locus_tag LOCUS_02450 gene folD 299640 298747 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_02450 300370 299618 gene locus_tag LOCUS_02460 300370 299618 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932049.1 protein_id gnl|my_center|LOCUS_02460 300587 301195 gene locus_tag LOCUS_02470 300587 301195 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_02470 301257 301331 gene locus_tag LOCUS_t00050 301257 301331 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 303273 301417 gene locus_tag LOCUS_02480 303273 301417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 304524 303406 gene locus_tag LOCUS_02490 304524 303406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 307796 304524 gene locus_tag LOCUS_02500 307796 304524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 310817 307848 gene locus_tag LOCUS_02510 310817 307848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 311381 313162 gene locus_tag LOCUS_02520 311381 313162 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_02520 313159 313611 gene locus_tag LOCUS_02530 313159 313611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 313608 313895 gene locus_tag LOCUS_02540 313608 313895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 313898 314827 gene locus_tag LOCUS_02550 313898 314827 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249945.1 protein_id gnl|my_center|LOCUS_02550 315802 314909 gene locus_tag LOCUS_02560 315802 314909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 315978 316958 gene locus_tag LOCUS_02570 315978 316958 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_02570 318178 317075 gene locus_tag LOCUS_02580 gene mnmA 318178 317075 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_02580 318299 319024 gene locus_tag LOCUS_02590 gene cruD 318299 319024 CDS product hydroxychlorobactene glucoside lauroyltransferase CruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932647.1 protein_id gnl|my_center|LOCUS_02590 320354 318990 gene locus_tag LOCUS_02600 gene hpnE 320354 318990 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_02600 321211 320351 gene locus_tag LOCUS_02610 gene hpnD 321211 320351 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225224.1 protein_id gnl|my_center|LOCUS_02610 322061 321204 gene locus_tag LOCUS_02620 gene hpnC 322061 321204 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_02620 323148 322213 gene locus_tag LOCUS_02630 gene cysK 323148 322213 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_02630 324106 323174 gene locus_tag LOCUS_02640 324106 323174 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_02640 324321 325112 gene locus_tag LOCUS_02650 324321 325112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 326370 325189 gene locus_tag LOCUS_02660 326370 325189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 326469 327761 gene locus_tag LOCUS_02670 326469 327761 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886737.1 protein_id gnl|my_center|LOCUS_02670 328044 327793 gene locus_tag LOCUS_02680 328044 327793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 328248 328766 gene locus_tag LOCUS_02690 328248 328766 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021795.1 protein_id gnl|my_center|LOCUS_02690 328854 331076 gene locus_tag LOCUS_02700 328854 331076 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421613.1 protein_id gnl|my_center|LOCUS_02700 331078 331932 gene locus_tag LOCUS_02710 331078 331932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 332043 332633 gene locus_tag LOCUS_02720 332043 332633 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_02720 332645 334117 gene locus_tag LOCUS_02730 332645 334117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 334208 335461 gene locus_tag LOCUS_02740 334208 335461 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583648.1 protein_id gnl|my_center|LOCUS_02740 335525 336313 gene locus_tag LOCUS_02750 335525 336313 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_02750 336328 337359 gene locus_tag LOCUS_02760 336328 337359 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 protein_id gnl|my_center|LOCUS_02760 339810 337393 gene locus_tag LOCUS_02770 339810 337393 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792370.1 protein_id gnl|my_center|LOCUS_02770 343205 339975 gene locus_tag LOCUS_02780 343205 339975 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_02780 344310 343237 gene locus_tag LOCUS_02790 344310 343237 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838489.1 protein_id gnl|my_center|LOCUS_02790 345678 344335 gene locus_tag LOCUS_02800 345678 344335 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926923.1 protein_id gnl|my_center|LOCUS_02800 346412 345711 gene locus_tag LOCUS_02810 346412 345711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 347057 346611 gene locus_tag LOCUS_02820 347057 346611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 347207 347659 gene locus_tag LOCUS_02830 347207 347659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 347656 348633 gene locus_tag LOCUS_02840 347656 348633 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965021.1 protein_id gnl|my_center|LOCUS_02840 349633 348707 gene locus_tag LOCUS_02850 349633 348707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 349709 350482 gene locus_tag LOCUS_02860 349709 350482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904043.1 protein_id gnl|my_center|LOCUS_02860 350586 351368 gene locus_tag LOCUS_02870 350586 351368 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_02870 351365 352471 gene locus_tag LOCUS_02880 351365 352471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 352547 353386 gene locus_tag LOCUS_02890 352547 353386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 354416 353409 gene locus_tag LOCUS_02900 354416 353409 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403765.1 protein_id gnl|my_center|LOCUS_02900 356174 354426 gene locus_tag LOCUS_02910 356174 354426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_02910 356927 356175 gene locus_tag LOCUS_02920 356927 356175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 358304 357015 gene locus_tag LOCUS_02930 gene serS 358304 357015 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932293.1 protein_id gnl|my_center|LOCUS_02930 359267 358326 gene locus_tag LOCUS_02940 gene rfbD 359267 358326 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_02940 360202 359264 gene locus_tag LOCUS_02950 360202 359264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 361263 360199 gene locus_tag LOCUS_02960 361263 360199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 362006 361260 gene locus_tag LOCUS_02970 362006 361260 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_02970 362818 362003 gene locus_tag LOCUS_02980 362818 362003 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_02980 363386 362880 gene locus_tag LOCUS_02990 363386 362880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 364570 363458 gene locus_tag LOCUS_03000 gene hppD 364570 363458 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_03000 365441 365010 gene locus_tag LOCUS_03010 365441 365010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 366211 365570 gene locus_tag LOCUS_03020 366211 365570 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_03020 368521 366449 gene locus_tag LOCUS_03030 368521 366449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 371253 368638 gene locus_tag LOCUS_03040 371253 368638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 373213 371408 gene locus_tag LOCUS_03050 373213 371408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 373487 374530 gene locus_tag LOCUS_03060 373487 374530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 374995 375204 gene locus_tag LOCUS_03070 374995 375204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 380192 375402 gene locus_tag LOCUS_03080 380192 375402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 381609 380359 gene locus_tag LOCUS_03090 381609 380359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 383125 381674 gene locus_tag LOCUS_03100 383125 381674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 >Feature sequence02 <1 543 gene locus_tag LOCUS_03110 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943147.1:glycosyltransferase family 2 protein 1285 596 gene locus_tag LOCUS_03120 1285 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 1467 2888 gene locus_tag LOCUS_03130 1467 2888 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_03130 2908 3882 gene locus_tag LOCUS_03140 2908 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4247 5185 gene locus_tag LOCUS_03150 4247 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 7012 5300 gene locus_tag LOCUS_03160 7012 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7200 10814 gene locus_tag LOCUS_03170 7200 10814 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403927.1 protein_id gnl|my_center|LOCUS_03170 10816 12216 gene locus_tag LOCUS_03180 10816 12216 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257994.1 protein_id gnl|my_center|LOCUS_03180 12382 14223 gene locus_tag LOCUS_03190 gene typA 12382 14223 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_03190 14295 16616 gene locus_tag LOCUS_03200 14295 16616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 16616 17452 gene locus_tag LOCUS_03210 16616 17452 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_03210 17469 18878 gene locus_tag LOCUS_03220 17469 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 20268 18952 gene locus_tag LOCUS_03230 20268 18952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037603.1 protein_id gnl|my_center|LOCUS_03230 20344 20568 gene locus_tag LOCUS_03240 20344 20568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 20561 21661 gene locus_tag LOCUS_03250 gene ugpC 20561 21661 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583259.1 protein_id gnl|my_center|LOCUS_03250 21904 25155 gene locus_tag LOCUS_03260 21904 25155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 26290 25163 gene locus_tag LOCUS_03270 26290 25163 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_03270 26456 29491 gene locus_tag LOCUS_03280 26456 29491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 29621 30085 gene locus_tag LOCUS_03290 29621 30085 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_03290 30451 30086 gene locus_tag LOCUS_03300 30451 30086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 30592 31155 gene locus_tag LOCUS_03310 gene rpoE 30592 31155 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_03310 31152 31706 gene locus_tag LOCUS_03320 31152 31706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 31847 33832 gene locus_tag LOCUS_03330 31847 33832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 36111 33826 gene locus_tag LOCUS_03340 gene pbpC 36111 33826 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014751.1 protein_id gnl|my_center|LOCUS_03340 41613 36163 gene locus_tag LOCUS_03350 41613 36163 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391582.1 protein_id gnl|my_center|LOCUS_03350 43638 41752 gene locus_tag LOCUS_03360 43638 41752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 43951 43709 gene locus_tag LOCUS_03370 43951 43709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 47403 44134 gene locus_tag LOCUS_03380 47403 44134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_03380 47546 48226 gene locus_tag LOCUS_03390 47546 48226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 49718 48324 gene locus_tag LOCUS_03400 49718 48324 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_03400 51234 49741 gene locus_tag LOCUS_03410 51234 49741 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_03410 51653 52327 gene locus_tag LOCUS_03420 51653 52327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 52378 53283 gene locus_tag LOCUS_03430 52378 53283 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_03430 53294 54511 gene locus_tag LOCUS_03440 gene hybB 53294 54511 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941443.1 protein_id gnl|my_center|LOCUS_03440 54550 55332 gene locus_tag LOCUS_03450 54550 55332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 55411 57018 gene locus_tag LOCUS_03460 55411 57018 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_03460 57015 58382 gene locus_tag LOCUS_03470 57015 58382 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_03470 58393 58926 gene locus_tag LOCUS_03480 58393 58926 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_03480 58984 60342 gene locus_tag LOCUS_03490 58984 60342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 60503 61147 gene locus_tag LOCUS_03500 60503 61147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 61144 62445 gene locus_tag LOCUS_03510 61144 62445 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202896.1 protein_id gnl|my_center|LOCUS_03510 62459 63352 gene locus_tag LOCUS_03520 62459 63352 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107324.1 protein_id gnl|my_center|LOCUS_03520 63349 64281 gene locus_tag LOCUS_03530 63349 64281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393401.1 protein_id gnl|my_center|LOCUS_03530 64271 65065 gene locus_tag LOCUS_03540 64271 65065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 65062 66165 gene locus_tag LOCUS_03550 65062 66165 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_03550 66199 67323 gene locus_tag LOCUS_03560 66199 67323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_03560 69767 67509 gene locus_tag LOCUS_03570 69767 67509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 69907 70551 gene locus_tag LOCUS_03580 69907 70551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 72156 70591 gene locus_tag LOCUS_03590 72156 70591 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_03590 72650 72312 gene locus_tag LOCUS_03600 72650 72312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 73397 72666 gene locus_tag LOCUS_03610 73397 72666 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403628.1 protein_id gnl|my_center|LOCUS_03610 73584 74126 gene locus_tag LOCUS_03620 73584 74126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 74194 76716 gene locus_tag LOCUS_03630 74194 76716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 77008 78861 gene locus_tag LOCUS_03640 77008 78861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 83008 78941 gene locus_tag LOCUS_03650 83008 78941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 84130 83066 gene locus_tag LOCUS_03660 84130 83066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 85006 86856 gene locus_tag LOCUS_03670 85006 86856 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953509.1 protein_id gnl|my_center|LOCUS_03670 87267 90254 gene locus_tag LOCUS_03680 87267 90254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 91290 90418 gene locus_tag LOCUS_03690 91290 90418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 93151 91514 gene locus_tag LOCUS_03700 93151 91514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 93918 93151 gene locus_tag LOCUS_03710 93918 93151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_03710 95707 93929 gene locus_tag LOCUS_03720 95707 93929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 95939 96949 gene locus_tag LOCUS_03730 95939 96949 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_03730 96946 97767 gene locus_tag LOCUS_03740 96946 97767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_03740 97771 98586 gene locus_tag LOCUS_03750 97771 98586 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392445.1 protein_id gnl|my_center|LOCUS_03750 98981 98577 gene locus_tag LOCUS_03760 98981 98577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 99105 102374 gene locus_tag LOCUS_03770 99105 102374 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_03770 102593 104674 gene locus_tag LOCUS_03780 102593 104674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 104695 107826 gene locus_tag LOCUS_03790 104695 107826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 107874 108356 gene locus_tag LOCUS_03800 107874 108356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 108367 111531 gene locus_tag LOCUS_03810 108367 111531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 111541 113010 gene locus_tag LOCUS_03820 111541 113010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 113011 115854 gene locus_tag LOCUS_03830 113011 115854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 115875 116858 gene locus_tag LOCUS_03840 115875 116858 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_03840 116882 117940 gene locus_tag LOCUS_03850 116882 117940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 119384 118122 gene locus_tag LOCUS_03860 119384 118122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 121522 119441 gene locus_tag LOCUS_03870 gene ppk1 121522 119441 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370393.1 protein_id gnl|my_center|LOCUS_03870 122036 121542 gene locus_tag LOCUS_03880 122036 121542 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_03880 122965 122051 gene locus_tag LOCUS_03890 122965 122051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 123103 125742 gene locus_tag LOCUS_03900 123103 125742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 128192 125823 gene locus_tag LOCUS_03910 128192 125823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 128693 128214 gene locus_tag LOCUS_03920 128693 128214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 129137 128796 gene locus_tag LOCUS_03930 129137 128796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 129342 130121 gene locus_tag LOCUS_03940 gene folE 129342 130121 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_03940 131194 130193 gene locus_tag LOCUS_03950 131194 130193 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933585.1 protein_id gnl|my_center|LOCUS_03950 134510 131265 gene locus_tag LOCUS_03960 134510 131265 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838071.1 protein_id gnl|my_center|LOCUS_03960 134644 136374 gene locus_tag LOCUS_03970 134644 136374 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_03970 136533 137453 gene locus_tag LOCUS_03980 136533 137453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 137453 138283 gene locus_tag LOCUS_03990 137453 138283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 138454 140052 gene locus_tag LOCUS_04000 138454 140052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 140195 140611 gene locus_tag LOCUS_04010 140195 140611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 142334 140592 gene locus_tag LOCUS_04020 142334 140592 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404191.1 protein_id gnl|my_center|LOCUS_04020 143030 142374 gene locus_tag LOCUS_04030 143030 142374 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932277.1 protein_id gnl|my_center|LOCUS_04030 144048 143056 gene locus_tag LOCUS_04040 gene pdxA 144048 143056 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760044.1 protein_id gnl|my_center|LOCUS_04040 145417 144053 gene locus_tag LOCUS_04050 145417 144053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 147392 145410 gene locus_tag LOCUS_04060 gene gyrB 147392 145410 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933913.1 protein_id gnl|my_center|LOCUS_04060 148812 147418 gene locus_tag LOCUS_04070 gene mnmE 148812 147418 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_04070 149102 148809 gene locus_tag LOCUS_04080 149102 148809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 150235 149099 gene locus_tag LOCUS_04090 150235 149099 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402853.1 protein_id gnl|my_center|LOCUS_04090 151365 150238 gene locus_tag LOCUS_04100 gene dnaN 151365 150238 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402793.1 protein_id gnl|my_center|LOCUS_04100 153199 151601 gene locus_tag LOCUS_04110 153199 151601 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933910.1 protein_id gnl|my_center|LOCUS_04110 154906 153299 gene locus_tag LOCUS_04120 154906 153299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 155418 154903 gene locus_tag LOCUS_04130 155418 154903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 156073 155456 gene locus_tag LOCUS_04140 156073 155456 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761607.1 protein_id gnl|my_center|LOCUS_04140 156510 156070 gene locus_tag LOCUS_04150 156510 156070 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933657.1 protein_id gnl|my_center|LOCUS_04150 156815 157279 gene locus_tag LOCUS_04160 156815 157279 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920750.1 protein_id gnl|my_center|LOCUS_04160 161660 157422 gene locus_tag LOCUS_04170 161660 157422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 162066 162521 gene locus_tag LOCUS_04180 162066 162521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 163196 162591 gene locus_tag LOCUS_04190 163196 162591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 164083 163208 gene locus_tag LOCUS_04200 gene nadC 164083 163208 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_04200 164652 164080 gene locus_tag LOCUS_04210 164652 164080 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_04210 165480 164668 gene locus_tag LOCUS_04220 165480 164668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 167172 165571 gene locus_tag LOCUS_04230 167172 165571 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_04230 168188 167364 gene locus_tag LOCUS_04240 168188 167364 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_04240 168979 168257 gene locus_tag LOCUS_04250 168979 168257 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_04250 169997 168993 gene locus_tag LOCUS_04260 169997 168993 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_04260 170153 171229 gene locus_tag LOCUS_04270 gene rlmN 170153 171229 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404854.1 protein_id gnl|my_center|LOCUS_04270 171329 171883 gene locus_tag LOCUS_04280 171329 171883 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222620.1 protein_id gnl|my_center|LOCUS_04280 171890 172813 gene locus_tag LOCUS_04290 171890 172813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 172825 173943 gene locus_tag LOCUS_04300 172825 173943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 174977 173925 gene locus_tag LOCUS_04310 174977 173925 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097654226.1 protein_id gnl|my_center|LOCUS_04310 175114 176679 gene locus_tag LOCUS_04320 175114 176679 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_04320 176689 177177 gene locus_tag LOCUS_04330 176689 177177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 177174 177866 gene locus_tag LOCUS_04340 gene tsaB 177174 177866 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403908.1 protein_id gnl|my_center|LOCUS_04340 177886 178734 gene locus_tag LOCUS_04350 gene accD 177886 178734 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933219.1 protein_id gnl|my_center|LOCUS_04350 178739 179590 gene locus_tag LOCUS_04360 gene panC 178739 179590 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_04360 179599 179955 gene locus_tag LOCUS_04370 179599 179955 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404162.1 protein_id gnl|my_center|LOCUS_04370 179985 180713 gene locus_tag LOCUS_04380 179985 180713 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931943.1 protein_id gnl|my_center|LOCUS_04380 180734 181372 gene locus_tag LOCUS_04390 180734 181372 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_04390 181739 181443 gene locus_tag LOCUS_04400 181739 181443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 183153 181741 gene locus_tag LOCUS_04410 183153 181741 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_04410 185403 183166 gene locus_tag LOCUS_04420 185403 183166 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_04420 185464 186708 gene locus_tag LOCUS_04430 185464 186708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223514.1 protein_id gnl|my_center|LOCUS_04430 188180 186795 gene locus_tag LOCUS_04440 188180 186795 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_04440 189152 188523 gene locus_tag LOCUS_04450 189152 188523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 189841 189185 gene locus_tag LOCUS_04460 189841 189185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 190613 189891 gene locus_tag LOCUS_04470 190613 189891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 190975 192894 gene locus_tag LOCUS_04480 190975 192894 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_04480 193661 193035 gene locus_tag LOCUS_04490 193661 193035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 194950 193823 gene locus_tag LOCUS_04500 gene orr 194950 193823 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226178.1 protein_id gnl|my_center|LOCUS_04500 195400 194960 gene locus_tag LOCUS_04510 195400 194960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 197291 195936 gene locus_tag LOCUS_04520 197291 195936 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297122.1 protein_id gnl|my_center|LOCUS_04520 198188 197370 gene locus_tag LOCUS_04530 198188 197370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 198530 203281 gene locus_tag LOCUS_04540 198530 203281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 203293 204057 gene locus_tag LOCUS_04550 203293 204057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 204482 204198 gene locus_tag LOCUS_04560 204482 204198 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_04560 206774 204540 gene locus_tag LOCUS_04570 206774 204540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 207444 206782 gene locus_tag LOCUS_04580 207444 206782 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_04580 207438 207671 gene locus_tag LOCUS_04590 207438 207671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 209423 207735 gene locus_tag LOCUS_04600 209423 207735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 211260 209980 gene locus_tag LOCUS_04610 211260 209980 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403893.1 protein_id gnl|my_center|LOCUS_04610 212440 211292 gene locus_tag LOCUS_04620 gene metK 212440 211292 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932404.1 protein_id gnl|my_center|LOCUS_04620 212439 212864 gene locus_tag LOCUS_04630 212439 212864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 212861 213034 gene locus_tag LOCUS_04640 212861 213034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 213025 213100 gene locus_tag LOCUS_t00060 213025 213100 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 213152 215506 gene locus_tag LOCUS_04650 213152 215506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 215511 216335 gene locus_tag LOCUS_04660 215511 216335 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930002.1 protein_id gnl|my_center|LOCUS_04660 216441 216962 gene locus_tag LOCUS_04670 216441 216962 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_04670 216990 217292 gene locus_tag LOCUS_04680 gene nuoK 216990 217292 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_04680 217396 219330 gene locus_tag LOCUS_04690 gene nuoL 217396 219330 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_04690 219345 220886 gene locus_tag LOCUS_04700 219345 220886 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_04700 220904 222412 gene locus_tag LOCUS_04710 220904 222412 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_04710 222449 223879 gene locus_tag LOCUS_04720 222449 223879 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_04720 223887 225470 gene locus_tag LOCUS_04730 223887 225470 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_04730 225467 225895 gene locus_tag LOCUS_04740 225467 225895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 227242 226160 gene locus_tag LOCUS_04750 gene ychF 227242 226160 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_04750 228691 227414 gene locus_tag LOCUS_04760 228691 227414 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_04760 228968 229366 gene locus_tag LOCUS_04770 gene mutT 228968 229366 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_04770 229370 230431 gene locus_tag LOCUS_04780 229370 230431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 230451 231080 gene locus_tag LOCUS_04790 230451 231080 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_04790 231083 231910 gene locus_tag LOCUS_04800 231083 231910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726608.1 protein_id gnl|my_center|LOCUS_04800 232006 232461 gene locus_tag LOCUS_04810 gene nusB 232006 232461 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402806.1 protein_id gnl|my_center|LOCUS_04810 232526 233875 gene locus_tag LOCUS_04820 232526 233875 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_04820 234156 235220 gene locus_tag LOCUS_04830 234156 235220 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874921.1 protein_id gnl|my_center|LOCUS_04830 235346 236146 gene locus_tag LOCUS_04840 235346 236146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 236542 238683 gene locus_tag LOCUS_04850 236542 238683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 238794 238868 gene locus_tag LOCUS_t00070 238794 238868 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 239887 239003 gene locus_tag LOCUS_04860 239887 239003 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023031.1 protein_id gnl|my_center|LOCUS_04860 242211 240058 gene locus_tag LOCUS_04870 242211 240058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 243039 242506 gene locus_tag LOCUS_04880 243039 242506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 243619 243155 gene locus_tag LOCUS_04890 243619 243155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 244052 244960 gene locus_tag LOCUS_04900 244052 244960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 245247 246371 gene locus_tag LOCUS_04910 245247 246371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 247653 246571 gene locus_tag LOCUS_04920 247653 246571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 248047 247646 gene locus_tag LOCUS_04930 248047 247646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 248773 248180 gene locus_tag LOCUS_04940 248773 248180 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_04940 249307 248831 gene locus_tag LOCUS_04950 249307 248831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 250316 249387 gene locus_tag LOCUS_04960 250316 249387 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_04960 251055 250504 gene locus_tag LOCUS_04970 251055 250504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 251500 251093 gene locus_tag LOCUS_04980 251500 251093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 252471 251557 gene locus_tag LOCUS_04990 252471 251557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 252572 254638 gene locus_tag LOCUS_05000 252572 254638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 256738 254678 gene locus_tag LOCUS_05010 256738 254678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 262433 256749 gene locus_tag LOCUS_05020 262433 256749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 264244 262532 gene locus_tag LOCUS_05030 264244 262532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 264899 264339 gene locus_tag LOCUS_05040 264899 264339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 265535 264978 gene locus_tag LOCUS_05050 265535 264978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 265691 266221 gene locus_tag LOCUS_05060 265691 266221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 266218 266826 gene locus_tag LOCUS_05070 266218 266826 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_05070 267061 267729 gene locus_tag LOCUS_05080 267061 267729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 267860 270517 gene locus_tag LOCUS_05090 267860 270517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 270627 271265 gene locus_tag LOCUS_05100 gene rpoE 270627 271265 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_05100 271262 272719 gene locus_tag LOCUS_05110 271262 272719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 272713 274341 gene locus_tag LOCUS_05120 272713 274341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 274591 275580 gene locus_tag LOCUS_05130 274591 275580 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082273.1 protein_id gnl|my_center|LOCUS_05130 276880 275699 gene locus_tag LOCUS_05140 276880 275699 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227876.1 protein_id gnl|my_center|LOCUS_05140 280260 277063 gene locus_tag LOCUS_05150 280260 277063 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_05150 285557 280284 gene locus_tag LOCUS_05160 285557 280284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 286427 285792 gene locus_tag LOCUS_05170 gene lexA 286427 285792 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080401.1 protein_id gnl|my_center|LOCUS_05170 286777 288987 gene locus_tag LOCUS_05180 286777 288987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 289129 291057 gene locus_tag LOCUS_05190 gene asnB 289129 291057 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_05190 291082 292146 gene locus_tag LOCUS_05200 291082 292146 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 protein_id gnl|my_center|LOCUS_05200 292240 292521 gene locus_tag LOCUS_05210 292240 292521 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_05210 292538 292843 gene locus_tag LOCUS_05220 292538 292843 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_05220 293841 292906 gene locus_tag LOCUS_05230 293841 292906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 295241 293838 gene locus_tag LOCUS_05240 295241 293838 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931971.1 protein_id gnl|my_center|LOCUS_05240 296453 295290 gene locus_tag LOCUS_05250 296453 295290 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_05250 297772 296474 gene locus_tag LOCUS_05260 gene eno 297772 296474 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_05260 299198 297822 gene locus_tag LOCUS_05270 gene glmM 299198 297822 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_05270 299438 299274 gene locus_tag LOCUS_05280 299438 299274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 299431 301128 gene locus_tag LOCUS_05290 299431 301128 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084504.1 protein_id gnl|my_center|LOCUS_05290 301142 301858 gene locus_tag LOCUS_05300 301142 301858 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_05300 301860 302573 gene locus_tag LOCUS_05310 301860 302573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 303616 302792 gene locus_tag LOCUS_05320 303616 302792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 305052 303616 gene locus_tag LOCUS_05330 gene rlmD 305052 303616 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_05330 306123 305086 gene locus_tag LOCUS_05340 306123 305086 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05340 306658 306125 gene locus_tag LOCUS_05350 306658 306125 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_05350 308067 306667 gene locus_tag LOCUS_05360 gene cysS 308067 306667 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966454.1 protein_id gnl|my_center|LOCUS_05360 309829 308126 gene locus_tag LOCUS_05370 gene recN 309829 308126 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933282.1 protein_id gnl|my_center|LOCUS_05370 310778 309981 gene locus_tag LOCUS_05380 310778 309981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 311126 310788 gene locus_tag LOCUS_05390 gene rplS 311126 310788 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_05390 311915 311172 gene locus_tag LOCUS_05400 gene trmD 311915 311172 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_05400 312432 311905 gene locus_tag LOCUS_05410 gene rimM 312432 311905 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_05410 313080 312466 gene locus_tag LOCUS_05420 313080 312466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 314451 313120 gene locus_tag LOCUS_05430 gene ffh 314451 313120 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404376.1 protein_id gnl|my_center|LOCUS_05430 316353 314698 gene locus_tag LOCUS_05440 316353 314698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 318810 316720 gene locus_tag LOCUS_05450 318810 316720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 320355 319006 gene locus_tag LOCUS_05460 gene mtaB 320355 319006 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_05460 320869 320483 gene locus_tag LOCUS_05470 320869 320483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 322247 321135 gene locus_tag LOCUS_05480 322247 321135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 323249 322506 gene locus_tag LOCUS_05490 323249 322506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 324278 323283 gene locus_tag LOCUS_05500 gene ligD 324278 323283 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227028.1 protein_id gnl|my_center|LOCUS_05500 325575 324271 gene locus_tag LOCUS_05510 325575 324271 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_05510 326191 325568 gene locus_tag LOCUS_05520 326191 325568 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926466.1 protein_id gnl|my_center|LOCUS_05520 332064 326542 gene locus_tag LOCUS_05530 332064 326542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 333026 332631 gene locus_tag LOCUS_05540 333026 332631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 333345 333091 gene locus_tag LOCUS_05550 gene yoeB 333345 333091 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_05550 333593 333342 gene locus_tag LOCUS_05560 333593 333342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 333605 333805 gene locus_tag LOCUS_05570 333605 333805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence03 2523 1258 gene locus_tag LOCUS_05580 2523 1258 CDS product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404810.1 protein_id gnl|my_center|LOCUS_05580 2878 4506 gene locus_tag LOCUS_05590 2878 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4540 6135 gene locus_tag LOCUS_05600 4540 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6259 7347 gene locus_tag LOCUS_05610 gene carA 6259 7347 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_05610 7351 10530 gene locus_tag LOCUS_05620 gene carB 7351 10530 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_05620 10704 12044 gene locus_tag LOCUS_05630 10704 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 12099 13115 gene locus_tag LOCUS_05640 12099 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 13808 13227 gene locus_tag LOCUS_05650 13808 13227 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365733.1 protein_id gnl|my_center|LOCUS_05650 14896 14000 gene locus_tag LOCUS_05660 14896 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 15282 15055 gene locus_tag LOCUS_05670 15282 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 16781 15294 gene locus_tag LOCUS_05680 16781 15294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933032.1 protein_id gnl|my_center|LOCUS_05680 17739 16774 gene locus_tag LOCUS_05690 17739 16774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_05690 19376 17775 gene locus_tag LOCUS_05700 19376 17775 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986790.1 protein_id gnl|my_center|LOCUS_05700 20593 19562 gene locus_tag LOCUS_05710 gene hprK 20593 19562 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839617.1 protein_id gnl|my_center|LOCUS_05710 20954 20658 gene locus_tag LOCUS_05720 20954 20658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 21880 20981 gene locus_tag LOCUS_05730 gene xerC 21880 20981 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_05730 24144 21892 gene locus_tag LOCUS_05740 gene topA 24144 21892 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_05740 24708 24250 gene locus_tag LOCUS_05750 24708 24250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 25300 24836 gene locus_tag LOCUS_05760 25300 24836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 25736 25263 gene locus_tag LOCUS_05770 25736 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 25945 27384 gene locus_tag LOCUS_05780 gene gltX 25945 27384 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435581.1 protein_id gnl|my_center|LOCUS_05780 27388 28314 gene locus_tag LOCUS_05790 27388 28314 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_05790 28311 28898 gene locus_tag LOCUS_05800 gene nadD 28311 28898 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_05800 29900 28902 gene locus_tag LOCUS_05810 29900 28902 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927122.1 protein_id gnl|my_center|LOCUS_05810 31864 30179 gene locus_tag LOCUS_05820 31864 30179 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_05820 32107 33300 gene locus_tag LOCUS_05830 32107 33300 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927123.1 protein_id gnl|my_center|LOCUS_05830 33322 34443 gene locus_tag LOCUS_05840 33322 34443 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_05840 34427 34729 gene locus_tag LOCUS_05850 gene gatC 34427 34729 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 protein_id gnl|my_center|LOCUS_05850 36684 34918 gene locus_tag LOCUS_05860 36684 34918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 36888 37637 gene locus_tag LOCUS_05870 gene kdsB 36888 37637 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_05870 37858 39087 gene locus_tag LOCUS_05880 gene rimO 37858 39087 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_05880 39091 40395 gene locus_tag LOCUS_05890 39091 40395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 42306 40525 gene locus_tag LOCUS_05900 42306 40525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931951.1 protein_id gnl|my_center|LOCUS_05900 42571 43905 gene locus_tag LOCUS_05910 gene ablA 42571 43905 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902142.1 protein_id gnl|my_center|LOCUS_05910 43905 45344 gene locus_tag LOCUS_05920 43905 45344 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_05920 45438 46310 gene locus_tag LOCUS_05930 45438 46310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 47489 46374 gene locus_tag LOCUS_05940 47489 46374 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 protein_id gnl|my_center|LOCUS_05940 48530 47547 gene locus_tag LOCUS_05950 48530 47547 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337406.1 protein_id gnl|my_center|LOCUS_05950 50059 48644 gene locus_tag LOCUS_05960 50059 48644 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460649.1 protein_id gnl|my_center|LOCUS_05960 50151 50360 gene locus_tag LOCUS_05970 50151 50360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 50755 51729 gene locus_tag LOCUS_05980 50755 51729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 51740 52663 gene locus_tag LOCUS_05990 51740 52663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 52660 53691 gene locus_tag LOCUS_06000 gene thiL 52660 53691 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103239.1 protein_id gnl|my_center|LOCUS_06000 53688 54980 gene locus_tag LOCUS_06010 53688 54980 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_06010 55144 56475 gene locus_tag LOCUS_06020 55144 56475 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_06020 57854 56586 gene locus_tag LOCUS_06030 57854 56586 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_06030 59004 58015 gene locus_tag LOCUS_06040 59004 58015 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_06040 59352 59152 gene locus_tag LOCUS_06050 59352 59152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 59242 61218 gene locus_tag LOCUS_06060 59242 61218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 61364 63874 gene locus_tag LOCUS_06070 61364 63874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 63871 64548 gene locus_tag LOCUS_06080 gene phoP 63871 64548 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065226.1 protein_id gnl|my_center|LOCUS_06080 64624 65631 gene locus_tag LOCUS_06090 64624 65631 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_06090 65852 65925 gene locus_tag LOCUS_t00080 65852 65925 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 66366 67373 gene locus_tag LOCUS_06100 gene purM 66366 67373 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404229.1 protein_id gnl|my_center|LOCUS_06100 68321 67425 gene locus_tag LOCUS_06110 68321 67425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 72274 68543 gene locus_tag LOCUS_06120 gene fdhF 72274 68543 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263145.1 protein_id gnl|my_center|LOCUS_06120 74040 72283 gene locus_tag LOCUS_06130 gene nuoF 74040 72283 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_06130 74553 74059 gene locus_tag LOCUS_06140 gene nuoE 74553 74059 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_06140 75059 74565 gene locus_tag LOCUS_06150 75059 74565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 75921 75289 gene locus_tag LOCUS_06160 75921 75289 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_06160 76137 77765 gene locus_tag LOCUS_06170 76137 77765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 78157 78071 gene locus_tag LOCUS_t00090 78157 78071 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 78360 79013 gene locus_tag LOCUS_06180 78360 79013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 79173 79643 gene locus_tag LOCUS_06190 79173 79643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 79618 80103 gene locus_tag LOCUS_06200 79618 80103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 80188 80979 gene locus_tag LOCUS_06210 80188 80979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 81014 81451 gene locus_tag LOCUS_06220 81014 81451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 81866 81540 gene locus_tag LOCUS_06230 81866 81540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 82404 82078 gene locus_tag LOCUS_06240 82404 82078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 83282 82401 gene locus_tag LOCUS_06250 83282 82401 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_06250 84133 83279 gene locus_tag LOCUS_06260 84133 83279 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_06260 84606 84130 gene locus_tag LOCUS_06270 84606 84130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 84870 84945 gene locus_tag LOCUS_t00100 84870 84945 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 85344 86744 gene locus_tag LOCUS_06280 85344 86744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 86741 87538 gene locus_tag LOCUS_06290 86741 87538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 88029 88535 gene locus_tag LOCUS_06300 88029 88535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 89758 90375 gene locus_tag LOCUS_06310 89758 90375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 90372 90542 gene locus_tag LOCUS_06320 90372 90542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 90992 93388 gene locus_tag LOCUS_06330 90992 93388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 94755 93556 gene locus_tag LOCUS_06340 94755 93556 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_06340 95710 95060 gene locus_tag LOCUS_06350 95710 95060 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933408.1 protein_id gnl|my_center|LOCUS_06350 96090 95737 gene locus_tag LOCUS_06360 96090 95737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 96788 96306 gene locus_tag LOCUS_06370 96788 96306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 96880 98007 gene locus_tag LOCUS_06380 96880 98007 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_06380 98179 99225 gene locus_tag LOCUS_06390 98179 99225 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924797.1 protein_id gnl|my_center|LOCUS_06390 99546 100316 gene locus_tag LOCUS_06400 gene etfB 99546 100316 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398765.1 protein_id gnl|my_center|LOCUS_06400 100320 101297 gene locus_tag LOCUS_06410 100320 101297 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_06410 101294 103384 gene locus_tag LOCUS_06420 101294 103384 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_06420 103389 104597 gene locus_tag LOCUS_06430 103389 104597 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_06430 104599 106602 gene locus_tag LOCUS_06440 gene hdrA 104599 106602 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_06440 106625 107158 gene locus_tag LOCUS_06450 106625 107158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 107151 108125 gene locus_tag LOCUS_06460 107151 108125 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_06460 108145 109665 gene locus_tag LOCUS_06470 108145 109665 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_06470 109662 110192 gene locus_tag LOCUS_06480 109662 110192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 111815 110151 gene locus_tag LOCUS_06490 111815 110151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 112672 111956 gene locus_tag LOCUS_06500 112672 111956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 112798 113655 gene locus_tag LOCUS_06510 112798 113655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 113887 113741 gene locus_tag LOCUS_06520 113887 113741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 116062 114056 gene locus_tag LOCUS_06530 116062 114056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 122294 116160 gene locus_tag LOCUS_06540 122294 116160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 123461 122415 gene locus_tag LOCUS_06550 123461 122415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 123655 124818 gene locus_tag LOCUS_06560 123655 124818 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_06560 124843 126315 gene locus_tag LOCUS_06570 gene guaB 124843 126315 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404245.1 protein_id gnl|my_center|LOCUS_06570 126521 127576 gene locus_tag LOCUS_06580 gene papA 126521 127576 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_06580 127573 128961 gene locus_tag LOCUS_06590 127573 128961 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_06590 128958 130241 gene locus_tag LOCUS_06600 gene purD 128958 130241 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704786.1 protein_id gnl|my_center|LOCUS_06600 130276 130662 gene locus_tag LOCUS_06610 130276 130662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 130678 131781 gene locus_tag LOCUS_06620 gene wecB 130678 131781 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776111.1 protein_id gnl|my_center|LOCUS_06620 132445 131936 gene locus_tag LOCUS_06630 132445 131936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 133694 132471 gene locus_tag LOCUS_06640 133694 132471 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266685.1 protein_id gnl|my_center|LOCUS_06640 135058 133694 gene locus_tag LOCUS_06650 135058 133694 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_06650 135273 136421 gene locus_tag LOCUS_06660 135273 136421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 136453 137613 gene locus_tag LOCUS_06670 136453 137613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 137878 139914 gene locus_tag LOCUS_06680 137878 139914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 140159 142225 gene locus_tag LOCUS_06690 140159 142225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 142403 144595 gene locus_tag LOCUS_06700 142403 144595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 145432 144680 gene locus_tag LOCUS_06710 145432 144680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 145975 145442 gene locus_tag LOCUS_06720 145975 145442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 146895 146218 gene locus_tag LOCUS_06730 146895 146218 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_06730 147123 148463 gene locus_tag LOCUS_06740 gene gdhA 147123 148463 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_06740 151576 148520 gene locus_tag LOCUS_06750 151576 148520 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_06750 151850 153193 gene locus_tag LOCUS_06760 gene gdhA 151850 153193 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_06760 156305 153294 gene locus_tag LOCUS_06770 156305 153294 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_06770 157604 156318 gene locus_tag LOCUS_06780 gene gdhA 157604 156318 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_06780 157855 161019 gene locus_tag LOCUS_06790 157855 161019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 161883 161014 gene locus_tag LOCUS_06800 161883 161014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 162522 161884 gene locus_tag LOCUS_06810 162522 161884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 162677 163288 gene locus_tag LOCUS_06820 gene nth 162677 163288 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_06820 164448 163372 gene locus_tag LOCUS_06830 164448 163372 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_06830 165337 164480 gene locus_tag LOCUS_06840 165337 164480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927025.1 protein_id gnl|my_center|LOCUS_06840 167233 165500 gene locus_tag LOCUS_06850 167233 165500 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_06850 168200 167385 gene locus_tag LOCUS_06860 gene zupT 168200 167385 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_06860 169244 168213 gene locus_tag LOCUS_06870 169244 168213 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_06870 170275 169400 gene locus_tag LOCUS_06880 170275 169400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 172568 170286 gene locus_tag LOCUS_06890 172568 170286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 174628 172829 gene locus_tag LOCUS_06900 174628 172829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 176604 174802 gene locus_tag LOCUS_06910 176604 174802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 176842 177516 gene locus_tag LOCUS_06920 176842 177516 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_06920 177553 178245 gene locus_tag LOCUS_06930 177553 178245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 178422 178679 gene locus_tag LOCUS_06940 178422 178679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 178676 178897 gene locus_tag LOCUS_06950 178676 178897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 178925 179296 gene locus_tag LOCUS_06960 178925 179296 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_06960 181279 179357 gene locus_tag LOCUS_06970 181279 179357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 182289 181276 gene locus_tag LOCUS_06980 182289 181276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_06980 182884 182318 gene locus_tag LOCUS_06990 182884 182318 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_06990 183769 183056 gene locus_tag LOCUS_07000 183769 183056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 185222 183963 gene locus_tag LOCUS_07010 gene hutI 185222 183963 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_07010 186998 185226 gene locus_tag LOCUS_07020 gene aspS 186998 185226 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_07020 187229 189460 gene locus_tag LOCUS_07030 187229 189460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 190201 190049 gene locus_tag LOCUS_07040 190201 190049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 190267 193872 gene locus_tag LOCUS_07050 gene nifJ 190267 193872 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_07050 193909 194907 gene locus_tag LOCUS_07060 193909 194907 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_07060 195439 194987 gene locus_tag LOCUS_07070 195439 194987 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_07070 195754 196029 gene locus_tag LOCUS_07080 195754 196029 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_07080 196029 196355 gene locus_tag LOCUS_07090 196029 196355 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_07090 196612 200904 gene locus_tag LOCUS_07100 196612 200904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 201208 204297 gene locus_tag LOCUS_07110 201208 204297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 204368 204925 gene locus_tag LOCUS_07120 204368 204925 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_07120 205690 204992 gene locus_tag LOCUS_07130 gene mtgA 205690 204992 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 protein_id gnl|my_center|LOCUS_07130 205886 206998 gene locus_tag LOCUS_07140 205886 206998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 207264 208508 gene locus_tag LOCUS_07150 gene icd 207264 208508 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_07150 208549 208914 gene locus_tag LOCUS_07160 208549 208914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 208953 210068 gene locus_tag LOCUS_07170 208953 210068 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480624.1 protein_id gnl|my_center|LOCUS_07170 211234 210149 gene locus_tag LOCUS_07180 211234 210149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 212369 211254 gene locus_tag LOCUS_07190 212369 211254 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403619.1 protein_id gnl|my_center|LOCUS_07190 214432 212393 gene locus_tag LOCUS_07200 214432 212393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 214917 214690 gene locus_tag LOCUS_07210 214917 214690 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_07210 215244 215035 gene locus_tag LOCUS_07220 215244 215035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 216524 215244 gene locus_tag LOCUS_07230 216524 215244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 218374 216524 gene locus_tag LOCUS_07240 218374 216524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_07240 219191 218367 gene locus_tag LOCUS_07250 219191 218367 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122210.1 protein_id gnl|my_center|LOCUS_07250 220235 219195 gene locus_tag LOCUS_07260 gene rfaQ 220235 219195 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703803.1 protein_id gnl|my_center|LOCUS_07260 220864 220382 gene locus_tag LOCUS_07270 220864 220382 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060883.1 protein_id gnl|my_center|LOCUS_07270 222658 220886 gene locus_tag LOCUS_07280 222658 220886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 222983 223897 gene locus_tag LOCUS_07290 222983 223897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 224074 224985 gene locus_tag LOCUS_07300 224074 224985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 225035 225814 gene locus_tag LOCUS_07310 225035 225814 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_07310 225819 227348 gene locus_tag LOCUS_07320 225819 227348 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_07320 227459 228142 gene locus_tag LOCUS_07330 227459 228142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 228769 228158 gene locus_tag LOCUS_07340 228769 228158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 229288 228806 gene locus_tag LOCUS_07350 229288 228806 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_07350 229422 230912 gene locus_tag LOCUS_07360 229422 230912 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_07360 231052 233271 gene locus_tag LOCUS_07370 231052 233271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 233360 235549 gene locus_tag LOCUS_07380 233360 235549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 235551 236402 gene locus_tag LOCUS_07390 235551 236402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 236840 236547 gene locus_tag LOCUS_07400 236840 236547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 237853 237038 gene locus_tag LOCUS_07410 237853 237038 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_07410 237980 237906 gene locus_tag LOCUS_t00110 237980 237906 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 238613 238149 gene locus_tag LOCUS_07420 238613 238149 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_07420 238812 238558 gene locus_tag LOCUS_07430 238812 238558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 240808 238865 gene locus_tag LOCUS_07440 240808 238865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 241461 240835 gene locus_tag LOCUS_07450 241461 240835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 245556 244618 gene locus_tag LOCUS_07460 245556 244618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 247975 245549 gene locus_tag LOCUS_07470 247975 245549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 249030 248062 gene locus_tag LOCUS_07480 249030 248062 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_07480 249751 249056 gene locus_tag LOCUS_07490 249751 249056 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_07490 250211 249810 gene locus_tag LOCUS_07500 250211 249810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 251623 250301 gene locus_tag LOCUS_07510 251623 250301 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_07510 252171 253664 gene locus_tag LOCUS_07520 252171 253664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 253957 255105 gene locus_tag LOCUS_07530 253957 255105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_07530 258508 255140 gene locus_tag LOCUS_07540 258508 255140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 260136 258643 gene locus_tag LOCUS_07550 260136 258643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 262189 260138 gene locus_tag LOCUS_07560 262189 260138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 262490 262891 gene locus_tag LOCUS_07570 262490 262891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 262888 264294 gene locus_tag LOCUS_07580 262888 264294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 264405 265151 gene locus_tag LOCUS_07590 264405 265151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 265397 266164 gene locus_tag LOCUS_07600 265397 266164 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_07600 267744 266194 gene locus_tag LOCUS_07610 267744 266194 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404336.1 protein_id gnl|my_center|LOCUS_07610 268168 267872 gene locus_tag LOCUS_07620 268168 267872 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552279.1 protein_id gnl|my_center|LOCUS_07620 268457 270556 gene locus_tag LOCUS_07630 268457 270556 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766152.1 protein_id gnl|my_center|LOCUS_07630 270582 271982 gene locus_tag LOCUS_07640 270582 271982 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_07640 272223 274094 gene locus_tag LOCUS_07650 gene mnmG 272223 274094 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_07650 274227 274541 gene locus_tag LOCUS_07660 274227 274541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 275759 274545 gene locus_tag LOCUS_07670 gene lpxK 275759 274545 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927066.1 protein_id gnl|my_center|LOCUS_07670 276395 275772 gene locus_tag LOCUS_07680 276395 275772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 277197 276403 gene locus_tag LOCUS_07690 277197 276403 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404263.1 protein_id gnl|my_center|LOCUS_07690 277469 277221 gene locus_tag LOCUS_07700 277469 277221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 277711 277487 gene locus_tag LOCUS_07710 277711 277487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 278086 277745 gene locus_tag LOCUS_07720 278086 277745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 279699 278113 gene locus_tag LOCUS_07730 279699 278113 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_07730 279821 282259 gene locus_tag LOCUS_07740 279821 282259 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_07740 282363 283139 gene locus_tag LOCUS_07750 282363 283139 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405283.1 protein_id gnl|my_center|LOCUS_07750 283152 284573 gene locus_tag LOCUS_07760 gene pyk 283152 284573 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_07760 284592 286097 gene locus_tag LOCUS_07770 284592 286097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 286462 288006 gene locus_tag LOCUS_07780 286462 288006 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_07780 288010 288327 gene locus_tag LOCUS_07790 288010 288327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence04 3353 5275 gene locus_tag LOCUS_07800 gene glmS 3353 5275 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838750.1 protein_id gnl|my_center|LOCUS_07800 5368 6306 gene locus_tag LOCUS_07810 gene nadA 5368 6306 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_07810 6365 8788 gene locus_tag LOCUS_07820 6365 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 8866 10812 gene locus_tag LOCUS_07830 8866 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 11649 10855 gene locus_tag LOCUS_07840 11649 10855 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_07840 13086 11689 gene locus_tag LOCUS_07850 gene lpdA 13086 11689 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_07850 13726 13175 gene locus_tag LOCUS_07860 13726 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 14840 13848 gene locus_tag LOCUS_07870 14840 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 15853 14846 gene locus_tag LOCUS_07880 15853 14846 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674020.1 protein_id gnl|my_center|LOCUS_07880 17702 15882 gene locus_tag LOCUS_07890 17702 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 17878 18426 gene locus_tag LOCUS_07900 17878 18426 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838224.1 protein_id gnl|my_center|LOCUS_07900 18432 18938 gene locus_tag LOCUS_07910 18432 18938 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_07910 18946 19446 gene locus_tag LOCUS_07920 18946 19446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 19439 19861 gene locus_tag LOCUS_07930 19439 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 20051 20533 gene locus_tag LOCUS_07940 20051 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 21085 20534 gene locus_tag LOCUS_07950 21085 20534 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_07950 21245 23254 gene locus_tag LOCUS_07960 21245 23254 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 protein_id gnl|my_center|LOCUS_07960 23345 24508 gene locus_tag LOCUS_07970 23345 24508 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_07970 24575 25606 gene locus_tag LOCUS_07980 gene trpX 24575 25606 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 protein_id gnl|my_center|LOCUS_07980 25646 26857 gene locus_tag LOCUS_07990 25646 26857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 26850 27806 gene locus_tag LOCUS_08000 26850 27806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289390.1 protein_id gnl|my_center|LOCUS_08000 27803 28621 gene locus_tag LOCUS_08010 27803 28621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529683.1 protein_id gnl|my_center|LOCUS_08010 28745 29806 gene locus_tag LOCUS_08020 28745 29806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 31917 29797 gene locus_tag LOCUS_08030 31917 29797 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065752.1 protein_id gnl|my_center|LOCUS_08030 32210 35089 gene locus_tag LOCUS_08040 32210 35089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 35500 35180 gene locus_tag LOCUS_08050 35500 35180 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706400.1 protein_id gnl|my_center|LOCUS_08050 35976 35650 gene locus_tag LOCUS_08060 35976 35650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 37500 35989 gene locus_tag LOCUS_08070 37500 35989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 37687 38610 gene locus_tag LOCUS_08080 37687 38610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 38617 39684 gene locus_tag LOCUS_08090 gene amrS 38617 39684 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_08090 40092 39826 gene locus_tag LOCUS_08100 40092 39826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 39976 41364 gene locus_tag LOCUS_08110 39976 41364 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_08110 42239 41502 gene locus_tag LOCUS_08120 42239 41502 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_08120 42403 42819 gene locus_tag LOCUS_08130 gene ndk 42403 42819 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020029.1 protein_id gnl|my_center|LOCUS_08130 44969 42930 gene locus_tag LOCUS_08140 44969 42930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 46079 44970 gene locus_tag LOCUS_08150 46079 44970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 46207 47280 gene locus_tag LOCUS_08160 gene rsgA 46207 47280 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939493.1 protein_id gnl|my_center|LOCUS_08160 47356 48285 gene locus_tag LOCUS_08170 47356 48285 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964929.1 protein_id gnl|my_center|LOCUS_08170 49680 48391 gene locus_tag LOCUS_08180 49680 48391 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_08180 50113 51501 gene locus_tag LOCUS_08190 50113 51501 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297122.1 protein_id gnl|my_center|LOCUS_08190 51626 53959 gene locus_tag LOCUS_08200 51626 53959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 53963 55831 gene locus_tag LOCUS_08210 53963 55831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 55962 56426 gene locus_tag LOCUS_08220 gene ybaK 55962 56426 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_08220 56580 57143 gene locus_tag LOCUS_08230 56580 57143 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249319.1 protein_id gnl|my_center|LOCUS_08230 57140 58432 gene locus_tag LOCUS_08240 57140 58432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 59596 58652 gene locus_tag LOCUS_08250 59596 58652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 60272 59841 gene locus_tag LOCUS_08260 60272 59841 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_08260 61076 60345 gene locus_tag LOCUS_08270 61076 60345 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530149.1 protein_id gnl|my_center|LOCUS_08270 61647 61081 gene locus_tag LOCUS_08280 61647 61081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 61976 61644 gene locus_tag LOCUS_08290 61976 61644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 62761 62186 gene locus_tag LOCUS_08300 62761 62186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 62894 64636 gene locus_tag LOCUS_08310 62894 64636 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839414.1 protein_id gnl|my_center|LOCUS_08310 64915 66453 gene locus_tag LOCUS_08320 64915 66453 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942369.1 protein_id gnl|my_center|LOCUS_08320 66450 69041 gene locus_tag LOCUS_08330 66450 69041 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942370.1 protein_id gnl|my_center|LOCUS_08330 69187 69642 gene locus_tag LOCUS_08340 69187 69642 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_08340 70706 69753 gene locus_tag LOCUS_08350 70706 69753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 71564 70863 gene locus_tag LOCUS_08360 71564 70863 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_08360 72580 71561 gene locus_tag LOCUS_08370 72580 71561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 73822 72698 gene locus_tag LOCUS_08380 gene hemW 73822 72698 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_08380 74821 73826 gene locus_tag LOCUS_08390 gene lepB 74821 73826 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_08390 75680 74823 gene locus_tag LOCUS_08400 gene lepB 75680 74823 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_08400 77662 75863 gene locus_tag LOCUS_08410 gene lepA 77662 75863 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_08410 78199 77741 gene locus_tag LOCUS_08420 78199 77741 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144151.1 protein_id gnl|my_center|LOCUS_08420 78359 78940 gene locus_tag LOCUS_08430 78359 78940 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080866.1 protein_id gnl|my_center|LOCUS_08430 78953 79609 gene locus_tag LOCUS_08440 gene queE 78953 79609 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_08440 79650 80006 gene locus_tag LOCUS_08450 gene queF 79650 80006 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_08450 80009 80710 gene locus_tag LOCUS_08460 gene queC 80009 80710 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_08460 81033 83324 gene locus_tag LOCUS_08470 81033 83324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 83611 86289 gene locus_tag LOCUS_08480 gene aceE 83611 86289 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_08480 86301 87647 gene locus_tag LOCUS_08490 86301 87647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 87871 89289 gene locus_tag LOCUS_08500 gene lpdA 87871 89289 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_08500 91967 89592 gene locus_tag LOCUS_08510 91967 89592 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208599863.1 protein_id gnl|my_center|LOCUS_08510 92872 92156 gene locus_tag LOCUS_08520 gene ric 92872 92156 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_08520 93073 93819 gene locus_tag LOCUS_08530 93073 93819 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_08530 94473 93889 gene locus_tag LOCUS_08540 94473 93889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 95790 94606 gene locus_tag LOCUS_08550 95790 94606 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228989.1 protein_id gnl|my_center|LOCUS_08550 95976 96782 gene locus_tag LOCUS_08560 95976 96782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075435.1 protein_id gnl|my_center|LOCUS_08560 97069 96779 gene locus_tag LOCUS_08570 97069 96779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 96956 97726 gene locus_tag LOCUS_08580 96956 97726 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_08580 97916 99106 gene locus_tag LOCUS_08590 97916 99106 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_08590 99291 100769 gene locus_tag LOCUS_08600 99291 100769 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_08600 100986 101591 gene locus_tag LOCUS_08610 100986 101591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 102963 101650 gene locus_tag LOCUS_08620 102963 101650 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_08620 104094 102982 gene locus_tag LOCUS_08630 104094 102982 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_08630 105233 104133 gene locus_tag LOCUS_08640 105233 104133 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_08640 105493 107049 gene locus_tag LOCUS_08650 105493 107049 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_08650 107058 107459 gene locus_tag LOCUS_08660 107058 107459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 107476 107919 gene locus_tag LOCUS_08670 107476 107919 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_08670 107924 109060 gene locus_tag LOCUS_08680 107924 109060 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789543.1 protein_id gnl|my_center|LOCUS_08680 109406 110113 gene locus_tag LOCUS_08690 109406 110113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 110246 110683 gene locus_tag LOCUS_08700 110246 110683 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 protein_id gnl|my_center|LOCUS_08700 112081 110789 gene locus_tag LOCUS_08710 112081 110789 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404349.1 protein_id gnl|my_center|LOCUS_08710 112913 112143 gene locus_tag LOCUS_08720 112913 112143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 114258 112936 gene locus_tag LOCUS_08730 114258 112936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 114403 114714 gene locus_tag LOCUS_08740 114403 114714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 114732 114989 gene locus_tag LOCUS_08750 gene rpmA 114732 114989 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056021.1 protein_id gnl|my_center|LOCUS_08750 115125 115964 gene locus_tag LOCUS_08760 115125 115964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 116536 119961 gene locus_tag LOCUS_08770 116536 119961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 120105 120701 gene locus_tag LOCUS_08780 120105 120701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 121263 120721 gene locus_tag LOCUS_08790 121263 120721 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_08790 121529 121260 gene locus_tag LOCUS_08800 121529 121260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 121550 124783 gene locus_tag LOCUS_08810 121550 124783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 125065 127047 gene locus_tag LOCUS_08820 125065 127047 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_08820 127816 128331 gene locus_tag LOCUS_08830 127816 128331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 130539 128425 gene locus_tag LOCUS_08840 130539 128425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 130703 130630 gene locus_tag LOCUS_t00120 130703 130630 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 131477 130758 gene locus_tag LOCUS_08850 131477 130758 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_08850 131670 134960 gene locus_tag LOCUS_08860 131670 134960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 135101 141169 gene locus_tag LOCUS_08870 135101 141169 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_08870 142115 141330 gene locus_tag LOCUS_08880 142115 141330 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_08880 142119 142325 gene locus_tag LOCUS_08890 142119 142325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 143129 142224 gene locus_tag LOCUS_08900 143129 142224 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_08900 143967 143395 gene locus_tag LOCUS_08910 143967 143395 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932505.1 protein_id gnl|my_center|LOCUS_08910 144832 144011 gene locus_tag LOCUS_08920 144832 144011 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_08920 145790 144837 gene locus_tag LOCUS_08930 145790 144837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 147161 145821 gene locus_tag LOCUS_08940 147161 145821 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_08940 148133 147168 gene locus_tag LOCUS_08950 148133 147168 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088175.1 protein_id gnl|my_center|LOCUS_08950 149020 148163 gene locus_tag LOCUS_08960 149020 148163 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_08960 149876 149040 gene locus_tag LOCUS_08970 149876 149040 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_08970 150891 149881 gene locus_tag LOCUS_08980 150891 149881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932826.1 protein_id gnl|my_center|LOCUS_08980 151975 150947 gene locus_tag LOCUS_08990 151975 150947 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932827.1 protein_id gnl|my_center|LOCUS_08990 152714 152097 gene locus_tag LOCUS_09000 152714 152097 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_09000 153572 152961 gene locus_tag LOCUS_09010 153572 152961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 154060 153569 gene locus_tag LOCUS_09020 154060 153569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 155542 154193 gene locus_tag LOCUS_09030 155542 154193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 157775 155649 gene locus_tag LOCUS_09040 157775 155649 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_09040 157662 158213 gene locus_tag LOCUS_09050 157662 158213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 158256 158903 gene locus_tag LOCUS_09060 158256 158903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 161839 158954 gene locus_tag LOCUS_09070 gene gcvP 161839 158954 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_09070 162781 161948 gene locus_tag LOCUS_09080 gene rnc 162781 161948 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838732.1 protein_id gnl|my_center|LOCUS_09080 164050 162800 gene locus_tag LOCUS_09090 gene fabF 164050 162800 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_09090 164367 164125 gene locus_tag LOCUS_09100 164367 164125 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405458.1 protein_id gnl|my_center|LOCUS_09100 165171 164425 gene locus_tag LOCUS_09110 gene fabG 165171 164425 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_09110 166125 165217 gene locus_tag LOCUS_09120 gene fabD 166125 165217 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933769.1 protein_id gnl|my_center|LOCUS_09120 167121 166135 gene locus_tag LOCUS_09130 167121 166135 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933768.1 protein_id gnl|my_center|LOCUS_09130 167944 167141 gene locus_tag LOCUS_09140 gene plsX 167944 167141 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_09140 168361 168182 gene locus_tag LOCUS_09150 gene rpmF 168361 168182 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_09150 168917 168402 gene locus_tag LOCUS_09160 168917 168402 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_09160 169031 169105 gene locus_tag LOCUS_t00130 169031 169105 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 170675 169206 gene locus_tag LOCUS_09170 gene nrfA 170675 169206 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107764.1 protein_id gnl|my_center|LOCUS_09170 171291 170695 gene locus_tag LOCUS_09180 gene nrfH 171291 170695 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201985.1 protein_id gnl|my_center|LOCUS_09180 172684 171422 gene locus_tag LOCUS_09190 172684 171422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 173863 172721 gene locus_tag LOCUS_09200 173863 172721 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818458.1 protein_id gnl|my_center|LOCUS_09200 174311 173907 gene locus_tag LOCUS_09210 174311 173907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 175610 174534 gene locus_tag LOCUS_09220 175610 174534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 177712 175622 gene locus_tag LOCUS_09230 177712 175622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 178009 177818 gene locus_tag LOCUS_09240 178009 177818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 177929 179164 gene locus_tag LOCUS_09250 177929 179164 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_09250 181156 179513 gene locus_tag LOCUS_09260 181156 179513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 181323 182663 gene locus_tag LOCUS_09270 181323 182663 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_09270 182666 184159 gene locus_tag LOCUS_09280 182666 184159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 184152 186419 gene locus_tag LOCUS_09290 184152 186419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 186437 187681 gene locus_tag LOCUS_09300 186437 187681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 189116 187818 gene locus_tag LOCUS_09310 189116 187818 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403541.1 protein_id gnl|my_center|LOCUS_09310 190470 189238 gene locus_tag LOCUS_09320 190470 189238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 190896 192077 gene locus_tag LOCUS_09330 190896 192077 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947949.1 protein_id gnl|my_center|LOCUS_09330 193738 192140 gene locus_tag LOCUS_09340 193738 192140 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_09340 195113 193731 gene locus_tag LOCUS_09350 gene trkA 195113 193731 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719964.1 protein_id gnl|my_center|LOCUS_09350 195338 196519 gene locus_tag LOCUS_09360 195338 196519 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_09360 196611 196829 gene locus_tag LOCUS_09370 196611 196829 CDS product DUF6132 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788321.1 protein_id gnl|my_center|LOCUS_09370 196843 197088 gene locus_tag LOCUS_09380 196843 197088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 197925 197092 gene locus_tag LOCUS_09390 197925 197092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 199079 197922 gene locus_tag LOCUS_09400 199079 197922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 199714 199256 gene locus_tag LOCUS_09410 199714 199256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 200294 199818 gene locus_tag LOCUS_09420 200294 199818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 200478 201632 gene locus_tag LOCUS_09430 200478 201632 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932672.1 protein_id gnl|my_center|LOCUS_09430 201714 202943 gene locus_tag LOCUS_09440 201714 202943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 202993 204687 gene locus_tag LOCUS_09450 202993 204687 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986824.1 protein_id gnl|my_center|LOCUS_09450 204758 204940 gene locus_tag LOCUS_09460 204758 204940 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_09460 205476 205081 gene locus_tag LOCUS_09470 205476 205081 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_09470 206390 205473 gene locus_tag LOCUS_09480 206390 205473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 206571 210326 gene locus_tag LOCUS_09490 206571 210326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 210444 214202 gene locus_tag LOCUS_09500 210444 214202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 214259 215353 gene locus_tag LOCUS_09510 214259 215353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 215471 218437 gene locus_tag LOCUS_09520 215471 218437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 218570 218800 gene locus_tag LOCUS_09530 218570 218800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 219134 219646 gene locus_tag LOCUS_09540 gene nuoE 219134 219646 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_09540 219633 221672 gene locus_tag LOCUS_09550 gene nuoF 219633 221672 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_09550 221691 223403 gene locus_tag LOCUS_09560 221691 223403 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_09560 223527 223928 gene locus_tag LOCUS_09570 223527 223928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 227462 224037 gene locus_tag LOCUS_09580 227462 224037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 230923 227687 gene locus_tag LOCUS_09590 230923 227687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 232133 230925 gene locus_tag LOCUS_09600 232133 230925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 232659 232862 gene locus_tag LOCUS_09610 232659 232862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 233001 233270 gene locus_tag LOCUS_09620 233001 233270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 237823 234824 gene locus_tag LOCUS_09630 237823 234824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 238398 238033 gene locus_tag LOCUS_09640 238398 238033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 239252 238587 gene locus_tag LOCUS_09650 239252 238587 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033930894.1 protein_id gnl|my_center|LOCUS_09650 240111 239419 gene locus_tag LOCUS_09660 gene mip 240111 239419 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_09660 240285 241253 gene locus_tag LOCUS_09670 240285 241253 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928449.1 protein_id gnl|my_center|LOCUS_09670 241494 242765 gene locus_tag LOCUS_09680 241494 242765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 242886 243641 gene locus_tag LOCUS_09690 242886 243641 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_09690 243651 244514 gene locus_tag LOCUS_09700 243651 244514 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 protein_id gnl|my_center|LOCUS_09700 244596 245147 gene locus_tag LOCUS_09710 244596 245147 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141087.1 protein_id gnl|my_center|LOCUS_09710 245144 246415 gene locus_tag LOCUS_09720 245144 246415 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_09720 246435 247523 gene locus_tag LOCUS_09730 246435 247523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 247547 248308 gene locus_tag LOCUS_09740 gene hisA 247547 248308 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404311.1 protein_id gnl|my_center|LOCUS_09740 248626 249375 gene locus_tag LOCUS_09750 248626 249375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 249469 251037 gene locus_tag LOCUS_09760 249469 251037 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence05 376 771 gene locus_tag LOCUS_09770 376 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1329 2381 gene locus_tag LOCUS_09780 1329 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2615 2938 gene locus_tag LOCUS_09790 2615 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3653 3048 gene locus_tag LOCUS_09800 3653 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 5668 3674 gene locus_tag LOCUS_09810 5668 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 5892 6434 gene locus_tag LOCUS_09820 5892 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 6887 6495 gene locus_tag LOCUS_09830 6887 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 7069 7260 gene locus_tag LOCUS_09840 7069 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 10503 8404 gene locus_tag LOCUS_09850 10503 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 11820 10600 gene locus_tag LOCUS_09860 11820 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 12524 11841 gene locus_tag LOCUS_09870 12524 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 14098 12599 gene locus_tag LOCUS_09880 14098 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 14654 14103 gene locus_tag LOCUS_09890 14654 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09890 14553 14777 gene locus_tag LOCUS_09900 14553 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 14988 15209 gene locus_tag LOCUS_09910 14988 15209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 15206 15493 gene locus_tag LOCUS_09920 15206 15493 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_09920 17569 15581 gene locus_tag LOCUS_09930 17569 15581 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_09930 18021 18452 gene locus_tag LOCUS_09940 18021 18452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 20832 18673 gene locus_tag LOCUS_09950 20832 18673 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_09950 21838 20867 gene locus_tag LOCUS_09960 21838 20867 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403976.1 protein_id gnl|my_center|LOCUS_09960 22639 21854 gene locus_tag LOCUS_09970 22639 21854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 23319 22897 gene locus_tag LOCUS_09980 23319 22897 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812593.1 protein_id gnl|my_center|LOCUS_09980 24132 23500 gene locus_tag LOCUS_09990 24132 23500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 29060 24162 gene locus_tag LOCUS_10000 29060 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 29514 29317 gene locus_tag LOCUS_10010 29514 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 29620 30882 gene locus_tag LOCUS_10020 29620 30882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 31229 32500 gene locus_tag LOCUS_10030 31229 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 32662 35592 gene locus_tag LOCUS_10040 gene uvrA 32662 35592 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405104.1 protein_id gnl|my_center|LOCUS_10040 36259 35597 gene locus_tag LOCUS_10050 36259 35597 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_10050 38411 36252 gene locus_tag LOCUS_10060 38411 36252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 38557 41328 gene locus_tag LOCUS_10070 gene ppc 38557 41328 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_10070 41452 42477 gene locus_tag LOCUS_10080 41452 42477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 44224 42608 gene locus_tag LOCUS_10090 44224 42608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 45861 44338 gene locus_tag LOCUS_10100 45861 44338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 46016 46237 gene locus_tag LOCUS_10110 46016 46237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 46335 47240 gene locus_tag LOCUS_10120 46335 47240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 47266 48105 gene locus_tag LOCUS_10130 47266 48105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812228.1 protein_id gnl|my_center|LOCUS_10130 48338 50212 gene locus_tag LOCUS_10140 48338 50212 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_10140 50381 51193 gene locus_tag LOCUS_10150 50381 51193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 51267 51341 gene locus_tag LOCUS_t00140 51267 51341 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 51482 52261 gene locus_tag LOCUS_10160 gene tpiA 51482 52261 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_10160 52401 53237 gene locus_tag LOCUS_10170 52401 53237 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_10170 53218 55599 gene locus_tag LOCUS_10180 gene bamA 53218 55599 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_10180 55694 56191 gene locus_tag LOCUS_10190 55694 56191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 56243 56923 gene locus_tag LOCUS_10200 56243 56923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 56938 58005 gene locus_tag LOCUS_10210 gene lpxD 56938 58005 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_10210 58085 58864 gene locus_tag LOCUS_10220 58085 58864 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_10220 59016 58798 gene locus_tag LOCUS_10230 59016 58798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 59623 59027 gene locus_tag LOCUS_10240 gene fadR 59623 59027 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_10240 62072 59865 gene locus_tag LOCUS_10250 62072 59865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 62327 63823 gene locus_tag LOCUS_10260 62327 63823 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444894.1 protein_id gnl|my_center|LOCUS_10260 63820 64434 gene locus_tag LOCUS_10270 gene pncA 63820 64434 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444893.1 protein_id gnl|my_center|LOCUS_10270 65350 64445 gene locus_tag LOCUS_10280 65350 64445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 65527 66129 gene locus_tag LOCUS_10290 65527 66129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 66193 67089 gene locus_tag LOCUS_10300 gene ligD 66193 67089 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863172.1 protein_id gnl|my_center|LOCUS_10300 67482 67736 gene locus_tag LOCUS_10310 67482 67736 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_10310 67915 69042 gene locus_tag LOCUS_10320 67915 69042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 69754 69212 gene locus_tag LOCUS_10330 69754 69212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 70588 69839 gene locus_tag LOCUS_10340 70588 69839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 70751 71704 gene locus_tag LOCUS_10350 gene carH 70751 71704 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_10350 71889 72020 gene locus_tag LOCUS_10360 71889 72020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 72039 72908 gene locus_tag LOCUS_10370 72039 72908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 72905 73906 gene locus_tag LOCUS_10380 72905 73906 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_10380 73903 74628 gene locus_tag LOCUS_10390 73903 74628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 74625 75587 gene locus_tag LOCUS_10400 74625 75587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 75584 76555 gene locus_tag LOCUS_10410 75584 76555 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_10410 76860 78356 gene locus_tag LOCUS_10420 76860 78356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 78596 80974 gene locus_tag LOCUS_10430 78596 80974 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_10430 81105 83240 gene locus_tag LOCUS_10440 81105 83240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 85161 83290 gene locus_tag LOCUS_10450 85161 83290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 85109 85375 gene locus_tag LOCUS_10460 85109 85375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 89837 85350 gene locus_tag LOCUS_10470 89837 85350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 91126 90089 gene locus_tag LOCUS_10480 91126 90089 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_10480 94053 91162 gene locus_tag LOCUS_10490 94053 91162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 94802 94050 gene locus_tag LOCUS_10500 94802 94050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 96120 94879 gene locus_tag LOCUS_10510 96120 94879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_10510 97738 96191 gene locus_tag LOCUS_10520 gene actP 97738 96191 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546484.1 protein_id gnl|my_center|LOCUS_10520 98088 97774 gene locus_tag LOCUS_10530 98088 97774 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545871.1 protein_id gnl|my_center|LOCUS_10530 100114 98618 gene locus_tag LOCUS_10540 100114 98618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 100375 100288 gene locus_tag LOCUS_t00150 100375 100288 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 100650 102059 gene locus_tag LOCUS_10550 gene mpl 100650 102059 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_10550 102191 102757 gene locus_tag LOCUS_10560 102191 102757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 106943 102822 gene locus_tag LOCUS_10570 106943 102822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 107890 106952 gene locus_tag LOCUS_10580 107890 106952 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_10580 108432 107887 gene locus_tag LOCUS_10590 108432 107887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 110227 108623 gene locus_tag LOCUS_10600 110227 108623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 111535 110402 gene locus_tag LOCUS_10610 111535 110402 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_10610 112579 111548 gene locus_tag LOCUS_10620 112579 111548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 113241 112645 gene locus_tag LOCUS_10630 113241 112645 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_10630 113372 115900 gene locus_tag LOCUS_10640 113372 115900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 116566 116832 gene locus_tag LOCUS_10650 116566 116832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 117825 116851 gene locus_tag LOCUS_10660 117825 116851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 118925 117822 gene locus_tag LOCUS_10670 gene glf 118925 117822 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038781.1 protein_id gnl|my_center|LOCUS_10670 120167 118926 gene locus_tag LOCUS_10680 120167 118926 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_10680 121505 120225 gene locus_tag LOCUS_10690 121505 120225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 122357 122785 gene locus_tag LOCUS_10700 122357 122785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 122914 123342 gene locus_tag LOCUS_10710 122914 123342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 123402 123824 gene locus_tag LOCUS_10720 123402 123824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 124090 124800 gene locus_tag LOCUS_10730 124090 124800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 125010 126704 gene locus_tag LOCUS_10740 125010 126704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 128285 126699 gene locus_tag LOCUS_10750 128285 126699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 128178 128414 gene locus_tag LOCUS_10760 128178 128414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 128605 129009 gene locus_tag LOCUS_10770 128605 129009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 129290 129051 gene locus_tag LOCUS_10780 129290 129051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 129222 130358 gene locus_tag LOCUS_10790 129222 130358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 130469 131956 gene locus_tag LOCUS_10800 gene glgA 130469 131956 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_10800 132116 133276 gene locus_tag LOCUS_10810 132116 133276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 133282 134484 gene locus_tag LOCUS_10820 133282 134484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 134515 135804 gene locus_tag LOCUS_10830 134515 135804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 135841 136269 gene locus_tag LOCUS_10840 gene rpiB 135841 136269 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_10840 137253 136402 gene locus_tag LOCUS_10850 137253 136402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 137480 140530 gene locus_tag LOCUS_10860 137480 140530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 140535 141737 gene locus_tag LOCUS_10870 140535 141737 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_10870 141805 144495 gene locus_tag LOCUS_10880 141805 144495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 144522 145403 gene locus_tag LOCUS_10890 gene menB 144522 145403 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_10890 145431 146339 gene locus_tag LOCUS_10900 145431 146339 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933177.1 protein_id gnl|my_center|LOCUS_10900 146344 147456 gene locus_tag LOCUS_10910 146344 147456 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_10910 147453 149030 gene locus_tag LOCUS_10920 147453 149030 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_10920 149692 149003 gene locus_tag LOCUS_10930 gene ubiE 149692 149003 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_10930 150533 149733 gene locus_tag LOCUS_10940 gene aroF 150533 149733 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_10940 151438 150731 gene locus_tag LOCUS_10950 gene fabG 151438 150731 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056775.1 protein_id gnl|my_center|LOCUS_10950 151514 151894 gene locus_tag LOCUS_10960 gene crcB 151514 151894 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_10960 151910 152269 gene locus_tag LOCUS_10970 151910 152269 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_10970 153722 152253 gene locus_tag LOCUS_10980 153722 152253 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459325.1 protein_id gnl|my_center|LOCUS_10980 153906 154355 gene locus_tag LOCUS_10990 gene rplM 153906 154355 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933443.1 protein_id gnl|my_center|LOCUS_10990 154398 154784 gene locus_tag LOCUS_11000 gene rpsI 154398 154784 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_11000 154988 155752 gene locus_tag LOCUS_11010 gene rpsB 154988 155752 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933441.1 protein_id gnl|my_center|LOCUS_11010 155844 156689 gene locus_tag LOCUS_11020 gene tsf 155844 156689 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402823.1 protein_id gnl|my_center|LOCUS_11020 156756 157496 gene locus_tag LOCUS_11030 gene pyrH 156756 157496 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933439.1 protein_id gnl|my_center|LOCUS_11030 157510 158067 gene locus_tag LOCUS_11040 gene frr 157510 158067 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_11040 158763 158230 gene locus_tag LOCUS_11050 158763 158230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 160772 158760 gene locus_tag LOCUS_11060 160772 158760 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462072.1 protein_id gnl|my_center|LOCUS_11060 163018 160949 gene locus_tag LOCUS_11070 163018 160949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 164066 163170 gene locus_tag LOCUS_11080 164066 163170 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970375.1 protein_id gnl|my_center|LOCUS_11080 164973 164206 gene locus_tag LOCUS_11090 164973 164206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 165112 166332 gene locus_tag LOCUS_11100 165112 166332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 166373 167452 gene locus_tag LOCUS_11110 166373 167452 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_11110 167617 167381 gene locus_tag LOCUS_11120 167617 167381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 168353 167601 gene locus_tag LOCUS_11130 168353 167601 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679291.1 protein_id gnl|my_center|LOCUS_11130 168569 170815 gene locus_tag LOCUS_11140 168569 170815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 170843 171835 gene locus_tag LOCUS_11150 170843 171835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 171832 172374 gene locus_tag LOCUS_11160 171832 172374 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404491.1 protein_id gnl|my_center|LOCUS_11160 173757 173116 gene locus_tag LOCUS_11170 173757 173116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 174390 173935 gene locus_tag LOCUS_11180 174390 173935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 175293 174400 gene locus_tag LOCUS_11190 175293 174400 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_11190 175446 175372 gene locus_tag LOCUS_t00160 175446 175372 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 175590 177101 gene locus_tag LOCUS_11200 gene lysS 175590 177101 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_11200 177258 179483 gene locus_tag LOCUS_11210 177258 179483 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403314.1 protein_id gnl|my_center|LOCUS_11210 179746 180519 gene locus_tag LOCUS_11220 179746 180519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 180770 180564 gene locus_tag LOCUS_11230 180770 180564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 180769 181221 gene locus_tag LOCUS_11240 180769 181221 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_11240 181440 182441 gene locus_tag LOCUS_11250 181440 182441 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_11250 183077 182631 gene locus_tag LOCUS_11260 183077 182631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 183805 183326 gene locus_tag LOCUS_11270 183805 183326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 186300 183811 gene locus_tag LOCUS_11280 gene priA 186300 183811 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405449.1 protein_id gnl|my_center|LOCUS_11280 188262 186421 gene locus_tag LOCUS_11290 188262 186421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 188549 189232 gene locus_tag LOCUS_11300 188549 189232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 189245 189940 gene locus_tag LOCUS_11310 189245 189940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 190018 191223 gene locus_tag LOCUS_11320 190018 191223 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_11320 191710 195183 gene locus_tag LOCUS_11330 191710 195183 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926886.1 protein_id gnl|my_center|LOCUS_11330 195288 196553 gene locus_tag LOCUS_11340 195288 196553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 197090 196596 gene locus_tag LOCUS_11350 197090 196596 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329720.1 protein_id gnl|my_center|LOCUS_11350 197311 198546 gene locus_tag LOCUS_11360 197311 198546 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664911.1 protein_id gnl|my_center|LOCUS_11360 200966 198708 gene locus_tag LOCUS_11370 200966 198708 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_11370 201939 201148 gene locus_tag LOCUS_11380 201939 201148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 205399 202016 gene locus_tag LOCUS_11390 205399 202016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 205727 207079 gene locus_tag LOCUS_11400 205727 207079 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_11400 207081 207761 gene locus_tag LOCUS_11410 207081 207761 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_11410 207799 209712 gene locus_tag LOCUS_11420 207799 209712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 210574 209675 gene locus_tag LOCUS_11430 gene dapF 210574 209675 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_11430 212159 210630 gene locus_tag LOCUS_11440 212159 210630 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869048.1 protein_id gnl|my_center|LOCUS_11440 213234 212167 gene locus_tag LOCUS_11450 213234 212167 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_11450 214040 213231 gene locus_tag LOCUS_11460 gene otsB 214040 213231 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869049.1 protein_id gnl|my_center|LOCUS_11460 215275 214037 gene locus_tag LOCUS_11470 215275 214037 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_11470 215961 215275 gene locus_tag LOCUS_11480 215961 215275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 216247 220089 gene locus_tag LOCUS_11490 216247 220089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 220502 220083 gene locus_tag LOCUS_11500 220502 220083 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582909.1 protein_id gnl|my_center|LOCUS_11500 220966 220499 gene locus_tag LOCUS_11510 220966 220499 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932630.1 protein_id gnl|my_center|LOCUS_11510 221191 221015 gene locus_tag LOCUS_11520 221191 221015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 221111 222226 gene locus_tag LOCUS_11530 221111 222226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 223641 222268 gene locus_tag LOCUS_11540 223641 222268 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_11540 224519 223728 gene locus_tag LOCUS_11550 gene fetB 224519 223728 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926980.1 protein_id gnl|my_center|LOCUS_11550 225202 224516 gene locus_tag LOCUS_11560 225202 224516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932770.1 protein_id gnl|my_center|LOCUS_11560 225275 225580 gene locus_tag LOCUS_11570 225275 225580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 227129 225609 gene locus_tag LOCUS_11580 227129 225609 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405055.1 protein_id gnl|my_center|LOCUS_11580 229377 227320 gene locus_tag LOCUS_11590 229377 227320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 230617 229508 gene locus_tag LOCUS_11600 230617 229508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 231836 230619 gene locus_tag LOCUS_11610 231836 230619 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_11610 232655 232023 gene locus_tag LOCUS_11620 232655 232023 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_11620 234712 232652 gene locus_tag LOCUS_11630 234712 232652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 234873 235283 gene locus_tag LOCUS_11640 234873 235283 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_11640 235430 235687 gene locus_tag LOCUS_11650 235430 235687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 235794 236885 gene locus_tag LOCUS_11660 235794 236885 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_11660 237275 237754 gene locus_tag LOCUS_11670 237275 237754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 238555 237776 gene locus_tag LOCUS_11680 gene cobB 238555 237776 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_11680 239407 238679 gene locus_tag LOCUS_11690 239407 238679 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762319.1 protein_id gnl|my_center|LOCUS_11690 240405 239404 gene locus_tag LOCUS_11700 240405 239404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 240776 241150 gene locus_tag LOCUS_11710 240776 241150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 243131 241170 gene locus_tag LOCUS_11720 243131 241170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 243354 243124 gene locus_tag LOCUS_11730 243354 243124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 245438 243366 gene locus_tag LOCUS_11740 245438 243366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence06 2097 544 gene locus_tag LOCUS_11750 gene atpA 2097 544 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_11750 2682 2140 gene locus_tag LOCUS_11760 2682 2140 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931712.1 protein_id gnl|my_center|LOCUS_11760 3198 2704 gene locus_tag LOCUS_11770 gene atpF 3198 2704 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552096.1 protein_id gnl|my_center|LOCUS_11770 3468 3244 gene locus_tag LOCUS_11780 3468 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 4311 3520 gene locus_tag LOCUS_11790 4311 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 5002 4583 gene locus_tag LOCUS_11800 5002 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5277 4999 gene locus_tag LOCUS_11810 5277 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6951 5440 gene locus_tag LOCUS_11820 6951 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 8330 7023 gene locus_tag LOCUS_11830 8330 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 8554 11550 gene locus_tag LOCUS_11840 8554 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 11547 13262 gene locus_tag LOCUS_11850 11547 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 13264 13491 gene locus_tag LOCUS_11860 13264 13491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 13488 14402 gene locus_tag LOCUS_11870 13488 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 14402 15091 gene locus_tag LOCUS_11880 14402 15091 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_11880 15088 15516 gene locus_tag LOCUS_11890 15088 15516 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_11890 15497 16345 gene locus_tag LOCUS_11900 15497 16345 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404702.1 protein_id gnl|my_center|LOCUS_11900 16457 18766 gene locus_tag LOCUS_11910 16457 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 18932 20242 gene locus_tag LOCUS_11920 18932 20242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 23648 20184 gene locus_tag LOCUS_11930 23648 20184 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_11930 26326 23645 gene locus_tag LOCUS_11940 26326 23645 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_11940 26868 26323 gene locus_tag LOCUS_11950 26868 26323 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256063.1 protein_id gnl|my_center|LOCUS_11950 27801 27016 gene locus_tag LOCUS_11960 27801 27016 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_11960 28601 27798 gene locus_tag LOCUS_11970 28601 27798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 28889 29773 gene locus_tag LOCUS_11980 28889 29773 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_11980 29915 31090 gene locus_tag LOCUS_11990 29915 31090 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_11990 31087 34257 gene locus_tag LOCUS_12000 31087 34257 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_12000 34257 35564 gene locus_tag LOCUS_12010 34257 35564 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838343.1 protein_id gnl|my_center|LOCUS_12010 35677 36072 gene locus_tag LOCUS_12020 35677 36072 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356374.1 protein_id gnl|my_center|LOCUS_12020 36069 37646 gene locus_tag LOCUS_12030 36069 37646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 37643 38851 gene locus_tag LOCUS_12040 37643 38851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 38859 39293 gene locus_tag LOCUS_12050 38859 39293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 39315 40562 gene locus_tag LOCUS_12060 39315 40562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 40593 42359 gene locus_tag LOCUS_12070 40593 42359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 42356 43714 gene locus_tag LOCUS_12080 42356 43714 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839967.1 protein_id gnl|my_center|LOCUS_12080 44423 43665 gene locus_tag LOCUS_12090 44423 43665 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108916.1 protein_id gnl|my_center|LOCUS_12090 45085 44420 gene locus_tag LOCUS_12100 45085 44420 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767460.1 protein_id gnl|my_center|LOCUS_12100 45373 45972 gene locus_tag LOCUS_12110 gene rpoE 45373 45972 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_12110 45974 47662 gene locus_tag LOCUS_12120 45974 47662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 47768 49507 gene locus_tag LOCUS_12130 47768 49507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 49537 51384 gene locus_tag LOCUS_12140 49537 51384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 51593 52906 gene locus_tag LOCUS_12150 51593 52906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 53148 52921 gene locus_tag LOCUS_12160 53148 52921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 54297 53155 gene locus_tag LOCUS_12170 54297 53155 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_12170 54592 56193 gene locus_tag LOCUS_12180 54592 56193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 56199 56885 gene locus_tag LOCUS_12190 gene yycF 56199 56885 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100856.1 protein_id gnl|my_center|LOCUS_12190 56980 58035 gene locus_tag LOCUS_12200 56980 58035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 58931 58032 gene locus_tag LOCUS_12210 58931 58032 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_12210 59097 60248 gene locus_tag LOCUS_12220 59097 60248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 62627 60330 gene locus_tag LOCUS_12230 62627 60330 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_12230 63346 62654 gene locus_tag LOCUS_12240 gene phoU 63346 62654 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932580.1 protein_id gnl|my_center|LOCUS_12240 65181 63379 gene locus_tag LOCUS_12250 65181 63379 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_12250 65876 65184 gene locus_tag LOCUS_12260 65876 65184 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_12260 67052 65991 gene locus_tag LOCUS_12270 67052 65991 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337252.1 protein_id gnl|my_center|LOCUS_12270 67251 68849 gene locus_tag LOCUS_12280 67251 68849 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_12280 68846 69442 gene locus_tag LOCUS_12290 68846 69442 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_12290 71674 69536 gene locus_tag LOCUS_12300 71674 69536 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_12300 74126 71946 gene locus_tag LOCUS_12310 74126 71946 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404722.1 protein_id gnl|my_center|LOCUS_12310 74850 74302 gene locus_tag LOCUS_12320 74850 74302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 76239 74947 gene locus_tag LOCUS_12330 76239 74947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 77522 76236 gene locus_tag LOCUS_12340 77522 76236 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948915.1 protein_id gnl|my_center|LOCUS_12340 81490 77519 gene locus_tag LOCUS_12350 81490 77519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 83817 81487 gene locus_tag LOCUS_12360 83817 81487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 85981 83873 gene locus_tag LOCUS_12370 85981 83873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 86265 86744 gene locus_tag LOCUS_12380 86265 86744 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_12380 86763 88205 gene locus_tag LOCUS_12390 86763 88205 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_12390 88387 89169 gene locus_tag LOCUS_12400 88387 89169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 89654 89316 gene locus_tag LOCUS_12410 89654 89316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 91513 89708 gene locus_tag LOCUS_12420 91513 89708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 92767 91526 gene locus_tag LOCUS_12430 92767 91526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 96569 92760 gene locus_tag LOCUS_12440 96569 92760 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_12440 97083 96685 gene locus_tag LOCUS_12450 97083 96685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 97334 97720 gene locus_tag LOCUS_12460 97334 97720 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_12460 97799 99184 gene locus_tag LOCUS_12470 97799 99184 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870113.1 protein_id gnl|my_center|LOCUS_12470 100328 99114 gene locus_tag LOCUS_12480 gene dinB 100328 99114 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_12480 100635 100393 gene locus_tag LOCUS_12490 100635 100393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 101278 100853 gene locus_tag LOCUS_12500 101278 100853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 101493 101275 gene locus_tag LOCUS_12510 101493 101275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 102228 101653 gene locus_tag LOCUS_12520 102228 101653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 102736 104772 gene locus_tag LOCUS_12530 102736 104772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 104894 109942 gene locus_tag LOCUS_12540 104894 109942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 110848 110015 gene locus_tag LOCUS_12550 110848 110015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 111703 110894 gene locus_tag LOCUS_12560 111703 110894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 112377 111703 gene locus_tag LOCUS_12570 gene rsmG 112377 111703 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933813.1 protein_id gnl|my_center|LOCUS_12570 114095 112506 gene locus_tag LOCUS_12580 114095 112506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 114966 114097 gene locus_tag LOCUS_12590 114966 114097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 118784 114987 gene locus_tag LOCUS_12600 118784 114987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 119120 120625 gene locus_tag LOCUS_12610 119120 120625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 121801 120815 gene locus_tag LOCUS_12620 gene pta 121801 120815 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_12620 122960 122034 gene locus_tag LOCUS_12630 122960 122034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 123097 124719 gene locus_tag LOCUS_12640 gene gpmI 123097 124719 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_12640 124725 126386 gene locus_tag LOCUS_12650 124725 126386 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403085.1 protein_id gnl|my_center|LOCUS_12650 127025 126465 gene locus_tag LOCUS_12660 gene lptC 127025 126465 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986830.1 protein_id gnl|my_center|LOCUS_12660 128073 127015 gene locus_tag LOCUS_12670 gene ruvB 128073 127015 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_12670 129243 128122 gene locus_tag LOCUS_12680 129243 128122 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839930.1 protein_id gnl|my_center|LOCUS_12680 130106 129279 gene locus_tag LOCUS_12690 gene era 130106 129279 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404809.1 protein_id gnl|my_center|LOCUS_12690 130291 131100 gene locus_tag LOCUS_12700 gene rsmA 130291 131100 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956993.1 protein_id gnl|my_center|LOCUS_12700 131093 132511 gene locus_tag LOCUS_12710 gene mgtE 131093 132511 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 protein_id gnl|my_center|LOCUS_12710 132647 133609 gene locus_tag LOCUS_12720 132647 133609 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546183.1 protein_id gnl|my_center|LOCUS_12720 135529 133640 gene locus_tag LOCUS_12730 135529 133640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 135620 135829 gene locus_tag LOCUS_12740 135620 135829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 136333 136260 gene locus_tag LOCUS_t00170 136333 136260 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 137798 136431 gene locus_tag LOCUS_12750 137798 136431 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_12750 139102 137807 gene locus_tag LOCUS_12760 139102 137807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 140289 139099 gene locus_tag LOCUS_12770 gene larC 140289 139099 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_12770 141101 140286 gene locus_tag LOCUS_12780 gene pyrF 141101 140286 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_12780 141253 141606 gene locus_tag LOCUS_12790 141253 141606 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_12790 141603 144944 gene locus_tag LOCUS_12800 gene mfd 141603 144944 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_12800 144934 145986 gene locus_tag LOCUS_12810 144934 145986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 146583 145960 gene locus_tag LOCUS_12820 146583 145960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 147290 146580 gene locus_tag LOCUS_12830 147290 146580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 150908 147315 gene locus_tag LOCUS_12840 150908 147315 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839103.1 protein_id gnl|my_center|LOCUS_12840 152829 150892 gene locus_tag LOCUS_12850 gene mutL 152829 150892 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_12850 153029 152835 gene locus_tag LOCUS_12860 153029 152835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 154041 153046 gene locus_tag LOCUS_12870 gene ftsY 154041 153046 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404898.1 protein_id gnl|my_center|LOCUS_12870 154755 154165 gene locus_tag LOCUS_12880 154755 154165 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404899.1 protein_id gnl|my_center|LOCUS_12880 159111 154762 gene locus_tag LOCUS_12890 159111 154762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 160625 159111 gene locus_tag LOCUS_12900 gene purF 160625 159111 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932005.1 protein_id gnl|my_center|LOCUS_12900 161788 160652 gene locus_tag LOCUS_12910 161788 160652 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_12910 161933 162643 gene locus_tag LOCUS_12920 161933 162643 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_12920 162636 163526 gene locus_tag LOCUS_12930 162636 163526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 163659 164510 gene locus_tag LOCUS_12940 163659 164510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 165253 164663 gene locus_tag LOCUS_12950 gene sodB 165253 164663 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357051.1 protein_id gnl|my_center|LOCUS_12950 166074 165385 gene locus_tag LOCUS_12960 166074 165385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 167072 166260 gene locus_tag LOCUS_12970 gene mscS 167072 166260 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_12970 169265 167139 gene locus_tag LOCUS_12980 169265 167139 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_12980 170506 169409 gene locus_tag LOCUS_12990 170506 169409 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_12990 172354 170666 gene locus_tag LOCUS_13000 172354 170666 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_13000 173347 172373 gene locus_tag LOCUS_13010 173347 172373 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_13010 176287 173477 gene locus_tag LOCUS_13020 176287 173477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 176481 177077 gene locus_tag LOCUS_13030 176481 177077 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_13030 177074 178429 gene locus_tag LOCUS_13040 177074 178429 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_13040 178429 179247 gene locus_tag LOCUS_13050 178429 179247 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289198.1 protein_id gnl|my_center|LOCUS_13050 179253 181541 gene locus_tag LOCUS_13060 179253 181541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 181660 183531 gene locus_tag LOCUS_13070 181660 183531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 183547 184761 gene locus_tag LOCUS_13080 183547 184761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 187942 184841 gene locus_tag LOCUS_13090 187942 184841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 190354 188348 gene locus_tag LOCUS_13100 190354 188348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 190540 191403 gene locus_tag LOCUS_13110 190540 191403 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_13110 192816 191722 gene locus_tag LOCUS_13120 192816 191722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 193946 192879 gene locus_tag LOCUS_13130 193946 192879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 194596 195153 gene locus_tag LOCUS_13140 194596 195153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 195872 195465 gene locus_tag LOCUS_13150 195872 195465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 196384 195896 gene locus_tag LOCUS_13160 196384 195896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 199678 196514 gene locus_tag LOCUS_13170 199678 196514 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_13170 201468 199699 gene locus_tag LOCUS_13180 201468 199699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 203024 201465 gene locus_tag LOCUS_13190 203024 201465 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_13190 203421 203038 gene locus_tag LOCUS_13200 203421 203038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 204484 205443 gene locus_tag LOCUS_13210 204484 205443 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_13210 205645 209874 gene locus_tag LOCUS_13220 205645 209874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 210270 210473 gene locus_tag LOCUS_13230 210270 210473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 210701 210495 gene locus_tag LOCUS_13240 210701 210495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 212297 216211 gene locus_tag LOCUS_13250 212297 216211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 216586 217032 gene locus_tag LOCUS_13260 216586 217032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 217043 217291 gene locus_tag LOCUS_13270 217043 217291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 217845 217621 gene locus_tag LOCUS_13280 217845 217621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 219649 217820 gene locus_tag LOCUS_13290 219649 217820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 220702 219770 gene locus_tag LOCUS_13300 220702 219770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 222234 221200 gene locus_tag LOCUS_13310 222234 221200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 222638 223726 gene locus_tag LOCUS_13320 222638 223726 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence07 1297 98 gene locus_tag LOCUS_13330 gene ftsZ 1297 98 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403340.1 protein_id gnl|my_center|LOCUS_13330 2649 1393 gene locus_tag LOCUS_13340 gene ftsA 2649 1393 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015601.1 protein_id gnl|my_center|LOCUS_13340 3536 2676 gene locus_tag LOCUS_13350 3536 2676 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403338.1 protein_id gnl|my_center|LOCUS_13350 4462 3533 gene locus_tag LOCUS_13360 gene murB 4462 3533 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_13360 5848 4466 gene locus_tag LOCUS_13370 gene murC 5848 4466 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_13370 6440 5970 gene locus_tag LOCUS_13380 6440 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7549 6437 gene locus_tag LOCUS_13390 gene murG 7549 6437 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403336.1 protein_id gnl|my_center|LOCUS_13390 8709 7546 gene locus_tag LOCUS_13400 8709 7546 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931729.1 protein_id gnl|my_center|LOCUS_13400 10088 8706 gene locus_tag LOCUS_13410 gene murD 10088 8706 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 protein_id gnl|my_center|LOCUS_13410 11200 10091 gene locus_tag LOCUS_13420 gene mraY 11200 10091 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403333.1 protein_id gnl|my_center|LOCUS_13420 12618 11203 gene locus_tag LOCUS_13430 gene murF 12618 11203 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927184.1 protein_id gnl|my_center|LOCUS_13430 14168 12615 gene locus_tag LOCUS_13440 14168 12615 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_13440 16344 14173 gene locus_tag LOCUS_13450 16344 14173 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931734.1 protein_id gnl|my_center|LOCUS_13450 16716 16354 gene locus_tag LOCUS_13460 16716 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 17674 16733 gene locus_tag LOCUS_13470 gene rsmH 17674 16733 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_13470 18126 17674 gene locus_tag LOCUS_13480 gene mraZ 18126 17674 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_13480 18495 18304 gene locus_tag LOCUS_13490 18495 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 18494 19414 gene locus_tag LOCUS_13500 18494 19414 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_13500 20651 19542 gene locus_tag LOCUS_13510 20651 19542 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_13510 21948 20662 gene locus_tag LOCUS_13520 21948 20662 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_13520 22377 22036 gene locus_tag LOCUS_13530 22377 22036 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_13530 23307 22387 gene locus_tag LOCUS_13540 gene secF 23307 22387 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404566.1 protein_id gnl|my_center|LOCUS_13540 25290 23356 gene locus_tag LOCUS_13550 gene secD 25290 23356 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_13550 28133 25458 gene locus_tag LOCUS_13560 28133 25458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 31402 28472 gene locus_tag LOCUS_13570 31402 28472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 31609 32268 gene locus_tag LOCUS_13580 31609 32268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016106.1 protein_id gnl|my_center|LOCUS_13580 32279 33211 gene locus_tag LOCUS_13590 32279 33211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 34902 33268 gene locus_tag LOCUS_13600 gene groL 34902 33268 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_13600 35333 35040 gene locus_tag LOCUS_13610 gene groES 35333 35040 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_13610 36387 35731 gene locus_tag LOCUS_13620 36387 35731 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_13620 38892 36406 gene locus_tag LOCUS_13630 38892 36406 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_13630 39163 40647 gene locus_tag LOCUS_13640 39163 40647 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_13640 40686 40832 gene locus_tag LOCUS_13650 40686 40832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 41012 41422 gene locus_tag LOCUS_13660 41012 41422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 44654 41976 gene locus_tag LOCUS_13670 44654 41976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 44995 45765 gene locus_tag LOCUS_13680 44995 45765 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_13680 45762 47969 gene locus_tag LOCUS_13690 45762 47969 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927193.1 protein_id gnl|my_center|LOCUS_13690 48090 48743 gene locus_tag LOCUS_13700 48090 48743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 49739 48804 gene locus_tag LOCUS_13710 49739 48804 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838653.1 protein_id gnl|my_center|LOCUS_13710 50655 49747 gene locus_tag LOCUS_13720 50655 49747 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_13720 50600 50776 gene locus_tag LOCUS_13730 50600 50776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 51912 50788 gene locus_tag LOCUS_13740 51912 50788 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_13740 53151 52000 gene locus_tag LOCUS_13750 53151 52000 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_13750 54185 53154 gene locus_tag LOCUS_13760 54185 53154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 55636 54182 gene locus_tag LOCUS_13770 55636 54182 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803944.1 protein_id gnl|my_center|LOCUS_13770 56790 55633 gene locus_tag LOCUS_13780 56790 55633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 59384 56799 gene locus_tag LOCUS_13790 59384 56799 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838538.1 protein_id gnl|my_center|LOCUS_13790 59840 59601 gene locus_tag LOCUS_13800 59840 59601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 62297 59883 gene locus_tag LOCUS_13810 gene lon 62297 59883 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_13810 62398 62979 gene locus_tag LOCUS_13820 62398 62979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 63040 63807 gene locus_tag LOCUS_13830 63040 63807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 64023 65066 gene locus_tag LOCUS_13840 gene hrcA 64023 65066 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405071.1 protein_id gnl|my_center|LOCUS_13840 65109 65672 gene locus_tag LOCUS_13850 65109 65672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 65669 66829 gene locus_tag LOCUS_13860 gene dnaJ 65669 66829 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933150.1 protein_id gnl|my_center|LOCUS_13860 66909 67373 gene locus_tag LOCUS_13870 66909 67373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 67413 67883 gene locus_tag LOCUS_13880 67413 67883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 67911 68837 gene locus_tag LOCUS_13890 67911 68837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 68834 69391 gene locus_tag LOCUS_13900 gene rsmD 68834 69391 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_13900 69388 69885 gene locus_tag LOCUS_13910 gene coaD 69388 69885 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_13910 69951 70277 gene locus_tag LOCUS_13920 69951 70277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 71360 70356 gene locus_tag LOCUS_13930 71360 70356 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_13930 72246 71353 gene locus_tag LOCUS_13940 72246 71353 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_13940 73644 72280 gene locus_tag LOCUS_13950 73644 72280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 74847 73798 gene locus_tag LOCUS_13960 74847 73798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 78093 74920 gene locus_tag LOCUS_13970 78093 74920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 81227 78153 gene locus_tag LOCUS_13980 81227 78153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 82088 81354 gene locus_tag LOCUS_13990 82088 81354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 82499 82272 gene locus_tag LOCUS_14000 82499 82272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 82536 82608 gene locus_tag LOCUS_t00180 82536 82608 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 82713 83594 gene locus_tag LOCUS_14010 82713 83594 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_14010 83591 84235 gene locus_tag LOCUS_14020 83591 84235 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_14020 84381 84457 gene locus_tag LOCUS_t00190 84381 84457 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 84496 85188 gene locus_tag LOCUS_14030 84496 85188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 85430 86251 gene locus_tag LOCUS_14040 85430 86251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 86307 87863 gene locus_tag LOCUS_14050 86307 87863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 87947 88555 gene locus_tag LOCUS_14060 87947 88555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 88577 92458 gene locus_tag LOCUS_14070 88577 92458 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838293.1 protein_id gnl|my_center|LOCUS_14070 92536 94080 gene locus_tag LOCUS_14080 92536 94080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 94152 96686 gene locus_tag LOCUS_14090 94152 96686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 96690 97475 gene locus_tag LOCUS_14100 96690 97475 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949043.1 protein_id gnl|my_center|LOCUS_14100 100388 97593 gene locus_tag LOCUS_14110 100388 97593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 101551 100460 gene locus_tag LOCUS_14120 101551 100460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 106619 101562 gene locus_tag LOCUS_14130 106619 101562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 106953 109652 gene locus_tag LOCUS_14140 gene polA 106953 109652 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404381.1 protein_id gnl|my_center|LOCUS_14140 109652 110299 gene locus_tag LOCUS_14150 109652 110299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 110586 111998 gene locus_tag LOCUS_14160 gene gltX 110586 111998 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_14160 112056 112424 gene locus_tag LOCUS_14170 gene folB 112056 112424 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403527.1 protein_id gnl|my_center|LOCUS_14170 112411 113049 gene locus_tag LOCUS_14180 112411 113049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 113151 113810 gene locus_tag LOCUS_14190 113151 113810 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_14190 113810 114004 gene locus_tag LOCUS_14200 113810 114004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 114021 115157 gene locus_tag LOCUS_14210 gene waaF 114021 115157 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_14210 115162 116718 gene locus_tag LOCUS_14220 115162 116718 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_14220 116799 118301 gene locus_tag LOCUS_14230 116799 118301 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387048.1 protein_id gnl|my_center|LOCUS_14230 119276 118452 gene locus_tag LOCUS_14240 119276 118452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 120243 119515 gene locus_tag LOCUS_14250 120243 119515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 120458 123043 gene locus_tag LOCUS_14260 120458 123043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 125318 123153 gene locus_tag LOCUS_14270 125318 123153 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144130.1 protein_id gnl|my_center|LOCUS_14270 125714 125325 gene locus_tag LOCUS_14280 125714 125325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 125846 126064 gene locus_tag LOCUS_14290 125846 126064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 130407 126232 gene locus_tag LOCUS_14300 130407 126232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 133311 130441 gene locus_tag LOCUS_14310 133311 130441 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_14310 133648 135102 gene locus_tag LOCUS_14320 133648 135102 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_14320 136651 135233 gene locus_tag LOCUS_14330 136651 135233 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_14330 136840 139203 gene locus_tag LOCUS_14340 136840 139203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 139203 140891 gene locus_tag LOCUS_14350 139203 140891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 141651 140860 gene locus_tag LOCUS_14360 141651 140860 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390489.1 protein_id gnl|my_center|LOCUS_14360 141860 142927 gene locus_tag LOCUS_14370 141860 142927 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256131.1 protein_id gnl|my_center|LOCUS_14370 144220 143000 gene locus_tag LOCUS_14380 144220 143000 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_14380 145741 144260 gene locus_tag LOCUS_14390 145741 144260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 146355 145792 gene locus_tag LOCUS_14400 146355 145792 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391659.1 protein_id gnl|my_center|LOCUS_14400 147071 146436 gene locus_tag LOCUS_14410 147071 146436 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_14410 147756 147064 gene locus_tag LOCUS_14420 147756 147064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 148058 147753 gene locus_tag LOCUS_14430 148058 147753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 148640 148062 gene locus_tag LOCUS_14440 148640 148062 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404141.1 protein_id gnl|my_center|LOCUS_14440 148946 149464 gene locus_tag LOCUS_14450 gene rpoE 148946 149464 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_14450 149451 150419 gene locus_tag LOCUS_14460 149451 150419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 150422 151891 gene locus_tag LOCUS_14470 150422 151891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 151891 152553 gene locus_tag LOCUS_14480 151891 152553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 152594 153724 gene locus_tag LOCUS_14490 152594 153724 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925698.1 protein_id gnl|my_center|LOCUS_14490 153755 154243 gene locus_tag LOCUS_14500 153755 154243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 155380 154316 gene locus_tag LOCUS_14510 155380 154316 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868771.1 protein_id gnl|my_center|LOCUS_14510 156963 155389 gene locus_tag LOCUS_14520 156963 155389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 157106 159169 gene locus_tag LOCUS_14530 157106 159169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 159209 160579 gene locus_tag LOCUS_14540 159209 160579 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_14540 160742 161119 gene locus_tag LOCUS_14550 160742 161119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 161116 162441 gene locus_tag LOCUS_14560 161116 162441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 163549 162623 gene locus_tag LOCUS_14570 163549 162623 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_14570 163636 165120 gene locus_tag LOCUS_14580 163636 165120 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_14580 165138 166229 gene locus_tag LOCUS_14590 165138 166229 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_14590 166804 166226 gene locus_tag LOCUS_14600 166804 166226 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_14600 167402 166818 gene locus_tag LOCUS_14610 gene yihA 167402 166818 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 protein_id gnl|my_center|LOCUS_14610 168320 167469 gene locus_tag LOCUS_14620 168320 167469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 169343 168342 gene locus_tag LOCUS_14630 169343 168342 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061621.1 protein_id gnl|my_center|LOCUS_14630 169864 169478 gene locus_tag LOCUS_14640 gene rpsK 169864 169478 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923548.1 protein_id gnl|my_center|LOCUS_14640 170283 169903 gene locus_tag LOCUS_14650 gene rpsM 170283 169903 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963448.1 protein_id gnl|my_center|LOCUS_14650 170675 170457 gene locus_tag LOCUS_14660 gene infA 170675 170457 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_14660 171417 170668 gene locus_tag LOCUS_14670 gene map 171417 170668 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_14670 172818 171478 gene locus_tag LOCUS_14680 gene secY 172818 171478 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_14680 173301 172834 gene locus_tag LOCUS_14690 gene rplO 173301 172834 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963451.1 protein_id gnl|my_center|LOCUS_14690 173519 173334 gene locus_tag LOCUS_14700 gene rpmD 173519 173334 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_14700 174058 173537 gene locus_tag LOCUS_14710 gene rpsE 174058 173537 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933825.1 protein_id gnl|my_center|LOCUS_14710 174459 174085 gene locus_tag LOCUS_14720 gene rplR 174459 174085 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938614.1 protein_id gnl|my_center|LOCUS_14720 175033 174494 gene locus_tag LOCUS_14730 gene rplF 175033 174494 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_14730 175448 175059 gene locus_tag LOCUS_14740 gene rpsH 175448 175059 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_14740 175670 175485 gene locus_tag LOCUS_14750 175670 175485 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_14750 176337 175705 gene locus_tag LOCUS_14760 gene rplE 176337 175705 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 protein_id gnl|my_center|LOCUS_14760 176692 176366 gene locus_tag LOCUS_14770 gene rplX 176692 176366 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_14770 177091 176723 gene locus_tag LOCUS_14780 gene rplN 177091 176723 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_14780 177390 177109 gene locus_tag LOCUS_14790 gene rpsQ 177390 177109 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357552.1 protein_id gnl|my_center|LOCUS_14790 177596 177393 gene locus_tag LOCUS_14800 gene rpmC 177596 177393 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_14800 178036 177614 gene locus_tag LOCUS_14810 gene rplP 178036 177614 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_14810 178730 178077 gene locus_tag LOCUS_14820 gene rpsC 178730 178077 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403801.1 protein_id gnl|my_center|LOCUS_14820 179099 178749 gene locus_tag LOCUS_14830 gene rplV 179099 178749 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933837.1 protein_id gnl|my_center|LOCUS_14830 179403 179122 gene locus_tag LOCUS_14840 gene rpsS 179403 179122 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933838.1 protein_id gnl|my_center|LOCUS_14840 180218 179403 gene locus_tag LOCUS_14850 gene rplB 180218 179403 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_14850 180566 180279 gene locus_tag LOCUS_14860 gene rplW 180566 180279 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933840.1 protein_id gnl|my_center|LOCUS_14860 181229 180582 gene locus_tag LOCUS_14870 gene rplD 181229 180582 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_14870 181825 181226 gene locus_tag LOCUS_14880 gene rplC 181825 181226 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_14880 182189 181881 gene locus_tag LOCUS_14890 gene rpsJ 182189 181881 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403794.1 protein_id gnl|my_center|LOCUS_14890 183476 182265 gene locus_tag LOCUS_14900 gene tuf 183476 182265 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_14900 185618 183531 gene locus_tag LOCUS_14910 gene fusA 185618 183531 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_14910 186117 185650 gene locus_tag LOCUS_14920 gene rpsG 186117 185650 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403791.1 protein_id gnl|my_center|LOCUS_14920 186514 186140 gene locus_tag LOCUS_14930 gene rpsL 186514 186140 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_14930 191064 186703 gene locus_tag LOCUS_14940 gene rpoC 191064 186703 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404501.1 protein_id gnl|my_center|LOCUS_14940 194961 191131 gene locus_tag LOCUS_14950 gene rpoB 194961 191131 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_14950 195498 195118 gene locus_tag LOCUS_14960 gene rplL 195498 195118 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_14960 196087 195554 gene locus_tag LOCUS_14970 gene rplJ 196087 195554 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931847.1 protein_id gnl|my_center|LOCUS_14970 196886 196188 gene locus_tag LOCUS_14980 gene rplA 196886 196188 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_14980 197322 196897 gene locus_tag LOCUS_14990 gene rplK 197322 196897 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931845.1 protein_id gnl|my_center|LOCUS_14990 197912 197343 gene locus_tag LOCUS_15000 gene nusG 197912 197343 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404507.1 protein_id gnl|my_center|LOCUS_15000 198126 197938 gene locus_tag LOCUS_15010 198126 197938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 198233 198160 gene locus_tag LOCUS_t00200 198233 198160 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 198408 198241 gene locus_tag LOCUS_15020 gene rpmG 198408 198241 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_15020 198530 198457 gene locus_tag LOCUS_t00210 198530 198457 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 198607 198532 gene locus_tag LOCUS_t00220 198607 198532 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 198721 198638 gene locus_tag LOCUS_t00230 198721 198638 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 198807 198734 gene locus_tag LOCUS_t00240 198807 198734 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 199709 198906 gene locus_tag LOCUS_15030 199709 198906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 200690 199740 gene locus_tag LOCUS_15040 gene miaA 200690 199740 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_15040 201348 200692 gene locus_tag LOCUS_15050 201348 200692 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404680.1 protein_id gnl|my_center|LOCUS_15050 202169 201345 gene locus_tag LOCUS_15060 gene cdaA 202169 201345 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_15060 203025 202159 gene locus_tag LOCUS_15070 gene folP 203025 202159 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311155.1 protein_id gnl|my_center|LOCUS_15070 206034 203209 gene locus_tag LOCUS_15080 206034 203209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 206309 209233 gene locus_tag LOCUS_15090 206309 209233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 213746 209460 gene locus_tag LOCUS_15100 213746 209460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence08 16 1332 gene locus_tag LOCUS_15110 16 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4561 4247 gene locus_tag LOCUS_15120 4561 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5948 5754 gene locus_tag LOCUS_15130 5948 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6373 8430 gene locus_tag LOCUS_15140 6373 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 10138 11310 gene locus_tag LOCUS_15150 10138 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 11470 13404 gene locus_tag LOCUS_15160 11470 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 14581 13424 gene locus_tag LOCUS_15170 14581 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 15499 14672 gene locus_tag LOCUS_15180 15499 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 16169 15501 gene locus_tag LOCUS_15190 16169 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 17486 16515 gene locus_tag LOCUS_15200 17486 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 18724 17633 gene locus_tag LOCUS_15210 18724 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 20412 19312 gene locus_tag LOCUS_15220 20412 19312 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311516.1 protein_id gnl|my_center|LOCUS_15220 21419 20412 gene locus_tag LOCUS_15230 21419 20412 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873305.1 protein_id gnl|my_center|LOCUS_15230 22543 21416 gene locus_tag LOCUS_15240 22543 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 25233 22534 gene locus_tag LOCUS_15250 25233 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 26162 25230 gene locus_tag LOCUS_15260 26162 25230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 27100 26159 gene locus_tag LOCUS_15270 27100 26159 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_15270 28235 27111 gene locus_tag LOCUS_15280 28235 27111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 29127 28396 gene locus_tag LOCUS_15290 29127 28396 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 protein_id gnl|my_center|LOCUS_15290 30114 29629 gene locus_tag LOCUS_15300 30114 29629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 30377 30183 gene locus_tag LOCUS_15310 30377 30183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 30530 32227 gene locus_tag LOCUS_15320 30530 32227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 32286 33230 gene locus_tag LOCUS_15330 32286 33230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 33507 33202 gene locus_tag LOCUS_15340 33507 33202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 33662 34708 gene locus_tag LOCUS_15350 33662 34708 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_15350 34718 35875 gene locus_tag LOCUS_15360 34718 35875 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_15360 35875 36273 gene locus_tag LOCUS_15370 35875 36273 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_15370 36648 36283 gene locus_tag LOCUS_15380 36648 36283 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392702.1 protein_id gnl|my_center|LOCUS_15380 38531 36687 gene locus_tag LOCUS_15390 38531 36687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 40059 38584 gene locus_tag LOCUS_15400 40059 38584 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721321.1 protein_id gnl|my_center|LOCUS_15400 42029 40056 gene locus_tag LOCUS_15410 gene asnB 42029 40056 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_15410 43210 42029 gene locus_tag LOCUS_15420 43210 42029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 44417 43200 gene locus_tag LOCUS_15430 44417 43200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 45373 44417 gene locus_tag LOCUS_15440 45373 44417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 46862 45321 gene locus_tag LOCUS_15450 46862 45321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 48304 46859 gene locus_tag LOCUS_15460 48304 46859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 49630 48323 gene locus_tag LOCUS_15470 49630 48323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 51206 49638 gene locus_tag LOCUS_15480 51206 49638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 51390 51304 gene locus_tag LOCUS_t00250 51390 51304 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 52753 51527 gene locus_tag LOCUS_15490 gene argJ 52753 51527 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_15490 53910 52858 gene locus_tag LOCUS_15500 gene argC 53910 52858 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 protein_id gnl|my_center|LOCUS_15500 55037 53907 gene locus_tag LOCUS_15510 55037 53907 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_15510 56054 55110 gene locus_tag LOCUS_15520 gene argB 56054 55110 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_15520 58533 56125 gene locus_tag LOCUS_15530 58533 56125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 59301 58543 gene locus_tag LOCUS_15540 59301 58543 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_15540 59460 59387 gene locus_tag LOCUS_t00260 59460 59387 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 59654 60355 gene locus_tag LOCUS_15550 59654 60355 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_15550 60367 61647 gene locus_tag LOCUS_15560 60367 61647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 62628 61690 gene locus_tag LOCUS_15570 62628 61690 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_15570 65591 62724 gene locus_tag LOCUS_15580 65591 62724 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404818.1 protein_id gnl|my_center|LOCUS_15580 65910 65638 gene locus_tag LOCUS_15590 65910 65638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 66679 65984 gene locus_tag LOCUS_15600 66679 65984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_15600 68048 66831 gene locus_tag LOCUS_15610 68048 66831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402810.1 protein_id gnl|my_center|LOCUS_15610 69305 68091 gene locus_tag LOCUS_15620 69305 68091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404265.1 protein_id gnl|my_center|LOCUS_15620 70394 69324 gene locus_tag LOCUS_15630 gene prfB 70394 69324 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_15630 70708 70451 gene locus_tag LOCUS_15640 70708 70451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 71651 70689 gene locus_tag LOCUS_15650 71651 70689 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404164.1 protein_id gnl|my_center|LOCUS_15650 72575 71787 gene locus_tag LOCUS_15660 72575 71787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 72907 72626 gene locus_tag LOCUS_15670 72907 72626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 74105 73092 gene locus_tag LOCUS_15680 gene dusB 74105 73092 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_15680 75349 74102 gene locus_tag LOCUS_15690 75349 74102 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_15690 76502 75342 gene locus_tag LOCUS_15700 gene wecB 76502 75342 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_15700 77559 76600 gene locus_tag LOCUS_15710 77559 76600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 78975 77632 gene locus_tag LOCUS_15720 78975 77632 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544945.1 protein_id gnl|my_center|LOCUS_15720 79351 79127 gene locus_tag LOCUS_15730 gene rpsT 79351 79127 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895949.1 protein_id gnl|my_center|LOCUS_15730 85646 79452 gene locus_tag LOCUS_15740 85646 79452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 87051 85807 gene locus_tag LOCUS_15750 87051 85807 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005032135.1 protein_id gnl|my_center|LOCUS_15750 90298 87464 gene locus_tag LOCUS_15760 90298 87464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 91479 90391 gene locus_tag LOCUS_15770 91479 90391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 96570 91492 gene locus_tag LOCUS_15780 96570 91492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 96867 99779 gene locus_tag LOCUS_15790 96867 99779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 99769 102981 gene locus_tag LOCUS_15800 99769 102981 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839229.1 protein_id gnl|my_center|LOCUS_15800 106080 103063 gene locus_tag LOCUS_15810 106080 103063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 106248 107048 gene locus_tag LOCUS_15820 106248 107048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 107836 107135 gene locus_tag LOCUS_15830 107836 107135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 108652 107993 gene locus_tag LOCUS_15840 108652 107993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 108967 110352 gene locus_tag LOCUS_15850 108967 110352 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_15850 110600 111565 gene locus_tag LOCUS_15860 110600 111565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 111562 112458 gene locus_tag LOCUS_15870 111562 112458 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_15870 114354 112462 gene locus_tag LOCUS_15880 114354 112462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 116233 114359 gene locus_tag LOCUS_15890 116233 114359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 117193 116336 gene locus_tag LOCUS_15900 117193 116336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 119774 117336 gene locus_tag LOCUS_15910 119774 117336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 119966 119844 gene locus_tag LOCUS_15920 119966 119844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 120066 121304 gene locus_tag LOCUS_15930 120066 121304 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964839.1 protein_id gnl|my_center|LOCUS_15930 121927 121544 gene locus_tag LOCUS_15940 gene tnpA 121927 121544 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_15940 124324 122441 gene locus_tag LOCUS_15950 124324 122441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 124356 124538 gene locus_tag LOCUS_15960 124356 124538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 124934 127759 gene locus_tag LOCUS_15970 124934 127759 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_15970 130849 127775 gene locus_tag LOCUS_15980 130849 127775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 131326 130859 gene locus_tag LOCUS_15990 131326 130859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 132355 131351 gene locus_tag LOCUS_16000 132355 131351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 133247 132828 gene locus_tag LOCUS_16010 133247 132828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 134384 133488 gene locus_tag LOCUS_16020 134384 133488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 134710 134901 gene locus_tag LOCUS_16030 134710 134901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 134979 136466 gene locus_tag LOCUS_16040 134979 136466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 138556 136463 gene locus_tag LOCUS_16050 138556 136463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 145464 138784 gene locus_tag LOCUS_16060 145464 138784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 145938 147137 gene locus_tag LOCUS_16070 145938 147137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 147134 148594 gene locus_tag LOCUS_16080 147134 148594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 148591 150075 gene locus_tag LOCUS_16090 148591 150075 CDS product O-unit flippase Wzx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461036.1 protein_id gnl|my_center|LOCUS_16090 150143 151048 gene locus_tag LOCUS_16100 150143 151048 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030726.1 protein_id gnl|my_center|LOCUS_16100 151041 152234 gene locus_tag LOCUS_16110 151041 152234 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_16110 152363 153685 gene locus_tag LOCUS_16120 152363 153685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 153682 155346 gene locus_tag LOCUS_16130 153682 155346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 161197 155549 gene locus_tag LOCUS_16140 161197 155549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 163832 161703 gene locus_tag LOCUS_16150 163832 161703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 164732 164079 gene locus_tag LOCUS_16160 164732 164079 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_16160 167568 164725 gene locus_tag LOCUS_16170 167568 164725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 169766 167637 gene locus_tag LOCUS_16180 169766 167637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 175423 169769 gene locus_tag LOCUS_16190 175423 169769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 179019 176284 gene locus_tag LOCUS_16200 179019 176284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 179194 179382 gene locus_tag LOCUS_16210 179194 179382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 185396 179325 gene locus_tag LOCUS_16220 185396 179325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 185936 187324 gene locus_tag LOCUS_16230 185936 187324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 187321 188121 gene locus_tag LOCUS_16240 187321 188121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 189731 188262 gene locus_tag LOCUS_16250 189731 188262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 193353 190189 gene locus_tag LOCUS_16260 193353 190189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 195074 196240 gene locus_tag LOCUS_16270 195074 196240 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_16270 196505 196326 gene locus_tag LOCUS_16280 196505 196326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 200523 196903 gene locus_tag LOCUS_16290 200523 196903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 200630 200896 gene locus_tag LOCUS_16300 200630 200896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 201661 201882 gene locus_tag LOCUS_16310 201661 201882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence09 <1 570 gene locus_tag LOCUS_16320 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942479.1:type I glutamate--ammonia ligase 1346 801 gene locus_tag LOCUS_16330 1346 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1526 2590 gene locus_tag LOCUS_16340 1526 2590 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_16340 2583 3227 gene locus_tag LOCUS_16350 2583 3227 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_16350 3311 3856 gene locus_tag LOCUS_16360 3311 3856 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_16360 4010 4369 gene locus_tag LOCUS_16370 4010 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 5048 4476 gene locus_tag LOCUS_16380 5048 4476 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_16380 5225 5791 gene locus_tag LOCUS_16390 5225 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 6600 5878 gene locus_tag LOCUS_16400 gene rlmB 6600 5878 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200237.1 protein_id gnl|my_center|LOCUS_16400 8842 6740 gene locus_tag LOCUS_16410 gene recG 8842 6740 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933239.1 protein_id gnl|my_center|LOCUS_16410 9029 11083 gene locus_tag LOCUS_16420 9029 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 11087 12814 gene locus_tag LOCUS_16430 11087 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 12875 15766 gene locus_tag LOCUS_16440 12875 15766 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265846.1 protein_id gnl|my_center|LOCUS_16440 15766 16584 gene locus_tag LOCUS_16450 gene truA 15766 16584 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258260.1 protein_id gnl|my_center|LOCUS_16450 19100 16581 gene locus_tag LOCUS_16460 19100 16581 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_16460 20069 19131 gene locus_tag LOCUS_16470 20069 19131 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_16470 20526 20050 gene locus_tag LOCUS_16480 gene dtd 20526 20050 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_16480 21219 20602 gene locus_tag LOCUS_16490 21219 20602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 23945 21366 gene locus_tag LOCUS_16500 23945 21366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 24219 24755 gene locus_tag LOCUS_16510 24219 24755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 24755 26116 gene locus_tag LOCUS_16520 gene tilS 24755 26116 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404456.1 protein_id gnl|my_center|LOCUS_16520 26122 26700 gene locus_tag LOCUS_16530 gene hpt 26122 26700 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_16530 26716 28944 gene locus_tag LOCUS_16540 26716 28944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 28941 29618 gene locus_tag LOCUS_16550 28941 29618 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933377.1 protein_id gnl|my_center|LOCUS_16550 29620 30687 gene locus_tag LOCUS_16560 29620 30687 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_16560 30687 31652 gene locus_tag LOCUS_16570 30687 31652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 31649 32809 gene locus_tag LOCUS_16580 31649 32809 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_16580 32764 33726 gene locus_tag LOCUS_16590 32764 33726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 33723 34892 gene locus_tag LOCUS_16600 33723 34892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404922.1 protein_id gnl|my_center|LOCUS_16600 35170 36408 gene locus_tag LOCUS_16610 35170 36408 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_16610 36528 37496 gene locus_tag LOCUS_16620 36528 37496 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433612.1 protein_id gnl|my_center|LOCUS_16620 37733 40024 gene locus_tag LOCUS_16630 37733 40024 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_16630 40017 40529 gene locus_tag LOCUS_16640 40017 40529 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_16640 43484 40659 gene locus_tag LOCUS_16650 gene ppdK 43484 40659 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_16650 43838 44590 gene locus_tag LOCUS_16660 43838 44590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838431.1 protein_id gnl|my_center|LOCUS_16660 44587 45435 gene locus_tag LOCUS_16670 44587 45435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 46156 45476 gene locus_tag LOCUS_16680 46156 45476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 46527 46165 gene locus_tag LOCUS_16690 46527 46165 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_16690 46820 46536 gene locus_tag LOCUS_16700 46820 46536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 47642 46821 gene locus_tag LOCUS_16710 gene panB 47642 46821 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933009.1 protein_id gnl|my_center|LOCUS_16710 48415 47639 gene locus_tag LOCUS_16720 48415 47639 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986778.1 protein_id gnl|my_center|LOCUS_16720 49170 48415 gene locus_tag LOCUS_16730 gene pgeF 49170 48415 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_16730 50477 49176 gene locus_tag LOCUS_16740 gene megL 50477 49176 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_16740 50703 51260 gene locus_tag LOCUS_16750 50703 51260 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_16750 52259 51336 gene locus_tag LOCUS_16760 52259 51336 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258066.1 protein_id gnl|my_center|LOCUS_16760 52473 53525 gene locus_tag LOCUS_16770 52473 53525 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_16770 53768 54853 gene locus_tag LOCUS_16780 53768 54853 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376722.1 protein_id gnl|my_center|LOCUS_16780 54857 56107 gene locus_tag LOCUS_16790 54857 56107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481670.1 protein_id gnl|my_center|LOCUS_16790 56109 57362 gene locus_tag LOCUS_16800 56109 57362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481616.1 protein_id gnl|my_center|LOCUS_16800 58672 57500 gene locus_tag LOCUS_16810 58672 57500 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_16810 61226 58686 gene locus_tag LOCUS_16820 61226 58686 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_16820 61981 61223 gene locus_tag LOCUS_16830 61981 61223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_16830 63239 62223 gene locus_tag LOCUS_16840 gene cydB 63239 62223 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_16840 64737 63241 gene locus_tag LOCUS_16850 64737 63241 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_16850 64950 65246 gene locus_tag LOCUS_16860 64950 65246 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_16860 65277 65525 gene locus_tag LOCUS_16870 65277 65525 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393126.1 protein_id gnl|my_center|LOCUS_16870 65522 65944 gene locus_tag LOCUS_16880 65522 65944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 65949 66659 gene locus_tag LOCUS_16890 65949 66659 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_16890 66659 67951 gene locus_tag LOCUS_16900 66659 67951 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_16900 68712 68071 gene locus_tag LOCUS_16910 68712 68071 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_16910 69806 68727 gene locus_tag LOCUS_16920 gene arsB 69806 68727 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_16920 70213 69803 gene locus_tag LOCUS_16930 70213 69803 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095199.1 protein_id gnl|my_center|LOCUS_16930 70386 71537 gene locus_tag LOCUS_16940 70386 71537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 71658 72284 gene locus_tag LOCUS_16950 71658 72284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 72380 73126 gene locus_tag LOCUS_16960 72380 73126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 73233 73964 gene locus_tag LOCUS_16970 73233 73964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 73966 74358 gene locus_tag LOCUS_16980 73966 74358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 75204 74467 gene locus_tag LOCUS_16990 gene bshB1 75204 74467 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_16990 78170 75201 gene locus_tag LOCUS_17000 78170 75201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 78399 78569 gene locus_tag LOCUS_17010 78399 78569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 78581 78814 gene locus_tag LOCUS_17020 gene rpmE 78581 78814 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545159.1 protein_id gnl|my_center|LOCUS_17020 78811 79071 gene locus_tag LOCUS_17030 gene rpsR 78811 79071 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549366.1 protein_id gnl|my_center|LOCUS_17030 79098 79322 gene locus_tag LOCUS_17040 gene rpmB 79098 79322 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_17040 79579 80313 gene locus_tag LOCUS_17050 79579 80313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 80604 81065 gene locus_tag LOCUS_17060 80604 81065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 81223 81315 gene locus_tag LOCUS_t00270 81223 81315 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 81557 84832 gene locus_tag LOCUS_17070 81557 84832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 86875 84923 gene locus_tag LOCUS_17080 86875 84923 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_17080 87248 91051 gene locus_tag LOCUS_17090 87248 91051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 91370 91200 gene locus_tag LOCUS_17100 91370 91200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 91348 91671 gene locus_tag LOCUS_17110 91348 91671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 92272 91784 gene locus_tag LOCUS_17120 92272 91784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 93359 92358 gene locus_tag LOCUS_17130 93359 92358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 93633 94514 gene locus_tag LOCUS_17140 93633 94514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 94781 95434 gene locus_tag LOCUS_17150 94781 95434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 95608 96642 gene locus_tag LOCUS_17160 95608 96642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 96649 97404 gene locus_tag LOCUS_17170 96649 97404 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_17170 99019 97445 gene locus_tag LOCUS_17180 99019 97445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 99997 99095 gene locus_tag LOCUS_17190 99997 99095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 100930 100031 gene locus_tag LOCUS_17200 100930 100031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 101050 103650 gene locus_tag LOCUS_17210 101050 103650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 104060 103668 gene locus_tag LOCUS_17220 104060 103668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 104319 106097 gene locus_tag LOCUS_17230 104319 106097 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_17230 106108 106971 gene locus_tag LOCUS_17240 106108 106971 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_17240 109490 107034 gene locus_tag LOCUS_17250 109490 107034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 109813 111510 gene locus_tag LOCUS_17260 109813 111510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 111544 114075 gene locus_tag LOCUS_17270 111544 114075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 115414 114146 gene locus_tag LOCUS_17280 gene alr 115414 114146 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982425.1 protein_id gnl|my_center|LOCUS_17280 115528 116610 gene locus_tag LOCUS_17290 115528 116610 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111129.1 protein_id gnl|my_center|LOCUS_17290 117145 116570 gene locus_tag LOCUS_17300 117145 116570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 117261 121070 gene locus_tag LOCUS_17310 117261 121070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 121658 121122 gene locus_tag LOCUS_17320 121658 121122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 121808 124129 gene locus_tag LOCUS_17330 121808 124129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 124922 124377 gene locus_tag LOCUS_17340 124922 124377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 125420 126946 gene locus_tag LOCUS_17350 125420 126946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 127033 127782 gene locus_tag LOCUS_17360 127033 127782 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_17360 127866 130412 gene locus_tag LOCUS_17370 127866 130412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 132867 130528 gene locus_tag LOCUS_17380 132867 130528 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_17380 132978 133724 gene locus_tag LOCUS_17390 132978 133724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 133736 134353 gene locus_tag LOCUS_17400 133736 134353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 134759 135037 gene locus_tag LOCUS_17410 134759 135037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 135356 135526 gene locus_tag LOCUS_17420 135356 135526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 135530 136900 gene locus_tag LOCUS_17430 135530 136900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 137448 138791 gene locus_tag LOCUS_17440 137448 138791 CDS product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 protein_id gnl|my_center|LOCUS_17440 138922 139524 gene locus_tag LOCUS_17450 138922 139524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 139617 139940 gene locus_tag LOCUS_17460 139617 139940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 140191 139937 gene locus_tag LOCUS_17470 140191 139937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 141760 140234 gene locus_tag LOCUS_17480 141760 140234 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_17480 141984 143036 gene locus_tag LOCUS_17490 141984 143036 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073502.1 protein_id gnl|my_center|LOCUS_17490 144130 143057 gene locus_tag LOCUS_17500 144130 143057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 144536 144132 gene locus_tag LOCUS_17510 144536 144132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 145685 144645 gene locus_tag LOCUS_17520 145685 144645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 146138 145827 gene locus_tag LOCUS_17530 146138 145827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 146846 149827 gene locus_tag LOCUS_17540 146846 149827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 151888 149897 gene locus_tag LOCUS_17550 gene cerN 151888 149897 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_17550 152421 154283 gene locus_tag LOCUS_17560 152421 154283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 154428 157718 gene locus_tag LOCUS_17570 154428 157718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 158068 158895 gene locus_tag LOCUS_17580 158068 158895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 159477 159148 gene locus_tag LOCUS_17590 159477 159148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 160326 159856 gene locus_tag LOCUS_17600 160326 159856 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_17600 160504 161457 gene locus_tag LOCUS_17610 160504 161457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 161457 162644 gene locus_tag LOCUS_17620 gene rlmI 161457 162644 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116317.1 protein_id gnl|my_center|LOCUS_17620 163856 162717 gene locus_tag LOCUS_17630 163856 162717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 164074 165873 gene locus_tag LOCUS_17640 164074 165873 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 protein_id gnl|my_center|LOCUS_17640 166017 167426 gene locus_tag LOCUS_17650 gene atpD 166017 167426 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_17650 167438 167845 gene locus_tag LOCUS_17660 167438 167845 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_17660 167951 169036 gene locus_tag LOCUS_17670 167951 169036 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_17670 169085 169519 gene locus_tag LOCUS_17680 169085 169519 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112869.1 protein_id gnl|my_center|LOCUS_17680 169548 171035 gene locus_tag LOCUS_17690 169548 171035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 171401 171153 gene locus_tag LOCUS_17700 171401 171153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 171321 171566 gene locus_tag LOCUS_17710 171321 171566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 171666 171749 gene locus_tag LOCUS_t00280 171666 171749 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 172992 171910 gene locus_tag LOCUS_17720 172992 171910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 173501 173085 gene locus_tag LOCUS_17730 173501 173085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 173824 173513 gene locus_tag LOCUS_17740 173824 173513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 175623 173845 gene locus_tag LOCUS_17750 175623 173845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 177199 175802 gene locus_tag LOCUS_17760 177199 175802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 177374 177910 gene locus_tag LOCUS_17770 177374 177910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 177879 178397 gene locus_tag LOCUS_17780 177879 178397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 178394 179167 gene locus_tag LOCUS_17790 178394 179167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 179170 179472 gene locus_tag LOCUS_17800 179170 179472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 179544 180128 gene locus_tag LOCUS_17810 gene radC 179544 180128 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013390.1 protein_id gnl|my_center|LOCUS_17810 180133 180594 gene locus_tag LOCUS_17820 180133 180594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 180922 181485 gene locus_tag LOCUS_17830 180922 181485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 181767 183167 gene locus_tag LOCUS_17840 181767 183167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 183195 187331 gene locus_tag LOCUS_17850 183195 187331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 190277 187932 gene locus_tag LOCUS_17860 190277 187932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 190488 190198 gene locus_tag LOCUS_17870 190488 190198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence10 363 815 gene locus_tag LOCUS_17880 363 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1532 918 gene locus_tag LOCUS_17890 1532 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1799 2386 gene locus_tag LOCUS_17900 1799 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2511 2840 gene locus_tag LOCUS_17910 2511 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3693 2842 gene locus_tag LOCUS_17920 3693 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4015 4479 gene locus_tag LOCUS_17930 4015 4479 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891185.1 protein_id gnl|my_center|LOCUS_17930 4470 5066 gene locus_tag LOCUS_17940 4470 5066 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_17940 5167 6876 gene locus_tag LOCUS_17950 5167 6876 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475821.1 protein_id gnl|my_center|LOCUS_17950 6964 7476 gene locus_tag LOCUS_17960 gene ftnA 6964 7476 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467599.1 protein_id gnl|my_center|LOCUS_17960 7694 8305 gene locus_tag LOCUS_17970 7694 8305 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_17970 11143 8306 gene locus_tag LOCUS_17980 11143 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 13058 11274 gene locus_tag LOCUS_17990 13058 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 14131 13055 gene locus_tag LOCUS_18000 14131 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 15404 14133 gene locus_tag LOCUS_18010 gene murA 15404 14133 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932242.1 protein_id gnl|my_center|LOCUS_18010 15490 16422 gene locus_tag LOCUS_18020 15490 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 16441 17988 gene locus_tag LOCUS_18030 16441 17988 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_18030 19470 18031 gene locus_tag LOCUS_18040 19470 18031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 19601 20056 gene locus_tag LOCUS_18050 19601 20056 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_18050 20191 20859 gene locus_tag LOCUS_18060 20191 20859 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_18060 20856 22268 gene locus_tag LOCUS_18070 20856 22268 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061914.1 protein_id gnl|my_center|LOCUS_18070 22252 22998 gene locus_tag LOCUS_18080 22252 22998 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942266.1 protein_id gnl|my_center|LOCUS_18080 23020 23553 gene locus_tag LOCUS_18090 23020 23553 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_18090 23593 25563 gene locus_tag LOCUS_18100 23593 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 25611 26978 gene locus_tag LOCUS_18110 25611 26978 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529380.1 protein_id gnl|my_center|LOCUS_18110 27037 30810 gene locus_tag LOCUS_18120 27037 30810 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_18120 30827 31933 gene locus_tag LOCUS_18130 30827 31933 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_18130 33084 31957 gene locus_tag LOCUS_18140 33084 31957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 34018 33092 gene locus_tag LOCUS_18150 34018 33092 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_18150 34392 34000 gene locus_tag LOCUS_18160 34392 34000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 34961 34551 gene locus_tag LOCUS_18170 34961 34551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 35515 34997 gene locus_tag LOCUS_18180 35515 34997 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932442.1 protein_id gnl|my_center|LOCUS_18180 36518 35673 gene locus_tag LOCUS_18190 36518 35673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 36811 36518 gene locus_tag LOCUS_18200 36811 36518 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_18200 37725 36835 gene locus_tag LOCUS_18210 gene sppA 37725 36835 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_18210 37954 38595 gene locus_tag LOCUS_18220 gene plsY 37954 38595 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965795.1 protein_id gnl|my_center|LOCUS_18220 38610 39773 gene locus_tag LOCUS_18230 38610 39773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 39784 41079 gene locus_tag LOCUS_18240 gene purB 39784 41079 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_18240 41346 41849 gene locus_tag LOCUS_18250 41346 41849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 41833 43353 gene locus_tag LOCUS_18260 41833 43353 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_18260 43350 43973 gene locus_tag LOCUS_18270 43350 43973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 44010 45806 gene locus_tag LOCUS_18280 44010 45806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 45831 48377 gene locus_tag LOCUS_18290 45831 48377 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015337756.1 protein_id gnl|my_center|LOCUS_18290 48377 49459 gene locus_tag LOCUS_18300 48377 49459 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967816.1 protein_id gnl|my_center|LOCUS_18300 49478 50788 gene locus_tag LOCUS_18310 49478 50788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 50869 51546 gene locus_tag LOCUS_18320 50869 51546 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_18320 51543 52544 gene locus_tag LOCUS_18330 51543 52544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 52752 53168 gene locus_tag LOCUS_18340 52752 53168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 53379 53795 gene locus_tag LOCUS_18350 53379 53795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 54020 55465 gene locus_tag LOCUS_18360 54020 55465 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840114.1 protein_id gnl|my_center|LOCUS_18360 55443 57218 gene locus_tag LOCUS_18370 55443 57218 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404025.1 protein_id gnl|my_center|LOCUS_18370 57280 57801 gene locus_tag LOCUS_18380 57280 57801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 57814 58452 gene locus_tag LOCUS_18390 57814 58452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 58468 59496 gene locus_tag LOCUS_18400 58468 59496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 59707 61026 gene locus_tag LOCUS_18410 59707 61026 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838690.1 protein_id gnl|my_center|LOCUS_18410 61106 62815 gene locus_tag LOCUS_18420 61106 62815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 62828 63736 gene locus_tag LOCUS_18430 62828 63736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 63747 65024 gene locus_tag LOCUS_18440 63747 65024 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404032.1 protein_id gnl|my_center|LOCUS_18440 65094 67793 gene locus_tag LOCUS_18450 65094 67793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 68008 69540 gene locus_tag LOCUS_18460 68008 69540 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_18460 69758 70267 gene locus_tag LOCUS_18470 69758 70267 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085437.1 protein_id gnl|my_center|LOCUS_18470 71646 70246 gene locus_tag LOCUS_18480 71646 70246 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932225.1 protein_id gnl|my_center|LOCUS_18480 71761 72393 gene locus_tag LOCUS_18490 gene upp 71761 72393 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262598.1 protein_id gnl|my_center|LOCUS_18490 72390 73067 gene locus_tag LOCUS_18500 72390 73067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 76811 73158 gene locus_tag LOCUS_18510 76811 73158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 77139 77876 gene locus_tag LOCUS_18520 77139 77876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 77940 79157 gene locus_tag LOCUS_18530 77940 79157 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839310.1 protein_id gnl|my_center|LOCUS_18530 80038 79100 gene locus_tag LOCUS_18540 80038 79100 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926799.1 protein_id gnl|my_center|LOCUS_18540 80865 80035 gene locus_tag LOCUS_18550 gene prmA 80865 80035 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403587.1 protein_id gnl|my_center|LOCUS_18550 81790 80867 gene locus_tag LOCUS_18560 81790 80867 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_18560 85031 82008 gene locus_tag LOCUS_18570 85031 82008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 86270 85221 gene locus_tag LOCUS_18580 86270 85221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_18580 86414 88066 gene locus_tag LOCUS_18590 86414 88066 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_18590 88070 88960 gene locus_tag LOCUS_18600 88070 88960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 88923 90290 gene locus_tag LOCUS_18610 88923 90290 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_18610 90662 90291 gene locus_tag LOCUS_18620 90662 90291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 90661 91542 gene locus_tag LOCUS_18630 90661 91542 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082238.1 protein_id gnl|my_center|LOCUS_18630 92850 91525 gene locus_tag LOCUS_18640 92850 91525 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141561.1 protein_id gnl|my_center|LOCUS_18640 94511 92847 gene locus_tag LOCUS_18650 94511 92847 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143058.1 protein_id gnl|my_center|LOCUS_18650 94498 94761 gene locus_tag LOCUS_18660 94498 94761 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583748.1 protein_id gnl|my_center|LOCUS_18660 94758 95249 gene locus_tag LOCUS_18670 gene ispF 94758 95249 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404396.1 protein_id gnl|my_center|LOCUS_18670 95256 95885 gene locus_tag LOCUS_18680 95256 95885 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421523.1 protein_id gnl|my_center|LOCUS_18680 95895 96482 gene locus_tag LOCUS_18690 95895 96482 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_18690 96479 98140 gene locus_tag LOCUS_18700 gene lnt 96479 98140 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_18700 98137 99174 gene locus_tag LOCUS_18710 gene ltaE 98137 99174 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_18710 99171 99641 gene locus_tag LOCUS_18720 99171 99641 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880969.1 protein_id gnl|my_center|LOCUS_18720 100393 99848 gene locus_tag LOCUS_18730 100393 99848 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_18730 101657 100434 gene locus_tag LOCUS_18740 gene tyrS 101657 100434 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932250.1 protein_id gnl|my_center|LOCUS_18740 102109 101654 gene locus_tag LOCUS_18750 gene smpB 102109 101654 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_18750 102258 102701 gene locus_tag LOCUS_18760 102258 102701 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_18760 102750 104021 gene locus_tag LOCUS_18770 gene nusA 102750 104021 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839192.1 protein_id gnl|my_center|LOCUS_18770 104051 106963 gene locus_tag LOCUS_18780 104051 106963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 106966 107319 gene locus_tag LOCUS_18790 gene rbfA 106966 107319 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_18790 107316 108068 gene locus_tag LOCUS_18800 gene truB 107316 108068 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931935.1 protein_id gnl|my_center|LOCUS_18800 108046 109017 gene locus_tag LOCUS_18810 108046 109017 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_18810 109031 109300 gene locus_tag LOCUS_18820 gene rpsO 109031 109300 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_18820 109343 111577 gene locus_tag LOCUS_18830 109343 111577 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933313.1 protein_id gnl|my_center|LOCUS_18830 111616 111918 gene locus_tag LOCUS_18840 111616 111918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 113359 111902 gene locus_tag LOCUS_18850 gene dacB 113359 111902 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_18850 113337 114662 gene locus_tag LOCUS_18860 113337 114662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 114731 117790 gene locus_tag LOCUS_18870 gene secA 114731 117790 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_18870 117887 118561 gene locus_tag LOCUS_18880 117887 118561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 118595 119296 gene locus_tag LOCUS_18890 118595 119296 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_18890 119518 120213 gene locus_tag LOCUS_18900 119518 120213 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_18900 120253 120762 gene locus_tag LOCUS_18910 120253 120762 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_18910 120775 121188 gene locus_tag LOCUS_18920 120775 121188 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_18920 121228 121716 gene locus_tag LOCUS_18930 121228 121716 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_18930 121717 124101 gene locus_tag LOCUS_18940 121717 124101 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403423.1 protein_id gnl|my_center|LOCUS_18940 124273 125793 gene locus_tag LOCUS_18950 gene accC 124273 125793 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_18950 125790 126296 gene locus_tag LOCUS_18960 125790 126296 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_18960 126323 127600 gene locus_tag LOCUS_18970 126323 127600 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_18970 127614 128951 gene locus_tag LOCUS_18980 127614 128951 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404687.1 protein_id gnl|my_center|LOCUS_18980 129190 131418 gene locus_tag LOCUS_18990 gene purL 129190 131418 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_18990 131415 132470 gene locus_tag LOCUS_19000 131415 132470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 133395 132448 gene locus_tag LOCUS_19010 133395 132448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 134254 133496 gene locus_tag LOCUS_19020 134254 133496 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_19020 135604 134300 gene locus_tag LOCUS_19030 135604 134300 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_19030 135900 137672 gene locus_tag LOCUS_19040 135900 137672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_19040 137676 141134 gene locus_tag LOCUS_19050 137676 141134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 141138 142130 gene locus_tag LOCUS_19060 141138 142130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 142142 143287 gene locus_tag LOCUS_19070 142142 143287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 143296 144354 gene locus_tag LOCUS_19080 143296 144354 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942890.1 protein_id gnl|my_center|LOCUS_19080 144413 145651 gene locus_tag LOCUS_19090 144413 145651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 145663 147021 gene locus_tag LOCUS_19100 145663 147021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 147018 147593 gene locus_tag LOCUS_19110 147018 147593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 147590 148669 gene locus_tag LOCUS_19120 147590 148669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 148666 149202 gene locus_tag LOCUS_19130 148666 149202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 149276 150076 gene locus_tag LOCUS_19140 149276 150076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 150108 150881 gene locus_tag LOCUS_19150 150108 150881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 150890 151675 gene locus_tag LOCUS_19160 150890 151675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 151988 151725 gene locus_tag LOCUS_19170 151988 151725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 152115 153407 gene locus_tag LOCUS_19180 152115 153407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 153639 153869 gene locus_tag LOCUS_19190 153639 153869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 153907 154674 gene locus_tag LOCUS_19200 153907 154674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 154883 156016 gene locus_tag LOCUS_19210 154883 156016 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_19210 156658 156017 gene locus_tag LOCUS_19220 gene ribE 156658 156017 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 protein_id gnl|my_center|LOCUS_19220 <157578 156662 gene locus_tag LOCUS_19230 <157578 156662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932429.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD >Feature sequence11 7299 4411 gene locus_tag LOCUS_19240 7299 4411 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041505.1 protein_id gnl|my_center|LOCUS_19240 8384 7296 gene locus_tag LOCUS_19250 8384 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 13225 8705 gene locus_tag LOCUS_19260 13225 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 13812 16646 gene locus_tag LOCUS_19270 13812 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 16857 18491 gene locus_tag LOCUS_19280 16857 18491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 18687 19247 gene locus_tag LOCUS_19290 18687 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 19232 20605 gene locus_tag LOCUS_19300 19232 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 20610 21389 gene locus_tag LOCUS_19310 20610 21389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 21386 22591 gene locus_tag LOCUS_19320 21386 22591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 24245 24727 gene locus_tag LOCUS_19330 24245 24727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 27435 24820 gene locus_tag LOCUS_19340 27435 24820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 29129 28056 gene locus_tag LOCUS_19350 29129 28056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 29500 29264 gene locus_tag LOCUS_19360 29500 29264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 29521 30351 gene locus_tag LOCUS_19370 29521 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 30362 31417 gene locus_tag LOCUS_19380 30362 31417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 31593 34826 gene locus_tag LOCUS_19390 31593 34826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 35127 37691 gene locus_tag LOCUS_19400 35127 37691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 37762 39843 gene locus_tag LOCUS_19410 37762 39843 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072120.1 protein_id gnl|my_center|LOCUS_19410 40055 40726 gene locus_tag LOCUS_19420 40055 40726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 40940 42280 gene locus_tag LOCUS_19430 40940 42280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 42586 45252 gene locus_tag LOCUS_19440 42586 45252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 45547 46005 gene locus_tag LOCUS_19450 45547 46005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 52142 46164 gene locus_tag LOCUS_19460 52142 46164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 52190 52396 gene locus_tag LOCUS_19470 52190 52396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 52628 54343 gene locus_tag LOCUS_19480 52628 54343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 54660 54361 gene locus_tag LOCUS_19490 54660 54361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 54614 55720 gene locus_tag LOCUS_19500 54614 55720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 61809 55723 gene locus_tag LOCUS_19510 61809 55723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 62277 62693 gene locus_tag LOCUS_19520 62277 62693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 62840 65104 gene locus_tag LOCUS_19530 62840 65104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 65327 67996 gene locus_tag LOCUS_19540 65327 67996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 67993 68646 gene locus_tag LOCUS_19550 67993 68646 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_19550 68653 68955 gene locus_tag LOCUS_19560 68653 68955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 69391 68906 gene locus_tag LOCUS_19570 69391 68906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 70093 69821 gene locus_tag LOCUS_19580 70093 69821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 71621 70104 gene locus_tag LOCUS_19590 71621 70104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 72520 71735 gene locus_tag LOCUS_19600 72520 71735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19600 72915 72619 gene locus_tag LOCUS_19610 72915 72619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 73058 73318 gene locus_tag LOCUS_19620 73058 73318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 73540 73467 gene locus_tag LOCUS_t00290 73540 73467 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 75542 73650 gene locus_tag LOCUS_19630 75542 73650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 77198 75663 gene locus_tag LOCUS_19640 77198 75663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 79909 77198 gene locus_tag LOCUS_19650 79909 77198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 80951 80175 gene locus_tag LOCUS_19660 80951 80175 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_19660 81354 80956 gene locus_tag LOCUS_19670 81354 80956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 82877 81351 gene locus_tag LOCUS_19680 82877 81351 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_19680 83181 83109 gene locus_tag LOCUS_t00300 83181 83109 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 83904 83242 gene locus_tag LOCUS_19690 83904 83242 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 protein_id gnl|my_center|LOCUS_19690 83983 84915 gene locus_tag LOCUS_19700 83983 84915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_19700 84912 85730 gene locus_tag LOCUS_19710 84912 85730 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061729.1 protein_id gnl|my_center|LOCUS_19710 85927 86166 gene locus_tag LOCUS_19720 gene cspD 85927 86166 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_19720 86302 86916 gene locus_tag LOCUS_19730 gene pgsA 86302 86916 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932027.1 protein_id gnl|my_center|LOCUS_19730 86919 87401 gene locus_tag LOCUS_19740 86919 87401 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_19740 87466 88218 gene locus_tag LOCUS_19750 87466 88218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 88222 89085 gene locus_tag LOCUS_19760 gene ispE 88222 89085 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933161.1 protein_id gnl|my_center|LOCUS_19760 89216 90145 gene locus_tag LOCUS_19770 89216 90145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 92580 90142 gene locus_tag LOCUS_19780 92580 90142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 94343 92577 gene locus_tag LOCUS_19790 94343 92577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 94573 95274 gene locus_tag LOCUS_19800 gene plsY 94573 95274 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_19800 95350 96351 gene locus_tag LOCUS_19810 95350 96351 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_19810 96354 101489 gene locus_tag LOCUS_19820 96354 101489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 101723 103948 gene locus_tag LOCUS_19830 101723 103948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 104899 104249 gene locus_tag LOCUS_19840 104899 104249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 107354 104985 gene locus_tag LOCUS_19850 107354 104985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 108180 107530 gene locus_tag LOCUS_19860 gene clpP 108180 107530 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933217.1 protein_id gnl|my_center|LOCUS_19860 109637 108270 gene locus_tag LOCUS_19870 gene tig 109637 108270 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730000.1 protein_id gnl|my_center|LOCUS_19870 109755 109671 gene locus_tag LOCUS_t00310 109755 109671 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 110350 110006 gene locus_tag LOCUS_19880 110350 110006 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545356.1 protein_id gnl|my_center|LOCUS_19880 110938 110375 gene locus_tag LOCUS_19890 110938 110375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 111941 111111 gene locus_tag LOCUS_19900 111941 111111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 113397 112270 gene locus_tag LOCUS_19910 113397 112270 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_19910 114255 114761 gene locus_tag LOCUS_19920 114255 114761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 115743 114838 gene locus_tag LOCUS_19930 115743 114838 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_19930 116930 115743 gene locus_tag LOCUS_19940 116930 115743 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870366.1 protein_id gnl|my_center|LOCUS_19940 117416 118027 gene locus_tag LOCUS_19950 117416 118027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 118101 119066 gene locus_tag LOCUS_19960 118101 119066 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259367.1 protein_id gnl|my_center|LOCUS_19960 119208 119771 gene locus_tag LOCUS_19970 119208 119771 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_19970 119768 120532 gene locus_tag LOCUS_19980 119768 120532 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942025.1 protein_id gnl|my_center|LOCUS_19980 121938 120550 gene locus_tag LOCUS_19990 121938 120550 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884020.1 protein_id gnl|my_center|LOCUS_19990 122133 123074 gene locus_tag LOCUS_20000 122133 123074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 123076 123300 gene locus_tag LOCUS_20010 123076 123300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 123478 124830 gene locus_tag LOCUS_20020 123478 124830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 124823 126355 gene locus_tag LOCUS_20030 gene gatB 124823 126355 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_20030 126352 127464 gene locus_tag LOCUS_20040 126352 127464 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_20040 127466 128302 gene locus_tag LOCUS_20050 127466 128302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 128299 129306 gene locus_tag LOCUS_20060 128299 129306 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_20060 129540 130310 gene locus_tag LOCUS_20070 129540 130310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_20070 130427 133003 gene locus_tag LOCUS_20080 130427 133003 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_20080 133519 133136 gene locus_tag LOCUS_20090 gene apaG 133519 133136 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706741.1 protein_id gnl|my_center|LOCUS_20090 134422 133628 gene locus_tag LOCUS_20100 gene lptB 134422 133628 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_20100 135257 134415 gene locus_tag LOCUS_20110 135257 134415 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_20110 136576 135254 gene locus_tag LOCUS_20120 gene amrB 136576 135254 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_20120 137528 136593 gene locus_tag LOCUS_20130 137528 136593 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_20130 137827 139974 gene locus_tag LOCUS_20140 137827 139974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 140032 140397 gene locus_tag LOCUS_20150 140032 140397 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_20150 140438 140887 gene locus_tag LOCUS_20160 gene rsbW 140438 140887 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447044.1 protein_id gnl|my_center|LOCUS_20160 140994 142739 gene locus_tag LOCUS_20170 140994 142739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 144118 142742 gene locus_tag LOCUS_20180 144118 142742 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_20180 144559 144188 gene locus_tag LOCUS_20190 144559 144188 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760049.1 protein_id gnl|my_center|LOCUS_20190 146740 144656 gene locus_tag LOCUS_20200 146740 144656 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_20200 147668 147045 gene locus_tag LOCUS_20210 147668 147045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 148383 147706 gene locus_tag LOCUS_20220 148383 147706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 148351 148626 gene locus_tag LOCUS_20230 148351 148626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 148987 148736 gene locus_tag LOCUS_20240 148987 148736 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933446.1 protein_id gnl|my_center|LOCUS_20240 150101 148995 gene locus_tag LOCUS_20250 150101 148995 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_20250 151403 150324 gene locus_tag LOCUS_20260 151403 150324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 152829 151408 gene locus_tag LOCUS_20270 152829 151408 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_20270 153263 152970 gene locus_tag LOCUS_20280 153263 152970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 154880 153402 gene locus_tag LOCUS_20290 154880 153402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence12 3388 2300 gene locus_tag LOCUS_20300 3388 2300 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_20300 4018 3536 gene locus_tag LOCUS_20310 4018 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 4165 5085 gene locus_tag LOCUS_20320 gene thyX 4165 5085 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597389.1 protein_id gnl|my_center|LOCUS_20320 5235 6905 gene locus_tag LOCUS_20330 gene ettA 5235 6905 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_20330 7175 7642 gene locus_tag LOCUS_20340 7175 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 9342 7954 gene locus_tag LOCUS_20350 gene gatD 9342 7954 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_20350 11264 9339 gene locus_tag LOCUS_20360 gene gatE 11264 9339 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979281.1 protein_id gnl|my_center|LOCUS_20360 11584 11817 gene locus_tag LOCUS_20370 11584 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 11805 12173 gene locus_tag LOCUS_20380 11805 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 12254 13276 gene locus_tag LOCUS_20390 12254 13276 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_20390 13418 14155 gene locus_tag LOCUS_20400 13418 14155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_20400 15732 16571 gene locus_tag LOCUS_20410 15732 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 16617 18608 gene locus_tag LOCUS_20420 16617 18608 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_20420 18610 20196 gene locus_tag LOCUS_20430 18610 20196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 20915 20202 gene locus_tag LOCUS_20440 20915 20202 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403937.1 protein_id gnl|my_center|LOCUS_20440 20973 22094 gene locus_tag LOCUS_20450 gene bshA 20973 22094 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_20450 22303 24849 gene locus_tag LOCUS_20460 22303 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 24851 25639 gene locus_tag LOCUS_20470 24851 25639 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933603.1 protein_id gnl|my_center|LOCUS_20470 25636 26598 gene locus_tag LOCUS_20480 25636 26598 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_20480 26595 27575 gene locus_tag LOCUS_20490 26595 27575 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_20490 27690 28415 gene locus_tag LOCUS_20500 27690 28415 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_20500 28541 29371 gene locus_tag LOCUS_20510 28541 29371 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 protein_id gnl|my_center|LOCUS_20510 29368 30267 gene locus_tag LOCUS_20520 29368 30267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 30340 31323 gene locus_tag LOCUS_20530 30340 31323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 31351 31482 gene locus_tag LOCUS_20540 31351 31482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 31740 31510 gene locus_tag LOCUS_20550 31740 31510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 31628 33928 gene locus_tag LOCUS_20560 31628 33928 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_20560 33928 34359 gene locus_tag LOCUS_20570 33928 34359 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_20570 34359 34706 gene locus_tag LOCUS_20580 34359 34706 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_20580 34703 36253 gene locus_tag LOCUS_20590 34703 36253 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_20590 36250 36597 gene locus_tag LOCUS_20600 36250 36597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 36597 36881 gene locus_tag LOCUS_20610 36597 36881 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 protein_id gnl|my_center|LOCUS_20610 36878 37267 gene locus_tag LOCUS_20620 gene mnhG 36878 37267 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942974.1 protein_id gnl|my_center|LOCUS_20620 39018 37279 gene locus_tag LOCUS_20630 39018 37279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 39447 39034 gene locus_tag LOCUS_20640 39447 39034 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_20640 40738 39464 gene locus_tag LOCUS_20650 40738 39464 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287683.1 protein_id gnl|my_center|LOCUS_20650 42127 40748 gene locus_tag LOCUS_20660 42127 40748 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118828814.1 protein_id gnl|my_center|LOCUS_20660 42344 43360 gene locus_tag LOCUS_20670 42344 43360 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_20670 43515 44156 gene locus_tag LOCUS_20680 43515 44156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 46963 44300 gene locus_tag LOCUS_20690 46963 44300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 47745 47095 gene locus_tag LOCUS_20700 47745 47095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 48058 48846 gene locus_tag LOCUS_20710 48058 48846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 49685 48924 gene locus_tag LOCUS_20720 49685 48924 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_20720 49879 51936 gene locus_tag LOCUS_20730 49879 51936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 52633 52121 gene locus_tag LOCUS_20740 52633 52121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 52973 53326 gene locus_tag LOCUS_20750 52973 53326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 54673 53606 gene locus_tag LOCUS_20760 gene coxFIC1 54673 53606 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_20760 54835 57009 gene locus_tag LOCUS_20770 54835 57009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 57587 57230 gene locus_tag LOCUS_tm00010 57587 57230 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 59199 57694 gene locus_tag LOCUS_20780 59199 57694 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_20780 60046 59213 gene locus_tag LOCUS_20790 60046 59213 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_20790 61868 60297 gene locus_tag LOCUS_20800 61868 60297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 62714 62247 gene locus_tag LOCUS_20810 62714 62247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 62932 64287 gene locus_tag LOCUS_20820 62932 64287 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258395.1 protein_id gnl|my_center|LOCUS_20820 64518 65048 gene locus_tag LOCUS_20830 64518 65048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 65111 65635 gene locus_tag LOCUS_20840 65111 65635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 65781 65978 gene locus_tag LOCUS_20850 65781 65978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 66185 67093 gene locus_tag LOCUS_20860 66185 67093 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_20860 67224 67748 gene locus_tag LOCUS_20870 67224 67748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 67917 68414 gene locus_tag LOCUS_20880 67917 68414 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932995.1 protein_id gnl|my_center|LOCUS_20880 68462 69802 gene locus_tag LOCUS_20890 gene glpT 68462 69802 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466385.1 protein_id gnl|my_center|LOCUS_20890 69936 70658 gene locus_tag LOCUS_20900 69936 70658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 73154 70824 gene locus_tag LOCUS_20910 73154 70824 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055269995.1 protein_id gnl|my_center|LOCUS_20910 73690 73208 gene locus_tag LOCUS_20920 73690 73208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 74076 75161 gene locus_tag LOCUS_20930 74076 75161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 75810 75325 gene locus_tag LOCUS_20940 75810 75325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 78133 75941 gene locus_tag LOCUS_20950 78133 75941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_20950 78337 79038 gene locus_tag LOCUS_20960 78337 79038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 82413 79123 gene locus_tag LOCUS_20970 82413 79123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 82895 84493 gene locus_tag LOCUS_20980 82895 84493 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941698.1 protein_id gnl|my_center|LOCUS_20980 84624 85313 gene locus_tag LOCUS_20990 84624 85313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 85486 86910 gene locus_tag LOCUS_21000 85486 86910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 88943 87006 gene locus_tag LOCUS_21010 88943 87006 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403075.1 protein_id gnl|my_center|LOCUS_21010 89165 90979 gene locus_tag LOCUS_21020 gene nuoF 89165 90979 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_21020 91010 91723 gene locus_tag LOCUS_21030 gene hoxU 91010 91723 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_21030 91720 92289 gene locus_tag LOCUS_21040 91720 92289 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_21040 92327 93769 gene locus_tag LOCUS_21050 92327 93769 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_21050 93769 94251 gene locus_tag LOCUS_21060 93769 94251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 94306 94680 gene locus_tag LOCUS_21070 94306 94680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 96329 94917 gene locus_tag LOCUS_21080 96329 94917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 97854 96484 gene locus_tag LOCUS_21090 97854 96484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 97854 98336 gene locus_tag LOCUS_21100 97854 98336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 101040 98386 gene locus_tag LOCUS_21110 101040 98386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 101522 101235 gene locus_tag LOCUS_21120 101522 101235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 101409 102344 gene locus_tag LOCUS_21130 101409 102344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 102499 103476 gene locus_tag LOCUS_21140 102499 103476 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_21140 103585 103827 gene locus_tag LOCUS_21150 103585 103827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 104071 104382 gene locus_tag LOCUS_21160 104071 104382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 104449 105519 gene locus_tag LOCUS_21170 104449 105519 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_21170 105543 106331 gene locus_tag LOCUS_21180 105543 106331 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_21180 106324 106878 gene locus_tag LOCUS_21190 106324 106878 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_21190 107144 107896 gene locus_tag LOCUS_21200 107144 107896 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_21200 107992 108798 gene locus_tag LOCUS_21210 107992 108798 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_21210 108840 109112 gene locus_tag LOCUS_21220 108840 109112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 109211 109969 gene locus_tag LOCUS_21230 109211 109969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21230 109947 113162 gene locus_tag LOCUS_21240 gene otsB 109947 113162 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410063.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21240 113336 113848 gene locus_tag LOCUS_21250 gene yhbO 113336 113848 CDS product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037599.1 protein_id gnl|my_center|LOCUS_21250 114443 115393 gene locus_tag LOCUS_21260 114443 115393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 115974 116381 gene locus_tag LOCUS_21270 115974 116381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 116457 116828 gene locus_tag LOCUS_21280 116457 116828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 116894 118216 gene locus_tag LOCUS_21290 116894 118216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 118262 118828 gene locus_tag LOCUS_21300 118262 118828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 118825 119256 gene locus_tag LOCUS_21310 118825 119256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 119286 120782 gene locus_tag LOCUS_21320 119286 120782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 121071 122429 gene locus_tag LOCUS_21330 121071 122429 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_21330 122692 122468 gene locus_tag LOCUS_21340 122692 122468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 122742 122830 gene locus_tag LOCUS_t00320 122742 122830 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 122940 123935 gene locus_tag LOCUS_21350 122940 123935 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_21350 124112 124363 gene locus_tag LOCUS_21360 124112 124363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 124375 126321 gene locus_tag LOCUS_21370 124375 126321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 126850 126647 gene locus_tag LOCUS_21380 126850 126647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 127485 128489 gene locus_tag LOCUS_21390 127485 128489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 128587 129492 gene locus_tag LOCUS_21400 128587 129492 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_21400 129621 130490 gene locus_tag LOCUS_21410 129621 130490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070525.1 protein_id gnl|my_center|LOCUS_21410 130832 131581 gene locus_tag LOCUS_21420 130832 131581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 131590 131874 gene locus_tag LOCUS_21430 131590 131874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 132021 133073 gene locus_tag LOCUS_21440 132021 133073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 133175 133438 gene locus_tag LOCUS_21450 133175 133438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 133588 133815 gene locus_tag LOCUS_21460 133588 133815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 133854 134573 gene locus_tag LOCUS_21470 133854 134573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 135355 134861 gene locus_tag LOCUS_21480 135355 134861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 136318 135704 gene locus_tag LOCUS_21490 136318 135704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 136458 136838 gene locus_tag LOCUS_21500 136458 136838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 137159 137536 gene locus_tag LOCUS_21510 137159 137536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 137673 137876 gene locus_tag LOCUS_21520 137673 137876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 138269 137886 gene locus_tag LOCUS_21530 138269 137886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 140872 138623 gene locus_tag LOCUS_21540 140872 138623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 141137 140841 gene locus_tag LOCUS_21550 141137 140841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence13 3046 281 gene locus_tag LOCUS_21560 3046 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 4011 3397 gene locus_tag LOCUS_21570 4011 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4365 6497 gene locus_tag LOCUS_21580 4365 6497 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839782.1 protein_id gnl|my_center|LOCUS_21580 6588 7961 gene locus_tag LOCUS_21590 gene hflX 6588 7961 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_21590 8229 10478 gene locus_tag LOCUS_21600 8229 10478 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_21600 10482 11312 gene locus_tag LOCUS_21610 10482 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 11383 12468 gene locus_tag LOCUS_21620 11383 12468 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049613991.1 protein_id gnl|my_center|LOCUS_21620 12578 13291 gene locus_tag LOCUS_21630 gene rsmI 12578 13291 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404816.1 protein_id gnl|my_center|LOCUS_21630 13373 13759 gene locus_tag LOCUS_21640 13373 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 13756 15177 gene locus_tag LOCUS_21650 13756 15177 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141291.1 protein_id gnl|my_center|LOCUS_21650 15256 15699 gene locus_tag LOCUS_21660 15256 15699 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390561.1 protein_id gnl|my_center|LOCUS_21660 15760 16128 gene locus_tag LOCUS_21670 15760 16128 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986720.1 protein_id gnl|my_center|LOCUS_21670 16150 16629 gene locus_tag LOCUS_21680 16150 16629 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771208.1 protein_id gnl|my_center|LOCUS_21680 16750 16944 gene locus_tag LOCUS_21690 16750 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 17204 18271 gene locus_tag LOCUS_21700 17204 18271 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 protein_id gnl|my_center|LOCUS_21700 18423 18935 gene locus_tag LOCUS_21710 18423 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 19003 19605 gene locus_tag LOCUS_21720 19003 19605 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_21720 19602 20738 gene locus_tag LOCUS_21730 19602 20738 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_21730 21092 20754 gene locus_tag LOCUS_21740 21092 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 21245 22348 gene locus_tag LOCUS_21750 21245 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 22351 23094 gene locus_tag LOCUS_21760 22351 23094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 23158 24678 gene locus_tag LOCUS_21770 23158 24678 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926895.1 protein_id gnl|my_center|LOCUS_21770 24755 25855 gene locus_tag LOCUS_21780 24755 25855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 26014 27933 gene locus_tag LOCUS_21790 26014 27933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 28004 28414 gene locus_tag LOCUS_21800 28004 28414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 28448 29479 gene locus_tag LOCUS_21810 gene fbp 28448 29479 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_21810 29496 30266 gene locus_tag LOCUS_21820 29496 30266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 30522 31577 gene locus_tag LOCUS_21830 30522 31577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 31668 33173 gene locus_tag LOCUS_21840 31668 33173 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405255.1 protein_id gnl|my_center|LOCUS_21840 33477 35582 gene locus_tag LOCUS_21850 33477 35582 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404166.1 protein_id gnl|my_center|LOCUS_21850 35584 36309 gene locus_tag LOCUS_21860 35584 36309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 37984 36395 gene locus_tag LOCUS_21870 gene argS 37984 36395 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_21870 38419 38075 gene locus_tag LOCUS_21880 gene rsfS 38419 38075 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_21880 38914 38441 gene locus_tag LOCUS_21890 38914 38441 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405259.1 protein_id gnl|my_center|LOCUS_21890 39499 38981 gene locus_tag LOCUS_21900 39499 38981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 39995 41407 gene locus_tag LOCUS_21910 gene dnaA 39995 41407 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931696.1 protein_id gnl|my_center|LOCUS_21910 41711 44074 gene locus_tag LOCUS_21920 gene glnD 41711 44074 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_21920 44087 44908 gene locus_tag LOCUS_21930 gene murI 44087 44908 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_21930 44998 47106 gene locus_tag LOCUS_21940 44998 47106 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_21940 47125 49293 gene locus_tag LOCUS_21950 gene scpA 47125 49293 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_21950 49415 53131 gene locus_tag LOCUS_21960 49415 53131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 53307 53393 gene locus_tag LOCUS_t00330 53307 53393 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54328 53462 gene locus_tag LOCUS_21970 54328 53462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 54476 55255 gene locus_tag LOCUS_21980 54476 55255 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_21980 55442 57562 gene locus_tag LOCUS_21990 55442 57562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 58022 58564 gene locus_tag LOCUS_22000 58022 58564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 58561 59577 gene locus_tag LOCUS_22010 58561 59577 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_22010 59960 60205 gene locus_tag LOCUS_22020 59960 60205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 60202 60423 gene locus_tag LOCUS_22030 gene yidD 60202 60423 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_22030 60451 62334 gene locus_tag LOCUS_22040 gene yidC 60451 62334 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_22040 63143 65650 gene locus_tag LOCUS_22050 63143 65650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 65676 69236 gene locus_tag LOCUS_22060 gene smc 65676 69236 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_22060 70611 69319 gene locus_tag LOCUS_22070 gene aspB 70611 69319 CDS product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 protein_id gnl|my_center|LOCUS_22070 71317 70646 gene locus_tag LOCUS_22080 71317 70646 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403628.1 protein_id gnl|my_center|LOCUS_22080 74070 71443 gene locus_tag LOCUS_22090 74070 71443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 78286 74075 gene locus_tag LOCUS_22100 78286 74075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 79136 78576 gene locus_tag LOCUS_22110 79136 78576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 79337 80734 gene locus_tag LOCUS_22120 gene sthA 79337 80734 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460367.1 protein_id gnl|my_center|LOCUS_22120 80761 81918 gene locus_tag LOCUS_22130 gene meaB 80761 81918 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_22130 81956 82564 gene locus_tag LOCUS_22140 81956 82564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 82568 83914 gene locus_tag LOCUS_22150 gene radA 82568 83914 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_22150 84384 83911 gene locus_tag LOCUS_22160 84384 83911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 84514 85200 gene locus_tag LOCUS_22170 84514 85200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 86500 85280 gene locus_tag LOCUS_22180 86500 85280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_22180 87570 86548 gene locus_tag LOCUS_22190 gene aroC 87570 86548 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_22190 89434 87575 gene locus_tag LOCUS_22200 89434 87575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 89595 90071 gene locus_tag LOCUS_22210 89595 90071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 91313 90153 gene locus_tag LOCUS_22220 91313 90153 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257764.1 protein_id gnl|my_center|LOCUS_22220 91543 91340 gene locus_tag LOCUS_22230 91543 91340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 92991 91540 gene locus_tag LOCUS_22240 92991 91540 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_22240 93178 93804 gene locus_tag LOCUS_22250 93178 93804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 94660 93824 gene locus_tag LOCUS_22260 94660 93824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 95308 94988 gene locus_tag LOCUS_22270 gene trxA 95308 94988 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_22270 98831 95331 gene locus_tag LOCUS_22280 gene dnaE 98831 95331 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403739.1 protein_id gnl|my_center|LOCUS_22280 99046 99924 gene locus_tag LOCUS_22290 99046 99924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 99911 101827 gene locus_tag LOCUS_22300 99911 101827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 101985 102419 gene locus_tag LOCUS_22310 101985 102419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 102613 103476 gene locus_tag LOCUS_22320 102613 103476 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_22320 104040 104315 gene locus_tag LOCUS_22330 104040 104315 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768500.1 protein_id gnl|my_center|LOCUS_22330 104599 104525 gene locus_tag LOCUS_t00340 104599 104525 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 104730 104990 gene locus_tag LOCUS_22340 104730 104990 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545802.1 protein_id gnl|my_center|LOCUS_22340 105146 105685 gene locus_tag LOCUS_22350 105146 105685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 106661 105675 gene locus_tag LOCUS_22360 106661 105675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 106928 108958 gene locus_tag LOCUS_22370 106928 108958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 109076 110872 gene locus_tag LOCUS_22380 109076 110872 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933059.1 protein_id gnl|my_center|LOCUS_22380 111622 110873 gene locus_tag LOCUS_22390 111622 110873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 111778 112251 gene locus_tag LOCUS_22400 111778 112251 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222249.1 protein_id gnl|my_center|LOCUS_22400 112248 113057 gene locus_tag LOCUS_22410 112248 113057 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261734.1 protein_id gnl|my_center|LOCUS_22410 113060 114289 gene locus_tag LOCUS_22420 113060 114289 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_22420 114291 115505 gene locus_tag LOCUS_22430 114291 115505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_22430 115616 116305 gene locus_tag LOCUS_22440 115616 116305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_22440 116302 117591 gene locus_tag LOCUS_22450 116302 117591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 119225 117708 gene locus_tag LOCUS_22460 119225 117708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 119678 119319 gene locus_tag LOCUS_22470 119678 119319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 120166 119879 gene locus_tag LOCUS_22480 120166 119879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 120704 120492 gene locus_tag LOCUS_22490 120704 120492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 120919 121152 gene locus_tag LOCUS_22500 120919 121152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 121339 121647 gene locus_tag LOCUS_22510 121339 121647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 121644 121982 gene locus_tag LOCUS_22520 121644 121982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 121986 122975 gene locus_tag LOCUS_22530 121986 122975 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_22530 122988 124118 gene locus_tag LOCUS_22540 gene cruC 122988 124118 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_22540 124205 125785 gene locus_tag LOCUS_22550 gene crtD 124205 125785 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_22550 125782 126474 gene locus_tag LOCUS_22560 125782 126474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 126505 127983 gene locus_tag LOCUS_22570 gene crtI 126505 127983 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_22570 <128651 128049 gene locus_tag LOCUS_22580 <128651 128049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:OmpA family protein >Feature sequence14 1828 4389 gene locus_tag LOCUS_22590 1828 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4706 5197 gene locus_tag LOCUS_22600 gene purE 4706 5197 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_22600 5455 5264 gene locus_tag LOCUS_22610 5455 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5685 8819 gene locus_tag LOCUS_22620 5685 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 8946 11783 gene locus_tag LOCUS_22630 8946 11783 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403151.1 protein_id gnl|my_center|LOCUS_22630 11920 13329 gene locus_tag LOCUS_22640 11920 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 13408 14223 gene locus_tag LOCUS_22650 13408 14223 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_22650 14428 16560 gene locus_tag LOCUS_22660 14428 16560 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404722.1 protein_id gnl|my_center|LOCUS_22660 18721 16595 gene locus_tag LOCUS_22670 18721 16595 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966811.1 protein_id gnl|my_center|LOCUS_22670 18862 20151 gene locus_tag LOCUS_22680 18862 20151 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812238.1 protein_id gnl|my_center|LOCUS_22680 20161 21042 gene locus_tag LOCUS_22690 20161 21042 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067135926.1 protein_id gnl|my_center|LOCUS_22690 22225 21167 gene locus_tag LOCUS_22700 22225 21167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 23164 22259 gene locus_tag LOCUS_22710 23164 22259 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_22710 23729 23196 gene locus_tag LOCUS_22720 23729 23196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 24484 23774 gene locus_tag LOCUS_22730 24484 23774 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813026.1 protein_id gnl|my_center|LOCUS_22730 25513 24623 gene locus_tag LOCUS_22740 25513 24623 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294680.1 protein_id gnl|my_center|LOCUS_22740 25901 25527 gene locus_tag LOCUS_22750 25901 25527 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 protein_id gnl|my_center|LOCUS_22750 28748 25929 gene locus_tag LOCUS_22760 gene uvrA 28748 25929 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403227.1 protein_id gnl|my_center|LOCUS_22760 28823 30082 gene locus_tag LOCUS_22770 28823 30082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 30086 30718 gene locus_tag LOCUS_22780 30086 30718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 31524 30802 gene locus_tag LOCUS_22790 31524 30802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 32373 31570 gene locus_tag LOCUS_22800 32373 31570 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_22800 32520 33641 gene locus_tag LOCUS_22810 gene corA 32520 33641 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_22810 33767 34063 gene locus_tag LOCUS_22820 33767 34063 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_22820 34239 35624 gene locus_tag LOCUS_22830 34239 35624 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_22830 36231 35680 gene locus_tag LOCUS_22840 36231 35680 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_22840 36503 38380 gene locus_tag LOCUS_22850 gene htpG 36503 38380 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932510.1 protein_id gnl|my_center|LOCUS_22850 38449 38958 gene locus_tag LOCUS_22860 38449 38958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 38955 39884 gene locus_tag LOCUS_22870 38955 39884 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020228.1 protein_id gnl|my_center|LOCUS_22870 41415 39967 gene locus_tag LOCUS_22880 41415 39967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 42432 41446 gene locus_tag LOCUS_22890 42432 41446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 43859 42642 gene locus_tag LOCUS_22900 43859 42642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 44718 43942 gene locus_tag LOCUS_22910 44718 43942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 45949 44708 gene locus_tag LOCUS_22920 45949 44708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 46539 45976 gene locus_tag LOCUS_22930 46539 45976 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_22930 46732 48420 gene locus_tag LOCUS_22940 46732 48420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 50223 48421 gene locus_tag LOCUS_22950 50223 48421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 50391 52523 gene locus_tag LOCUS_22960 50391 52523 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141815383.1 protein_id gnl|my_center|LOCUS_22960 52536 53312 gene locus_tag LOCUS_22970 52536 53312 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_22970 54148 53315 gene locus_tag LOCUS_22980 54148 53315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 55298 54516 gene locus_tag LOCUS_22990 gene lgt 55298 54516 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_22990 58623 55612 gene locus_tag LOCUS_23000 58623 55612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 61853 58851 gene locus_tag LOCUS_23010 61853 58851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 62046 63893 gene locus_tag LOCUS_23020 62046 63893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 63967 66087 gene locus_tag LOCUS_23030 63967 66087 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_23030 66864 66364 gene locus_tag LOCUS_23040 66864 66364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 67951 66893 gene locus_tag LOCUS_23050 67951 66893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 68527 67958 gene locus_tag LOCUS_23060 68527 67958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 68928 68557 gene locus_tag LOCUS_23070 68928 68557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 68839 69126 gene locus_tag LOCUS_23080 68839 69126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 69629 69204 gene locus_tag LOCUS_23090 69629 69204 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932411.1 protein_id gnl|my_center|LOCUS_23090 69927 69637 gene locus_tag LOCUS_23100 69927 69637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 70817 69924 gene locus_tag LOCUS_23110 70817 69924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 70993 73059 gene locus_tag LOCUS_23120 70993 73059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 74067 73210 gene locus_tag LOCUS_23130 74067 73210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 74918 74337 gene locus_tag LOCUS_23140 gene gmhA 74918 74337 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_23140 76455 74929 gene locus_tag LOCUS_23150 76455 74929 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926942.1 protein_id gnl|my_center|LOCUS_23150 76639 77106 gene locus_tag LOCUS_23160 76639 77106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 78675 77239 gene locus_tag LOCUS_23170 78675 77239 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_23170 79102 78776 gene locus_tag LOCUS_23180 79102 78776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 79320 81704 gene locus_tag LOCUS_23190 79320 81704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 81736 82572 gene locus_tag LOCUS_23200 81736 82572 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880637.1 protein_id gnl|my_center|LOCUS_23200 82591 83388 gene locus_tag LOCUS_23210 gene rfbF 82591 83388 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_23210 84094 83393 gene locus_tag LOCUS_23220 84094 83393 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_23220 85280 84138 gene locus_tag LOCUS_23230 gene ispG 85280 84138 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_23230 86240 85305 gene locus_tag LOCUS_23240 86240 85305 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_23240 87506 86310 gene locus_tag LOCUS_23250 87506 86310 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_23250 88607 87618 gene locus_tag LOCUS_23260 gene gap 88607 87618 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_23260 90125 88707 gene locus_tag LOCUS_23270 90125 88707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 91935 90115 gene locus_tag LOCUS_23280 91935 90115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 92231 92746 gene locus_tag LOCUS_23290 92231 92746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 92948 94273 gene locus_tag LOCUS_23300 gene miaB 92948 94273 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_23300 94290 95012 gene locus_tag LOCUS_23310 94290 95012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 95026 95799 gene locus_tag LOCUS_23320 95026 95799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 95799 96959 gene locus_tag LOCUS_23330 95799 96959 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_23330 96959 97483 gene locus_tag LOCUS_23340 96959 97483 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933430.1 protein_id gnl|my_center|LOCUS_23340 97526 98986 gene locus_tag LOCUS_23350 97526 98986 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_23350 99104 100003 gene locus_tag LOCUS_23360 99104 100003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 100071 100610 gene locus_tag LOCUS_23370 100071 100610 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_23370 102880 100757 gene locus_tag LOCUS_23380 102880 100757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 104240 102912 gene locus_tag LOCUS_23390 104240 102912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23390 104936 104268 gene locus_tag LOCUS_23400 104936 104268 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065832.1 protein_id gnl|my_center|LOCUS_23400 105932 105261 gene locus_tag LOCUS_23410 105932 105261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 106124 109219 gene locus_tag LOCUS_23420 106124 109219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 110032 109250 gene locus_tag LOCUS_23430 110032 109250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 110709 110272 gene locus_tag LOCUS_23440 110709 110272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 112115 110706 gene locus_tag LOCUS_23450 112115 110706 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791938.1 protein_id gnl|my_center|LOCUS_23450 114363 112174 gene locus_tag LOCUS_23460 114363 112174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 115678 114386 gene locus_tag LOCUS_23470 gene hemL 115678 114386 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933753.1 protein_id gnl|my_center|LOCUS_23470 116382 115681 gene locus_tag LOCUS_23480 116382 115681 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_23480 117399 116401 gene locus_tag LOCUS_23490 gene hemB 117399 116401 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_23490 117553 117795 gene locus_tag LOCUS_23500 117553 117795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 117780 118121 gene locus_tag LOCUS_23510 117780 118121 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 protein_id gnl|my_center|LOCUS_23510 119496 118105 gene locus_tag LOCUS_23520 gene hemG 119496 118105 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_23520 120775 119744 gene locus_tag LOCUS_23530 gene hemH 120775 119744 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839952.1 protein_id gnl|my_center|LOCUS_23530 122177 120780 gene locus_tag LOCUS_23540 gene hemN 122177 120780 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403512.1 protein_id gnl|my_center|LOCUS_23540 123335 122268 gene locus_tag LOCUS_23550 gene hemE 123335 122268 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933694.1 protein_id gnl|my_center|LOCUS_23550 124296 123526 gene locus_tag LOCUS_23560 124296 123526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 125231 124293 gene locus_tag LOCUS_23570 gene hemC 125231 124293 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933094.1 protein_id gnl|my_center|LOCUS_23570 126517 125228 gene locus_tag LOCUS_23580 gene hemA 126517 125228 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_23580 127408 126575 gene locus_tag LOCUS_23590 gene ccsA 127408 126575 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933092.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence15 38 322 gene locus_tag LOCUS_23600 38 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2011 380 gene locus_tag LOCUS_23610 gene pruA 2011 380 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_23610 2372 2596 gene locus_tag LOCUS_23620 2372 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2583 2840 gene locus_tag LOCUS_23630 2583 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2837 3259 gene locus_tag LOCUS_23640 2837 3259 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_23640 3597 4364 gene locus_tag LOCUS_23650 3597 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4583 4831 gene locus_tag LOCUS_23660 4583 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 7509 4846 gene locus_tag LOCUS_23670 7509 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 8103 8918 gene locus_tag LOCUS_23680 8103 8918 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637552.1 protein_id gnl|my_center|LOCUS_23680 11836 9122 gene locus_tag LOCUS_23690 11836 9122 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_23690 11971 13644 gene locus_tag LOCUS_23700 11971 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 13730 16024 gene locus_tag LOCUS_23710 13730 16024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 16526 16092 gene locus_tag LOCUS_23720 16526 16092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 16937 16548 gene locus_tag LOCUS_23730 16937 16548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 17376 17008 gene locus_tag LOCUS_23740 17376 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 18446 17385 gene locus_tag LOCUS_23750 18446 17385 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868074.1 protein_id gnl|my_center|LOCUS_23750 19591 18443 gene locus_tag LOCUS_23760 19591 18443 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401993.1 protein_id gnl|my_center|LOCUS_23760 19645 20763 gene locus_tag LOCUS_23770 19645 20763 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_23770 20827 21378 gene locus_tag LOCUS_23780 20827 21378 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_23780 21546 22115 gene locus_tag LOCUS_23790 21546 22115 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 protein_id gnl|my_center|LOCUS_23790 22216 23739 gene locus_tag LOCUS_23800 22216 23739 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_23800 24044 24784 gene locus_tag LOCUS_23810 24044 24784 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_23810 24908 26518 gene locus_tag LOCUS_23820 24908 26518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 26646 28817 gene locus_tag LOCUS_23830 26646 28817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 28846 30003 gene locus_tag LOCUS_23840 gene alr 28846 30003 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_23840 30088 33144 gene locus_tag LOCUS_23850 30088 33144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 33227 33598 gene locus_tag LOCUS_23860 33227 33598 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141683.1 protein_id gnl|my_center|LOCUS_23860 33598 34335 gene locus_tag LOCUS_23870 33598 34335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 34491 34874 gene locus_tag LOCUS_23880 34491 34874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 36497 34935 gene locus_tag LOCUS_23890 36497 34935 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087273407.1 protein_id gnl|my_center|LOCUS_23890 36601 37386 gene locus_tag LOCUS_23900 36601 37386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 37393 38100 gene locus_tag LOCUS_23910 37393 38100 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_23910 39362 38160 gene locus_tag LOCUS_23920 39362 38160 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431263.1 protein_id gnl|my_center|LOCUS_23920 39553 40569 gene locus_tag LOCUS_23930 39553 40569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 40592 41233 gene locus_tag LOCUS_23940 40592 41233 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020952.1 protein_id gnl|my_center|LOCUS_23940 42188 41409 gene locus_tag LOCUS_23950 42188 41409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 42496 43572 gene locus_tag LOCUS_23960 42496 43572 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_23960 44236 43796 gene locus_tag LOCUS_23970 44236 43796 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_23970 44537 45367 gene locus_tag LOCUS_23980 44537 45367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 45386 48013 gene locus_tag LOCUS_23990 gene clpB 45386 48013 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_23990 48066 49172 gene locus_tag LOCUS_24000 48066 49172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 49668 49180 gene locus_tag LOCUS_24010 49668 49180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 50160 52430 gene locus_tag LOCUS_24020 50160 52430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 52427 53554 gene locus_tag LOCUS_24030 52427 53554 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838638.1 protein_id gnl|my_center|LOCUS_24030 53656 55278 gene locus_tag LOCUS_24040 53656 55278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 55500 55279 gene locus_tag LOCUS_24050 55500 55279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 56665 55775 gene locus_tag LOCUS_24060 56665 55775 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_24060 58326 56662 gene locus_tag LOCUS_24070 58326 56662 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_24070 58455 58664 gene locus_tag LOCUS_24080 58455 58664 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132585.1 protein_id gnl|my_center|LOCUS_24080 58657 60912 gene locus_tag LOCUS_24090 58657 60912 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_24090 63729 61003 gene locus_tag LOCUS_24100 63729 61003 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_24100 63876 64628 gene locus_tag LOCUS_24110 gene larB 63876 64628 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141462.1 protein_id gnl|my_center|LOCUS_24110 64621 65478 gene locus_tag LOCUS_24120 gene larE 64621 65478 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_24120 65475 66455 gene locus_tag LOCUS_24130 65475 66455 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_24130 66452 68119 gene locus_tag LOCUS_24140 66452 68119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 70761 68218 gene locus_tag LOCUS_24150 70761 68218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 71814 70822 gene locus_tag LOCUS_24160 71814 70822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 72271 71825 gene locus_tag LOCUS_24170 72271 71825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 73139 72390 gene locus_tag LOCUS_24180 73139 72390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 73399 74481 gene locus_tag LOCUS_24190 gene prfA 73399 74481 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931817.1 protein_id gnl|my_center|LOCUS_24190 74478 75317 gene locus_tag LOCUS_24200 gene kdsA 74478 75317 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931782.1 protein_id gnl|my_center|LOCUS_24200 75314 75841 gene locus_tag LOCUS_24210 75314 75841 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_24210 76214 75873 gene locus_tag LOCUS_24220 76214 75873 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269102.1 protein_id gnl|my_center|LOCUS_24220 76421 76810 gene locus_tag LOCUS_24230 76421 76810 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812348.1 protein_id gnl|my_center|LOCUS_24230 77998 77066 gene locus_tag LOCUS_24240 77998 77066 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461600.1 protein_id gnl|my_center|LOCUS_24240 78465 77995 gene locus_tag LOCUS_24250 78465 77995 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461601.1 protein_id gnl|my_center|LOCUS_24250 79841 78552 gene locus_tag LOCUS_24260 79841 78552 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_24260 79984 80685 gene locus_tag LOCUS_24270 79984 80685 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_24270 80787 80859 gene locus_tag LOCUS_t00350 80787 80859 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 80889 81842 gene locus_tag LOCUS_24280 80889 81842 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933029.1 protein_id gnl|my_center|LOCUS_24280 81873 82514 gene locus_tag LOCUS_24290 81873 82514 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933030.1 protein_id gnl|my_center|LOCUS_24290 82520 83149 gene locus_tag LOCUS_24300 gene pth 82520 83149 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_24300 83152 85158 gene locus_tag LOCUS_24310 83152 85158 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_24310 85264 85860 gene locus_tag LOCUS_24320 85264 85860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 85936 86457 gene locus_tag LOCUS_24330 gene ssb 85936 86457 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927163.1 protein_id gnl|my_center|LOCUS_24330 86511 86966 gene locus_tag LOCUS_24340 gene rplI 86511 86966 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_24340 87076 88962 gene locus_tag LOCUS_24350 87076 88962 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931857.1 protein_id gnl|my_center|LOCUS_24350 88966 90018 gene locus_tag LOCUS_24360 88966 90018 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_24360 92368 90182 gene locus_tag LOCUS_24370 92368 90182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 93005 92499 gene locus_tag LOCUS_24380 93005 92499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 93379 93008 gene locus_tag LOCUS_24390 93379 93008 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_24390 93998 93342 gene locus_tag LOCUS_24400 93998 93342 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933911.1 protein_id gnl|my_center|LOCUS_24400 94879 93995 gene locus_tag LOCUS_24410 94879 93995 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_24410 96539 94869 gene locus_tag LOCUS_24420 96539 94869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 96518 96718 gene locus_tag LOCUS_24430 96518 96718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 96723 97112 gene locus_tag LOCUS_24440 96723 97112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 97123 97671 gene locus_tag LOCUS_24450 97123 97671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 97945 101160 gene locus_tag LOCUS_24460 97945 101160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 101336 101872 gene locus_tag LOCUS_24470 101336 101872 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_24470 102100 102525 gene locus_tag LOCUS_24480 102100 102525 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173532.1 protein_id gnl|my_center|LOCUS_24480 103696 102752 gene locus_tag LOCUS_24490 103696 102752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 103884 104513 gene locus_tag LOCUS_24500 103884 104513 CDS product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257658.1 protein_id gnl|my_center|LOCUS_24500 104530 105294 gene locus_tag LOCUS_24510 104530 105294 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048437.1 protein_id gnl|my_center|LOCUS_24510 105899 105267 gene locus_tag LOCUS_24520 105899 105267 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920512.1 protein_id gnl|my_center|LOCUS_24520 107223 106111 gene locus_tag LOCUS_24530 107223 106111 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026931.1 protein_id gnl|my_center|LOCUS_24530 107610 107263 gene locus_tag LOCUS_24540 107610 107263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 107536 108177 gene locus_tag LOCUS_24550 107536 108177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964282.1 protein_id gnl|my_center|LOCUS_24550 108158 108448 gene locus_tag LOCUS_24560 108158 108448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 108502 109608 gene locus_tag LOCUS_24570 108502 109608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 109737 114458 gene locus_tag LOCUS_24580 109737 114458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 114682 117126 gene locus_tag LOCUS_24590 gene leuS 114682 117126 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_24590 117128 117781 gene locus_tag LOCUS_24600 117128 117781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 117911 118645 gene locus_tag LOCUS_24610 117911 118645 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528671.1 protein_id gnl|my_center|LOCUS_24610 120006 118669 gene locus_tag LOCUS_24620 120006 118669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 121164 120100 gene locus_tag LOCUS_24630 121164 120100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 122540 121161 gene locus_tag LOCUS_24640 122540 121161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 123906 122662 gene locus_tag LOCUS_24650 123906 122662 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_24650 124164 125009 gene locus_tag LOCUS_24660 124164 125009 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404797.1 protein_id gnl|my_center|LOCUS_24660 125059 125739 gene locus_tag LOCUS_24670 125059 125739 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_24670 125723 126577 gene locus_tag LOCUS_24680 125723 126577 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence16 254 1387 gene locus_tag LOCUS_24690 gene rffA 254 1387 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_24690 1470 2219 gene locus_tag LOCUS_24700 1470 2219 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_24700 2324 3295 gene locus_tag LOCUS_24710 2324 3295 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_24710 3360 3929 gene locus_tag LOCUS_24720 3360 3929 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_24720 4430 4927 gene locus_tag LOCUS_24730 4430 4927 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020764.1 protein_id gnl|my_center|LOCUS_24730 5070 6038 gene locus_tag LOCUS_24740 gene gmd 5070 6038 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_24740 6104 6487 gene locus_tag LOCUS_24750 6104 6487 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_24750 6552 7709 gene locus_tag LOCUS_24760 6552 7709 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_24760 7725 8639 gene locus_tag LOCUS_24770 7725 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 8674 9540 gene locus_tag LOCUS_24780 gene rfbA 8674 9540 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889302.1 protein_id gnl|my_center|LOCUS_24780 9558 10532 gene locus_tag LOCUS_24790 9558 10532 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_24790 10576 11163 gene locus_tag LOCUS_24800 10576 11163 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_24800 11160 12008 gene locus_tag LOCUS_24810 11160 12008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_24810 12027 13292 gene locus_tag LOCUS_24820 12027 13292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_24820 13320 14123 gene locus_tag LOCUS_24830 13320 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 14125 15258 gene locus_tag LOCUS_24840 14125 15258 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105217984.1 protein_id gnl|my_center|LOCUS_24840 16428 15682 gene locus_tag LOCUS_24850 gene istB 16428 15682 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_24850 17983 16406 gene locus_tag LOCUS_24860 gene istA 17983 16406 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_24860 18370 18077 gene locus_tag LOCUS_24870 18370 18077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24870 18471 19163 gene locus_tag LOCUS_24880 18471 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 19633 20061 gene locus_tag LOCUS_24890 19633 20061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 20134 20601 gene locus_tag LOCUS_24900 20134 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24900 20610 21272 gene locus_tag LOCUS_24910 20610 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24910 21383 21685 gene locus_tag LOCUS_24920 21383 21685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 21736 22272 gene locus_tag LOCUS_24930 21736 22272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24930 22226 23365 gene locus_tag LOCUS_24940 22226 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24940 23512 24144 gene locus_tag LOCUS_24950 23512 24144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 24197 24463 gene locus_tag LOCUS_24960 24197 24463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24960 24777 24460 gene locus_tag LOCUS_24970 24777 24460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 24952 25320 gene locus_tag LOCUS_24980 24952 25320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 25780 25496 gene locus_tag LOCUS_24990 25780 25496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24990 26119 27111 gene locus_tag LOCUS_25000 26119 27111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 27127 27981 gene locus_tag LOCUS_25010 27127 27981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 28034 28981 gene locus_tag LOCUS_25020 28034 28981 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_25020 28983 30029 gene locus_tag LOCUS_25030 28983 30029 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045001.1 protein_id gnl|my_center|LOCUS_25030 30548 31543 gene locus_tag LOCUS_25040 30548 31543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 31710 32477 gene locus_tag LOCUS_25050 31710 32477 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_25050 33109 33360 gene locus_tag LOCUS_25060 33109 33360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 33372 34877 gene locus_tag LOCUS_25070 33372 34877 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225537.1 protein_id gnl|my_center|LOCUS_25070 34874 35137 gene locus_tag LOCUS_25080 34874 35137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 35134 35616 gene locus_tag LOCUS_25090 35134 35616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 35613 36194 gene locus_tag LOCUS_25100 35613 36194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 37208 37624 gene locus_tag LOCUS_25110 37208 37624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 37621 38670 gene locus_tag LOCUS_25120 37621 38670 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799038.1 protein_id gnl|my_center|LOCUS_25120 38667 39611 gene locus_tag LOCUS_25130 38667 39611 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_25130 39693 40892 gene locus_tag LOCUS_25140 39693 40892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 40889 42118 gene locus_tag LOCUS_25150 40889 42118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 42105 43220 gene locus_tag LOCUS_25160 42105 43220 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050765261.1 protein_id gnl|my_center|LOCUS_25160 43426 43280 gene locus_tag LOCUS_25170 43426 43280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 43403 45088 gene locus_tag LOCUS_25180 gene asnB 43403 45088 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_25180 45090 47228 gene locus_tag LOCUS_25190 45090 47228 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862490.1 protein_id gnl|my_center|LOCUS_25190 47377 48597 gene locus_tag LOCUS_25200 gene vpsj 47377 48597 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_25200 48590 49513 gene locus_tag LOCUS_25210 48590 49513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 49510 50304 gene locus_tag LOCUS_25220 49510 50304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 50304 51374 gene locus_tag LOCUS_25230 50304 51374 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_25230 51371 52888 gene locus_tag LOCUS_25240 51371 52888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 53286 52981 gene locus_tag LOCUS_25250 53286 52981 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_25250 53424 55115 gene locus_tag LOCUS_25260 53424 55115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 55274 56314 gene locus_tag LOCUS_25270 gene gmd 55274 56314 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_25270 56377 57411 gene locus_tag LOCUS_25280 56377 57411 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_25280 57487 58713 gene locus_tag LOCUS_25290 57487 58713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 58804 60300 gene locus_tag LOCUS_25300 58804 60300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 60414 60572 gene locus_tag LOCUS_25310 60414 60572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 60562 61986 gene locus_tag LOCUS_25320 gene noeA 60562 61986 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_25320 62163 63734 gene locus_tag LOCUS_25330 62163 63734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 63869 65392 gene locus_tag LOCUS_25340 63869 65392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 65431 67992 gene locus_tag LOCUS_25350 65431 67992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 68075 68257 gene locus_tag LOCUS_25360 68075 68257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 68472 70352 gene locus_tag LOCUS_25370 gene asnB 68472 70352 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_25370 70829 72223 gene locus_tag LOCUS_25380 70829 72223 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_25380 72348 73691 gene locus_tag LOCUS_25390 72348 73691 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020726.1 protein_id gnl|my_center|LOCUS_25390 73811 74359 gene locus_tag LOCUS_25400 gene rfbC 73811 74359 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_25400 74487 76844 gene locus_tag LOCUS_25410 74487 76844 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_25410 77015 78580 gene locus_tag LOCUS_25420 77015 78580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 78759 79361 gene locus_tag LOCUS_25430 78759 79361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 79560 80582 gene locus_tag LOCUS_25440 79560 80582 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272791.1 protein_id gnl|my_center|LOCUS_25440 80808 81191 gene locus_tag LOCUS_25450 80808 81191 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_25450 81344 81919 gene locus_tag LOCUS_25460 gene thpR 81344 81919 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267029.1 protein_id gnl|my_center|LOCUS_25460 81957 83075 gene locus_tag LOCUS_25470 gene recA 81957 83075 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057169.1 protein_id gnl|my_center|LOCUS_25470 83086 84012 gene locus_tag LOCUS_25480 83086 84012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 84192 85079 gene locus_tag LOCUS_25490 84192 85079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 85471 86106 gene locus_tag LOCUS_25500 gene recX 85471 86106 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243354.1 protein_id gnl|my_center|LOCUS_25500 88087 86480 gene locus_tag LOCUS_25510 88087 86480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 88331 90118 gene locus_tag LOCUS_25520 gene ggt 88331 90118 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_25520 90287 90880 gene locus_tag LOCUS_25530 90287 90880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 91059 92312 gene locus_tag LOCUS_25540 gene clpX 91059 92312 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932095.1 protein_id gnl|my_center|LOCUS_25540 93870 92368 gene locus_tag LOCUS_25550 93870 92368 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940347.1 protein_id gnl|my_center|LOCUS_25550 94909 93998 gene locus_tag LOCUS_25560 94909 93998 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_25560 95234 97252 gene locus_tag LOCUS_25570 gene uvrB 95234 97252 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403914.1 protein_id gnl|my_center|LOCUS_25570 99243 97390 gene locus_tag LOCUS_25580 99243 97390 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_25580 99266 99499 gene locus_tag LOCUS_25590 99266 99499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 99496 99963 gene locus_tag LOCUS_25600 99496 99963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 100891 100154 gene locus_tag LOCUS_25610 100891 100154 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_25610 101749 100964 gene locus_tag LOCUS_25620 101749 100964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 101933 101856 gene locus_tag LOCUS_t00360 101933 101856 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 103100 102948 gene locus_tag LOCUS_25630 103100 102948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 103219 103515 gene locus_tag LOCUS_25640 103219 103515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 103599 104189 gene locus_tag LOCUS_25650 103599 104189 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_25650 104201 105010 gene locus_tag LOCUS_25660 104201 105010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 105059 105238 gene locus_tag LOCUS_25670 105059 105238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 105415 107460 gene locus_tag LOCUS_25680 105415 107460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 107718 109733 gene locus_tag LOCUS_25690 107718 109733 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839216.1 protein_id gnl|my_center|LOCUS_25690 109805 111079 gene locus_tag LOCUS_25700 109805 111079 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_25700 111081 112358 gene locus_tag LOCUS_25710 111081 112358 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_25710 112361 113767 gene locus_tag LOCUS_25720 112361 113767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25720 113764 114765 gene locus_tag LOCUS_25730 113764 114765 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_25730 115112 117109 gene locus_tag LOCUS_25740 115112 117109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 117125 119377 gene locus_tag LOCUS_25750 117125 119377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_25750 120298 119519 gene locus_tag LOCUS_25760 120298 119519 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_25760 120459 120770 gene locus_tag LOCUS_25770 120459 120770 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816569.1 protein_id gnl|my_center|LOCUS_25770 121023 121775 gene locus_tag LOCUS_25780 121023 121775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 122124 121882 gene locus_tag LOCUS_25790 122124 121882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence17 2394 163 gene locus_tag LOCUS_25800 2394 163 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765027.1 protein_id gnl|my_center|LOCUS_25800 2464 2649 gene locus_tag LOCUS_25810 2464 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2843 3193 gene locus_tag LOCUS_25820 2843 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 3981 3463 gene locus_tag LOCUS_25830 3981 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 4559 3978 gene locus_tag LOCUS_25840 4559 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 5607 4507 gene locus_tag LOCUS_25850 5607 4507 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_25850 5963 8677 gene locus_tag LOCUS_25860 5963 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 10377 8845 gene locus_tag LOCUS_25870 10377 8845 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_25870 11821 10634 gene locus_tag LOCUS_25880 11821 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_25880 12537 11818 gene locus_tag LOCUS_25890 12537 11818 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_25890 13063 12524 gene locus_tag LOCUS_25900 13063 12524 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_25900 14508 13078 gene locus_tag LOCUS_25910 gene nrfD 14508 13078 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_25910 17555 14505 gene locus_tag LOCUS_25920 17555 14505 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_25920 18215 17604 gene locus_tag LOCUS_25930 18215 17604 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_25930 18496 18218 gene locus_tag LOCUS_25940 18496 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 18911 18489 gene locus_tag LOCUS_25950 18911 18489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 19498 18908 gene locus_tag LOCUS_25960 19498 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 20259 19495 gene locus_tag LOCUS_25970 20259 19495 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405089.1 protein_id gnl|my_center|LOCUS_25970 21185 20256 gene locus_tag LOCUS_25980 21185 20256 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123496.1 protein_id gnl|my_center|LOCUS_25980 21478 21197 gene locus_tag LOCUS_25990 21478 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 22088 21498 gene locus_tag LOCUS_26000 22088 21498 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_26000 22981 22094 gene locus_tag LOCUS_26010 gene cyoE 22981 22094 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_26010 23997 23008 gene locus_tag LOCUS_26020 23997 23008 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405086.1 protein_id gnl|my_center|LOCUS_26020 25843 24011 gene locus_tag LOCUS_26030 25843 24011 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_26030 26629 25859 gene locus_tag LOCUS_26040 26629 25859 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086566.1 protein_id gnl|my_center|LOCUS_26040 27238 26666 gene locus_tag LOCUS_26050 27238 26666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 28042 27773 gene locus_tag LOCUS_26060 gene groES 28042 27773 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_26060 28311 28066 gene locus_tag LOCUS_26070 28311 28066 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_26070 28548 28375 gene locus_tag LOCUS_26080 28548 28375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 28927 28673 gene locus_tag LOCUS_26090 28927 28673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 29501 28920 gene locus_tag LOCUS_26100 29501 28920 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_26100 30299 29574 gene locus_tag LOCUS_26110 30299 29574 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_26110 30934 30308 gene locus_tag LOCUS_26120 30934 30308 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460932.1 protein_id gnl|my_center|LOCUS_26120 36350 31068 gene locus_tag LOCUS_26130 36350 31068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 37771 36425 gene locus_tag LOCUS_26140 37771 36425 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838623.1 protein_id gnl|my_center|LOCUS_26140 39212 37956 gene locus_tag LOCUS_26150 gene nuoF 39212 37956 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838122.1 protein_id gnl|my_center|LOCUS_26150 39726 39238 gene locus_tag LOCUS_26160 39726 39238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 41035 39731 gene locus_tag LOCUS_26170 gene nuoD 41035 39731 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403174.1 protein_id gnl|my_center|LOCUS_26170 41533 41039 gene locus_tag LOCUS_26180 41533 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 42089 41583 gene locus_tag LOCUS_26190 42089 41583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 42436 42080 gene locus_tag LOCUS_26200 42436 42080 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_26200 44323 42515 gene locus_tag LOCUS_26210 44323 42515 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_26210 45002 44421 gene locus_tag LOCUS_26220 gene pyrE 45002 44421 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393616.1 protein_id gnl|my_center|LOCUS_26220 45450 45133 gene locus_tag LOCUS_26230 45450 45133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 45731 45447 gene locus_tag LOCUS_26240 45731 45447 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_26240 47680 45815 gene locus_tag LOCUS_26250 gene dnaG 47680 45815 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403730.1 protein_id gnl|my_center|LOCUS_26250 48648 47677 gene locus_tag LOCUS_26260 48648 47677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 50344 48707 gene locus_tag LOCUS_26270 50344 48707 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931836.1 protein_id gnl|my_center|LOCUS_26270 51317 50385 gene locus_tag LOCUS_26280 51317 50385 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927196.1 protein_id gnl|my_center|LOCUS_26280 51892 51314 gene locus_tag LOCUS_26290 51892 51314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 52892 51906 gene locus_tag LOCUS_26300 52892 51906 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840143.1 protein_id gnl|my_center|LOCUS_26300 53844 52885 gene locus_tag LOCUS_26310 53844 52885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_26310 55813 54032 gene locus_tag LOCUS_26320 55813 54032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 56647 55835 gene locus_tag LOCUS_26330 56647 55835 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_26330 57840 56815 gene locus_tag LOCUS_26340 57840 56815 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 protein_id gnl|my_center|LOCUS_26340 58458 57856 gene locus_tag LOCUS_26350 58458 57856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 58643 59266 gene locus_tag LOCUS_26360 58643 59266 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_240331840.1 protein_id gnl|my_center|LOCUS_26360 59247 60218 gene locus_tag LOCUS_26370 59247 60218 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_26370 60299 62344 gene locus_tag LOCUS_26380 60299 62344 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838897.1 protein_id gnl|my_center|LOCUS_26380 63457 62357 gene locus_tag LOCUS_26390 gene rsgA 63457 62357 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933238.1 protein_id gnl|my_center|LOCUS_26390 64806 63466 gene locus_tag LOCUS_26400 gene estD 64806 63466 CDS product esterase EstD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083104.1 protein_id gnl|my_center|LOCUS_26400 65684 64983 gene locus_tag LOCUS_26410 65684 64983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 66076 65681 gene locus_tag LOCUS_26420 66076 65681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26420 67211 66081 gene locus_tag LOCUS_26430 67211 66081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26430 68986 67208 gene locus_tag LOCUS_26440 68986 67208 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_26440 71881 69161 gene locus_tag LOCUS_26450 71881 69161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 72048 74528 gene locus_tag LOCUS_26460 72048 74528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 74607 76211 gene locus_tag LOCUS_26470 74607 76211 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_26470 76278 78722 gene locus_tag LOCUS_26480 76278 78722 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_26480 78830 79882 gene locus_tag LOCUS_26490 78830 79882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 79882 81075 gene locus_tag LOCUS_26500 gene cotH 79882 81075 CDS product spore coat protein CotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159093.1 protein_id gnl|my_center|LOCUS_26500 81088 81966 gene locus_tag LOCUS_26510 81088 81966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 82232 83077 gene locus_tag LOCUS_26520 82232 83077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 86219 83133 gene locus_tag LOCUS_26530 86219 83133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 86755 86285 gene locus_tag LOCUS_26540 86755 86285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 87896 86847 gene locus_tag LOCUS_26550 87896 86847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 88489 88013 gene locus_tag LOCUS_26560 88489 88013 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732594.1 protein_id gnl|my_center|LOCUS_26560 89035 88502 gene locus_tag LOCUS_26570 89035 88502 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367419.1 protein_id gnl|my_center|LOCUS_26570 89454 89131 gene locus_tag LOCUS_26580 89454 89131 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213210.1 protein_id gnl|my_center|LOCUS_26580 89916 89464 gene locus_tag LOCUS_26590 89916 89464 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_26590 91190 89916 gene locus_tag LOCUS_26600 91190 89916 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_26600 92518 91190 gene locus_tag LOCUS_26610 gene sufD 92518 91190 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_26610 93301 92534 gene locus_tag LOCUS_26620 gene sufC 93301 92534 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_26620 94823 93378 gene locus_tag LOCUS_26630 gene sufB 94823 93378 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_26630 95056 97056 gene locus_tag LOCUS_26640 95056 97056 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_26640 97133 98662 gene locus_tag LOCUS_26650 97133 98662 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705832.1 protein_id gnl|my_center|LOCUS_26650 99297 98821 gene locus_tag LOCUS_26660 gene greA 99297 98821 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840123.1 protein_id gnl|my_center|LOCUS_26660 100653 99439 gene locus_tag LOCUS_26670 100653 99439 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_26670 100994 100671 gene locus_tag LOCUS_26680 gene yajC 100994 100671 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_26680 102159 101029 gene locus_tag LOCUS_26690 gene tgt 102159 101029 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933064.1 protein_id gnl|my_center|LOCUS_26690 102673 102224 gene locus_tag LOCUS_26700 102673 102224 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583901.1 protein_id gnl|my_center|LOCUS_26700 103070 102720 gene locus_tag LOCUS_26710 103070 102720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 103487 104185 gene locus_tag LOCUS_26720 103487 104185 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_26720 104244 104537 gene locus_tag LOCUS_26730 104244 104537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 104547 104999 gene locus_tag LOCUS_26740 104547 104999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 105037 106113 gene locus_tag LOCUS_26750 105037 106113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 106617 106198 gene locus_tag LOCUS_26760 gene ruvX 106617 106198 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_26760 107014 106607 gene locus_tag LOCUS_26770 107014 106607 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403823.1 protein_id gnl|my_center|LOCUS_26770 109323 107035 gene locus_tag LOCUS_26780 109323 107035 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403822.1 protein_id gnl|my_center|LOCUS_26780 109643 110842 gene locus_tag LOCUS_26790 109643 110842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 110868 111200 gene locus_tag LOCUS_26800 110868 111200 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence18 1232 438 gene locus_tag LOCUS_26810 1232 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1362 1778 gene locus_tag LOCUS_26820 1362 1778 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879906.1 protein_id gnl|my_center|LOCUS_26820 1863 4283 gene locus_tag LOCUS_26830 1863 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 4280 4966 gene locus_tag LOCUS_26840 4280 4966 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_26840 6591 4975 gene locus_tag LOCUS_26850 6591 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 7121 6618 gene locus_tag LOCUS_26860 7121 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 12521 7128 gene locus_tag LOCUS_26870 12521 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 13491 12871 gene locus_tag LOCUS_26880 13491 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 14208 21215 gene locus_tag LOCUS_26890 14208 21215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 21580 25797 gene locus_tag LOCUS_26900 21580 25797 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_26900 28362 26005 gene locus_tag LOCUS_26910 28362 26005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 28802 29434 gene locus_tag LOCUS_26920 28802 29434 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_26920 30154 29501 gene locus_tag LOCUS_26930 30154 29501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 30875 30204 gene locus_tag LOCUS_26940 30875 30204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_26940 33934 30872 gene locus_tag LOCUS_26950 33934 30872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 36545 34164 gene locus_tag LOCUS_26960 36545 34164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 36873 39161 gene locus_tag LOCUS_26970 36873 39161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 39375 41459 gene locus_tag LOCUS_26980 39375 41459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 41716 43668 gene locus_tag LOCUS_26990 41716 43668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 43966 44385 gene locus_tag LOCUS_27000 43966 44385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 46422 44278 gene locus_tag LOCUS_27010 46422 44278 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_27010 47113 46550 gene locus_tag LOCUS_27020 47113 46550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 47236 48801 gene locus_tag LOCUS_27030 47236 48801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 49076 49564 gene locus_tag LOCUS_27040 49076 49564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 49646 51715 gene locus_tag LOCUS_27050 49646 51715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 52347 53945 gene locus_tag LOCUS_27060 52347 53945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 54005 54631 gene locus_tag LOCUS_27070 54005 54631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 54788 58051 gene locus_tag LOCUS_27080 54788 58051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 58473 58117 gene locus_tag LOCUS_27090 58473 58117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 59244 58567 gene locus_tag LOCUS_27100 59244 58567 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977570.1 protein_id gnl|my_center|LOCUS_27100 59661 59398 gene locus_tag LOCUS_27110 59661 59398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 60030 59764 gene locus_tag LOCUS_27120 60030 59764 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080382.1 protein_id gnl|my_center|LOCUS_27120 60997 60368 gene locus_tag LOCUS_27130 60997 60368 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117499.1 protein_id gnl|my_center|LOCUS_27130 61272 61919 gene locus_tag LOCUS_27140 61272 61919 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_27140 61916 64969 gene locus_tag LOCUS_27150 61916 64969 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_27150 65116 66537 gene locus_tag LOCUS_27160 gene nrfD 65116 66537 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_27160 66534 67064 gene locus_tag LOCUS_27170 66534 67064 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_27170 67064 67762 gene locus_tag LOCUS_27180 67064 67762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 67769 68953 gene locus_tag LOCUS_27190 67769 68953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_27190 69052 71508 gene locus_tag LOCUS_27200 69052 71508 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_27200 71510 71749 gene locus_tag LOCUS_27210 71510 71749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 71739 73850 gene locus_tag LOCUS_27220 gene ccoN 71739 73850 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_27220 73863 74069 gene locus_tag LOCUS_27230 73863 74069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 74072 74872 gene locus_tag LOCUS_27240 74072 74872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 74894 76312 gene locus_tag LOCUS_27250 gene ccoG 74894 76312 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_27250 76325 76786 gene locus_tag LOCUS_27260 76325 76786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 76819 77640 gene locus_tag LOCUS_27270 76819 77640 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_27270 78093 77644 gene locus_tag LOCUS_27280 78093 77644 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_27280 78680 78093 gene locus_tag LOCUS_27290 78680 78093 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228210.1 protein_id gnl|my_center|LOCUS_27290 80150 79125 gene locus_tag LOCUS_27300 80150 79125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 80754 80383 gene locus_tag LOCUS_27310 80754 80383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 83153 80910 gene locus_tag LOCUS_27320 83153 80910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 84486 83155 gene locus_tag LOCUS_27330 84486 83155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 86668 84590 gene locus_tag LOCUS_27340 86668 84590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 89563 86951 gene locus_tag LOCUS_27350 89563 86951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 89748 92945 gene locus_tag LOCUS_27360 89748 92945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 92958 93728 gene locus_tag LOCUS_27370 92958 93728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 93771 94538 gene locus_tag LOCUS_27380 93771 94538 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_27380 94717 96528 gene locus_tag LOCUS_27390 94717 96528 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_27390 96578 97192 gene locus_tag LOCUS_27400 96578 97192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 97411 98394 gene locus_tag LOCUS_27410 97411 98394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 98564 99973 gene locus_tag LOCUS_27420 98564 99973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 100572 100081 gene locus_tag LOCUS_27430 100572 100081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence19 138 611 gene locus_tag LOCUS_27440 138 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3343 1031 gene locus_tag LOCUS_27450 3343 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3610 4125 gene locus_tag LOCUS_27460 3610 4125 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946613.1 protein_id gnl|my_center|LOCUS_27460 5071 4163 gene locus_tag LOCUS_27470 gene sucD 5071 4163 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_27470 5230 5622 gene locus_tag LOCUS_27480 gene nifU 5230 5622 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_27480 6393 5818 gene locus_tag LOCUS_27490 6393 5818 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_27490 7663 6401 gene locus_tag LOCUS_27500 7663 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_27500 9519 7663 gene locus_tag LOCUS_27510 9519 7663 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404587.1 protein_id gnl|my_center|LOCUS_27510 9727 10911 gene locus_tag LOCUS_27520 9727 10911 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_27520 10918 12240 gene locus_tag LOCUS_27530 gene rseP 10918 12240 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931818.1 protein_id gnl|my_center|LOCUS_27530 13146 12520 gene locus_tag LOCUS_27540 13146 12520 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582936.1 protein_id gnl|my_center|LOCUS_27540 14596 13343 gene locus_tag LOCUS_27550 14596 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 15417 14746 gene locus_tag LOCUS_27560 gene rpe 15417 14746 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_27560 15803 15414 gene locus_tag LOCUS_27570 15803 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 17098 15932 gene locus_tag LOCUS_27580 17098 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 17133 17348 gene locus_tag LOCUS_27590 17133 17348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 17353 18237 gene locus_tag LOCUS_27600 17353 18237 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_27600 18332 19480 gene locus_tag LOCUS_27610 18332 19480 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256918.1 protein_id gnl|my_center|LOCUS_27610 19590 20393 gene locus_tag LOCUS_27620 19590 20393 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_27620 20547 24092 gene locus_tag LOCUS_27630 20547 24092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840147.1 protein_id gnl|my_center|LOCUS_27630 25237 24089 gene locus_tag LOCUS_27640 25237 24089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 25443 26813 gene locus_tag LOCUS_27650 gene glnA 25443 26813 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_27650 26957 27124 gene locus_tag LOCUS_27660 26957 27124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 29009 29365 gene locus_tag LOCUS_27670 29009 29365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 29508 29690 gene locus_tag LOCUS_27680 29508 29690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 29677 30597 gene locus_tag LOCUS_27690 29677 30597 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_27690 30788 31963 gene locus_tag LOCUS_27700 30788 31963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 32172 31903 gene locus_tag LOCUS_27710 32172 31903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 32204 32635 gene locus_tag LOCUS_27720 32204 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 32616 32819 gene locus_tag LOCUS_27730 32616 32819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 33017 33430 gene locus_tag LOCUS_27740 33017 33430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 33494 33844 gene locus_tag LOCUS_27750 33494 33844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 33897 34016 gene locus_tag LOCUS_27760 33897 34016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 34314 36716 gene locus_tag LOCUS_27770 gene lon 34314 36716 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_27770 36815 37678 gene locus_tag LOCUS_27780 gene prmC 36815 37678 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933153.1 protein_id gnl|my_center|LOCUS_27780 39247 37685 gene locus_tag LOCUS_27790 39247 37685 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263049.1 protein_id gnl|my_center|LOCUS_27790 39887 40318 gene locus_tag LOCUS_27800 39887 40318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 40421 41446 gene locus_tag LOCUS_27810 40421 41446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 41547 43439 gene locus_tag LOCUS_27820 41547 43439 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989931.1 protein_id gnl|my_center|LOCUS_27820 43564 43641 gene locus_tag LOCUS_t00370 43564 43641 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 44128 43874 gene locus_tag LOCUS_27830 44128 43874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 44684 44502 gene locus_tag LOCUS_27840 44684 44502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 47280 45436 gene locus_tag LOCUS_27850 47280 45436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 47552 47295 gene locus_tag LOCUS_27860 47552 47295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 47942 48485 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgccagctttcatccaatggccatgaaggaaggac 49097 48798 gene locus_tag LOCUS_27870 gene cas2 49097 48798 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387937.1 protein_id gnl|my_center|LOCUS_27870 50828 49101 gene locus_tag LOCUS_27880 gene cas1 50828 49101 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_27880 54183 50812 gene locus_tag LOCUS_27890 54183 50812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 55183 54617 gene locus_tag LOCUS_27900 55183 54617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 55283 55957 gene locus_tag LOCUS_27910 55283 55957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 56935 55925 gene locus_tag LOCUS_27920 56935 55925 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_27920 58073 56928 gene locus_tag LOCUS_27930 58073 56928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 58365 58060 gene locus_tag LOCUS_27940 58365 58060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 58944 59414 gene locus_tag LOCUS_27950 58944 59414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 61248 60241 gene locus_tag LOCUS_27960 61248 60241 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_27960 62109 61438 gene locus_tag LOCUS_27970 62109 61438 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_27970 65294 62106 gene locus_tag LOCUS_27980 65294 62106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 67898 65514 gene locus_tag LOCUS_27990 67898 65514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 67985 68188 gene locus_tag LOCUS_28000 67985 68188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 69998 73624 gene locus_tag LOCUS_28010 69998 73624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 73621 73812 gene locus_tag LOCUS_28020 73621 73812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 74049 74366 gene locus_tag LOCUS_28030 74049 74366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 77774 74478 gene locus_tag LOCUS_28040 77774 74478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 80533 77807 gene locus_tag LOCUS_28050 80533 77807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 83680 80696 gene locus_tag LOCUS_28060 83680 80696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 86774 83805 gene locus_tag LOCUS_28070 86774 83805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 88678 88187 gene locus_tag LOCUS_28080 88678 88187 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812290.1 protein_id gnl|my_center|LOCUS_28080 89709 88699 gene locus_tag LOCUS_28090 89709 88699 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_28090 90704 89814 gene locus_tag LOCUS_28100 90704 89814 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_28100 91722 90718 gene locus_tag LOCUS_28110 91722 90718 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_28110 92655 91765 gene locus_tag LOCUS_28120 92655 91765 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_28120 93002 92724 gene locus_tag LOCUS_28130 93002 92724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 93201 94760 gene locus_tag LOCUS_28140 93201 94760 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_28140 97003 95708 gene locus_tag LOCUS_28150 97003 95708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 99590 97392 gene locus_tag LOCUS_28160 99590 97392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence20 232 930 gene locus_tag LOCUS_28170 232 930 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_28170 1041 1544 gene locus_tag LOCUS_28180 1041 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2649 1672 gene locus_tag LOCUS_28190 2649 1672 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_28190 3437 2646 gene locus_tag LOCUS_28200 gene lpxA 3437 2646 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_28200 4887 3475 gene locus_tag LOCUS_28210 4887 3475 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_28210 5098 7305 gene locus_tag LOCUS_28220 gene ppk1 5098 7305 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_28220 8367 7420 gene locus_tag LOCUS_28230 8367 7420 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_28230 8606 8364 gene locus_tag LOCUS_28240 8606 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 10703 8859 gene locus_tag LOCUS_28250 10703 8859 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_28250 11690 10716 gene locus_tag LOCUS_28260 11690 10716 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_28260 12201 11782 gene locus_tag LOCUS_28270 12201 11782 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868448.1 protein_id gnl|my_center|LOCUS_28270 13133 12198 gene locus_tag LOCUS_28280 13133 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933300.1 protein_id gnl|my_center|LOCUS_28280 13245 13628 gene locus_tag LOCUS_28290 13245 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 13691 14437 gene locus_tag LOCUS_28300 13691 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 14665 15285 gene locus_tag LOCUS_28310 gene udk 14665 15285 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700143.1 protein_id gnl|my_center|LOCUS_28310 16120 15377 gene locus_tag LOCUS_28320 16120 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 17047 16163 gene locus_tag LOCUS_28330 17047 16163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926835.1 protein_id gnl|my_center|LOCUS_28330 17116 17946 gene locus_tag LOCUS_28340 gene mazG 17116 17946 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_28340 19296 18025 gene locus_tag LOCUS_28350 19296 18025 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932280.1 protein_id gnl|my_center|LOCUS_28350 19413 20402 gene locus_tag LOCUS_28360 19413 20402 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_28360 20427 21551 gene locus_tag LOCUS_28370 20427 21551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 21548 22714 gene locus_tag LOCUS_28380 21548 22714 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_28380 22720 24417 gene locus_tag LOCUS_28390 22720 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 24630 28154 gene locus_tag LOCUS_28400 24630 28154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 28207 29808 gene locus_tag LOCUS_28410 28207 29808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 30007 32136 gene locus_tag LOCUS_28420 gene glgP 30007 32136 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933260.1 protein_id gnl|my_center|LOCUS_28420 32201 32401 gene locus_tag LOCUS_28430 32201 32401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 32476 32937 gene locus_tag LOCUS_28440 gene bcp 32476 32937 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337529.1 protein_id gnl|my_center|LOCUS_28440 33052 33633 gene locus_tag LOCUS_28450 33052 33633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 33630 34040 gene locus_tag LOCUS_28460 33630 34040 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_28460 34037 34648 gene locus_tag LOCUS_28470 gene folE 34037 34648 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_28470 34652 35359 gene locus_tag LOCUS_28480 34652 35359 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_28480 35359 36072 gene locus_tag LOCUS_28490 35359 36072 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_28490 36264 37769 gene locus_tag LOCUS_28500 36264 37769 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_28500 40680 37900 gene locus_tag LOCUS_28510 40680 37900 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927267.1 protein_id gnl|my_center|LOCUS_28510 42202 40817 gene locus_tag LOCUS_28520 42202 40817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 44320 42230 gene locus_tag LOCUS_28530 44320 42230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 46965 44332 gene locus_tag LOCUS_28540 46965 44332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 47641 47219 gene locus_tag LOCUS_28550 47641 47219 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_28550 48593 47643 gene locus_tag LOCUS_28560 48593 47643 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931855.1 protein_id gnl|my_center|LOCUS_28560 50615 48600 gene locus_tag LOCUS_28570 50615 48600 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_28570 51251 50637 gene locus_tag LOCUS_28580 51251 50637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 52565 51291 gene locus_tag LOCUS_28590 52565 51291 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_28590 53495 52569 gene locus_tag LOCUS_28600 53495 52569 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_28600 54063 53521 gene locus_tag LOCUS_28610 gene pyrR 54063 53521 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_28610 55328 54060 gene locus_tag LOCUS_28620 55328 54060 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948020.1 protein_id gnl|my_center|LOCUS_28620 55482 57575 gene locus_tag LOCUS_28630 gene fusA 55482 57575 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931838.1 protein_id gnl|my_center|LOCUS_28630 57576 58118 gene locus_tag LOCUS_28640 57576 58118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 58211 60589 gene locus_tag LOCUS_28650 58211 60589 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_28650 60715 62103 gene locus_tag LOCUS_28660 60715 62103 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_28660 62162 63349 gene locus_tag LOCUS_28670 62162 63349 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_28670 63437 64807 gene locus_tag LOCUS_28680 63437 64807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 64809 66113 gene locus_tag LOCUS_28690 gene larA 64809 66113 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_28690 66110 66751 gene locus_tag LOCUS_28700 66110 66751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 70644 66835 gene locus_tag LOCUS_28710 70644 66835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 70823 71827 gene locus_tag LOCUS_28720 70823 71827 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545786.1 protein_id gnl|my_center|LOCUS_28720 73259 71832 gene locus_tag LOCUS_28730 73259 71832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 74356 73256 gene locus_tag LOCUS_28740 74356 73256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 75755 74373 gene locus_tag LOCUS_28750 75755 74373 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 protein_id gnl|my_center|LOCUS_28750 77057 75777 gene locus_tag LOCUS_28760 gene kynU 77057 75777 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_28760 77900 77079 gene locus_tag LOCUS_28770 77900 77079 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_28770 78913 77897 gene locus_tag LOCUS_28780 78913 77897 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_28780 79532 79017 gene locus_tag LOCUS_28790 79532 79017 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_28790 80122 79649 gene locus_tag LOCUS_28800 80122 79649 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691774.1 protein_id gnl|my_center|LOCUS_28800 81622 80132 gene locus_tag LOCUS_28810 81622 80132 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_28810 82411 81854 gene locus_tag LOCUS_28820 82411 81854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 83059 82424 gene locus_tag LOCUS_28830 83059 82424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 83285 83890 gene locus_tag LOCUS_28840 gene rpsD 83285 83890 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 protein_id gnl|my_center|LOCUS_28840 84178 86253 gene locus_tag LOCUS_28850 84178 86253 CDS product DUF3857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203669.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence21 1758 151 gene locus_tag LOCUS_28860 1758 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2645 1806 gene locus_tag LOCUS_28870 2645 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2885 2658 gene locus_tag LOCUS_28880 2885 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 4390 2882 gene locus_tag LOCUS_28890 4390 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 5205 4444 gene locus_tag LOCUS_28900 5205 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 6329 5397 gene locus_tag LOCUS_28910 6329 5397 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_28910 6412 7977 gene locus_tag LOCUS_28920 6412 7977 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_28920 8018 8593 gene locus_tag LOCUS_28930 8018 8593 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932408.1 protein_id gnl|my_center|LOCUS_28930 8726 9718 gene locus_tag LOCUS_28940 gene trpS 8726 9718 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931707.1 protein_id gnl|my_center|LOCUS_28940 9721 10575 gene locus_tag LOCUS_28950 9721 10575 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_28950 10578 11780 gene locus_tag LOCUS_28960 10578 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 11780 12658 gene locus_tag LOCUS_28970 11780 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 12717 13556 gene locus_tag LOCUS_28980 12717 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 13553 14248 gene locus_tag LOCUS_28990 13553 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 14421 16343 gene locus_tag LOCUS_29000 14421 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 18535 16496 gene locus_tag LOCUS_29010 18535 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 18873 18703 gene locus_tag LOCUS_29020 18873 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 18902 20941 gene locus_tag LOCUS_29030 18902 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 21111 22085 gene locus_tag LOCUS_29040 21111 22085 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_29040 23240 22155 gene locus_tag LOCUS_29050 gene serC 23240 22155 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_29050 23549 24457 gene locus_tag LOCUS_29060 23549 24457 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963344.1 protein_id gnl|my_center|LOCUS_29060 24482 25723 gene locus_tag LOCUS_29070 24482 25723 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_29070 26782 25865 gene locus_tag LOCUS_29080 26782 25865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 27526 26975 gene locus_tag LOCUS_29090 27526 26975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 29564 27537 gene locus_tag LOCUS_29100 29564 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 29817 29599 gene locus_tag LOCUS_29110 29817 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 30265 29819 gene locus_tag LOCUS_29120 30265 29819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 30430 30882 gene locus_tag LOCUS_29130 30430 30882 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_29130 30914 31444 gene locus_tag LOCUS_29140 30914 31444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 31416 32489 gene locus_tag LOCUS_29150 gene dusB 31416 32489 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_29150 32508 33731 gene locus_tag LOCUS_29160 32508 33731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 33728 34981 gene locus_tag LOCUS_29170 33728 34981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_29170 34991 35167 gene locus_tag LOCUS_29180 34991 35167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 35164 36483 gene locus_tag LOCUS_29190 gene der 35164 36483 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_29190 36586 38520 gene locus_tag LOCUS_29200 gene ftsH 36586 38520 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_29200 40028 38667 gene locus_tag LOCUS_29210 gene rsmB 40028 38667 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838452.1 protein_id gnl|my_center|LOCUS_29210 41329 40049 gene locus_tag LOCUS_29220 41329 40049 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404674.1 protein_id gnl|my_center|LOCUS_29220 42352 41426 gene locus_tag LOCUS_29230 42352 41426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 44376 42352 gene locus_tag LOCUS_29240 44376 42352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 47676 44578 gene locus_tag LOCUS_29250 47676 44578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 50994 47743 gene locus_tag LOCUS_29260 50994 47743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 52290 51112 gene locus_tag LOCUS_29270 gene porV 52290 51112 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_29270 56365 52358 gene locus_tag LOCUS_29280 gene porU 56365 52358 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_29280 57697 56441 gene locus_tag LOCUS_29290 57697 56441 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_29290 58432 57920 gene locus_tag LOCUS_29300 58432 57920 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706144.1 protein_id gnl|my_center|LOCUS_29300 58516 59058 gene locus_tag LOCUS_29310 58516 59058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 59871 59062 gene locus_tag LOCUS_29320 59871 59062 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545723.1 protein_id gnl|my_center|LOCUS_29320 60030 60104 gene locus_tag LOCUS_t00380 60030 60104 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 60116 60200 gene locus_tag LOCUS_t00390 60116 60200 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60282 61034 gene locus_tag LOCUS_29330 60282 61034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 63368 61140 gene locus_tag LOCUS_29340 63368 61140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 63982 63368 gene locus_tag LOCUS_29350 63982 63368 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_29350 64532 63987 gene locus_tag LOCUS_29360 64532 63987 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_29360 65464 64529 gene locus_tag LOCUS_29370 65464 64529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 66256 65471 gene locus_tag LOCUS_29380 66256 65471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 66460 67287 gene locus_tag LOCUS_29390 66460 67287 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_29390 67468 69858 gene locus_tag LOCUS_29400 67468 69858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 71759 69945 gene locus_tag LOCUS_29410 gene pepF 71759 69945 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_29410 72523 71783 gene locus_tag LOCUS_29420 72523 71783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 73314 72535 gene locus_tag LOCUS_29430 73314 72535 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_29430 75944 73311 gene locus_tag LOCUS_29440 gene alaS 75944 73311 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_29440 76252 75941 gene locus_tag LOCUS_29450 76252 75941 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838511.1 protein_id gnl|my_center|LOCUS_29450 76738 76427 gene locus_tag LOCUS_29460 76738 76427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 77248 76793 gene locus_tag LOCUS_29470 77248 76793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 78172 77264 gene locus_tag LOCUS_29480 78172 77264 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_29480 79177 78179 gene locus_tag LOCUS_29490 79177 78179 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_29490 79920 79174 gene locus_tag LOCUS_29500 79920 79174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 80535 79957 gene locus_tag LOCUS_29510 gene rsxA 80535 79957 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_29510 81218 80526 gene locus_tag LOCUS_29520 81218 80526 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_29520 81799 81215 gene locus_tag LOCUS_29530 81799 81215 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_29530 82770 81796 gene locus_tag LOCUS_29540 82770 81796 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_29540 84160 82811 gene locus_tag LOCUS_29550 gene rsxC 84160 82811 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_29550 84440 85822 gene locus_tag LOCUS_29560 gene lysC 84440 85822 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence22 484 1629 gene locus_tag LOCUS_29570 484 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1869 2075 gene locus_tag LOCUS_29580 1869 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 2072 3331 gene locus_tag LOCUS_29590 2072 3331 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_29590 3494 3958 gene locus_tag LOCUS_29600 3494 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 4360 3968 gene locus_tag LOCUS_29610 4360 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 5790 4453 gene locus_tag LOCUS_29620 5790 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 6179 5787 gene locus_tag LOCUS_29630 gene mecI 6179 5787 CDS product mecA-type methicillin resistance repressor MecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369214.1 protein_id gnl|my_center|LOCUS_29630 7525 6338 gene locus_tag LOCUS_29640 7525 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 8943 7588 gene locus_tag LOCUS_29650 8943 7588 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_29650 10033 9194 gene locus_tag LOCUS_29660 10033 9194 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811306.1 protein_id gnl|my_center|LOCUS_29660 10253 10804 gene locus_tag LOCUS_29670 10253 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_29670 11211 12131 gene locus_tag LOCUS_29680 gene argF 11211 12131 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_29680 12142 13086 gene locus_tag LOCUS_29690 gene arcC 12142 13086 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_29690 13126 14043 gene locus_tag LOCUS_29700 gene pyrB 13126 14043 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871106.1 protein_id gnl|my_center|LOCUS_29700 14080 15276 gene locus_tag LOCUS_29710 14080 15276 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 protein_id gnl|my_center|LOCUS_29710 15316 16650 gene locus_tag LOCUS_29720 15316 16650 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_29720 16987 18924 gene locus_tag LOCUS_29730 16987 18924 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_29730 21633 19057 gene locus_tag LOCUS_29740 21633 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 21946 28197 gene locus_tag LOCUS_29750 21946 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 28413 30446 gene locus_tag LOCUS_29760 28413 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 30595 36591 gene locus_tag LOCUS_29770 30595 36591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 37426 36719 gene locus_tag LOCUS_29780 gene rsmI 37426 36719 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404816.1 protein_id gnl|my_center|LOCUS_29780 38115 37429 gene locus_tag LOCUS_29790 gene ispD 38115 37429 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704771.1 protein_id gnl|my_center|LOCUS_29790 39237 38203 gene locus_tag LOCUS_29800 gene queA 39237 38203 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_29800 39608 41662 gene locus_tag LOCUS_29810 39608 41662 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_29810 41706 42452 gene locus_tag LOCUS_29820 41706 42452 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294676.1 protein_id gnl|my_center|LOCUS_29820 43218 42421 gene locus_tag LOCUS_29830 43218 42421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838431.1 protein_id gnl|my_center|LOCUS_29830 43469 45970 gene locus_tag LOCUS_29840 43469 45970 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405549.1 protein_id gnl|my_center|LOCUS_29840 46730 45999 gene locus_tag LOCUS_29850 46730 45999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 46860 47966 gene locus_tag LOCUS_29860 46860 47966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 48303 47998 gene locus_tag LOCUS_29870 48303 47998 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_29870 52125 48727 gene locus_tag LOCUS_29880 52125 48727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839243.1 protein_id gnl|my_center|LOCUS_29880 52889 52137 gene locus_tag LOCUS_29890 52889 52137 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_29890 53146 53541 gene locus_tag LOCUS_29900 53146 53541 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831050.1 protein_id gnl|my_center|LOCUS_29900 53664 53738 gene locus_tag LOCUS_t00400 53664 53738 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 54770 53820 gene locus_tag LOCUS_29910 54770 53820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 54834 56168 gene locus_tag LOCUS_29920 54834 56168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 56332 58272 gene locus_tag LOCUS_29930 56332 58272 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_29930 58278 58607 gene locus_tag LOCUS_29940 58278 58607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 59756 58611 gene locus_tag LOCUS_29950 59756 58611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 59923 60540 gene locus_tag LOCUS_29960 gene sigM 59923 60540 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087658.1 protein_id gnl|my_center|LOCUS_29960 60537 61121 gene locus_tag LOCUS_29970 60537 61121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 61227 62171 gene locus_tag LOCUS_29980 61227 62171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 62283 63197 gene locus_tag LOCUS_29990 62283 63197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 63434 66187 gene locus_tag LOCUS_30000 63434 66187 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_30000 66249 67370 gene locus_tag LOCUS_30010 66249 67370 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 protein_id gnl|my_center|LOCUS_30010 67550 67350 gene locus_tag LOCUS_30020 67550 67350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 67744 68703 gene locus_tag LOCUS_30030 67744 68703 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_30030 69785 68847 gene locus_tag LOCUS_30040 69785 68847 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_30040 70125 69778 gene locus_tag LOCUS_30050 70125 69778 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_30050 70330 70130 gene locus_tag LOCUS_30060 70330 70130 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_30060 70936 70550 gene locus_tag LOCUS_30070 70936 70550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 74917 72959 gene locus_tag LOCUS_30080 74917 72959 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926967.1 protein_id gnl|my_center|LOCUS_30080 76006 74960 gene locus_tag LOCUS_30090 76006 74960 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_30090 76219 77022 gene locus_tag LOCUS_30100 76219 77022 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_30100 77054 77959 gene locus_tag LOCUS_30110 77054 77959 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_30110 78193 77996 gene locus_tag LOCUS_30120 78193 77996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 78171 79226 gene locus_tag LOCUS_30130 gene mtnA 78171 79226 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_30130 79242 80009 gene locus_tag LOCUS_30140 79242 80009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 80146 81666 gene locus_tag LOCUS_30150 80146 81666 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404792.1 protein_id gnl|my_center|LOCUS_30150 82199 82570 gene locus_tag LOCUS_30160 82199 82570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 83363 82725 gene locus_tag LOCUS_30170 83363 82725 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_30170 83601 84656 gene locus_tag LOCUS_30180 83601 84656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838453.1 protein_id gnl|my_center|LOCUS_30180 84662 85345 gene locus_tag LOCUS_30190 84662 85345 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 protein_id gnl|my_center|LOCUS_30190 85521 86114 gene locus_tag LOCUS_30200 85521 86114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 86183 86686 gene locus_tag LOCUS_30210 gene tadA 86183 86686 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence23 5092 2288 gene locus_tag LOCUS_30220 5092 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 6744 5428 gene locus_tag LOCUS_30230 6744 5428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921130.1 protein_id gnl|my_center|LOCUS_30230 7675 6737 gene locus_tag LOCUS_30240 7675 6737 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_30240 9399 7741 gene locus_tag LOCUS_30250 9399 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 12519 9532 gene locus_tag LOCUS_30260 12519 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 16815 12598 gene locus_tag LOCUS_30270 16815 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 19795 16826 gene locus_tag LOCUS_30280 19795 16826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 20025 21512 gene locus_tag LOCUS_30290 20025 21512 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626511.1 protein_id gnl|my_center|LOCUS_30290 21685 26268 gene locus_tag LOCUS_30300 21685 26268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 26420 28564 gene locus_tag LOCUS_30310 26420 28564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 31048 28685 gene locus_tag LOCUS_30320 31048 28685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 29843 29767 gene locus_tag LOCUS_t00410 29843 29767 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31482 32960 gene locus_tag LOCUS_30330 31482 32960 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_30330 33080 35128 gene locus_tag LOCUS_30340 33080 35128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 35263 35676 gene locus_tag LOCUS_30350 gene nikR 35263 35676 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_30350 35677 36477 gene locus_tag LOCUS_30360 35677 36477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 36474 37217 gene locus_tag LOCUS_30370 36474 37217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_30370 37455 39329 gene locus_tag LOCUS_30380 37455 39329 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555875.1 protein_id gnl|my_center|LOCUS_30380 39316 39927 gene locus_tag LOCUS_30390 39316 39927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 39927 40622 gene locus_tag LOCUS_30400 39927 40622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 43202 40818 gene locus_tag LOCUS_30410 43202 40818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 43555 44784 gene locus_tag LOCUS_30420 43555 44784 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_30420 44787 45491 gene locus_tag LOCUS_30430 44787 45491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 45503 45820 gene locus_tag LOCUS_30440 45503 45820 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_30440 45839 46306 gene locus_tag LOCUS_30450 45839 46306 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_30450 47089 46427 gene locus_tag LOCUS_30460 47089 46427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 50334 47086 gene locus_tag LOCUS_30470 50334 47086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 52106 50331 gene locus_tag LOCUS_30480 52106 50331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 52648 54951 gene locus_tag LOCUS_30490 52648 54951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 55186 56280 gene locus_tag LOCUS_30500 55186 56280 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_30500 56330 58972 gene locus_tag LOCUS_30510 56330 58972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 59022 60386 gene locus_tag LOCUS_30520 59022 60386 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_30520 61645 60530 gene locus_tag LOCUS_30530 gene cfa 61645 60530 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_30530 61875 63518 gene locus_tag LOCUS_30540 61875 63518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 63760 67005 gene locus_tag LOCUS_30550 63760 67005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 67473 70064 gene locus_tag LOCUS_30560 67473 70064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 70412 71767 gene locus_tag LOCUS_30570 70412 71767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 72422 71940 gene locus_tag LOCUS_30580 72422 71940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 73031 75406 gene locus_tag LOCUS_30590 73031 75406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 75523 77886 gene locus_tag LOCUS_30600 75523 77886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 78109 79119 gene locus_tag LOCUS_30610 78109 79119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence24 1462 356 gene locus_tag LOCUS_30620 1462 356 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_30620 1826 1566 gene locus_tag LOCUS_30630 1826 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 2508 2729 gene locus_tag LOCUS_30640 2508 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 2742 3068 gene locus_tag LOCUS_30650 2742 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 4626 3301 gene locus_tag LOCUS_30660 4626 3301 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680054.1 protein_id gnl|my_center|LOCUS_30660 5043 6530 gene locus_tag LOCUS_30670 5043 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 6539 8149 gene locus_tag LOCUS_30680 6539 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 8146 8916 gene locus_tag LOCUS_30690 8146 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 15228 9136 gene locus_tag LOCUS_30700 15228 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 15938 15624 gene locus_tag LOCUS_30710 15938 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 16235 17377 gene locus_tag LOCUS_30720 16235 17377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 17579 18874 gene locus_tag LOCUS_30730 17579 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 18969 20939 gene locus_tag LOCUS_30740 18969 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 21107 22165 gene locus_tag LOCUS_30750 21107 22165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 22408 22803 gene locus_tag LOCUS_30760 22408 22803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 25639 22982 gene locus_tag LOCUS_30770 25639 22982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 26186 25932 gene locus_tag LOCUS_30780 26186 25932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 27483 26257 gene locus_tag LOCUS_30790 27483 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 28285 27569 gene locus_tag LOCUS_30800 28285 27569 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_30800 29301 28282 gene locus_tag LOCUS_30810 29301 28282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 31679 29685 gene locus_tag LOCUS_30820 31679 29685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 34989 31666 gene locus_tag LOCUS_30830 34989 31666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 35902 35081 gene locus_tag LOCUS_30840 35902 35081 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_30840 37206 35899 gene locus_tag LOCUS_30850 37206 35899 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_30850 39109 37187 gene locus_tag LOCUS_30860 39109 37187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 39419 42583 gene locus_tag LOCUS_30870 39419 42583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 42675 44864 gene locus_tag LOCUS_30880 42675 44864 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_30880 45082 46338 gene locus_tag LOCUS_30890 45082 46338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 46763 46287 gene locus_tag LOCUS_30900 46763 46287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 46704 47468 gene locus_tag LOCUS_30910 46704 47468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 47545 50679 gene locus_tag LOCUS_30920 47545 50679 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_30920 50687 50980 gene locus_tag LOCUS_30930 50687 50980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_30930 51400 53694 gene locus_tag LOCUS_30940 51400 53694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 53977 56898 gene locus_tag LOCUS_30950 53977 56898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 57338 57880 gene locus_tag LOCUS_30960 57338 57880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 57917 58252 gene locus_tag LOCUS_30970 57917 58252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_30970 58338 59135 gene locus_tag LOCUS_30980 58338 59135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 59185 60432 gene locus_tag LOCUS_30990 59185 60432 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_30990 60559 61017 gene locus_tag LOCUS_31000 gene nuoE 60559 61017 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_31000 61004 62896 gene locus_tag LOCUS_31010 gene nuoF 61004 62896 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_31010 62893 65409 gene locus_tag LOCUS_31020 gene fdhF 62893 65409 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_31020 65402 66340 gene locus_tag LOCUS_31030 65402 66340 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_31030 66340 67830 gene locus_tag LOCUS_31040 gene gltA 66340 67830 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_31040 67889 68341 gene locus_tag LOCUS_31050 67889 68341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence25 <1 669 gene locus_tag LOCUS_31060 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965721.1:GAF domain-containing protein 666 3509 gene locus_tag LOCUS_31070 666 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31070 3538 6507 gene locus_tag LOCUS_31080 3538 6507 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176521608.1 protein_id gnl|my_center|LOCUS_31080 6521 7717 gene locus_tag LOCUS_31090 6521 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 8127 10226 gene locus_tag LOCUS_31100 8127 10226 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_31100 10349 13366 gene locus_tag LOCUS_31110 10349 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 15185 13437 gene locus_tag LOCUS_31120 15185 13437 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942841.1 protein_id gnl|my_center|LOCUS_31120 16884 15451 gene locus_tag LOCUS_31130 16884 15451 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862091.1 protein_id gnl|my_center|LOCUS_31130 18318 16963 gene locus_tag LOCUS_31140 18318 16963 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_31140 19013 18474 gene locus_tag LOCUS_31150 19013 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 19823 19026 gene locus_tag LOCUS_31160 19823 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 20158 20730 gene locus_tag LOCUS_31170 20158 20730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 20888 25309 gene locus_tag LOCUS_31180 20888 25309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 25272 26621 gene locus_tag LOCUS_31190 25272 26621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 26810 27358 gene locus_tag LOCUS_31200 26810 27358 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933185.1 protein_id gnl|my_center|LOCUS_31200 27364 29022 gene locus_tag LOCUS_31210 27364 29022 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090948.1 protein_id gnl|my_center|LOCUS_31210 29142 30086 gene locus_tag LOCUS_31220 29142 30086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 30101 30511 gene locus_tag LOCUS_31230 30101 30511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 30524 32482 gene locus_tag LOCUS_31240 30524 32482 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_31240 32641 32961 gene locus_tag LOCUS_31250 32641 32961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 32972 33772 gene locus_tag LOCUS_31260 32972 33772 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_31260 33796 34149 gene locus_tag LOCUS_31270 33796 34149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 34187 35611 gene locus_tag LOCUS_31280 34187 35611 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_31280 35788 36942 gene locus_tag LOCUS_31290 35788 36942 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_31290 37033 37470 gene locus_tag LOCUS_31300 37033 37470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 37668 41597 gene locus_tag LOCUS_31310 37668 41597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 42501 41605 gene locus_tag LOCUS_31320 gene lipA 42501 41605 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061389.1 protein_id gnl|my_center|LOCUS_31320 43009 42665 gene locus_tag LOCUS_31330 43009 42665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 44639 43233 gene locus_tag LOCUS_31340 44639 43233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 46652 44703 gene locus_tag LOCUS_31350 46652 44703 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_31350 46708 47094 gene locus_tag LOCUS_31360 46708 47094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 47376 47753 gene locus_tag LOCUS_31370 47376 47753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 47766 48245 gene locus_tag LOCUS_31380 47766 48245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 48274 48465 gene locus_tag LOCUS_31390 48274 48465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 51018 48406 gene locus_tag LOCUS_31400 gene mutS 51018 48406 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_31400 51428 51072 gene locus_tag LOCUS_31410 51428 51072 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_31410 53338 51623 gene locus_tag LOCUS_31420 gene ade 53338 51623 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_31420 54831 53617 gene locus_tag LOCUS_31430 54831 53617 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_31430 55288 55935 gene locus_tag LOCUS_31440 55288 55935 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932940.1 protein_id gnl|my_center|LOCUS_31440 56164 55925 gene locus_tag LOCUS_31450 56164 55925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 56082 56960 gene locus_tag LOCUS_31460 56082 56960 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931938.1 protein_id gnl|my_center|LOCUS_31460 56969 57538 gene locus_tag LOCUS_31470 gene gmk 56969 57538 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931939.1 protein_id gnl|my_center|LOCUS_31470 57560 57850 gene locus_tag LOCUS_31480 57560 57850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 57847 59061 gene locus_tag LOCUS_31490 gene coaBC 57847 59061 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402817.1 protein_id gnl|my_center|LOCUS_31490 59292 60020 gene locus_tag LOCUS_31500 59292 60020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 60049 61491 gene locus_tag LOCUS_31510 gene dnaB 60049 61491 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_31510 61632 62654 gene locus_tag LOCUS_31520 61632 62654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 62668 64191 gene locus_tag LOCUS_31530 62668 64191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 64776 64477 gene locus_tag LOCUS_31540 64776 64477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 >Feature sequence26 <1 5529 gene locus_tag LOCUS_31550 <1 5529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 5628 6623 gene locus_tag LOCUS_31560 5628 6623 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564992.1 protein_id gnl|my_center|LOCUS_31560 6620 7378 gene locus_tag LOCUS_31570 gene dapB 6620 7378 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933509.1 protein_id gnl|my_center|LOCUS_31570 7359 8252 gene locus_tag LOCUS_31580 gene dapA 7359 8252 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933288.1 protein_id gnl|my_center|LOCUS_31580 8387 9175 gene locus_tag LOCUS_31590 8387 9175 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_31590 10853 9240 gene locus_tag LOCUS_31600 10853 9240 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_31600 11044 11298 gene locus_tag LOCUS_31610 11044 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082814.1 protein_id gnl|my_center|LOCUS_31610 11504 13801 gene locus_tag LOCUS_31620 11504 13801 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_31620 13812 14696 gene locus_tag LOCUS_31630 13812 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 14789 15211 gene locus_tag LOCUS_31640 14789 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 15437 16951 gene locus_tag LOCUS_31650 15437 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 17195 18571 gene locus_tag LOCUS_31660 17195 18571 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_31660 18703 20325 gene locus_tag LOCUS_31670 18703 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_31670 20365 20544 gene locus_tag LOCUS_31680 20365 20544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 22061 20613 gene locus_tag LOCUS_31690 22061 20613 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_31690 22889 22527 gene locus_tag LOCUS_31700 22889 22527 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082088.1 protein_id gnl|my_center|LOCUS_31700 24149 22896 gene locus_tag LOCUS_31710 gene pepT 24149 22896 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_31710 25482 24247 gene locus_tag LOCUS_31720 25482 24247 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_31720 26495 25587 gene locus_tag LOCUS_31730 26495 25587 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207777.1 protein_id gnl|my_center|LOCUS_31730 26662 27006 gene locus_tag LOCUS_31740 gene hypA 26662 27006 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_31740 27275 26913 gene locus_tag LOCUS_31750 27275 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 27327 27923 gene locus_tag LOCUS_31760 27327 27923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 27943 30366 gene locus_tag LOCUS_31770 27943 30366 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_31770 31625 30363 gene locus_tag LOCUS_31780 gene guaD 31625 30363 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419799.1 protein_id gnl|my_center|LOCUS_31780 32176 31715 gene locus_tag LOCUS_31790 gene dut 32176 31715 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_31790 33602 32271 gene locus_tag LOCUS_31800 33602 32271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 34752 33742 gene locus_tag LOCUS_31810 gene hypE 34752 33742 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_31810 35845 34754 gene locus_tag LOCUS_31820 gene hypD 35845 34754 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_31820 36099 35842 gene locus_tag LOCUS_31830 36099 35842 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_31830 38508 36103 gene locus_tag LOCUS_31840 gene hypF 38508 36103 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_31840 38742 39938 gene locus_tag LOCUS_31850 38742 39938 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_31850 39996 41933 gene locus_tag LOCUS_31860 39996 41933 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_31860 42320 44866 gene locus_tag LOCUS_31870 42320 44866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 45077 47347 gene locus_tag LOCUS_31880 45077 47347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 48415 47354 gene locus_tag LOCUS_31890 48415 47354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_31890 50352 48427 gene locus_tag LOCUS_31900 50352 48427 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107818.1 protein_id gnl|my_center|LOCUS_31900 51020 51577 gene locus_tag LOCUS_31910 51020 51577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329267.1 protein_id gnl|my_center|LOCUS_31910 52124 53161 gene locus_tag LOCUS_31920 52124 53161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 53291 54316 gene locus_tag LOCUS_31930 53291 54316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 54483 55820 gene locus_tag LOCUS_31940 54483 55820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 55820 58267 gene locus_tag LOCUS_31950 55820 58267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 59638 58418 gene locus_tag LOCUS_31960 59638 58418 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728278.1 protein_id gnl|my_center|LOCUS_31960 60210 59635 gene locus_tag LOCUS_31970 60210 59635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 60465 61316 gene locus_tag LOCUS_31980 60465 61316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 61441 62316 gene locus_tag LOCUS_31990 61441 62316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 >Feature sequence27 5499 520 gene locus_tag LOCUS_32000 5499 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 6870 5515 gene locus_tag LOCUS_32010 6870 5515 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_32010 7051 7875 gene locus_tag LOCUS_32020 7051 7875 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225970.1 protein_id gnl|my_center|LOCUS_32020 7872 8573 gene locus_tag LOCUS_32030 7872 8573 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_32030 8488 10689 gene locus_tag LOCUS_32040 8488 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 10986 13286 gene locus_tag LOCUS_32050 10986 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 13376 15643 gene locus_tag LOCUS_32060 13376 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 15651 16544 gene locus_tag LOCUS_32070 15651 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 16619 18580 gene locus_tag LOCUS_32080 16619 18580 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174683.1 protein_id gnl|my_center|LOCUS_32080 18646 19260 gene locus_tag LOCUS_32090 18646 19260 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679904.1 protein_id gnl|my_center|LOCUS_32090 19487 19242 gene locus_tag LOCUS_32100 19487 19242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 19486 21198 gene locus_tag LOCUS_32110 19486 21198 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405517.1 protein_id gnl|my_center|LOCUS_32110 22206 21247 gene locus_tag LOCUS_32120 22206 21247 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 protein_id gnl|my_center|LOCUS_32120 23813 22245 gene locus_tag LOCUS_32130 23813 22245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 24672 23893 gene locus_tag LOCUS_32140 24672 23893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 25162 24743 gene locus_tag LOCUS_32150 25162 24743 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_32150 26675 25152 gene locus_tag LOCUS_32160 26675 25152 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_32160 28150 26672 gene locus_tag LOCUS_32170 28150 26672 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_32170 29162 28164 gene locus_tag LOCUS_32180 29162 28164 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940962.1 protein_id gnl|my_center|LOCUS_32180 29677 29159 gene locus_tag LOCUS_32190 29677 29159 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403129.1 protein_id gnl|my_center|LOCUS_32190 29830 31365 gene locus_tag LOCUS_32200 gene hutH 29830 31365 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_32200 31451 31975 gene locus_tag LOCUS_32210 31451 31975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 33898 32036 gene locus_tag LOCUS_32220 33898 32036 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922636.1 protein_id gnl|my_center|LOCUS_32220 34999 33908 gene locus_tag LOCUS_32230 34999 33908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 39176 35406 gene locus_tag LOCUS_32240 39176 35406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 41252 39477 gene locus_tag LOCUS_32250 41252 39477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 41757 41260 gene locus_tag LOCUS_32260 41757 41260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 42811 41786 gene locus_tag LOCUS_32270 gene nuoH 42811 41786 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552781.1 protein_id gnl|my_center|LOCUS_32270 44529 42826 gene locus_tag LOCUS_32280 44529 42826 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_32280 45711 44539 gene locus_tag LOCUS_32290 45711 44539 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_32290 47188 45893 gene locus_tag LOCUS_32300 47188 45893 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_32300 47666 47196 gene locus_tag LOCUS_32310 47666 47196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 48549 47701 gene locus_tag LOCUS_32320 48549 47701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 50806 48680 gene locus_tag LOCUS_32330 50806 48680 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_32330 50902 51321 gene locus_tag LOCUS_32340 50902 51321 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_32340 52689 51346 gene locus_tag LOCUS_32350 52689 51346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 54563 52839 gene locus_tag LOCUS_32360 54563 52839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence28 210 359 gene locus_tag LOCUS_32370 210 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 2694 451 gene locus_tag LOCUS_32380 2694 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 2917 2696 gene locus_tag LOCUS_32390 2917 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 4256 3039 gene locus_tag LOCUS_32400 4256 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 4950 6572 gene locus_tag LOCUS_32410 4950 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 6858 6730 gene locus_tag LOCUS_32420 6858 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 7575 6970 gene locus_tag LOCUS_32430 7575 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 7718 9976 gene locus_tag LOCUS_32440 7718 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 9988 11034 gene locus_tag LOCUS_32450 9988 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 11031 13445 gene locus_tag LOCUS_32460 11031 13445 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_32460 13548 14210 gene locus_tag LOCUS_32470 13548 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 14192 15502 gene locus_tag LOCUS_32480 14192 15502 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926826.1 protein_id gnl|my_center|LOCUS_32480 15833 17086 gene locus_tag LOCUS_32490 gene rho 15833 17086 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_32490 17128 18303 gene locus_tag LOCUS_32500 17128 18303 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_32500 18455 19309 gene locus_tag LOCUS_32510 18455 19309 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_32510 19361 20503 gene locus_tag LOCUS_32520 19361 20503 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_32520 20540 21082 gene locus_tag LOCUS_32530 20540 21082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 21305 21880 gene locus_tag LOCUS_32540 21305 21880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 22064 22654 gene locus_tag LOCUS_32550 22064 22654 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_32550 22654 23403 gene locus_tag LOCUS_32560 22654 23403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 23425 24384 gene locus_tag LOCUS_32570 23425 24384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 24393 24944 gene locus_tag LOCUS_32580 24393 24944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 24944 25720 gene locus_tag LOCUS_32590 24944 25720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 25752 26249 gene locus_tag LOCUS_32600 25752 26249 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_32600 26265 28025 gene locus_tag LOCUS_32610 26265 28025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 28028 28648 gene locus_tag LOCUS_32620 gene ccmA 28028 28648 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_32620 28645 29310 gene locus_tag LOCUS_32630 28645 29310 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_32630 29474 30421 gene locus_tag LOCUS_32640 29474 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 30446 30565 gene locus_tag LOCUS_32650 30446 30565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 30583 30990 gene locus_tag LOCUS_32660 30583 30990 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_32660 31115 33832 gene locus_tag LOCUS_32670 gene ccsA 31115 33832 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_32670 34127 35446 gene locus_tag LOCUS_32680 34127 35446 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_32680 35537 36274 gene locus_tag LOCUS_32690 35537 36274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 36398 37399 gene locus_tag LOCUS_32700 gene rfaE1 36398 37399 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_32700 37399 37887 gene locus_tag LOCUS_32710 37399 37887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32710 37859 42448 gene locus_tag LOCUS_32720 37859 42448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 42450 44540 gene locus_tag LOCUS_32730 gene rnr 42450 44540 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838893.1 protein_id gnl|my_center|LOCUS_32730 44537 45355 gene locus_tag LOCUS_32740 44537 45355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 45585 47112 gene locus_tag LOCUS_r00010 45585 47112 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 47203 47277 gene locus_tag LOCUS_t00420 47203 47277 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 47301 47376 gene locus_tag LOCUS_t00430 47301 47376 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence29 304 53 gene locus_tag LOCUS_32750 304 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 867 301 gene locus_tag LOCUS_32760 867 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 1874 960 gene locus_tag LOCUS_32770 1874 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2073 1816 gene locus_tag LOCUS_32780 2073 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2363 2575 gene locus_tag LOCUS_32790 2363 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3428 2631 gene locus_tag LOCUS_32800 3428 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4478 3543 gene locus_tag LOCUS_32810 4478 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 5235 4420 gene locus_tag LOCUS_32820 5235 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 6262 5453 gene locus_tag LOCUS_32830 6262 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 6454 6378 gene locus_tag LOCUS_t00440 6454 6378 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7154 6654 gene locus_tag LOCUS_32840 7154 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 7296 7742 gene locus_tag LOCUS_32850 7296 7742 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_32850 7739 8686 gene locus_tag LOCUS_32860 7739 8686 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_32860 8670 9623 gene locus_tag LOCUS_32870 8670 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 9839 10582 gene locus_tag LOCUS_32880 9839 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 10587 11672 gene locus_tag LOCUS_32890 10587 11672 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_32890 11742 12164 gene locus_tag LOCUS_32900 gene arfB 11742 12164 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_32900 13348 12245 gene locus_tag LOCUS_32910 13348 12245 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_32910 13881 13345 gene locus_tag LOCUS_32920 gene purE 13881 13345 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_32920 15320 13878 gene locus_tag LOCUS_32930 15320 13878 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_32930 16021 15488 gene locus_tag LOCUS_32940 16021 15488 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_32940 19016 16158 gene locus_tag LOCUS_32950 19016 16158 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_32950 21180 19264 gene locus_tag LOCUS_32960 21180 19264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 22686 21397 gene locus_tag LOCUS_32970 22686 21397 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247973.1 protein_id gnl|my_center|LOCUS_32970 24392 22683 gene locus_tag LOCUS_32980 24392 22683 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_32980 25060 24398 gene locus_tag LOCUS_32990 25060 24398 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926557.1 protein_id gnl|my_center|LOCUS_32990 26078 25074 gene locus_tag LOCUS_33000 gene pip 26078 25074 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036072.1 protein_id gnl|my_center|LOCUS_33000 26248 26430 gene locus_tag LOCUS_33010 26248 26430 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_33010 26688 27356 gene locus_tag LOCUS_33020 26688 27356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 27337 28533 gene locus_tag LOCUS_33030 27337 28533 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729293.1 protein_id gnl|my_center|LOCUS_33030 28679 29881 gene locus_tag LOCUS_33040 gene sucC 28679 29881 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_33040 30033 31268 gene locus_tag LOCUS_33050 30033 31268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 32393 31560 gene locus_tag LOCUS_33060 32393 31560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 32633 32421 gene locus_tag LOCUS_33070 32633 32421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 32523 33590 gene locus_tag LOCUS_33080 32523 33590 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_33080 37273 33869 gene locus_tag LOCUS_33090 37273 33869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 40847 40194 gene locus_tag LOCUS_33100 40847 40194 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_33100 43791 40840 gene locus_tag LOCUS_33110 43791 40840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 46304 43989 gene locus_tag LOCUS_33120 46304 43989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 46768 46412 gene locus_tag LOCUS_33130 46768 46412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence30 1245 382 gene locus_tag LOCUS_33140 1245 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 2888 1401 gene locus_tag LOCUS_33150 2888 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 3537 2923 gene locus_tag LOCUS_33160 3537 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 4445 3534 gene locus_tag LOCUS_33170 4445 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 4946 4638 gene locus_tag LOCUS_33180 gene nadS 4946 4638 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670672.1 protein_id gnl|my_center|LOCUS_33180 9285 5206 gene locus_tag LOCUS_33190 9285 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 9858 9721 gene locus_tag LOCUS_33200 9858 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 10524 9928 gene locus_tag LOCUS_33210 10524 9928 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_33210 11495 10638 gene locus_tag LOCUS_33220 11495 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 12983 11730 gene locus_tag LOCUS_33230 12983 11730 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_33230 17104 12995 gene locus_tag LOCUS_33240 17104 12995 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_33240 17355 18275 gene locus_tag LOCUS_33250 17355 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_33250 18635 20563 gene locus_tag LOCUS_33260 18635 20563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 21705 20740 gene locus_tag LOCUS_33270 21705 20740 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_33270 23925 21784 gene locus_tag LOCUS_33280 23925 21784 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_33280 24223 25038 gene locus_tag LOCUS_33290 24223 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 25035 26006 gene locus_tag LOCUS_33300 25035 26006 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_33300 32386 26054 gene locus_tag LOCUS_33310 32386 26054 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937974.1 protein_id gnl|my_center|LOCUS_33310 33182 32391 gene locus_tag LOCUS_33320 33182 32391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 34063 33176 gene locus_tag LOCUS_33330 34063 33176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 34716 34264 gene locus_tag LOCUS_33340 34716 34264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 35132 34845 gene locus_tag LOCUS_33350 35132 34845 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_33350 35430 35648 gene locus_tag LOCUS_33360 35430 35648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 35980 35702 gene locus_tag LOCUS_33370 gene mazF 35980 35702 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_33370 36135 35977 gene locus_tag LOCUS_33380 36135 35977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 36442 36867 gene locus_tag LOCUS_33390 36442 36867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 37273 36887 gene locus_tag LOCUS_33400 37273 36887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 37463 37260 gene locus_tag LOCUS_33410 37463 37260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 37998 37762 gene locus_tag LOCUS_33420 37998 37762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 39020 38451 gene locus_tag LOCUS_33430 39020 38451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 40578 39022 gene locus_tag LOCUS_33440 40578 39022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 40938 40723 gene locus_tag LOCUS_33450 40938 40723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 42718 40931 gene locus_tag LOCUS_33460 42718 40931 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266186.1 protein_id gnl|my_center|LOCUS_33460 43954 42722 gene locus_tag LOCUS_33470 43954 42722 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015415380.1 protein_id gnl|my_center|LOCUS_33470 45030 44683 gene locus_tag LOCUS_33480 45030 44683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence31 6754 4469 gene locus_tag LOCUS_33490 6754 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 8544 7000 gene locus_tag LOCUS_33500 8544 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 9418 8552 gene locus_tag LOCUS_33510 9418 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 10972 9572 gene locus_tag LOCUS_33520 10972 9572 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_33520 11984 11223 gene locus_tag LOCUS_33530 11984 11223 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_33530 13900 11984 gene locus_tag LOCUS_33540 13900 11984 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_33540 14598 13897 gene locus_tag LOCUS_33550 14598 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_33550 16480 14786 gene locus_tag LOCUS_33560 16480 14786 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_33560 19719 16642 gene locus_tag LOCUS_33570 19719 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 20501 19866 gene locus_tag LOCUS_33580 20501 19866 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_33580 21762 20524 gene locus_tag LOCUS_33590 21762 20524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 22360 21830 gene locus_tag LOCUS_33600 22360 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 22854 22357 gene locus_tag LOCUS_33610 22854 22357 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839585.1 protein_id gnl|my_center|LOCUS_33610 24318 22888 gene locus_tag LOCUS_33620 24318 22888 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_33620 24477 24815 gene locus_tag LOCUS_33630 24477 24815 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_33630 24850 25809 gene locus_tag LOCUS_33640 24850 25809 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_33640 25822 26745 gene locus_tag LOCUS_33650 25822 26745 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403291.1 protein_id gnl|my_center|LOCUS_33650 29591 27165 gene locus_tag LOCUS_33660 29591 27165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 30312 29731 gene locus_tag LOCUS_33670 30312 29731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 31511 30309 gene locus_tag LOCUS_33680 31511 30309 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_33680 34125 31594 gene locus_tag LOCUS_33690 34125 31594 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023262.1 protein_id gnl|my_center|LOCUS_33690 34329 36311 gene locus_tag LOCUS_33700 34329 36311 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_33700 39646 36392 gene locus_tag LOCUS_33710 39646 36392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 43047 39787 gene locus_tag LOCUS_33720 43047 39787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence32 2433 1522 gene locus_tag LOCUS_33730 2433 1522 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931975.1 protein_id gnl|my_center|LOCUS_33730 3164 2430 gene locus_tag LOCUS_33740 gene cmk 3164 2430 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303123.1 protein_id gnl|my_center|LOCUS_33740 3363 8618 gene locus_tag LOCUS_33750 3363 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 10886 8652 gene locus_tag LOCUS_33760 10886 8652 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_33760 11385 10912 gene locus_tag LOCUS_33770 gene ribE 11385 10912 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_33770 12226 11399 gene locus_tag LOCUS_33780 12226 11399 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_33780 13026 12268 gene locus_tag LOCUS_33790 13026 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 14198 13074 gene locus_tag LOCUS_33800 14198 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 17125 14231 gene locus_tag LOCUS_33810 17125 14231 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_33810 18176 17115 gene locus_tag LOCUS_33820 18176 17115 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_33820 19653 18304 gene locus_tag LOCUS_33830 19653 18304 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965968.1 protein_id gnl|my_center|LOCUS_33830 21424 19646 gene locus_tag LOCUS_33840 gene ptsI 21424 19646 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262387.1 protein_id gnl|my_center|LOCUS_33840 21724 21458 gene locus_tag LOCUS_33850 21724 21458 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_33850 22710 21730 gene locus_tag LOCUS_33860 22710 21730 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931948.1 protein_id gnl|my_center|LOCUS_33860 23748 22714 gene locus_tag LOCUS_33870 gene fni 23748 22714 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931949.1 protein_id gnl|my_center|LOCUS_33870 26157 24013 gene locus_tag LOCUS_33880 26157 24013 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_33880 29085 26263 gene locus_tag LOCUS_33890 29085 26263 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_33890 29256 30662 gene locus_tag LOCUS_33900 29256 30662 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384989.1 protein_id gnl|my_center|LOCUS_33900 30810 31967 gene locus_tag LOCUS_33910 30810 31967 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_33910 34519 31988 gene locus_tag LOCUS_33920 34519 31988 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_33920 35281 34526 gene locus_tag LOCUS_33930 35281 34526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 38084 35295 gene locus_tag LOCUS_33940 38084 35295 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_33940 38919 38305 gene locus_tag LOCUS_33950 38919 38305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 39243 39019 gene locus_tag LOCUS_33960 39243 39019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence33 419 910 gene locus_tag LOCUS_33970 419 910 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_33970 910 1752 gene locus_tag LOCUS_33980 910 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693980.1 protein_id gnl|my_center|LOCUS_33980 1765 2787 gene locus_tag LOCUS_33990 1765 2787 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_33990 3522 2788 gene locus_tag LOCUS_34000 3522 2788 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_34000 3587 4546 gene locus_tag LOCUS_34010 3587 4546 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_34010 4554 5258 gene locus_tag LOCUS_34020 4554 5258 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861319.1 protein_id gnl|my_center|LOCUS_34020 5261 6034 gene locus_tag LOCUS_34030 5261 6034 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_34030 6190 7371 gene locus_tag LOCUS_34040 6190 7371 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104435.1 protein_id gnl|my_center|LOCUS_34040 8129 7491 gene locus_tag LOCUS_34050 8129 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 8554 8126 gene locus_tag LOCUS_34060 8554 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 8760 9983 gene locus_tag LOCUS_34070 8760 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 9973 11538 gene locus_tag LOCUS_34080 gene citF 9973 11538 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_34080 12123 11707 gene locus_tag LOCUS_34090 12123 11707 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209780.1 protein_id gnl|my_center|LOCUS_34090 12378 12451 gene locus_tag LOCUS_t00450 12378 12451 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12574 13605 gene locus_tag LOCUS_34100 12574 13605 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438644.1 protein_id gnl|my_center|LOCUS_34100 13630 14352 gene locus_tag LOCUS_34110 13630 14352 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_34110 14829 16583 gene locus_tag LOCUS_34120 gene recJ 14829 16583 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_34120 16614 17357 gene locus_tag LOCUS_34130 16614 17357 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_34130 17364 17900 gene locus_tag LOCUS_34140 gene ruvC 17364 17900 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405380.1 protein_id gnl|my_center|LOCUS_34140 17939 18496 gene locus_tag LOCUS_34150 gene ruvA 17939 18496 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450983.1 protein_id gnl|my_center|LOCUS_34150 19168 18830 gene locus_tag LOCUS_34160 19168 18830 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225869.1 protein_id gnl|my_center|LOCUS_34160 19311 20003 gene locus_tag LOCUS_34170 19311 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 20105 20581 gene locus_tag LOCUS_34180 gene ndhC 20105 20581 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_34180 20599 21099 gene locus_tag LOCUS_34190 20599 21099 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_34190 21096 21572 gene locus_tag LOCUS_34200 21096 21572 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_34200 21589 22746 gene locus_tag LOCUS_34210 21589 22746 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_34210 22774 23886 gene locus_tag LOCUS_34220 gene nuoH 22774 23886 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_34220 23909 24559 gene locus_tag LOCUS_34230 23909 24559 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932453.1 protein_id gnl|my_center|LOCUS_34230 24562 25050 gene locus_tag LOCUS_34240 24562 25050 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_34240 25064 25375 gene locus_tag LOCUS_34250 gene nuoK 25064 25375 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_34250 25375 27366 gene locus_tag LOCUS_34260 25375 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 27415 29637 gene locus_tag LOCUS_34270 gene nuoL 27415 29637 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927227.1 protein_id gnl|my_center|LOCUS_34270 29677 31257 gene locus_tag LOCUS_34280 29677 31257 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_34280 31295 32812 gene locus_tag LOCUS_34290 31295 32812 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_34290 32995 33540 gene locus_tag LOCUS_34300 32995 33540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 33708 35018 gene locus_tag LOCUS_34310 33708 35018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 35028 36101 gene locus_tag LOCUS_34320 35028 36101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 36101 36931 gene locus_tag LOCUS_34330 36101 36931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34330 >Feature sequence34 337 882 gene locus_tag LOCUS_34340 337 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 1131 1778 gene locus_tag LOCUS_34350 1131 1778 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_34350 1942 3291 gene locus_tag LOCUS_34360 1942 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 3288 5708 gene locus_tag LOCUS_34370 3288 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 5705 6364 gene locus_tag LOCUS_34380 5705 6364 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_34380 6632 8050 gene locus_tag LOCUS_34390 6632 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 8096 8455 gene locus_tag LOCUS_34400 8096 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 8517 10454 gene locus_tag LOCUS_34410 8517 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 10762 10544 gene locus_tag LOCUS_34420 10762 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 11026 12624 gene locus_tag LOCUS_34430 11026 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 12634 14541 gene locus_tag LOCUS_34440 12634 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 14718 15446 gene locus_tag LOCUS_34450 14718 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 16605 16177 gene locus_tag LOCUS_34460 16605 16177 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_34460 16791 17105 gene locus_tag LOCUS_34470 16791 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 17140 18294 gene locus_tag LOCUS_34480 gene rho 17140 18294 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405059.1 protein_id gnl|my_center|LOCUS_34480 19307 18420 gene locus_tag LOCUS_34490 19307 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 22282 19652 gene locus_tag LOCUS_34500 22282 19652 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_34500 23756 22413 gene locus_tag LOCUS_34510 23756 22413 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_34510 24358 24011 gene locus_tag LOCUS_34520 24358 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 24554 25315 gene locus_tag LOCUS_34530 24554 25315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 25305 25583 gene locus_tag LOCUS_34540 25305 25583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 26694 25540 gene locus_tag LOCUS_34550 26694 25540 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_34550 28005 26815 gene locus_tag LOCUS_34560 28005 26815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 29757 28129 gene locus_tag LOCUS_34570 29757 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 29785 29994 gene locus_tag LOCUS_34580 29785 29994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 31163 30060 gene locus_tag LOCUS_34590 gene wecB 31163 30060 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_34590 32487 31165 gene locus_tag LOCUS_34600 32487 31165 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_34600 33690 32662 gene locus_tag LOCUS_34610 gene rfbB 33690 32662 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence35 70 2004 gene locus_tag LOCUS_34620 70 2004 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949065.1 protein_id gnl|my_center|LOCUS_34620 2133 2420 gene locus_tag LOCUS_34630 2133 2420 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_34630 2446 2712 gene locus_tag LOCUS_34640 2446 2712 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015205689.1 protein_id gnl|my_center|LOCUS_34640 2983 4398 gene locus_tag LOCUS_34650 gene egtB 2983 4398 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_34650 4395 5354 gene locus_tag LOCUS_34660 gene egtD 4395 5354 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_34660 8220 5545 gene locus_tag LOCUS_34670 8220 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 8810 8364 gene locus_tag LOCUS_34680 8810 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 9149 8961 gene locus_tag LOCUS_34690 9149 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 10240 9680 gene locus_tag LOCUS_34700 10240 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 10830 10237 gene locus_tag LOCUS_34710 10830 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 11594 10854 gene locus_tag LOCUS_34720 11594 10854 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932718.1 protein_id gnl|my_center|LOCUS_34720 12192 11596 gene locus_tag LOCUS_34730 gene recR 12192 11596 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932487.1 protein_id gnl|my_center|LOCUS_34730 12550 12212 gene locus_tag LOCUS_34740 12550 12212 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537018.1 protein_id gnl|my_center|LOCUS_34740 20401 12755 gene locus_tag LOCUS_34750 20401 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 20790 22412 gene locus_tag LOCUS_34760 20790 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 22413 23519 gene locus_tag LOCUS_34770 gene lptG 22413 23519 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_34770 23651 24085 gene locus_tag LOCUS_34780 gene queD 23651 24085 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931062.1 protein_id gnl|my_center|LOCUS_34780 24204 24857 gene locus_tag LOCUS_34790 gene fsa 24204 24857 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393880.1 protein_id gnl|my_center|LOCUS_34790 24900 25985 gene locus_tag LOCUS_34800 gene gcvT 24900 25985 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_34800 26013 28901 gene locus_tag LOCUS_34810 26013 28901 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839038.1 protein_id gnl|my_center|LOCUS_34810 28912 29544 gene locus_tag LOCUS_34820 28912 29544 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404316.1 protein_id gnl|my_center|LOCUS_34820 >Feature sequence36 470 2362 gene locus_tag LOCUS_34830 gene acs 470 2362 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_34830 4110 2476 gene locus_tag LOCUS_34840 4110 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 4285 5529 gene locus_tag LOCUS_34850 4285 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 5771 8173 gene locus_tag LOCUS_34860 5771 8173 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_34860 8794 8444 gene locus_tag LOCUS_34870 8794 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 8729 9001 gene locus_tag LOCUS_34880 8729 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 9213 10193 gene locus_tag LOCUS_34890 9213 10193 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_34890 10270 11004 gene locus_tag LOCUS_34900 10270 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 11284 11604 gene locus_tag LOCUS_34910 11284 11604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020545.1 protein_id gnl|my_center|LOCUS_34910 11656 12108 gene locus_tag LOCUS_34920 11656 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 12181 12627 gene locus_tag LOCUS_34930 12181 12627 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_34930 12763 13923 gene locus_tag LOCUS_34940 12763 13923 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_34940 14269 15540 gene locus_tag LOCUS_34950 14269 15540 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223883297.1 protein_id gnl|my_center|LOCUS_34950 15533 15994 gene locus_tag LOCUS_34960 gene vsr 15533 15994 CDS product DNA mismatch endonuclease Vsr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940109.1 protein_id gnl|my_center|LOCUS_34960 15991 17208 gene locus_tag LOCUS_34970 15991 17208 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940107.1 protein_id gnl|my_center|LOCUS_34970 17257 18321 gene locus_tag LOCUS_34980 17257 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 18322 18957 gene locus_tag LOCUS_34990 18322 18957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 19077 20081 gene locus_tag LOCUS_35000 19077 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 20418 20182 gene locus_tag LOCUS_35010 20418 20182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 20598 21353 gene locus_tag LOCUS_35020 20598 21353 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095760.1 protein_id gnl|my_center|LOCUS_35020 21484 22812 gene locus_tag LOCUS_35030 21484 22812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 24580 23213 gene locus_tag LOCUS_35040 24580 23213 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403984.1 protein_id gnl|my_center|LOCUS_35040 24672 25676 gene locus_tag LOCUS_35050 gene galT 24672 25676 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258726.1 protein_id gnl|my_center|LOCUS_35050 26498 25716 gene locus_tag LOCUS_35060 gene surE 26498 25716 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_35060 26948 26628 gene locus_tag LOCUS_35070 26948 26628 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_35070 27397 26945 gene locus_tag LOCUS_35080 27397 26945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 27951 27394 gene locus_tag LOCUS_35090 gene rpoE 27951 27394 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_35090 28129 28953 gene locus_tag LOCUS_35100 28129 28953 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220028.1 protein_id gnl|my_center|LOCUS_35100 29018 29884 gene locus_tag LOCUS_35110 29018 29884 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057545.1 protein_id gnl|my_center|LOCUS_35110 30056 32107 gene locus_tag LOCUS_35120 30056 32107 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_35120 >Feature sequence37 3033 3767 gene locus_tag LOCUS_35130 3033 3767 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_35130 3914 5383 gene locus_tag LOCUS_35140 3914 5383 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_35140 5581 7101 gene locus_tag LOCUS_35150 gene hutH 5581 7101 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_35150 7193 8797 gene locus_tag LOCUS_35160 7193 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 9386 8886 gene locus_tag LOCUS_35170 9386 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 9915 9370 gene locus_tag LOCUS_35180 9915 9370 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_35180 10669 9935 gene locus_tag LOCUS_35190 10669 9935 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259509.1 protein_id gnl|my_center|LOCUS_35190 11094 10669 gene locus_tag LOCUS_35200 11094 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 12414 11212 gene locus_tag LOCUS_35210 12414 11212 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804023.1 protein_id gnl|my_center|LOCUS_35210 13022 12567 gene locus_tag LOCUS_35220 13022 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 15350 13236 gene locus_tag LOCUS_35230 15350 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 15628 17346 gene locus_tag LOCUS_35240 15628 17346 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_35240 17458 19488 gene locus_tag LOCUS_35250 17458 19488 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869356.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence38 3144 796 gene locus_tag LOCUS_35260 3144 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 3568 3173 gene locus_tag LOCUS_35270 3568 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 4332 3679 gene locus_tag LOCUS_35280 4332 3679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_35280 6670 4325 gene locus_tag LOCUS_35290 6670 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 7510 7031 gene locus_tag LOCUS_35300 7510 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence39 967 146 gene locus_tag LOCUS_35310 967 146 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_35310 2026 1130 gene locus_tag LOCUS_35320 2026 1130 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_35320 3598 2030 gene locus_tag LOCUS_35330 gene atpA 3598 2030 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_35330 4189 3647 gene locus_tag LOCUS_35340 gene atpH 4189 3647 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142900.1 protein_id gnl|my_center|LOCUS_35340 4702 4208 gene locus_tag LOCUS_35350 gene atpF 4702 4208 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552096.1 protein_id gnl|my_center|LOCUS_35350 4967 4746 gene locus_tag LOCUS_35360 4967 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence40 1009 263 gene locus_tag LOCUS_35370 1009 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 2164 1013 gene locus_tag LOCUS_35380 2164 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 3496 2261 gene locus_tag LOCUS_35390 3496 2261 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_35390 >Feature sequence41 <2716 319 gene locus_tag LOCUS_35400 <2716 319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144184.1:SBBP repeat-containing protein >Feature sequence42