>Feature sequence01 2784 1477 gene locus_tag LOCUS_00010 gene tyrS 2784 1477 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262278.1 protein_id gnl|my_center|LOCUS_00010 2953 4392 gene locus_tag LOCUS_00020 2953 4392 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401947.1 protein_id gnl|my_center|LOCUS_00020 4404 5528 gene locus_tag LOCUS_00030 4404 5528 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_00030 6113 5760 gene locus_tag LOCUS_00040 gene erpA 6113 5760 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085254.1 protein_id gnl|my_center|LOCUS_00040 6654 6214 gene locus_tag LOCUS_00050 6654 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7307 6666 gene locus_tag LOCUS_00060 7307 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8416 7385 gene locus_tag LOCUS_00070 gene argC 8416 7385 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_00070 8517 10265 gene locus_tag LOCUS_00080 8517 10265 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_00080 10276 10731 gene locus_tag LOCUS_00090 gene hemJ 10276 10731 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_00090 11352 10741 gene locus_tag LOCUS_00100 11352 10741 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_00100 11443 12723 gene locus_tag LOCUS_00110 gene hemL 11443 12723 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_00110 13553 12816 gene locus_tag LOCUS_00120 13553 12816 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_00120 13725 14498 gene locus_tag LOCUS_00130 13725 14498 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 protein_id gnl|my_center|LOCUS_00130 14495 15535 gene locus_tag LOCUS_00140 14495 15535 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_00140 15820 18207 gene locus_tag LOCUS_00150 15820 18207 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 protein_id gnl|my_center|LOCUS_00150 18551 19285 gene locus_tag LOCUS_00160 18551 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19295 19840 gene locus_tag LOCUS_00170 19295 19840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20461 19985 gene locus_tag LOCUS_00180 20461 19985 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 protein_id gnl|my_center|LOCUS_00180 20883 20620 gene locus_tag LOCUS_00190 20883 20620 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_00190 21122 20880 gene locus_tag LOCUS_00200 21122 20880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22139 21357 gene locus_tag LOCUS_00210 gene blaOXA 22139 21357 CDS product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 protein_id gnl|my_center|LOCUS_00210 24163 22442 gene locus_tag LOCUS_00220 24163 22442 CDS product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121559.1 protein_id gnl|my_center|LOCUS_00220 24392 24150 gene locus_tag LOCUS_00230 24392 24150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25344 24385 gene locus_tag LOCUS_00240 25344 24385 CDS product SMEK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092235370.1 protein_id gnl|my_center|LOCUS_00240 25879 25493 gene locus_tag LOCUS_00250 25879 25493 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 protein_id gnl|my_center|LOCUS_00250 26282 27295 gene locus_tag LOCUS_00260 gene hemB 26282 27295 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_00260 28528 27308 gene locus_tag LOCUS_00270 28528 27308 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 protein_id gnl|my_center|LOCUS_00270 29024 28638 gene locus_tag LOCUS_00280 gene gcvH 29024 28638 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307993.1 protein_id gnl|my_center|LOCUS_00280 30352 29114 gene locus_tag LOCUS_00290 30352 29114 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_00290 31652 30345 gene locus_tag LOCUS_00300 gene ubiH 31652 30345 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266319.1 protein_id gnl|my_center|LOCUS_00300 32962 31649 gene locus_tag LOCUS_00310 gene pepP 32962 31649 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_00310 33561 33004 gene locus_tag LOCUS_00320 33561 33004 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621372.1 protein_id gnl|my_center|LOCUS_00320 33755 33961 gene locus_tag LOCUS_00330 33755 33961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33967 34278 gene locus_tag LOCUS_00340 33967 34278 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_00340 34510 35082 gene locus_tag LOCUS_00350 34510 35082 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706539.1 protein_id gnl|my_center|LOCUS_00350 35111 36535 gene locus_tag LOCUS_00360 gene pyk 35111 36535 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_00360 36550 37950 gene locus_tag LOCUS_00370 gene phoA 36550 37950 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224636.1 protein_id gnl|my_center|LOCUS_00370 38875 37973 gene locus_tag LOCUS_00380 38875 37973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40417 38906 gene locus_tag LOCUS_00390 gene ilvA 40417 38906 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_00390 40561 41256 gene locus_tag LOCUS_00400 gene rpiA 40561 41256 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 protein_id gnl|my_center|LOCUS_00400 42294 41272 gene locus_tag LOCUS_00410 42294 41272 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_00410 43469 42291 gene locus_tag LOCUS_00420 43469 42291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 42400 42320 gene locus_tag LOCUS_t00010 42400 42320 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 43669 43953 gene locus_tag LOCUS_00430 43669 43953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44221 44003 gene locus_tag LOCUS_00440 44221 44003 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_00440 44758 44279 gene locus_tag LOCUS_00450 44758 44279 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_00450 45529 44852 gene locus_tag LOCUS_00460 45529 44852 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162993.1 protein_id gnl|my_center|LOCUS_00460 47135 45735 gene locus_tag LOCUS_00470 47135 45735 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_00470 47238 48467 gene locus_tag LOCUS_00480 gene serA 47238 48467 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_00480 49532 48534 gene locus_tag LOCUS_00490 49532 48534 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_00490 49755 49525 gene locus_tag LOCUS_00500 49755 49525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50922 49858 gene locus_tag LOCUS_00510 gene fba 50922 49858 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763563.1 protein_id gnl|my_center|LOCUS_00510 52180 51011 gene locus_tag LOCUS_00520 52180 51011 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084960.1 protein_id gnl|my_center|LOCUS_00520 53238 52216 gene locus_tag LOCUS_00530 gene epd 53238 52216 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071211.1 protein_id gnl|my_center|LOCUS_00530 55272 53278 gene locus_tag LOCUS_00540 gene tkt 55272 53278 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 protein_id gnl|my_center|LOCUS_00540 55422 56426 gene locus_tag LOCUS_00550 55422 56426 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_00550 56458 57612 gene locus_tag LOCUS_00560 gene metK 56458 57612 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372639.1 protein_id gnl|my_center|LOCUS_00560 57640 59013 gene locus_tag LOCUS_00570 gene ahcY 57640 59013 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266417.1 protein_id gnl|my_center|LOCUS_00570 59062 59907 gene locus_tag LOCUS_00580 gene metF 59062 59907 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765400.1 protein_id gnl|my_center|LOCUS_00580 59900 60634 gene locus_tag LOCUS_00590 59900 60634 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402944.1 protein_id gnl|my_center|LOCUS_00590 61237 60794 gene locus_tag LOCUS_00600 gene secB 61237 60794 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372189.1 protein_id gnl|my_center|LOCUS_00600 62007 61507 gene locus_tag LOCUS_00610 62007 61507 CDS product acetone carboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001877024.1 protein_id gnl|my_center|LOCUS_00610 64422 62095 gene locus_tag LOCUS_00620 64422 62095 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285084.1 protein_id gnl|my_center|LOCUS_00620 66637 64493 gene locus_tag LOCUS_00630 66637 64493 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650637.1 protein_id gnl|my_center|LOCUS_00630 67107 69077 gene locus_tag LOCUS_00640 67107 69077 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086466.1 protein_id gnl|my_center|LOCUS_00640 69623 69153 gene locus_tag LOCUS_00650 69623 69153 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_00650 72749 69627 gene locus_tag LOCUS_00660 72749 69627 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_00660 73900 72746 gene locus_tag LOCUS_00670 73900 72746 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_00670 74122 74928 gene locus_tag LOCUS_00680 74122 74928 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070077545.1 protein_id gnl|my_center|LOCUS_00680 76348 74951 gene locus_tag LOCUS_00690 76348 74951 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 protein_id gnl|my_center|LOCUS_00690 76571 78157 gene locus_tag LOCUS_00700 gene gshA 76571 78157 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_00700 78154 78735 gene locus_tag LOCUS_00710 78154 78735 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405918.1 protein_id gnl|my_center|LOCUS_00710 78761 79240 gene locus_tag LOCUS_00720 78761 79240 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_00720 79237 79596 gene locus_tag LOCUS_00730 79237 79596 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 protein_id gnl|my_center|LOCUS_00730 79593 80300 gene locus_tag LOCUS_00740 79593 80300 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_00740 80403 80879 gene locus_tag LOCUS_00750 gene rsd 80403 80879 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120370.1 protein_id gnl|my_center|LOCUS_00750 81744 80992 gene locus_tag LOCUS_00760 gene mip 81744 80992 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_00760 82313 81795 gene locus_tag LOCUS_00770 82313 81795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 82980 82324 gene locus_tag LOCUS_00780 gene elbB 82980 82324 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266301.1 protein_id gnl|my_center|LOCUS_00780 83780 83088 gene locus_tag LOCUS_00790 gene trmB 83780 83088 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209991.1 protein_id gnl|my_center|LOCUS_00790 84175 83783 gene locus_tag LOCUS_00800 84175 83783 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688312.1 protein_id gnl|my_center|LOCUS_00800 85109 84255 gene locus_tag LOCUS_00810 gene rpoH 85109 84255 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_00810 86257 85208 gene locus_tag LOCUS_00820 gene ftsX 86257 85208 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_00820 86924 86247 gene locus_tag LOCUS_00830 gene ftsE 86924 86247 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_00830 88006 86942 gene locus_tag LOCUS_00840 88006 86942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 88072 88671 gene locus_tag LOCUS_00850 gene rsmD 88072 88671 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 protein_id gnl|my_center|LOCUS_00850 88727 89209 gene locus_tag LOCUS_00860 gene coaD 88727 89209 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 protein_id gnl|my_center|LOCUS_00860 90025 89210 gene locus_tag LOCUS_00870 gene mutM 90025 89210 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704183.1 protein_id gnl|my_center|LOCUS_00870 90149 90556 gene locus_tag LOCUS_00880 90149 90556 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_00880 90810 90643 gene locus_tag LOCUS_00890 gene rpmG 90810 90643 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922510.1 protein_id gnl|my_center|LOCUS_00890 91058 90822 gene locus_tag LOCUS_00900 gene rpmB 91058 90822 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048256.1 protein_id gnl|my_center|LOCUS_00900 91910 91236 gene locus_tag LOCUS_00910 gene radC 91910 91236 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769555.1 protein_id gnl|my_center|LOCUS_00910 92009 93208 gene locus_tag LOCUS_00920 gene coaBC 92009 93208 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_00920 93215 95650 gene locus_tag LOCUS_00930 93215 95650 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114359.1 protein_id gnl|my_center|LOCUS_00930 95675 96589 gene locus_tag LOCUS_00940 gene argB 95675 96589 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_00940 96586 97188 gene locus_tag LOCUS_00950 gene slmA 96586 97188 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 protein_id gnl|my_center|LOCUS_00950 97777 97109 gene locus_tag LOCUS_00960 97777 97109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769563.1 protein_id gnl|my_center|LOCUS_00960 97893 98666 gene locus_tag LOCUS_00970 97893 98666 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_00970 98768 99925 gene locus_tag LOCUS_00980 98768 99925 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084535.1 protein_id gnl|my_center|LOCUS_00980 99922 100518 gene locus_tag LOCUS_00990 gene metW 99922 100518 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316724.1 protein_id gnl|my_center|LOCUS_00990 100527 100988 gene locus_tag LOCUS_01000 100527 100988 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233674.1 protein_id gnl|my_center|LOCUS_01000 101072 101671 gene locus_tag LOCUS_01010 101072 101671 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174736.1 protein_id gnl|my_center|LOCUS_01010 101735 102310 gene locus_tag LOCUS_01020 101735 102310 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269385.1 protein_id gnl|my_center|LOCUS_01020 102332 103204 gene locus_tag LOCUS_01030 gene ubiA 102332 103204 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245012.1 protein_id gnl|my_center|LOCUS_01030 103291 103992 gene locus_tag LOCUS_01040 gene phoB 103291 103992 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_01040 104001 105278 gene locus_tag LOCUS_01050 gene phoR 104001 105278 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_01050 105333 106379 gene locus_tag LOCUS_01060 105333 106379 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002051251.1 protein_id gnl|my_center|LOCUS_01060 106390 107532 gene locus_tag LOCUS_01070 106390 107532 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268677.1 protein_id gnl|my_center|LOCUS_01070 107567 108106 gene locus_tag LOCUS_01080 107567 108106 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931004.1 protein_id gnl|my_center|LOCUS_01080 108718 108125 gene locus_tag LOCUS_01090 108718 108125 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_01090 109503 108718 gene locus_tag LOCUS_01100 gene yaaA 109503 108718 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266801.1 protein_id gnl|my_center|LOCUS_01100 109587 111143 gene locus_tag LOCUS_01110 109587 111143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 112022 111159 gene locus_tag LOCUS_01120 112022 111159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 112591 112031 gene locus_tag LOCUS_01130 112591 112031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 113054 112770 gene locus_tag LOCUS_01140 113054 112770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 114041 113181 gene locus_tag LOCUS_01150 114041 113181 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_01150 114166 114558 gene locus_tag LOCUS_01160 114166 114558 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198617.1 protein_id gnl|my_center|LOCUS_01160 114581 115330 gene locus_tag LOCUS_01170 114581 115330 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707660.1 protein_id gnl|my_center|LOCUS_01170 115317 115907 gene locus_tag LOCUS_01180 115317 115907 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 protein_id gnl|my_center|LOCUS_01180 116809 116042 gene locus_tag LOCUS_01190 116809 116042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 117313 116954 gene locus_tag LOCUS_01200 117313 116954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 118203 117367 gene locus_tag LOCUS_01210 118203 117367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 119353 118196 gene locus_tag LOCUS_01220 119353 118196 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197970.1 protein_id gnl|my_center|LOCUS_01220 119729 119568 gene locus_tag LOCUS_01230 119729 119568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 119658 119930 gene locus_tag LOCUS_01240 119658 119930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 119911 120183 gene locus_tag LOCUS_01250 gene yoeB 119911 120183 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_01250 120782 120228 gene locus_tag LOCUS_01260 120782 120228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 121256 120969 gene locus_tag LOCUS_01270 121256 120969 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071008.1 protein_id gnl|my_center|LOCUS_01270 121512 121249 gene locus_tag LOCUS_01280 121512 121249 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_01280 122389 121652 gene locus_tag LOCUS_01290 122389 121652 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_01290 122711 122442 gene locus_tag LOCUS_01300 122711 122442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_01300 123524 123048 gene locus_tag LOCUS_01310 123524 123048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 123564 123722 gene locus_tag LOCUS_01320 123564 123722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 124349 123894 gene locus_tag LOCUS_01330 124349 123894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 124720 124427 gene locus_tag LOCUS_01340 124720 124427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 124941 124717 gene locus_tag LOCUS_01350 124941 124717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 125830 125111 gene locus_tag LOCUS_01360 125830 125111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 127945 126251 gene locus_tag LOCUS_01370 gene leuA 127945 126251 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815908.1 protein_id gnl|my_center|LOCUS_01370 128170 128631 gene locus_tag LOCUS_01380 128170 128631 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_01380 128791 131949 gene locus_tag LOCUS_01390 gene putA 128791 131949 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_01390 132713 131946 gene locus_tag LOCUS_01400 132713 131946 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 protein_id gnl|my_center|LOCUS_01400 133394 132738 gene locus_tag LOCUS_01410 gene can 133394 132738 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_01410 134200 133511 gene locus_tag LOCUS_01420 gene phoU 134200 133511 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_01420 134403 134203 gene locus_tag LOCUS_01430 134403 134203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 135370 134480 gene locus_tag LOCUS_01440 gene pstB 135370 134480 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_01440 136654 135386 gene locus_tag LOCUS_01450 gene pstA 136654 135386 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_01450 138067 136679 gene locus_tag LOCUS_01460 gene pstC 138067 136679 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_01460 139233 138184 gene locus_tag LOCUS_01470 139233 138184 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_01470 139483 140040 gene locus_tag LOCUS_01480 139483 140040 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_01480 140040 141410 gene locus_tag LOCUS_01490 140040 141410 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_01490 141445 141843 gene locus_tag LOCUS_01500 141445 141843 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 protein_id gnl|my_center|LOCUS_01500 142195 141941 gene locus_tag LOCUS_01510 142195 141941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 143063 142299 gene locus_tag LOCUS_01520 143063 142299 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_01520 143403 144353 gene locus_tag LOCUS_01530 gene glyQ 143403 144353 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_01530 144350 146440 gene locus_tag LOCUS_01540 gene glyS 144350 146440 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_01540 146441 147016 gene locus_tag LOCUS_01550 gene gmhB 146441 147016 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769732.1 protein_id gnl|my_center|LOCUS_01550 147009 147737 gene locus_tag LOCUS_01560 147009 147737 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_01560 147825 147998 gene locus_tag LOCUS_01570 147825 147998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 150493 148073 gene locus_tag LOCUS_01580 gene gyrB 150493 148073 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340175.1 protein_id gnl|my_center|LOCUS_01580 151638 150535 gene locus_tag LOCUS_01590 gene recF 151638 150535 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_01590 152779 151676 gene locus_tag LOCUS_01600 gene dnaN 152779 151676 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_01600 154304 152874 gene locus_tag LOCUS_01610 gene dnaA 154304 152874 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220732.1 protein_id gnl|my_center|LOCUS_01610 156020 154647 gene locus_tag LOCUS_01620 gene mnmE 156020 154647 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205962.1 protein_id gnl|my_center|LOCUS_01620 157765 156059 gene locus_tag LOCUS_01630 gene yidC 157765 156059 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_01630 157996 157766 gene locus_tag LOCUS_01640 gene yidD 157996 157766 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_01640 158364 157999 gene locus_tag LOCUS_01650 gene rnpA 158364 157999 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100251.1 protein_id gnl|my_center|LOCUS_01650 159109 161001 gene locus_tag LOCUS_01660 gene mnmG 159109 161001 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_01660 161002 161628 gene locus_tag LOCUS_01670 gene rsmG 161002 161628 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367844.1 protein_id gnl|my_center|LOCUS_01670 161639 162433 gene locus_tag LOCUS_01680 gene soj 161639 162433 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_01680 162438 163304 gene locus_tag LOCUS_01690 162438 163304 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 protein_id gnl|my_center|LOCUS_01690 163476 163859 gene locus_tag LOCUS_01700 163476 163859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 163884 164747 gene locus_tag LOCUS_01710 gene atpB 163884 164747 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 protein_id gnl|my_center|LOCUS_01710 164789 165019 gene locus_tag LOCUS_01720 gene atpE 164789 165019 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424060.1 protein_id gnl|my_center|LOCUS_01720 165068 165538 gene locus_tag LOCUS_01730 165068 165538 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_01730 165551 166087 gene locus_tag LOCUS_01740 165551 166087 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_01740 166106 167650 gene locus_tag LOCUS_01750 gene atpA 166106 167650 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 protein_id gnl|my_center|LOCUS_01750 167701 168561 gene locus_tag LOCUS_01760 gene atpG 167701 168561 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_01760 168600 170000 gene locus_tag LOCUS_01770 gene atpD 168600 170000 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074330.1 protein_id gnl|my_center|LOCUS_01770 170024 170455 gene locus_tag LOCUS_01780 170024 170455 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_01780 170609 171985 gene locus_tag LOCUS_01790 gene glmU 170609 171985 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074328.1 protein_id gnl|my_center|LOCUS_01790 172001 173830 gene locus_tag LOCUS_01800 gene glmS 172001 173830 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269442.1 protein_id gnl|my_center|LOCUS_01800 175237 174377 gene locus_tag LOCUS_01810 gene hexR 175237 174377 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768321.1 protein_id gnl|my_center|LOCUS_01810 175367 177535 gene locus_tag LOCUS_01820 gene uvrD 175367 177535 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 protein_id gnl|my_center|LOCUS_01820 177553 178650 gene locus_tag LOCUS_01830 gene dctP 177553 178650 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_01830 179719 178673 gene locus_tag LOCUS_01840 179719 178673 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071748.1 protein_id gnl|my_center|LOCUS_01840 180638 179733 gene locus_tag LOCUS_01850 gene rimK 180638 179733 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 protein_id gnl|my_center|LOCUS_01850 181105 180635 gene locus_tag LOCUS_01860 181105 180635 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660269.1 protein_id gnl|my_center|LOCUS_01860 181412 181098 gene locus_tag LOCUS_01870 181412 181098 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120685.1 protein_id gnl|my_center|LOCUS_01870 182901 181450 gene locus_tag LOCUS_01880 182901 181450 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160591.1 protein_id gnl|my_center|LOCUS_01880 184298 182916 gene locus_tag LOCUS_01890 gene trkA 184298 182916 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_01890 185665 184361 gene locus_tag LOCUS_01900 gene rsmB 185665 184361 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103025.1 protein_id gnl|my_center|LOCUS_01900 186630 185662 gene locus_tag LOCUS_01910 gene fmt 186630 185662 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070447.1 protein_id gnl|my_center|LOCUS_01910 187143 186637 gene locus_tag LOCUS_01920 gene def 187143 186637 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 protein_id gnl|my_center|LOCUS_01920 187278 188297 gene locus_tag LOCUS_01930 187278 188297 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_01930 188383 189480 gene locus_tag LOCUS_01940 gene dprA 188383 189480 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114641.1 protein_id gnl|my_center|LOCUS_01940 189605 190111 gene locus_tag LOCUS_01950 gene purE 189605 190111 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_01950 190123 190680 gene locus_tag LOCUS_01960 190123 190680 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_01960 190777 191679 gene locus_tag LOCUS_01970 gene hemF 190777 191679 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_01970 191703 192551 gene locus_tag LOCUS_01980 gene aroE 191703 192551 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_01980 193133 192567 gene locus_tag LOCUS_01990 193133 192567 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_01990 193271 193510 gene locus_tag LOCUS_02000 193271 193510 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 protein_id gnl|my_center|LOCUS_02000 194179 193526 gene locus_tag LOCUS_02010 194179 193526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115620.1 protein_id gnl|my_center|LOCUS_02010 195531 194251 gene locus_tag LOCUS_02020 gene dinF 195531 194251 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819117.1 protein_id gnl|my_center|LOCUS_02020 195787 196917 gene locus_tag LOCUS_02030 gene coxB 195787 196917 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 protein_id gnl|my_center|LOCUS_02030 196933 198486 gene locus_tag LOCUS_02040 gene ctaD 196933 198486 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_02040 198504 199058 gene locus_tag LOCUS_02050 198504 199058 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_02050 199105 200010 gene locus_tag LOCUS_02060 199105 200010 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_02060 200344 200090 gene locus_tag LOCUS_02070 200344 200090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 200448 201164 gene locus_tag LOCUS_02080 200448 201164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_02080 201164 201793 gene locus_tag LOCUS_02090 201164 201793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 201892 202923 gene locus_tag LOCUS_02100 201892 202923 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_02100 202942 203853 gene locus_tag LOCUS_02110 gene cyoE 202942 203853 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 protein_id gnl|my_center|LOCUS_02110 203932 204558 gene locus_tag LOCUS_02120 gene senC 203932 204558 CDS product cytochrome c oxidase copper chaperone SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_02120 205367 204588 gene locus_tag LOCUS_02130 gene znuB 205367 204588 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_02130 206109 205360 gene locus_tag LOCUS_02140 gene znuC 206109 205360 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114128.1 protein_id gnl|my_center|LOCUS_02140 206594 206106 gene locus_tag LOCUS_02150 206594 206106 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_02150 206804 207715 gene locus_tag LOCUS_02160 206804 207715 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114126.1 protein_id gnl|my_center|LOCUS_02160 208678 207722 gene locus_tag LOCUS_02170 208678 207722 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114124.1 protein_id gnl|my_center|LOCUS_02170 208791 211511 gene locus_tag LOCUS_02180 gene polA 208791 211511 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 protein_id gnl|my_center|LOCUS_02180 212571 211963 gene locus_tag LOCUS_02190 gene yihA 212571 211963 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456829.1 protein_id gnl|my_center|LOCUS_02190 212704 213342 gene locus_tag LOCUS_02200 212704 213342 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_02200 213454 214125 gene locus_tag LOCUS_02210 gene dsbA 213454 214125 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_02210 214295 215410 gene locus_tag LOCUS_02220 214295 215410 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_02220 215446 216615 gene locus_tag LOCUS_02230 215446 216615 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_02230 219310 216659 gene locus_tag LOCUS_02240 gene gacS 219310 216659 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_02240 220173 219307 gene locus_tag LOCUS_02250 220173 219307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 222461 220365 gene locus_tag LOCUS_02260 222461 220365 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927081.1 protein_id gnl|my_center|LOCUS_02260 222676 223311 gene locus_tag LOCUS_02270 gene pdxH 222676 223311 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365910.1 protein_id gnl|my_center|LOCUS_02270 224654 223383 gene locus_tag LOCUS_02280 gene rho 224654 223383 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_02280 225186 224860 gene locus_tag LOCUS_02290 gene trxA 225186 224860 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_02290 225344 226861 gene locus_tag LOCUS_02300 gene ppx 225344 226861 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_02300 228933 226858 gene locus_tag LOCUS_02310 gene ppk1 228933 226858 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_02310 229164 230204 gene locus_tag LOCUS_02320 229164 230204 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812925.1 protein_id gnl|my_center|LOCUS_02320 231382 230228 gene locus_tag LOCUS_02330 gene hemW 231382 230228 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_02330 232539 231505 gene locus_tag LOCUS_02340 232539 231505 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_02340 232659 234536 gene locus_tag LOCUS_02350 232659 234536 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091605.1 protein_id gnl|my_center|LOCUS_02350 234595 235863 gene locus_tag LOCUS_02360 234595 235863 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_02360 237179 235905 gene locus_tag LOCUS_02370 237179 235905 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_02370 237889 237209 gene locus_tag LOCUS_02380 237889 237209 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_02380 240060 237988 gene locus_tag LOCUS_02390 gene recG 240060 237988 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425918.1 protein_id gnl|my_center|LOCUS_02390 240989 240057 gene locus_tag LOCUS_02400 gene oxyR 240989 240057 CDS product oxidative stress transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_02400 241054 241917 gene locus_tag LOCUS_02410 241054 241917 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266255.1 protein_id gnl|my_center|LOCUS_02410 242309 241926 gene locus_tag LOCUS_02420 242309 241926 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_02420 244429 242327 gene locus_tag LOCUS_02430 gene spoT 244429 242327 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_02430 244736 244449 gene locus_tag LOCUS_02440 gene rpoZ 244736 244449 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003320174.1 protein_id gnl|my_center|LOCUS_02440 245462 244845 gene locus_tag LOCUS_02450 gene gmk 245462 244845 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_02450 246527 245664 gene locus_tag LOCUS_02460 246527 245664 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 protein_id gnl|my_center|LOCUS_02460 246648 247376 gene locus_tag LOCUS_02470 gene rph 246648 247376 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 protein_id gnl|my_center|LOCUS_02470 247672 247373 gene locus_tag LOCUS_02480 gene yggU 247672 247373 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073225.1 protein_id gnl|my_center|LOCUS_02480 248259 247672 gene locus_tag LOCUS_02490 248259 247672 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_02490 249103 248282 gene locus_tag LOCUS_02500 gene proC 249103 248282 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_02500 249838 249137 gene locus_tag LOCUS_02510 249838 249137 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_02510 249910 250944 gene locus_tag LOCUS_02520 gene pilT 249910 250944 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_02520 251012 252154 gene locus_tag LOCUS_02530 gene pilU 251012 252154 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_02530 252634 252161 gene locus_tag LOCUS_02540 gene ruvX 252634 252161 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_02540 253199 252618 gene locus_tag LOCUS_02550 253199 252618 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946323.1 protein_id gnl|my_center|LOCUS_02550 254131 253265 gene locus_tag LOCUS_02560 254131 253265 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_02560 255078 254131 gene locus_tag LOCUS_02570 gene gshB 255078 254131 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_02570 255315 255776 gene locus_tag LOCUS_02580 gene pilG 255315 255776 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_02580 255754 256116 gene locus_tag LOCUS_02590 gene pilH 255754 256116 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377196.1 protein_id gnl|my_center|LOCUS_02590 256137 256670 gene locus_tag LOCUS_02600 256137 256670 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_02600 256741 259251 gene locus_tag LOCUS_02610 gene pilJ 256741 259251 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_02610 259271 260113 gene locus_tag LOCUS_02620 gene pilK 259271 260113 CDS product type 4 fimbrial methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_02620 260104 265800 gene locus_tag LOCUS_02630 260104 265800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 265870 266382 gene locus_tag LOCUS_02640 265870 266382 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266436.1 protein_id gnl|my_center|LOCUS_02640 266492 268276 gene locus_tag LOCUS_02650 gene phaC 266492 268276 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_02650 268263 269111 gene locus_tag LOCUS_02660 gene phaZ 268263 269111 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_02660 269155 269559 gene locus_tag LOCUS_02670 gene htdZ 269155 269559 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_02670 270570 269599 gene locus_tag LOCUS_02680 270570 269599 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123657.1 protein_id gnl|my_center|LOCUS_02680 270708 272609 gene locus_tag LOCUS_02690 gene fabY 270708 272609 CDS product beta-ketoacyl-ACP synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114068.1 protein_id gnl|my_center|LOCUS_02690 272913 274832 gene locus_tag LOCUS_02700 gene speA 272913 274832 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_02700 274946 276133 gene locus_tag LOCUS_02710 274946 276133 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_02710 279606 276121 gene locus_tag LOCUS_02720 279606 276121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 281636 279603 gene locus_tag LOCUS_02730 281636 279603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 282068 283261 gene locus_tag LOCUS_02740 gene nspC 282068 283261 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943174.1 protein_id gnl|my_center|LOCUS_02740 283414 283701 gene locus_tag LOCUS_02750 283414 283701 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_02750 285243 283771 gene locus_tag LOCUS_02760 gene ubiD 285243 283771 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 protein_id gnl|my_center|LOCUS_02760 285313 285726 gene locus_tag LOCUS_02770 285313 285726 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_02770 285729 286175 gene locus_tag LOCUS_02780 285729 286175 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_02780 287044 286187 gene locus_tag LOCUS_02790 gene purU 287044 286187 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_02790 287700 287164 gene locus_tag LOCUS_02800 287700 287164 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814256.1 protein_id gnl|my_center|LOCUS_02800 288215 287694 gene locus_tag LOCUS_02810 288215 287694 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813947.1 protein_id gnl|my_center|LOCUS_02810 288371 289969 gene locus_tag LOCUS_02820 288371 289969 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_02820 290095 290757 gene locus_tag LOCUS_02830 gene rpe 290095 290757 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 protein_id gnl|my_center|LOCUS_02830 290970 292442 gene locus_tag LOCUS_02840 gene trpE 290970 292442 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_02840 293564 292497 gene locus_tag LOCUS_02850 293564 292497 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_02850 294146 293793 gene locus_tag LOCUS_02860 gene cbpM 294146 293793 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368685.1 protein_id gnl|my_center|LOCUS_02860 295102 294143 gene locus_tag LOCUS_02870 gene cbpA 295102 294143 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817008.1 protein_id gnl|my_center|LOCUS_02870 295415 295170 gene locus_tag LOCUS_02880 295415 295170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 296542 295442 gene locus_tag LOCUS_02890 gene arsB 296542 295442 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 protein_id gnl|my_center|LOCUS_02890 296829 296599 gene locus_tag LOCUS_02900 296829 296599 CDS product MTH895/ArsE family thioredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060920.1 protein_id gnl|my_center|LOCUS_02900 298202 296886 gene locus_tag LOCUS_02910 298202 296886 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_02910 299467 298199 gene locus_tag LOCUS_02920 gene arsJ 299467 298199 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712457.1 protein_id gnl|my_center|LOCUS_02920 300564 299548 gene locus_tag LOCUS_02930 300564 299548 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_02930 301005 300664 gene locus_tag LOCUS_02940 301005 300664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 301777 303048 gene locus_tag LOCUS_02950 301777 303048 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772650.1 protein_id gnl|my_center|LOCUS_02950 303082 303699 gene locus_tag LOCUS_02960 303082 303699 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_02960 303880 304266 gene locus_tag LOCUS_02970 303880 304266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 304377 305699 gene locus_tag LOCUS_02980 304377 305699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 305705 307591 gene locus_tag LOCUS_02990 305705 307591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 307585 310827 gene locus_tag LOCUS_03000 307585 310827 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_03000 312150 311179 gene locus_tag LOCUS_03010 312150 311179 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105579.1 protein_id gnl|my_center|LOCUS_03010 312643 312245 gene locus_tag LOCUS_03020 gene cadR 312643 312245 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004364961.1 protein_id gnl|my_center|LOCUS_03020 312738 313634 gene locus_tag LOCUS_03030 312738 313634 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 protein_id gnl|my_center|LOCUS_03030 314612 313671 gene locus_tag LOCUS_03040 314612 313671 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_03040 315010 314657 gene locus_tag LOCUS_03050 315010 314657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 315285 315046 gene locus_tag LOCUS_03060 315285 315046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 318468 315325 gene locus_tag LOCUS_03070 318468 315325 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_03070 319698 318481 gene locus_tag LOCUS_03080 319698 318481 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275505.1 protein_id gnl|my_center|LOCUS_03080 321022 319718 gene locus_tag LOCUS_03090 321022 319718 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_03090 321460 321101 gene locus_tag LOCUS_03100 321460 321101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 323370 321583 gene locus_tag LOCUS_03110 gene mobH 323370 321583 CDS product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_03110 324347 323589 gene locus_tag LOCUS_03120 324347 323589 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199747194.1 protein_id gnl|my_center|LOCUS_03120 324689 325681 gene locus_tag LOCUS_03130 324689 325681 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_03130 325693 328227 gene locus_tag LOCUS_03140 325693 328227 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_03140 328462 328821 gene locus_tag LOCUS_03150 328462 328821 CDS product DUF3742 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041106822.1 protein_id gnl|my_center|LOCUS_03150 330366 328846 gene locus_tag LOCUS_03160 330366 328846 CDS product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038855.1 protein_id gnl|my_center|LOCUS_03160 330720 330388 gene locus_tag LOCUS_03170 330720 330388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 332102 330717 gene locus_tag LOCUS_03180 332102 330717 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 protein_id gnl|my_center|LOCUS_03180 333051 332113 gene locus_tag LOCUS_03190 333051 332113 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 protein_id gnl|my_center|LOCUS_03190 333503 333048 gene locus_tag LOCUS_03200 333503 333048 CDS product TIGR03757 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267009.1 protein_id gnl|my_center|LOCUS_03200 334142 333642 gene locus_tag LOCUS_03210 334142 333642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 334108 334314 gene locus_tag LOCUS_03220 334108 334314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 337263 334330 gene locus_tag LOCUS_03230 337263 334330 CDS product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_03230 337712 337263 gene locus_tag LOCUS_03240 337712 337263 CDS product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_03240 339111 337693 gene locus_tag LOCUS_03250 339111 337693 CDS product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_03250 339994 339101 gene locus_tag LOCUS_03260 339994 339101 CDS product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011805409.1 protein_id gnl|my_center|LOCUS_03260 340667 340005 gene locus_tag LOCUS_03270 340667 340005 CDS product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 protein_id gnl|my_center|LOCUS_03270 341062 340664 gene locus_tag LOCUS_03280 341062 340664 CDS product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_03280 341449 341075 gene locus_tag LOCUS_03290 341449 341075 CDS product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_03290 341701 341468 gene locus_tag LOCUS_03300 341701 341468 CDS product TIGR03758 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 protein_id gnl|my_center|LOCUS_03300 342048 341698 gene locus_tag LOCUS_03310 342048 341698 CDS product RAQPRD family integrative conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317499.1 protein_id gnl|my_center|LOCUS_03310 342389 343729 gene locus_tag LOCUS_03320 342389 343729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 344499 343750 gene locus_tag LOCUS_03330 344499 343750 CDS product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_03330 346667 344496 gene locus_tag LOCUS_03340 gene traD 346667 344496 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_03340 347205 346669 gene locus_tag LOCUS_03350 347205 346669 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_03350 347783 347202 gene locus_tag LOCUS_03360 347783 347202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 348598 347768 gene locus_tag LOCUS_03370 348598 347768 CDS product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_03370 349052 348546 gene locus_tag LOCUS_03380 349052 348546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 349283 349759 gene locus_tag LOCUS_03390 349283 349759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 349756 352866 gene locus_tag LOCUS_03400 349756 352866 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_03400 352850 353494 gene locus_tag LOCUS_03410 352850 353494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 353518 355068 gene locus_tag LOCUS_03420 353518 355068 CDS product SEC-C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123350.1 protein_id gnl|my_center|LOCUS_03420 357406 355127 gene locus_tag LOCUS_03430 357406 355127 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165797420.1 protein_id gnl|my_center|LOCUS_03430 357778 357485 gene locus_tag LOCUS_03440 357778 357485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_03440 359004 357895 gene locus_tag LOCUS_03450 359004 357895 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104230471.1 protein_id gnl|my_center|LOCUS_03450 359732 359085 gene locus_tag LOCUS_03460 359732 359085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_03460 360207 359818 gene locus_tag LOCUS_03470 360207 359818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 360897 360295 gene locus_tag LOCUS_03480 360897 360295 CDS product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 protein_id gnl|my_center|LOCUS_03480 361508 360978 gene locus_tag LOCUS_03490 361508 360978 CDS product STY4534 family ICE replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267041.1 protein_id gnl|my_center|LOCUS_03490 361597 361797 gene locus_tag LOCUS_03500 361597 361797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 362569 361853 gene locus_tag LOCUS_03510 362569 361853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_03510 363040 362648 gene locus_tag LOCUS_03520 363040 362648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_03520 363381 363626 gene locus_tag LOCUS_03530 363381 363626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 365801 363780 gene locus_tag LOCUS_03540 365801 363780 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038895.1 protein_id gnl|my_center|LOCUS_03540 366432 366037 gene locus_tag LOCUS_03550 366432 366037 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013721963.1 protein_id gnl|my_center|LOCUS_03550 366965 366429 gene locus_tag LOCUS_03560 366965 366429 CDS product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_03560 367747 366962 gene locus_tag LOCUS_03570 367747 366962 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_03570 369243 368044 gene locus_tag LOCUS_03580 369243 368044 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136258754.1 protein_id gnl|my_center|LOCUS_03580 369807 369247 gene locus_tag LOCUS_03590 369807 369247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 371566 369824 gene locus_tag LOCUS_03600 371566 369824 CDS product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150625513.1 protein_id gnl|my_center|LOCUS_03600 371798 371559 gene locus_tag LOCUS_03610 371798 371559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 372646 371795 gene locus_tag LOCUS_03620 372646 371795 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_03620 372901 372686 gene locus_tag LOCUS_03630 372901 372686 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 protein_id gnl|my_center|LOCUS_03630 373757 373011 gene locus_tag LOCUS_03640 373757 373011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036990101.1 protein_id gnl|my_center|LOCUS_03640 375074 374190 gene locus_tag LOCUS_03650 375074 374190 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213173803.1 protein_id gnl|my_center|LOCUS_03650 375414 375656 gene locus_tag LOCUS_03660 375414 375656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 377058 375760 gene locus_tag LOCUS_03670 377058 375760 CDS product Cu(+)/Ag(+) sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096578.1 protein_id gnl|my_center|LOCUS_03670 376942 377148 gene locus_tag LOCUS_03680 376942 377148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 377848 377156 gene locus_tag LOCUS_03690 377848 377156 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_03690 378032 378334 gene locus_tag LOCUS_03700 378032 378334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 378369 378929 gene locus_tag LOCUS_03710 378369 378929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 378996 380783 gene locus_tag LOCUS_03720 378996 380783 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_03720 380794 381543 gene locus_tag LOCUS_03730 380794 381543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 381579 382931 gene locus_tag LOCUS_03740 381579 382931 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065084.1 protein_id gnl|my_center|LOCUS_03740 382976 383188 gene locus_tag LOCUS_03750 382976 383188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 383260 383718 gene locus_tag LOCUS_03760 383260 383718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 384213 383788 gene locus_tag LOCUS_03770 gene merR 384213 383788 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_03770 384287 384637 gene locus_tag LOCUS_03780 384287 384637 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 protein_id gnl|my_center|LOCUS_03780 384652 384945 gene locus_tag LOCUS_03790 gene merP 384652 384945 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732275.1 protein_id gnl|my_center|LOCUS_03790 384942 386351 gene locus_tag LOCUS_03800 gene merA 384942 386351 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03800 387726 386452 gene locus_tag LOCUS_03810 387726 386452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 387670 387864 gene locus_tag LOCUS_03820 387670 387864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 387848 388960 gene locus_tag LOCUS_03830 387848 388960 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039558.1 protein_id gnl|my_center|LOCUS_03830 389079 389561 gene locus_tag LOCUS_03840 389079 389561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 391236 389578 gene locus_tag LOCUS_03850 391236 389578 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399701.1 protein_id gnl|my_center|LOCUS_03850 391640 391359 gene locus_tag LOCUS_03860 391640 391359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 392294 391782 gene locus_tag LOCUS_03870 392294 391782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 393237 392356 gene locus_tag LOCUS_03880 393237 392356 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243358.1 protein_id gnl|my_center|LOCUS_03880 393971 393270 gene locus_tag LOCUS_03890 393971 393270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 394868 393978 gene locus_tag LOCUS_03900 394868 393978 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_03900 397279 394865 gene locus_tag LOCUS_03910 397279 394865 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_03910 398382 397276 gene locus_tag LOCUS_03920 398382 397276 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_03920 399908 398379 gene locus_tag LOCUS_03930 399908 398379 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 protein_id gnl|my_center|LOCUS_03930 400564 399908 gene locus_tag LOCUS_03940 400564 399908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 401920 400568 gene locus_tag LOCUS_03950 401920 400568 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_03950 402654 401998 gene locus_tag LOCUS_03960 402654 401998 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966090.1 protein_id gnl|my_center|LOCUS_03960 402920 402651 gene locus_tag LOCUS_03970 402920 402651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 403294 402929 gene locus_tag LOCUS_03980 403294 402929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 403803 403363 gene locus_tag LOCUS_03990 403803 403363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 404182 403895 gene locus_tag LOCUS_04000 404182 403895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 406736 404217 gene locus_tag LOCUS_04010 406736 404217 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966917.1 protein_id gnl|my_center|LOCUS_04010 407472 406852 gene locus_tag LOCUS_04020 407472 406852 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966090.1 protein_id gnl|my_center|LOCUS_04020 407987 407568 gene locus_tag LOCUS_04030 407987 407568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 408933 408706 gene locus_tag LOCUS_04040 408933 408706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 409107 408943 gene locus_tag LOCUS_04050 409107 408943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 409235 409597 gene locus_tag LOCUS_04060 409235 409597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 409594 410907 gene locus_tag LOCUS_04070 409594 410907 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482614.1 protein_id gnl|my_center|LOCUS_04070 410918 412489 gene locus_tag LOCUS_04080 410918 412489 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190973259.1 protein_id gnl|my_center|LOCUS_04080 412482 415604 gene locus_tag LOCUS_04090 412482 415604 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_04090 416364 416948 gene locus_tag LOCUS_04100 416364 416948 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_04100 416955 417986 gene locus_tag LOCUS_04110 gene trpD 416955 417986 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 protein_id gnl|my_center|LOCUS_04110 417983 418792 gene locus_tag LOCUS_04120 gene trpC 417983 418792 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_04120 419230 418805 gene locus_tag LOCUS_04130 419230 418805 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243288.1 protein_id gnl|my_center|LOCUS_04130 420093 419371 gene locus_tag LOCUS_04140 gene crp 420093 419371 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_04140 420201 420620 gene locus_tag LOCUS_04150 420201 420620 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_04150 421147 422118 gene locus_tag LOCUS_04160 421147 422118 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477202.1 protein_id gnl|my_center|LOCUS_04160 422763 422119 gene locus_tag LOCUS_04170 gene coq7 422763 422119 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269103.1 protein_id gnl|my_center|LOCUS_04170 422834 423784 gene locus_tag LOCUS_04180 422834 423784 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_04180 425071 423785 gene locus_tag LOCUS_04190 gene purD 425071 423785 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_04190 426757 425168 gene locus_tag LOCUS_04200 gene purH 426757 425168 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105209.1 protein_id gnl|my_center|LOCUS_04200 427075 426779 gene locus_tag LOCUS_04210 427075 426779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 427950 427072 gene locus_tag LOCUS_04220 gene dusB 427950 427072 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_04220 <428867 428133 gene locus_tag LOCUS_04230 <428867 428133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112325.1:DUF3426 domain-containing protein >Feature sequence02 1125 319 gene locus_tag LOCUS_04240 1125 319 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105307.1 protein_id gnl|my_center|LOCUS_04240 1892 1203 gene locus_tag LOCUS_04250 gene narI 1892 1203 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 protein_id gnl|my_center|LOCUS_04250 2598 1903 gene locus_tag LOCUS_04260 gene narJ 2598 1903 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 protein_id gnl|my_center|LOCUS_04260 4119 2602 gene locus_tag LOCUS_04270 gene narH 4119 2602 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 protein_id gnl|my_center|LOCUS_04270 7923 4156 gene locus_tag LOCUS_04280 7923 4156 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 protein_id gnl|my_center|LOCUS_04280 9645 7981 gene locus_tag LOCUS_04290 9645 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10954 9671 gene locus_tag LOCUS_04300 10954 9671 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113773.1 protein_id gnl|my_center|LOCUS_04300 11183 13051 gene locus_tag LOCUS_04310 gene narX 11183 13051 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_04310 13156 13812 gene locus_tag LOCUS_04320 gene narL 13156 13812 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_04320 13853 14338 gene locus_tag LOCUS_04330 13853 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 14577 14335 gene locus_tag LOCUS_04340 14577 14335 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 protein_id gnl|my_center|LOCUS_04340 15825 14665 gene locus_tag LOCUS_04350 15825 14665 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_04350 16836 15940 gene locus_tag LOCUS_04360 16836 15940 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110916.1 protein_id gnl|my_center|LOCUS_04360 17858 16863 gene locus_tag LOCUS_04370 17858 16863 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705630.1 protein_id gnl|my_center|LOCUS_04370 18383 17952 gene locus_tag LOCUS_04380 18383 17952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 18750 20222 gene locus_tag LOCUS_04390 18750 20222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 20256 22007 gene locus_tag LOCUS_04400 20256 22007 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_04400 22007 22606 gene locus_tag LOCUS_04410 gene moaB 22007 22606 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 protein_id gnl|my_center|LOCUS_04410 22630 23835 gene locus_tag LOCUS_04420 22630 23835 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 protein_id gnl|my_center|LOCUS_04420 23962 25359 gene locus_tag LOCUS_04430 23962 25359 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444159.1 protein_id gnl|my_center|LOCUS_04430 25800 25360 gene locus_tag LOCUS_04440 25800 25360 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245175.1 protein_id gnl|my_center|LOCUS_04440 26276 25815 gene locus_tag LOCUS_04450 gene moaE 26276 25815 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_04450 26521 26273 gene locus_tag LOCUS_04460 gene moaD 26521 26273 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705488.1 protein_id gnl|my_center|LOCUS_04460 27006 26518 gene locus_tag LOCUS_04470 gene moaC 27006 26518 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764132.1 protein_id gnl|my_center|LOCUS_04470 28417 27098 gene locus_tag LOCUS_04480 28417 27098 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 protein_id gnl|my_center|LOCUS_04480 28475 29062 gene locus_tag LOCUS_04490 28475 29062 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_04490 29970 29068 gene locus_tag LOCUS_04500 29970 29068 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267708.1 protein_id gnl|my_center|LOCUS_04500 30276 32372 gene locus_tag LOCUS_04510 30276 32372 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925735.1 protein_id gnl|my_center|LOCUS_04510 32388 32969 gene locus_tag LOCUS_04520 32388 32969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 32972 34486 gene locus_tag LOCUS_04530 32972 34486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 34689 34492 gene locus_tag LOCUS_04540 34689 34492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 34785 35153 gene locus_tag LOCUS_04550 34785 35153 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_04550 35169 35711 gene locus_tag LOCUS_04560 35169 35711 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 protein_id gnl|my_center|LOCUS_04560 35930 36985 gene locus_tag LOCUS_04570 35930 36985 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_04570 36999 40154 gene locus_tag LOCUS_04580 36999 40154 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_04580 41679 40213 gene locus_tag LOCUS_04590 41679 40213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 43358 41676 gene locus_tag LOCUS_04600 43358 41676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538283.1 protein_id gnl|my_center|LOCUS_04600 44554 43355 gene locus_tag LOCUS_04610 44554 43355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 45929 44547 gene locus_tag LOCUS_04620 45929 44547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 47799 45937 gene locus_tag LOCUS_04630 47799 45937 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_04630 49088 47955 gene locus_tag LOCUS_04640 49088 47955 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_04640 49479 49691 gene locus_tag LOCUS_04650 49479 49691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 49858 50349 gene locus_tag LOCUS_04660 49858 50349 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440285.1 protein_id gnl|my_center|LOCUS_04660 50488 52953 gene locus_tag LOCUS_04670 50488 52953 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439072.1 protein_id gnl|my_center|LOCUS_04670 53594 53082 gene locus_tag LOCUS_04680 53594 53082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 54054 53794 gene locus_tag LOCUS_04690 54054 53794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 54855 54070 gene locus_tag LOCUS_04700 gene cysE 54855 54070 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 protein_id gnl|my_center|LOCUS_04700 55379 54906 gene locus_tag LOCUS_04710 55379 54906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 55750 56808 gene locus_tag LOCUS_04720 gene bioB 55750 56808 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_04720 56891 58078 gene locus_tag LOCUS_04730 gene bioF 56891 58078 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_04730 58202 58900 gene locus_tag LOCUS_04740 gene bioD 58202 58900 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_04740 58922 59110 gene locus_tag LOCUS_04750 58922 59110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 59565 59107 gene locus_tag LOCUS_04760 59565 59107 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 protein_id gnl|my_center|LOCUS_04760 60688 59675 gene locus_tag LOCUS_04770 60688 59675 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_04770 61280 60789 gene locus_tag LOCUS_04780 61280 60789 CDS product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206153.1 protein_id gnl|my_center|LOCUS_04780 61716 61528 gene locus_tag LOCUS_04790 61716 61528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 63142 61796 gene locus_tag LOCUS_04800 63142 61796 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_04800 63894 63220 gene locus_tag LOCUS_04810 63894 63220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 64571 63891 gene locus_tag LOCUS_04820 64571 63891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 65582 64575 gene locus_tag LOCUS_04830 65582 64575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 66643 65579 gene locus_tag LOCUS_04840 66643 65579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 67970 66645 gene locus_tag LOCUS_04850 67970 66645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 68788 67991 gene locus_tag LOCUS_04860 68788 67991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 69148 68861 gene locus_tag LOCUS_04870 69148 68861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 71212 69155 gene locus_tag LOCUS_04880 71212 69155 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008292761.1 protein_id gnl|my_center|LOCUS_04880 72708 71209 gene locus_tag LOCUS_04890 72708 71209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 73895 72714 gene locus_tag LOCUS_04900 73895 72714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 74640 73900 gene locus_tag LOCUS_04910 74640 73900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 76081 74651 gene locus_tag LOCUS_04920 76081 74651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 76255 77145 gene locus_tag LOCUS_04930 76255 77145 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 protein_id gnl|my_center|LOCUS_04930 77159 78352 gene locus_tag LOCUS_04940 77159 78352 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_04940 78420 79202 gene locus_tag LOCUS_04950 78420 79202 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037490.1 protein_id gnl|my_center|LOCUS_04950 80491 79406 gene locus_tag LOCUS_04960 80491 79406 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_04960 82799 80502 gene locus_tag LOCUS_04970 82799 80502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 82961 83596 gene locus_tag LOCUS_04980 82961 83596 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257831.1 protein_id gnl|my_center|LOCUS_04980 84531 83602 gene locus_tag LOCUS_04990 84531 83602 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_04990 86039 84528 gene locus_tag LOCUS_05000 86039 84528 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 protein_id gnl|my_center|LOCUS_05000 86848 86192 gene locus_tag LOCUS_05010 86848 86192 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_05010 87281 86949 gene locus_tag LOCUS_05020 87281 86949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 87769 87539 gene locus_tag LOCUS_05030 87769 87539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 88371 87763 gene locus_tag LOCUS_05040 88371 87763 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_05040 88807 89532 gene locus_tag LOCUS_05050 88807 89532 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707541.1 protein_id gnl|my_center|LOCUS_05050 90911 89565 gene locus_tag LOCUS_05060 90911 89565 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_05060 91579 90908 gene locus_tag LOCUS_05070 91579 90908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_05070 91884 91576 gene locus_tag LOCUS_05080 91884 91576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 92130 92591 gene locus_tag LOCUS_05090 92130 92591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 93540 92662 gene locus_tag LOCUS_05100 93540 92662 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225975.1 protein_id gnl|my_center|LOCUS_05100 94141 93749 gene locus_tag LOCUS_05110 94141 93749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 94847 94335 gene locus_tag LOCUS_05120 94847 94335 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844776.1 protein_id gnl|my_center|LOCUS_05120 95571 94978 gene locus_tag LOCUS_05130 95571 94978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 96621 95719 gene locus_tag LOCUS_05140 96621 95719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 97123 97047 gene locus_tag LOCUS_t00020 97123 97047 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 99057 97240 gene locus_tag LOCUS_05150 gene rpoD 99057 97240 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614111.1 protein_id gnl|my_center|LOCUS_05150 101088 99166 gene locus_tag LOCUS_05160 gene dnaG 101088 99166 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244455.1 protein_id gnl|my_center|LOCUS_05160 101988 101506 gene locus_tag LOCUS_05170 101988 101506 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704780.1 protein_id gnl|my_center|LOCUS_05170 102251 102036 gene locus_tag LOCUS_05180 gene rpsU 102251 102036 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_05180 102446 103483 gene locus_tag LOCUS_05190 gene tsaD 102446 103483 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071502.1 protein_id gnl|my_center|LOCUS_05190 103489 103845 gene locus_tag LOCUS_05200 gene folB 103489 103845 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_05200 103845 104396 gene locus_tag LOCUS_05210 gene folK 103845 104396 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_05210 104739 104419 gene locus_tag LOCUS_05220 104739 104419 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974806.1 protein_id gnl|my_center|LOCUS_05220 105225 104827 gene locus_tag LOCUS_05230 105225 104827 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_05230 106179 105442 gene locus_tag LOCUS_05240 106179 105442 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_05240 107405 106176 gene locus_tag LOCUS_05250 107405 106176 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207256.1 protein_id gnl|my_center|LOCUS_05250 107529 108500 gene locus_tag LOCUS_05260 gene corA 107529 108500 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_05260 108509 109438 gene locus_tag LOCUS_05270 108509 109438 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_05270 109617 109435 gene locus_tag LOCUS_05280 109617 109435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 112566 109741 gene locus_tag LOCUS_05290 gene uvrA 112566 109741 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_05290 112827 113915 gene locus_tag LOCUS_05300 112827 113915 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113430.1 protein_id gnl|my_center|LOCUS_05300 114205 115527 gene locus_tag LOCUS_05310 114205 115527 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 protein_id gnl|my_center|LOCUS_05310 115574 117208 gene locus_tag LOCUS_05320 115574 117208 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986975.1 protein_id gnl|my_center|LOCUS_05320 117205 118263 gene locus_tag LOCUS_05330 117205 118263 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937656.1 protein_id gnl|my_center|LOCUS_05330 118260 119408 gene locus_tag LOCUS_05340 118260 119408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 119789 119466 gene locus_tag LOCUS_05350 119789 119466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 119965 120696 gene locus_tag LOCUS_05360 119965 120696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 120680 121198 gene locus_tag LOCUS_05370 120680 121198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 121235 122635 gene locus_tag LOCUS_05380 121235 122635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 122635 123849 gene locus_tag LOCUS_05390 122635 123849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 123930 124625 gene locus_tag LOCUS_05400 123930 124625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 124635 125750 gene locus_tag LOCUS_05410 124635 125750 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530608.1 protein_id gnl|my_center|LOCUS_05410 125778 126878 gene locus_tag LOCUS_05420 125778 126878 CDS product DUF1972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172642.1 protein_id gnl|my_center|LOCUS_05420 126898 127914 gene locus_tag LOCUS_05430 gene galE 126898 127914 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_05430 128149 129966 gene locus_tag LOCUS_05440 128149 129966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095999.1 protein_id gnl|my_center|LOCUS_05440 129991 130701 gene locus_tag LOCUS_05450 129991 130701 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407623.1 protein_id gnl|my_center|LOCUS_05450 130698 131627 gene locus_tag LOCUS_05460 130698 131627 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407612.1 protein_id gnl|my_center|LOCUS_05460 131608 132243 gene locus_tag LOCUS_05470 131608 132243 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902091.1 protein_id gnl|my_center|LOCUS_05470 132240 132905 gene locus_tag LOCUS_05480 132240 132905 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_05480 132902 133825 gene locus_tag LOCUS_05490 132902 133825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407616.1 protein_id gnl|my_center|LOCUS_05490 133818 134258 gene locus_tag LOCUS_05500 133818 134258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 134255 135127 gene locus_tag LOCUS_05510 134255 135127 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114948346.1 protein_id gnl|my_center|LOCUS_05510 135143 136270 gene locus_tag LOCUS_05520 gene rffA 135143 136270 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_05520 136325 137362 gene locus_tag LOCUS_05530 gene rfbB 136325 137362 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224748.1 protein_id gnl|my_center|LOCUS_05530 137411 138292 gene locus_tag LOCUS_05540 gene rfbA 137411 138292 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 protein_id gnl|my_center|LOCUS_05540 138289 138831 gene locus_tag LOCUS_05550 gene rfbC 138289 138831 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 protein_id gnl|my_center|LOCUS_05550 138828 139706 gene locus_tag LOCUS_05560 gene rfbD 138828 139706 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980837.1 protein_id gnl|my_center|LOCUS_05560 139688 139966 gene locus_tag LOCUS_05570 139688 139966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 140002 141426 gene locus_tag LOCUS_05580 140002 141426 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_05580 141520 142881 gene locus_tag LOCUS_05590 141520 142881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_05590 143443 142934 gene locus_tag LOCUS_05600 gene ssb 143443 142934 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_05600 144157 143522 gene locus_tag LOCUS_05610 144157 143522 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_05610 145666 144287 gene locus_tag LOCUS_05620 145666 144287 CDS product UDP-glucose--undecaprenyl-phosphate glucose-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183107.1 protein_id gnl|my_center|LOCUS_05620 146959 145742 gene locus_tag LOCUS_05630 gene fabB 146959 145742 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769613.1 protein_id gnl|my_center|LOCUS_05630 147539 147009 gene locus_tag LOCUS_05640 gene fabA 147539 147009 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316569.1 protein_id gnl|my_center|LOCUS_05640 148717 147755 gene locus_tag LOCUS_05650 gene ispB 148717 147755 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345929.1 protein_id gnl|my_center|LOCUS_05650 148967 149281 gene locus_tag LOCUS_05660 gene rplU 148967 149281 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304210.1 protein_id gnl|my_center|LOCUS_05660 149301 149558 gene locus_tag LOCUS_05670 gene rpmA 149301 149558 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940599.1 protein_id gnl|my_center|LOCUS_05670 149699 150886 gene locus_tag LOCUS_05680 gene cgtA 149699 150886 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_05680 150959 152080 gene locus_tag LOCUS_05690 gene proB 150959 152080 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381304.1 protein_id gnl|my_center|LOCUS_05690 152767 152099 gene locus_tag LOCUS_05700 152767 152099 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_05700 153020 155260 gene locus_tag LOCUS_05710 gene ptsP 153020 155260 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_05710 155459 156919 gene locus_tag LOCUS_05720 155459 156919 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_05720 157275 157006 gene locus_tag LOCUS_05730 gene rpsT 157275 157006 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 protein_id gnl|my_center|LOCUS_05730 157585 159171 gene locus_tag LOCUS_05740 gene murJ 157585 159171 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 protein_id gnl|my_center|LOCUS_05740 159299 160243 gene locus_tag LOCUS_05750 gene ribF 159299 160243 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769259.1 protein_id gnl|my_center|LOCUS_05750 160262 163081 gene locus_tag LOCUS_05760 gene ileS 160262 163081 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 protein_id gnl|my_center|LOCUS_05760 163092 163592 gene locus_tag LOCUS_05770 gene lspA 163092 163592 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_05770 163592 164071 gene locus_tag LOCUS_05780 gene fkpB 163592 164071 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_05780 164071 165003 gene locus_tag LOCUS_05790 gene ispH 164071 165003 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769262.1 protein_id gnl|my_center|LOCUS_05790 165506 165105 gene locus_tag LOCUS_05800 165506 165105 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 protein_id gnl|my_center|LOCUS_05800 168889 165506 gene locus_tag LOCUS_05810 168889 165506 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_05810 169266 168886 gene locus_tag LOCUS_05820 169266 168886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 169803 169288 gene locus_tag LOCUS_05830 169803 169288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 170566 169790 gene locus_tag LOCUS_05840 170566 169790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 171114 170563 gene locus_tag LOCUS_05850 171114 170563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 171605 171111 gene locus_tag LOCUS_05860 171605 171111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 172235 171816 gene locus_tag LOCUS_05870 172235 171816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 172356 172177 gene locus_tag LOCUS_05880 172356 172177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 173814 172465 gene locus_tag LOCUS_05890 173814 172465 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594919.1 protein_id gnl|my_center|LOCUS_05890 175439 173811 gene locus_tag LOCUS_05900 gene pilS 175439 173811 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_05900 176398 175553 gene locus_tag LOCUS_05910 gene nadE 176398 175553 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400328.1 protein_id gnl|my_center|LOCUS_05910 177589 176606 gene locus_tag LOCUS_05920 177589 176606 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371138.1 protein_id gnl|my_center|LOCUS_05920 177593 178657 gene locus_tag LOCUS_05930 gene rluD 177593 178657 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266591.1 protein_id gnl|my_center|LOCUS_05930 178666 179412 gene locus_tag LOCUS_05940 gene yfiH 178666 179412 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098337.1 protein_id gnl|my_center|LOCUS_05940 179485 182148 gene locus_tag LOCUS_05950 gene clpB 179485 182148 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 protein_id gnl|my_center|LOCUS_05950 182689 182234 gene locus_tag LOCUS_05960 182689 182234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 183103 184842 gene locus_tag LOCUS_05970 183103 184842 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095071.1 protein_id gnl|my_center|LOCUS_05970 184842 185333 gene locus_tag LOCUS_05980 gene ilvN 184842 185333 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_05980 185422 186438 gene locus_tag LOCUS_05990 gene ilvC 185422 186438 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_05990 186572 187354 gene locus_tag LOCUS_06000 gene pssA 186572 187354 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_06000 187667 189214 gene locus_tag LOCUS_06010 187667 189214 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_06010 189220 189900 gene locus_tag LOCUS_06020 189220 189900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 189897 190346 gene locus_tag LOCUS_06030 gene rimI 189897 190346 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205970.1 protein_id gnl|my_center|LOCUS_06030 190532 192874 gene locus_tag LOCUS_06040 190532 192874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 192964 193905 gene locus_tag LOCUS_06050 192964 193905 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 protein_id gnl|my_center|LOCUS_06050 193923 194150 gene locus_tag LOCUS_06060 193923 194150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 194150 194599 gene locus_tag LOCUS_06070 194150 194599 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_06070 194658 195509 gene locus_tag LOCUS_06080 194658 195509 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_06080 195605 196012 gene locus_tag LOCUS_06090 195605 196012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 196795 196043 gene locus_tag LOCUS_06100 196795 196043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 199205 196785 gene locus_tag LOCUS_06110 199205 196785 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_06110 199899 199363 gene locus_tag LOCUS_06120 199899 199363 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 protein_id gnl|my_center|LOCUS_06120 201157 199889 gene locus_tag LOCUS_06130 201157 199889 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_06130 202735 201425 gene locus_tag LOCUS_06140 202735 201425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 203405 202719 gene locus_tag LOCUS_06150 gene cprR 203405 202719 CDS product cationic peptide response regulator transcription factor CprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 protein_id gnl|my_center|LOCUS_06150 206554 203399 gene locus_tag LOCUS_06160 206554 203399 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_06160 207719 206547 gene locus_tag LOCUS_06170 207719 206547 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_06170 209107 207716 gene locus_tag LOCUS_06180 209107 207716 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207235.1 protein_id gnl|my_center|LOCUS_06180 209492 209202 gene locus_tag LOCUS_06190 209492 209202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 212608 209489 gene locus_tag LOCUS_06200 212608 209489 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_06200 213741 212608 gene locus_tag LOCUS_06210 213741 212608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 215006 213738 gene locus_tag LOCUS_06220 215006 213738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 215180 215851 gene locus_tag LOCUS_06230 215180 215851 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_06230 215897 217177 gene locus_tag LOCUS_06240 215897 217177 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437598.1 protein_id gnl|my_center|LOCUS_06240 218058 217186 gene locus_tag LOCUS_06250 218058 217186 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_06250 219551 218058 gene locus_tag LOCUS_06260 219551 218058 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_06260 221537 220086 gene locus_tag LOCUS_06270 gene nhaD 221537 220086 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 protein_id gnl|my_center|LOCUS_06270 222008 223594 gene locus_tag LOCUS_06280 222008 223594 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396266.1 protein_id gnl|my_center|LOCUS_06280 223713 224207 gene locus_tag LOCUS_06290 223713 224207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 224283 225032 gene locus_tag LOCUS_06300 224283 225032 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925727.1 protein_id gnl|my_center|LOCUS_06300 225029 225358 gene locus_tag LOCUS_06310 225029 225358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 225355 226443 gene locus_tag LOCUS_06320 225355 226443 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_06320 226495 227157 gene locus_tag LOCUS_06330 226495 227157 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_06330 227395 230193 gene locus_tag LOCUS_06340 227395 230193 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_06340 230190 231710 gene locus_tag LOCUS_06350 230190 231710 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022106.1 protein_id gnl|my_center|LOCUS_06350 231820 231984 gene locus_tag LOCUS_06360 231820 231984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 232391 232855 gene locus_tag LOCUS_06370 232391 232855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 232867 233649 gene locus_tag LOCUS_06380 232867 233649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 233766 233930 gene locus_tag LOCUS_06390 233766 233930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 233934 234464 gene locus_tag LOCUS_06400 233934 234464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 234556 235524 gene locus_tag LOCUS_06410 gene rhuM 234556 235524 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_06410 235539 237029 gene locus_tag LOCUS_06420 235539 237029 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_06420 237105 238286 gene locus_tag LOCUS_06430 gene purT 237105 238286 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 protein_id gnl|my_center|LOCUS_06430 238381 240282 gene locus_tag LOCUS_06440 238381 240282 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530071.1 protein_id gnl|my_center|LOCUS_06440 240301 240657 gene locus_tag LOCUS_06450 240301 240657 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_06450 242191 240719 gene locus_tag LOCUS_06460 242191 240719 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266437.1 protein_id gnl|my_center|LOCUS_06460 242404 243066 gene locus_tag LOCUS_06470 242404 243066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 243173 244267 gene locus_tag LOCUS_06480 gene vmeJ 243173 244267 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_06480 244264 247413 gene locus_tag LOCUS_06490 244264 247413 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_06490 247428 247769 gene locus_tag LOCUS_06500 247428 247769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 247773 248402 gene locus_tag LOCUS_06510 247773 248402 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_06510 248451 249821 gene locus_tag LOCUS_06520 248451 249821 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_06520 250408 249875 gene locus_tag LOCUS_06530 gene greB 250408 249875 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090951.1 protein_id gnl|my_center|LOCUS_06530 252378 250420 gene locus_tag LOCUS_06540 252378 250420 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_06540 252705 252382 gene locus_tag LOCUS_06550 gene yciH 252705 252382 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422748.1 protein_id gnl|my_center|LOCUS_06550 253734 252736 gene locus_tag LOCUS_06560 253734 252736 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_06560 254009 253737 gene locus_tag LOCUS_06570 254009 253737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 254082 254939 gene locus_tag LOCUS_06580 254082 254939 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 protein_id gnl|my_center|LOCUS_06580 254943 256418 gene locus_tag LOCUS_06590 gene cls 254943 256418 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121332.1 protein_id gnl|my_center|LOCUS_06590 256473 256784 gene locus_tag LOCUS_06600 256473 256784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 257020 256829 gene locus_tag LOCUS_06610 257020 256829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 257122 258876 gene locus_tag LOCUS_06620 gene dauA 257122 258876 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 protein_id gnl|my_center|LOCUS_06620 259124 259630 gene locus_tag LOCUS_06630 259124 259630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 259711 260181 gene locus_tag LOCUS_06640 259711 260181 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_06640 260182 260451 gene locus_tag LOCUS_06650 260182 260451 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_06650 260451 260771 gene locus_tag LOCUS_06660 260451 260771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 260961 261866 gene locus_tag LOCUS_06670 260961 261866 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599366.1 protein_id gnl|my_center|LOCUS_06670 261866 262216 gene locus_tag LOCUS_06680 261866 262216 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_06680 262210 263682 gene locus_tag LOCUS_06690 262210 263682 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_06690 263679 265157 gene locus_tag LOCUS_06700 263679 265157 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_06700 265154 265429 gene locus_tag LOCUS_06710 265154 265429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 265422 267107 gene locus_tag LOCUS_06720 265422 267107 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389322.1 protein_id gnl|my_center|LOCUS_06720 267196 268053 gene locus_tag LOCUS_06730 267196 268053 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 protein_id gnl|my_center|LOCUS_06730 268242 269855 gene locus_tag LOCUS_06740 268242 269855 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072485.1 protein_id gnl|my_center|LOCUS_06740 270508 269966 gene locus_tag LOCUS_06750 270508 269966 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_06750 272699 270549 gene locus_tag LOCUS_06760 272699 270549 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_06760 273601 273209 gene locus_tag LOCUS_06770 273601 273209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 274021 273935 gene locus_tag LOCUS_t00030 274021 273935 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 274276 276693 gene locus_tag LOCUS_06780 gene rnr 274276 276693 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_06780 276727 277491 gene locus_tag LOCUS_06790 gene rlmB 276727 277491 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_06790 277689 277525 gene locus_tag LOCUS_06800 277689 277525 CDS product DUF3012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966574.1 protein_id gnl|my_center|LOCUS_06800 277888 278388 gene locus_tag LOCUS_06810 gene rpsF 277888 278388 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856034.1 protein_id gnl|my_center|LOCUS_06810 278391 278618 gene locus_tag LOCUS_06820 gene rpsR 278391 278618 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_06820 278635 279492 gene locus_tag LOCUS_06830 278635 279492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_06830 279541 279990 gene locus_tag LOCUS_06840 gene rplI 279541 279990 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196054.1 protein_id gnl|my_center|LOCUS_06840 280084 281445 gene locus_tag LOCUS_06850 gene dnaB 280084 281445 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380723.1 protein_id gnl|my_center|LOCUS_06850 281482 282327 gene locus_tag LOCUS_06860 gene panC 281482 282327 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109313.1 protein_id gnl|my_center|LOCUS_06860 282340 282720 gene locus_tag LOCUS_06870 282340 282720 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_06870 283183 282851 gene locus_tag LOCUS_06880 283183 282851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 284377 283577 gene locus_tag LOCUS_06890 284377 283577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 284819 288346 gene locus_tag LOCUS_06900 284819 288346 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478571.1 protein_id gnl|my_center|LOCUS_06900 288443 288928 gene locus_tag LOCUS_06910 288443 288928 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073585.1 protein_id gnl|my_center|LOCUS_06910 289649 288984 gene locus_tag LOCUS_06920 289649 288984 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616037.1 protein_id gnl|my_center|LOCUS_06920 289903 289649 gene locus_tag LOCUS_06930 289903 289649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 289863 291182 gene locus_tag LOCUS_06940 289863 291182 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 protein_id gnl|my_center|LOCUS_06940 291303 291575 gene locus_tag LOCUS_06950 291303 291575 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 protein_id gnl|my_center|LOCUS_06950 291586 293292 gene locus_tag LOCUS_06960 291586 293292 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_06960 294846 293398 gene locus_tag LOCUS_06970 294846 293398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 295475 295062 gene locus_tag LOCUS_06980 gene arfB 295475 295062 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767723.1 protein_id gnl|my_center|LOCUS_06980 295614 295856 gene locus_tag LOCUS_06990 295614 295856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 298003 295742 gene locus_tag LOCUS_07000 298003 295742 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_07000 298502 298044 gene locus_tag LOCUS_07010 298502 298044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 301066 298661 gene locus_tag LOCUS_07020 301066 298661 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_07020 302427 301225 gene locus_tag LOCUS_07030 302427 301225 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927045.1 protein_id gnl|my_center|LOCUS_07030 302770 304626 gene locus_tag LOCUS_07040 302770 304626 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072774.1 protein_id gnl|my_center|LOCUS_07040 304626 305309 gene locus_tag LOCUS_07050 304626 305309 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072773.1 protein_id gnl|my_center|LOCUS_07050 305444 307381 gene locus_tag LOCUS_07060 gene acs 305444 307381 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_07060 307548 308090 gene locus_tag LOCUS_07070 307548 308090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 308686 308150 gene locus_tag LOCUS_07080 gene ppa 308686 308150 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093248.1 protein_id gnl|my_center|LOCUS_07080 309545 308862 gene locus_tag LOCUS_07090 309545 308862 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 protein_id gnl|my_center|LOCUS_07090 311208 309649 gene locus_tag LOCUS_07100 311208 309649 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615749.1 protein_id gnl|my_center|LOCUS_07100 311424 312815 gene locus_tag LOCUS_07110 gene hemN 311424 312815 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_07110 313031 315217 gene locus_tag LOCUS_07120 313031 315217 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_07120 315245 315493 gene locus_tag LOCUS_07130 315245 315493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 315494 316108 gene locus_tag LOCUS_07140 gene pnuC 315494 316108 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_07140 316086 316820 gene locus_tag LOCUS_07150 316086 316820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 317295 316876 gene locus_tag LOCUS_07160 317295 316876 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672395.1 protein_id gnl|my_center|LOCUS_07160 317675 317307 gene locus_tag LOCUS_07170 317675 317307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 318290 317706 gene locus_tag LOCUS_07180 318290 317706 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_07180 319671 318358 gene locus_tag LOCUS_07190 319671 318358 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921463.1 protein_id gnl|my_center|LOCUS_07190 321718 319688 gene locus_tag LOCUS_07200 321718 319688 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921462.1 protein_id gnl|my_center|LOCUS_07200 322768 322016 gene locus_tag LOCUS_07210 gene tatC 322768 322016 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_07210 323091 322765 gene locus_tag LOCUS_07220 gene tatB 323091 322765 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115042.1 protein_id gnl|my_center|LOCUS_07220 323364 323122 gene locus_tag LOCUS_07230 gene tatA 323364 323122 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508969.1 protein_id gnl|my_center|LOCUS_07230 323703 323383 gene locus_tag LOCUS_07240 323703 323383 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_07240 324116 323724 gene locus_tag LOCUS_07250 gene hisI 324116 323724 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_07250 325775 324165 gene locus_tag LOCUS_07260 gene ubiB 325775 324165 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_07260 326440 325778 gene locus_tag LOCUS_07270 326440 325778 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015961899.1 protein_id gnl|my_center|LOCUS_07270 327189 326440 gene locus_tag LOCUS_07280 gene ubiE 327189 326440 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_07280 329018 327309 gene locus_tag LOCUS_07290 329018 327309 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_07290 329904 329113 gene locus_tag LOCUS_07300 329904 329113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 332708 330012 gene locus_tag LOCUS_07310 332708 330012 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 protein_id gnl|my_center|LOCUS_07310 332938 334203 gene locus_tag LOCUS_07320 332938 334203 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071852.1 protein_id gnl|my_center|LOCUS_07320 334868 334200 gene locus_tag LOCUS_07330 334868 334200 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_07330 335068 335412 gene locus_tag LOCUS_07340 335068 335412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 335857 335459 gene locus_tag LOCUS_07350 335857 335459 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463876.1 protein_id gnl|my_center|LOCUS_07350 337218 335893 gene locus_tag LOCUS_07360 gene hslU 337218 335893 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765516.1 protein_id gnl|my_center|LOCUS_07360 337900 337337 gene locus_tag LOCUS_07370 gene hslV 337900 337337 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_07370 338313 337966 gene locus_tag LOCUS_07380 338313 337966 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_07380 339206 338313 gene locus_tag LOCUS_07390 gene htpX 339206 338313 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369784.1 protein_id gnl|my_center|LOCUS_07390 339539 339973 gene locus_tag LOCUS_07400 339539 339973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 340067 340786 gene locus_tag LOCUS_07410 340067 340786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_07410 341621 340794 gene locus_tag LOCUS_07420 gene mscS 341621 340794 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_07420 341724 342410 gene locus_tag LOCUS_07430 341724 342410 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262398.1 protein_id gnl|my_center|LOCUS_07430 342449 343261 gene locus_tag LOCUS_07440 gene cysE 342449 343261 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 protein_id gnl|my_center|LOCUS_07440 343261 343623 gene locus_tag LOCUS_07450 343261 343623 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024297.1 protein_id gnl|my_center|LOCUS_07450 343689 344261 gene locus_tag LOCUS_07460 343689 344261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 344521 348003 gene locus_tag LOCUS_07470 344521 348003 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104408.1 protein_id gnl|my_center|LOCUS_07470 348065 349156 gene locus_tag LOCUS_07480 348065 349156 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_07480 349190 349786 gene locus_tag LOCUS_07490 gene smrA 349190 349786 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_07490 350296 349832 gene locus_tag LOCUS_07500 350296 349832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 352688 350478 gene locus_tag LOCUS_07510 352688 350478 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266372.1 protein_id gnl|my_center|LOCUS_07510 352955 353170 gene locus_tag LOCUS_07520 gene rpmE 352955 353170 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 protein_id gnl|my_center|LOCUS_07520 353304 353972 gene locus_tag LOCUS_07530 353304 353972 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105331.1 protein_id gnl|my_center|LOCUS_07530 355223 354024 gene locus_tag LOCUS_07540 355223 354024 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 protein_id gnl|my_center|LOCUS_07540 358051 355223 gene locus_tag LOCUS_07550 358051 355223 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 protein_id gnl|my_center|LOCUS_07550 358572 360890 gene locus_tag LOCUS_07560 358572 360890 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550100.1 protein_id gnl|my_center|LOCUS_07560 360923 362254 gene locus_tag LOCUS_07570 360923 362254 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105743634.1 protein_id gnl|my_center|LOCUS_07570 362304 363062 gene locus_tag LOCUS_07580 362304 363062 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_07580 363446 365023 gene locus_tag LOCUS_07590 gene pntA 363446 365023 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 protein_id gnl|my_center|LOCUS_07590 365036 366430 gene locus_tag LOCUS_07600 gene pntB 365036 366430 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 protein_id gnl|my_center|LOCUS_07600 366649 368433 gene locus_tag LOCUS_07610 366649 368433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 368907 368485 gene locus_tag LOCUS_07620 368907 368485 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304069.1 protein_id gnl|my_center|LOCUS_07620 369589 369164 gene locus_tag LOCUS_07630 369589 369164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 370313 370693 gene locus_tag LOCUS_07640 370313 370693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 370744 371256 gene locus_tag LOCUS_07650 370744 371256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 371365 372435 gene locus_tag LOCUS_07660 371365 372435 CDS product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706810.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence03 79 906 gene locus_tag LOCUS_07670 79 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 998 1306 gene locus_tag LOCUS_07680 998 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1402 2301 gene locus_tag LOCUS_07690 1402 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2376 2723 gene locus_tag LOCUS_07700 2376 2723 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477812.1 protein_id gnl|my_center|LOCUS_07700 2829 3014 gene locus_tag LOCUS_07710 2829 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3301 4017 gene locus_tag LOCUS_07720 gene gntA 3301 4017 CDS product guanitoxin biosynthesis heme-dependent pre-guanitoxin N-hydroxylase GntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_07720 4014 4619 gene locus_tag LOCUS_07730 4014 4619 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_07730 5059 5637 gene locus_tag LOCUS_07740 5059 5637 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786942.1 protein_id gnl|my_center|LOCUS_07740 5640 6677 gene locus_tag LOCUS_07750 5640 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 6811 7278 gene locus_tag LOCUS_07760 gene ybaK 6811 7278 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186559.1 protein_id gnl|my_center|LOCUS_07760 8733 7411 gene locus_tag LOCUS_07770 8733 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9128 10252 gene locus_tag LOCUS_07780 9128 10252 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190450.1 protein_id gnl|my_center|LOCUS_07780 11636 10347 gene locus_tag LOCUS_07790 11636 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 11801 12598 gene locus_tag LOCUS_07800 11801 12598 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_07800 12715 13167 gene locus_tag LOCUS_07810 12715 13167 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393609.1 protein_id gnl|my_center|LOCUS_07810 13305 14270 gene locus_tag LOCUS_07820 13305 14270 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368513.1 protein_id gnl|my_center|LOCUS_07820 14417 15517 gene locus_tag LOCUS_07830 14417 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 15713 16237 gene locus_tag LOCUS_07840 gene fecI 15713 16237 CDS product RNA polymerase sigma factor FecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283626.1 protein_id gnl|my_center|LOCUS_07840 16234 17241 gene locus_tag LOCUS_07850 16234 17241 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112303.1 protein_id gnl|my_center|LOCUS_07850 17318 19747 gene locus_tag LOCUS_07860 17318 19747 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269073.1 protein_id gnl|my_center|LOCUS_07860 19913 20428 gene locus_tag LOCUS_07870 19913 20428 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524116.1 protein_id gnl|my_center|LOCUS_07870 20428 21399 gene locus_tag LOCUS_07880 20428 21399 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 protein_id gnl|my_center|LOCUS_07880 21555 23990 gene locus_tag LOCUS_07890 gene fauA 21555 23990 CDS product TonB-dependent alcaligin siderophore receptor FauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926982.1 protein_id gnl|my_center|LOCUS_07890 24444 24953 gene locus_tag LOCUS_07900 24444 24953 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092999.1 protein_id gnl|my_center|LOCUS_07900 24966 25943 gene locus_tag LOCUS_07910 24966 25943 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 protein_id gnl|my_center|LOCUS_07910 26077 28347 gene locus_tag LOCUS_07920 26077 28347 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 protein_id gnl|my_center|LOCUS_07920 28532 28810 gene locus_tag LOCUS_07930 28532 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 28807 30516 gene locus_tag LOCUS_07940 28807 30516 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463402.1 protein_id gnl|my_center|LOCUS_07940 30928 31353 gene locus_tag LOCUS_07950 30928 31353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 31350 32306 gene locus_tag LOCUS_07960 31350 32306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 32310 32738 gene locus_tag LOCUS_07970 32310 32738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 32735 33628 gene locus_tag LOCUS_07980 32735 33628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 36832 33959 gene locus_tag LOCUS_07990 36832 33959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 37211 37435 gene locus_tag LOCUS_08000 37211 37435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 37493 37867 gene locus_tag LOCUS_08010 37493 37867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 39039 38095 gene locus_tag LOCUS_08020 39039 38095 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_08020 40537 39080 gene locus_tag LOCUS_08030 40537 39080 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899906.1 protein_id gnl|my_center|LOCUS_08030 41404 40658 gene locus_tag LOCUS_08040 41404 40658 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_08040 42654 41404 gene locus_tag LOCUS_08050 42654 41404 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_08050 43271 43549 gene locus_tag LOCUS_08060 43271 43549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 44229 43624 gene locus_tag LOCUS_08070 44229 43624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 44425 44580 gene locus_tag LOCUS_08080 44425 44580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 44631 45272 gene locus_tag LOCUS_08090 44631 45272 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_08090 45306 45923 gene locus_tag LOCUS_08100 gene dut 45306 45923 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_08100 46009 46875 gene locus_tag LOCUS_08110 gene ttcA 46009 46875 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925707.1 protein_id gnl|my_center|LOCUS_08110 46946 48988 gene locus_tag LOCUS_08120 gene dnaX 46946 48988 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_08120 49006 49323 gene locus_tag LOCUS_08130 49006 49323 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_08130 49403 49996 gene locus_tag LOCUS_08140 gene recR 49403 49996 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195023.1 protein_id gnl|my_center|LOCUS_08140 50054 51226 gene locus_tag LOCUS_08150 gene rnd 50054 51226 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104784.1 protein_id gnl|my_center|LOCUS_08150 51219 51503 gene locus_tag LOCUS_08160 51219 51503 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295992.1 protein_id gnl|my_center|LOCUS_08160 51515 51961 gene locus_tag LOCUS_08170 51515 51961 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327718.1 protein_id gnl|my_center|LOCUS_08170 52127 52498 gene locus_tag LOCUS_08180 52127 52498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 54443 52503 gene locus_tag LOCUS_08190 54443 52503 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_08190 54633 56294 gene locus_tag LOCUS_08200 gene fadD2 54633 56294 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_08200 56316 60194 gene locus_tag LOCUS_08210 gene hrpA 56316 60194 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_08210 60330 60641 gene locus_tag LOCUS_08220 60330 60641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 60662 61522 gene locus_tag LOCUS_08230 60662 61522 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 protein_id gnl|my_center|LOCUS_08230 61515 62297 gene locus_tag LOCUS_08240 61515 62297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 63631 62375 gene locus_tag LOCUS_08250 63631 62375 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926950.1 protein_id gnl|my_center|LOCUS_08250 65104 63869 gene locus_tag LOCUS_08260 65104 63869 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926950.1 protein_id gnl|my_center|LOCUS_08260 65381 66076 gene locus_tag LOCUS_08270 65381 66076 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267309.1 protein_id gnl|my_center|LOCUS_08270 66183 67358 gene locus_tag LOCUS_08280 66183 67358 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103855.1 protein_id gnl|my_center|LOCUS_08280 67358 67849 gene locus_tag LOCUS_08290 67358 67849 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_08290 68292 67846 gene locus_tag LOCUS_08300 68292 67846 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 protein_id gnl|my_center|LOCUS_08300 69242 68289 gene locus_tag LOCUS_08310 gene tal 69242 68289 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263519.1 protein_id gnl|my_center|LOCUS_08310 70065 69244 gene locus_tag LOCUS_08320 gene dusA 70065 69244 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884460.1 protein_id gnl|my_center|LOCUS_08320 70420 72582 gene locus_tag LOCUS_08330 70420 72582 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154355.1 protein_id gnl|my_center|LOCUS_08330 72582 73946 gene locus_tag LOCUS_08340 72582 73946 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_08340 74099 75415 gene locus_tag LOCUS_08350 74099 75415 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_08350 75484 78651 gene locus_tag LOCUS_08360 75484 78651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 79294 78734 gene locus_tag LOCUS_08370 79294 78734 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 protein_id gnl|my_center|LOCUS_08370 79581 81545 gene locus_tag LOCUS_08380 79581 81545 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_08380 81614 83128 gene locus_tag LOCUS_08390 gene gltX 81614 83128 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207840.1 protein_id gnl|my_center|LOCUS_08390 83169 83244 gene locus_tag LOCUS_t00040 83169 83244 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 83939 84130 gene locus_tag LOCUS_08400 83939 84130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 84730 85218 gene locus_tag LOCUS_08410 84730 85218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 85955 85566 gene locus_tag LOCUS_08420 85955 85566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 86488 86054 gene locus_tag LOCUS_08430 86488 86054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 88003 86726 gene locus_tag LOCUS_08440 gene gltA 88003 86726 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 protein_id gnl|my_center|LOCUS_08440 88304 88690 gene locus_tag LOCUS_08450 gene sdhC 88304 88690 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 protein_id gnl|my_center|LOCUS_08450 88681 89055 gene locus_tag LOCUS_08460 gene sdhD 88681 89055 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316551.1 protein_id gnl|my_center|LOCUS_08460 89060 90832 gene locus_tag LOCUS_08470 gene sdhA 89060 90832 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087407.1 protein_id gnl|my_center|LOCUS_08470 90847 91551 gene locus_tag LOCUS_08480 90847 91551 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_08480 91638 94469 gene locus_tag LOCUS_08490 91638 94469 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_08490 94508 95725 gene locus_tag LOCUS_08500 gene odhB 94508 95725 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_08500 95758 97200 gene locus_tag LOCUS_08510 gene lpdA 95758 97200 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_08510 97283 98452 gene locus_tag LOCUS_08520 gene sucC 97283 98452 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_08520 98452 99324 gene locus_tag LOCUS_08530 gene sucD 98452 99324 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_08530 99533 101440 gene locus_tag LOCUS_08540 gene htpG 99533 101440 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769616.1 protein_id gnl|my_center|LOCUS_08540 101500 102537 gene locus_tag LOCUS_08550 101500 102537 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267382.1 protein_id gnl|my_center|LOCUS_08550 102521 102955 gene locus_tag LOCUS_08560 102521 102955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 102964 103419 gene locus_tag LOCUS_08570 gene sixA 102964 103419 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769602.1 protein_id gnl|my_center|LOCUS_08570 104128 103478 gene locus_tag LOCUS_08580 gene folE 104128 103478 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616969.1 protein_id gnl|my_center|LOCUS_08580 104145 105038 gene locus_tag LOCUS_08590 gene prmB 104145 105038 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_08590 105163 106266 gene locus_tag LOCUS_08600 gene aroC 105163 106266 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 protein_id gnl|my_center|LOCUS_08600 106282 107430 gene locus_tag LOCUS_08610 106282 107430 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_08610 107482 107763 gene locus_tag LOCUS_08620 107482 107763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 107892 107816 gene locus_tag LOCUS_t00050 107892 107816 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 108036 108743 gene locus_tag LOCUS_08630 108036 108743 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770607.1 protein_id gnl|my_center|LOCUS_08630 110468 108828 gene locus_tag LOCUS_08640 110468 108828 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 protein_id gnl|my_center|LOCUS_08640 110691 111443 gene locus_tag LOCUS_08650 110691 111443 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_08650 111443 112372 gene locus_tag LOCUS_08660 111443 112372 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_08660 112890 112417 gene locus_tag LOCUS_08670 112890 112417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 113223 112894 gene locus_tag LOCUS_08680 113223 112894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 113752 113216 gene locus_tag LOCUS_08690 113752 113216 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_08690 114195 113839 gene locus_tag LOCUS_08700 114195 113839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 115081 114269 gene locus_tag LOCUS_08710 gene xthA 115081 114269 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104169.1 protein_id gnl|my_center|LOCUS_08710 117347 115275 gene locus_tag LOCUS_08720 117347 115275 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174518733.1 protein_id gnl|my_center|LOCUS_08720 117479 118306 gene locus_tag LOCUS_08730 117479 118306 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139980.1 protein_id gnl|my_center|LOCUS_08730 118299 118721 gene locus_tag LOCUS_08740 118299 118721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 118837 119817 gene locus_tag LOCUS_08750 118837 119817 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_08750 119950 120462 gene locus_tag LOCUS_08760 119950 120462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 120531 121007 gene locus_tag LOCUS_08770 gene bcp 120531 121007 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 protein_id gnl|my_center|LOCUS_08770 121083 121418 gene locus_tag LOCUS_08780 gene yajC 121083 121418 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_08780 121432 122469 gene locus_tag LOCUS_08790 121432 122469 CDS product aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082912.1 protein_id gnl|my_center|LOCUS_08790 122466 123812 gene locus_tag LOCUS_08800 122466 123812 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_08800 124177 123836 gene locus_tag LOCUS_08810 124177 123836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 124661 125566 gene locus_tag LOCUS_08820 124661 125566 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_08820 126276 125572 gene locus_tag LOCUS_08830 126276 125572 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268904.1 protein_id gnl|my_center|LOCUS_08830 126475 127449 gene locus_tag LOCUS_08840 gene cysB 126475 127449 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_08840 127856 127521 gene locus_tag LOCUS_08850 127856 127521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087777.1 protein_id gnl|my_center|LOCUS_08850 128602 127871 gene locus_tag LOCUS_08860 128602 127871 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_08860 128782 129471 gene locus_tag LOCUS_08870 gene thrH 128782 129471 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_08870 130859 129477 gene locus_tag LOCUS_08880 gene pabB 130859 129477 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211081.1 protein_id gnl|my_center|LOCUS_08880 131243 131665 gene locus_tag LOCUS_08890 gene rraA 131243 131665 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_08890 131756 132307 gene locus_tag LOCUS_08900 131756 132307 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_08900 134364 132772 gene locus_tag LOCUS_08910 134364 132772 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 protein_id gnl|my_center|LOCUS_08910 134474 135412 gene locus_tag LOCUS_08920 134474 135412 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_08920 135533 137698 gene locus_tag LOCUS_08930 135533 137698 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_08930 138747 137776 gene locus_tag LOCUS_08940 138747 137776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 138849 140576 gene locus_tag LOCUS_08950 gene ggt 138849 140576 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_08950 141551 140613 gene locus_tag LOCUS_08960 141551 140613 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_08960 142983 141616 gene locus_tag LOCUS_08970 gene purB 142983 141616 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380132.1 protein_id gnl|my_center|LOCUS_08970 143698 143072 gene locus_tag LOCUS_08980 gene hflD 143698 143072 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131182.1 protein_id gnl|my_center|LOCUS_08980 144798 143689 gene locus_tag LOCUS_08990 gene mnmA 144798 143689 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_08990 145258 144812 gene locus_tag LOCUS_09000 145258 144812 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 protein_id gnl|my_center|LOCUS_09000 145842 145255 gene locus_tag LOCUS_09010 145842 145255 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763288.1 protein_id gnl|my_center|LOCUS_09010 146026 147279 gene locus_tag LOCUS_09020 gene icd 146026 147279 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_09020 147614 147345 gene locus_tag LOCUS_09030 gene cspD 147614 147345 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080268799.1 protein_id gnl|my_center|LOCUS_09030 147847 148236 gene locus_tag LOCUS_09040 gene clpS 147847 148236 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405085.1 protein_id gnl|my_center|LOCUS_09040 148261 150525 gene locus_tag LOCUS_09050 gene clpA 148261 150525 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_09050 150766 150548 gene locus_tag LOCUS_09060 gene infA 150766 150548 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_09060 151556 150834 gene locus_tag LOCUS_09070 151556 150834 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_09070 153260 152310 gene locus_tag LOCUS_09080 gene trxB 153260 152310 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_09080 153449 155824 gene locus_tag LOCUS_09090 gene ftsK 153449 155824 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405080.1 protein_id gnl|my_center|LOCUS_09090 155888 156484 gene locus_tag LOCUS_09100 gene lolA 155888 156484 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 protein_id gnl|my_center|LOCUS_09100 156477 157811 gene locus_tag LOCUS_09110 156477 157811 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_09110 157811 158182 gene locus_tag LOCUS_09120 gene crcB 157811 158182 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819067.1 protein_id gnl|my_center|LOCUS_09120 158197 159483 gene locus_tag LOCUS_09130 gene serS 158197 159483 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_09130 159512 160891 gene locus_tag LOCUS_09140 gene cysG 159512 160891 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405073.1 protein_id gnl|my_center|LOCUS_09140 160901 162256 gene locus_tag LOCUS_09150 gene gorA 160901 162256 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 protein_id gnl|my_center|LOCUS_09150 162991 162398 gene locus_tag LOCUS_09160 162991 162398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 163295 163981 gene locus_tag LOCUS_09170 163295 163981 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197905.1 protein_id gnl|my_center|LOCUS_09170 164761 164033 gene locus_tag LOCUS_09180 164761 164033 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_09180 164985 166247 gene locus_tag LOCUS_09190 gene bioA 164985 166247 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210761.1 protein_id gnl|my_center|LOCUS_09190 167305 166274 gene locus_tag LOCUS_09200 167305 166274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 168692 167379 gene locus_tag LOCUS_09210 168692 167379 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104764.1 protein_id gnl|my_center|LOCUS_09210 169586 168699 gene locus_tag LOCUS_09220 169586 168699 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104396.1 protein_id gnl|my_center|LOCUS_09220 170409 169609 gene locus_tag LOCUS_09230 170409 169609 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_09230 171142 170414 gene locus_tag LOCUS_09240 gene tsaB 171142 170414 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_09240 172235 171231 gene locus_tag LOCUS_09250 172235 171231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 173365 172379 gene locus_tag LOCUS_09260 gene hemH 173365 172379 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065964.1 protein_id gnl|my_center|LOCUS_09260 174088 173435 gene locus_tag LOCUS_09270 gene adk 174088 173435 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406317.1 protein_id gnl|my_center|LOCUS_09270 175041 174208 gene locus_tag LOCUS_09280 gene mazG 175041 174208 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 protein_id gnl|my_center|LOCUS_09280 177297 175045 gene locus_tag LOCUS_09290 gene relA 177297 175045 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_09290 178334 177432 gene locus_tag LOCUS_09300 gene cysM 178334 177432 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_09300 178876 178490 gene locus_tag LOCUS_09310 gene acpS 178876 178490 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 protein_id gnl|my_center|LOCUS_09310 179613 178873 gene locus_tag LOCUS_09320 gene recO 179613 178873 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101972.1 protein_id gnl|my_center|LOCUS_09320 180482 179724 gene locus_tag LOCUS_09330 gene era 180482 179724 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_09330 181309 180623 gene locus_tag LOCUS_09340 gene rnc 181309 180623 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 protein_id gnl|my_center|LOCUS_09340 181684 181319 gene locus_tag LOCUS_09350 181684 181319 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246809.1 protein_id gnl|my_center|LOCUS_09350 182468 181716 gene locus_tag LOCUS_09360 gene lepB 182468 181716 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101969.1 protein_id gnl|my_center|LOCUS_09360 184139 182478 gene locus_tag LOCUS_09370 gene lepA 184139 182478 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 protein_id gnl|my_center|LOCUS_09370 185542 184466 gene locus_tag LOCUS_09380 gene mucD 185542 184466 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_09380 185645 185833 gene locus_tag LOCUS_09390 185645 185833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 187037 186174 gene locus_tag LOCUS_09400 187037 186174 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 protein_id gnl|my_center|LOCUS_09400 187812 187153 gene locus_tag LOCUS_09410 187812 187153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 188562 187978 gene locus_tag LOCUS_09420 gene rpoE 188562 187978 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_09420 188724 190346 gene locus_tag LOCUS_09430 gene nadB 188724 190346 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_09430 190933 190727 gene locus_tag LOCUS_09440 190933 190727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 191277 192065 gene locus_tag LOCUS_09450 191277 192065 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_09450 192125 192541 gene locus_tag LOCUS_09460 192125 192541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 193245 192538 gene locus_tag LOCUS_09470 gene ung 193245 192538 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038854.1 protein_id gnl|my_center|LOCUS_09470 193346 194176 gene locus_tag LOCUS_09480 193346 194176 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974622.1 protein_id gnl|my_center|LOCUS_09480 194942 194160 gene locus_tag LOCUS_09490 194942 194160 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_09490 195232 196263 gene locus_tag LOCUS_09500 195232 196263 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975052.1 protein_id gnl|my_center|LOCUS_09500 196310 196615 gene locus_tag LOCUS_09510 196310 196615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 200538 196672 gene locus_tag LOCUS_09520 gene purL 200538 196672 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_09520 200800 202260 gene locus_tag LOCUS_09530 gene mltF 200800 202260 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_09530 202707 202255 gene locus_tag LOCUS_09540 gene tadA 202707 202255 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266922.1 protein_id gnl|my_center|LOCUS_09540 202963 202769 gene locus_tag LOCUS_09550 202963 202769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 203266 204264 gene locus_tag LOCUS_09560 203266 204264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 204249 204947 gene locus_tag LOCUS_09570 204249 204947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 206067 205057 gene locus_tag LOCUS_09580 206067 205057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 206610 207446 gene locus_tag LOCUS_09590 206610 207446 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072510.1 protein_id gnl|my_center|LOCUS_09590 208212 207451 gene locus_tag LOCUS_09600 208212 207451 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_09600 209347 208676 gene locus_tag LOCUS_09610 209347 208676 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072507.1 protein_id gnl|my_center|LOCUS_09610 209848 210108 gene locus_tag LOCUS_09620 209848 210108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 210136 210339 gene locus_tag LOCUS_09630 210136 210339 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_09630 210681 210523 gene locus_tag LOCUS_09640 210681 210523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 210907 212553 gene locus_tag LOCUS_09650 210907 212553 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943636.1 protein_id gnl|my_center|LOCUS_09650 212619 212855 gene locus_tag LOCUS_09660 212619 212855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 212916 213329 gene locus_tag LOCUS_09670 212916 213329 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327476.1 protein_id gnl|my_center|LOCUS_09670 215276 213330 gene locus_tag LOCUS_09680 215276 213330 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086001.1 protein_id gnl|my_center|LOCUS_09680 216133 215273 gene locus_tag LOCUS_09690 216133 215273 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970966.1 protein_id gnl|my_center|LOCUS_09690 217498 216161 gene locus_tag LOCUS_09700 217498 216161 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338149.1 protein_id gnl|my_center|LOCUS_09700 218036 217584 gene locus_tag LOCUS_09710 218036 217584 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973802.1 protein_id gnl|my_center|LOCUS_09710 218692 218381 gene locus_tag LOCUS_09720 218692 218381 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_09720 218979 219266 gene locus_tag LOCUS_09730 218979 219266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 219266 219547 gene locus_tag LOCUS_09740 219266 219547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 219986 219711 gene locus_tag LOCUS_09750 219986 219711 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039113.1 protein_id gnl|my_center|LOCUS_09750 220731 220195 gene locus_tag LOCUS_09760 220731 220195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 221100 223514 gene locus_tag LOCUS_09770 gene katE 221100 223514 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105396.1 protein_id gnl|my_center|LOCUS_09770 224412 225710 gene locus_tag LOCUS_09780 224412 225710 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208816.1 protein_id gnl|my_center|LOCUS_09780 226118 226375 gene locus_tag LOCUS_09790 226118 226375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 227805 226441 gene locus_tag LOCUS_09800 227805 226441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 228907 227834 gene locus_tag LOCUS_09810 228907 227834 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_09810 229344 229183 gene locus_tag LOCUS_09820 229344 229183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 229976 229548 gene locus_tag LOCUS_09830 229976 229548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 231067 229973 gene locus_tag LOCUS_09840 231067 229973 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_09840 231725 231324 gene locus_tag LOCUS_09850 231725 231324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 231901 231722 gene locus_tag LOCUS_09860 231901 231722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 232965 232123 gene locus_tag LOCUS_09870 232965 232123 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_09870 233747 233010 gene locus_tag LOCUS_09880 233747 233010 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_09880 233954 233775 gene locus_tag LOCUS_09890 233954 233775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 234406 235734 gene locus_tag LOCUS_09900 234406 235734 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 protein_id gnl|my_center|LOCUS_09900 235834 236442 gene locus_tag LOCUS_09910 235834 236442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 236469 239051 gene locus_tag LOCUS_09920 236469 239051 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_09920 239282 240484 gene locus_tag LOCUS_09930 239282 240484 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925859.1 protein_id gnl|my_center|LOCUS_09930 240719 240955 gene locus_tag LOCUS_09940 240719 240955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 241272 243104 gene locus_tag LOCUS_09950 241272 243104 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 protein_id gnl|my_center|LOCUS_09950 245163 243166 gene locus_tag LOCUS_09960 245163 243166 CDS product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 protein_id gnl|my_center|LOCUS_09960 246180 245506 gene locus_tag LOCUS_09970 246180 245506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 247360 246203 gene locus_tag LOCUS_09980 247360 246203 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768762.1 protein_id gnl|my_center|LOCUS_09980 248523 247357 gene locus_tag LOCUS_09990 248523 247357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 248993 248520 gene locus_tag LOCUS_10000 248993 248520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 252243 249121 gene locus_tag LOCUS_10010 252243 249121 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706761.1 protein_id gnl|my_center|LOCUS_10010 253834 252236 gene locus_tag LOCUS_10020 253834 252236 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190973259.1 protein_id gnl|my_center|LOCUS_10020 255059 253845 gene locus_tag LOCUS_10030 255059 253845 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482614.1 protein_id gnl|my_center|LOCUS_10030 256460 255903 gene locus_tag LOCUS_10040 256460 255903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 257503 256463 gene locus_tag LOCUS_10050 257503 256463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 258731 257481 gene locus_tag LOCUS_10060 258731 257481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 259687 259238 gene locus_tag LOCUS_10070 gene csdE 259687 259238 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 protein_id gnl|my_center|LOCUS_10070 260248 259709 gene locus_tag LOCUS_10080 gene sufT 260248 259709 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_10080 260610 260245 gene locus_tag LOCUS_10090 gene sufA 260610 260245 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367176.1 protein_id gnl|my_center|LOCUS_10090 261929 260679 gene locus_tag LOCUS_10100 261929 260679 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_10100 263259 261934 gene locus_tag LOCUS_10110 gene sufD 263259 261934 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_10110 264008 263259 gene locus_tag LOCUS_10120 gene sufC 264008 263259 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_10120 265504 264068 gene locus_tag LOCUS_10130 gene sufB 265504 264068 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_10130 266030 265554 gene locus_tag LOCUS_10140 gene iscR 266030 265554 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_10140 266661 267593 gene locus_tag LOCUS_10150 266661 267593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 267925 269172 gene locus_tag LOCUS_10160 267925 269172 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704570.1 protein_id gnl|my_center|LOCUS_10160 269457 270905 gene locus_tag LOCUS_10170 269457 270905 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_10170 271125 272309 gene locus_tag LOCUS_10180 271125 272309 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 protein_id gnl|my_center|LOCUS_10180 272328 273605 gene locus_tag LOCUS_10190 272328 273605 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805145.1 protein_id gnl|my_center|LOCUS_10190 273602 274858 gene locus_tag LOCUS_10200 gene doeA 273602 274858 CDS product ectoine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805146.1 protein_id gnl|my_center|LOCUS_10200 274866 276227 gene locus_tag LOCUS_10210 274866 276227 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_10210 277989 276568 gene locus_tag LOCUS_10220 277989 276568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 282968 277986 gene locus_tag LOCUS_10230 282968 277986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 283620 283030 gene locus_tag LOCUS_10240 283620 283030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 284330 283626 gene locus_tag LOCUS_10250 284330 283626 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969222.1 protein_id gnl|my_center|LOCUS_10250 284728 284327 gene locus_tag LOCUS_10260 284728 284327 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_10260 284997 284782 gene locus_tag LOCUS_10270 284997 284782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 287465 285186 gene locus_tag LOCUS_10280 gene metE 287465 285186 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114925.1 protein_id gnl|my_center|LOCUS_10280 287578 288486 gene locus_tag LOCUS_10290 287578 288486 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_10290 288711 289961 gene locus_tag LOCUS_10300 288711 289961 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_10300 290058 290465 gene locus_tag LOCUS_10310 290058 290465 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530666.1 protein_id gnl|my_center|LOCUS_10310 290564 290935 gene locus_tag LOCUS_10320 290564 290935 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_10320 290974 291768 gene locus_tag LOCUS_10330 290974 291768 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970229.1 protein_id gnl|my_center|LOCUS_10330 291824 292192 gene locus_tag LOCUS_10340 291824 292192 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_10340 292237 292695 gene locus_tag LOCUS_10350 292237 292695 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_10350 292970 292782 gene locus_tag LOCUS_10360 292970 292782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 293194 293676 gene locus_tag LOCUS_10370 293194 293676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 293678 294280 gene locus_tag LOCUS_10380 293678 294280 CDS product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816099.1 protein_id gnl|my_center|LOCUS_10380 296106 294532 gene locus_tag LOCUS_10390 gene guaA 296106 294532 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105901.1 protein_id gnl|my_center|LOCUS_10390 297649 296180 gene locus_tag LOCUS_10400 gene guaB 297649 296180 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380633.1 protein_id gnl|my_center|LOCUS_10400 297866 299209 gene locus_tag LOCUS_10410 gene xseA 297866 299209 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953156.1 protein_id gnl|my_center|LOCUS_10410 299206 301101 gene locus_tag LOCUS_10420 gene pepF 299206 301101 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_10420 301218 301547 gene locus_tag LOCUS_10430 301218 301547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 301941 303149 gene locus_tag LOCUS_10440 301941 303149 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_10440 303263 303874 gene locus_tag LOCUS_10450 303263 303874 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 protein_id gnl|my_center|LOCUS_10450 303877 305100 gene locus_tag LOCUS_10460 303877 305100 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984073.1 protein_id gnl|my_center|LOCUS_10460 305392 306783 gene locus_tag LOCUS_10470 305392 306783 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_10470 306855 307856 gene locus_tag LOCUS_10480 306855 307856 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_10480 307887 308807 gene locus_tag LOCUS_10490 307887 308807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_10490 308811 310031 gene locus_tag LOCUS_10500 308811 310031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 310083 312578 gene locus_tag LOCUS_10510 gene nirB 310083 312578 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104464.1 protein_id gnl|my_center|LOCUS_10510 312591 312944 gene locus_tag LOCUS_10520 gene nirD 312591 312944 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463771.1 protein_id gnl|my_center|LOCUS_10520 312972 315626 gene locus_tag LOCUS_10530 312972 315626 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973413.1 protein_id gnl|my_center|LOCUS_10530 316013 315861 gene locus_tag LOCUS_10540 316013 315861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 316045 317685 gene locus_tag LOCUS_10550 316045 317685 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_10550 317685 318620 gene locus_tag LOCUS_10560 gene oppB 317685 318620 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210654.1 protein_id gnl|my_center|LOCUS_10560 318620 319504 gene locus_tag LOCUS_10570 318620 319504 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_10570 319913 321169 gene locus_tag LOCUS_10580 319913 321169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 protein_id gnl|my_center|LOCUS_10580 321192 321614 gene locus_tag LOCUS_10590 321192 321614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 323961 321631 gene locus_tag LOCUS_10600 323961 321631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 324240 324052 gene locus_tag LOCUS_10610 324240 324052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 324611 326254 gene locus_tag LOCUS_10620 324611 326254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537707.1 protein_id gnl|my_center|LOCUS_10620 327028 326300 gene locus_tag LOCUS_10630 327028 326300 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181878.1 protein_id gnl|my_center|LOCUS_10630 327946 327068 gene locus_tag LOCUS_10640 327946 327068 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809826.1 protein_id gnl|my_center|LOCUS_10640 329288 328029 gene locus_tag LOCUS_10650 329288 328029 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_10650 329408 330265 gene locus_tag LOCUS_10660 329408 330265 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_10660 330262 330990 gene locus_tag LOCUS_10670 330262 330990 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 protein_id gnl|my_center|LOCUS_10670 331097 331546 gene locus_tag LOCUS_10680 331097 331546 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025263.1 protein_id gnl|my_center|LOCUS_10680 332206 331559 gene locus_tag LOCUS_10690 gene msrA 332206 331559 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_10690 332287 332961 gene locus_tag LOCUS_10700 332287 332961 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 protein_id gnl|my_center|LOCUS_10700 334985 332967 gene locus_tag LOCUS_10710 gene tgpA 334985 332967 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_10710 335971 334982 gene locus_tag LOCUS_10720 335971 334982 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_10720 336966 336049 gene locus_tag LOCUS_10730 336966 336049 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_10730 338209 337007 gene locus_tag LOCUS_10740 338209 337007 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_10740 339750 338209 gene locus_tag LOCUS_10750 gene purF 339750 338209 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 protein_id gnl|my_center|LOCUS_10750 340300 339806 gene locus_tag LOCUS_10760 340300 339806 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_10760 340890 340354 gene locus_tag LOCUS_10770 340890 340354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 342139 340880 gene locus_tag LOCUS_10780 gene folC 342139 340880 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_10780 343010 342117 gene locus_tag LOCUS_10790 gene accD 343010 342117 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_10790 343843 343022 gene locus_tag LOCUS_10800 gene trpA 343843 343022 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_10800 345091 343874 gene locus_tag LOCUS_10810 gene trpB 345091 343874 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 protein_id gnl|my_center|LOCUS_10810 345728 345108 gene locus_tag LOCUS_10820 345728 345108 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_10820 346668 345805 gene locus_tag LOCUS_10830 gene truA 346668 345805 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072966.1 protein_id gnl|my_center|LOCUS_10830 349193 346674 gene locus_tag LOCUS_10840 349193 346674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 350528 349446 gene locus_tag LOCUS_10850 gene asd 350528 349446 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_10850 351692 350619 gene locus_tag LOCUS_10860 gene leuB 351692 350619 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_10860 352352 351705 gene locus_tag LOCUS_10870 gene leuD 352352 351705 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_10870 353785 352349 gene locus_tag LOCUS_10880 gene leuC 353785 352349 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208284.1 protein_id gnl|my_center|LOCUS_10880 353900 354769 gene locus_tag LOCUS_10890 353900 354769 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 protein_id gnl|my_center|LOCUS_10890 356578 354800 gene locus_tag LOCUS_10900 356578 354800 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_10900 357397 356717 gene locus_tag LOCUS_10910 gene trmH 357397 356717 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042026804.1 protein_id gnl|my_center|LOCUS_10910 357535 358452 gene locus_tag LOCUS_10920 357535 358452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence04 <1 950 gene locus_tag LOCUS_10930 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105976.1:integron integrase 1278 982 gene locus_tag LOCUS_10940 1278 982 CDS product PA4642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768817.1 protein_id gnl|my_center|LOCUS_10940 2769 1306 gene locus_tag LOCUS_10950 gene gatB 2769 1306 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 protein_id gnl|my_center|LOCUS_10950 4223 2769 gene locus_tag LOCUS_10960 gene gatA 4223 2769 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766477.1 protein_id gnl|my_center|LOCUS_10960 4526 4239 gene locus_tag LOCUS_10970 gene gatC 4526 4239 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_10970 4769 5803 gene locus_tag LOCUS_10980 gene mreB 4769 5803 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_10980 5907 6713 gene locus_tag LOCUS_10990 gene mreC 5907 6713 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_10990 6700 7209 gene locus_tag LOCUS_11000 6700 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7252 7845 gene locus_tag LOCUS_11010 7252 7845 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_11010 7842 9305 gene locus_tag LOCUS_11020 gene rng 7842 9305 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_11020 9512 13366 gene locus_tag LOCUS_11030 9512 13366 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947481.1 protein_id gnl|my_center|LOCUS_11030 13363 14193 gene locus_tag LOCUS_11040 13363 14193 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766488.1 protein_id gnl|my_center|LOCUS_11040 14211 14720 gene locus_tag LOCUS_11050 14211 14720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 14757 15401 gene locus_tag LOCUS_11060 gene pcp 14757 15401 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015794.1 protein_id gnl|my_center|LOCUS_11060 15948 15481 gene locus_tag LOCUS_11070 gene rlmH 15948 15481 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 protein_id gnl|my_center|LOCUS_11070 16305 15955 gene locus_tag LOCUS_11080 gene rsfS 16305 15955 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_11080 16974 16321 gene locus_tag LOCUS_11090 gene nadD 16974 16321 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_11090 18276 16990 gene locus_tag LOCUS_11100 18276 16990 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208331.1 protein_id gnl|my_center|LOCUS_11100 18342 19235 gene locus_tag LOCUS_11110 18342 19235 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035561.1 protein_id gnl|my_center|LOCUS_11110 19831 19244 gene locus_tag LOCUS_11120 19831 19244 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103257.1 protein_id gnl|my_center|LOCUS_11120 20433 19906 gene locus_tag LOCUS_11130 20433 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 20555 21103 gene locus_tag LOCUS_11140 20555 21103 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073878.1 protein_id gnl|my_center|LOCUS_11140 21100 22170 gene locus_tag LOCUS_11150 21100 22170 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_11150 23445 22192 gene locus_tag LOCUS_11160 gene umuC 23445 22192 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096856.1 protein_id gnl|my_center|LOCUS_11160 23858 23433 gene locus_tag LOCUS_11170 23858 23433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 24648 23965 gene locus_tag LOCUS_11180 24648 23965 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105028.1 protein_id gnl|my_center|LOCUS_11180 25498 24665 gene locus_tag LOCUS_11190 gene fghA 25498 24665 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113869.1 protein_id gnl|my_center|LOCUS_11190 26628 25522 gene locus_tag LOCUS_11200 26628 25522 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815761.1 protein_id gnl|my_center|LOCUS_11200 28365 26734 gene locus_tag LOCUS_11210 28365 26734 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_11210 31036 28490 gene locus_tag LOCUS_11220 31036 28490 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_11220 31409 31128 gene locus_tag LOCUS_11230 31409 31128 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091717.1 protein_id gnl|my_center|LOCUS_11230 31466 32416 gene locus_tag LOCUS_11240 31466 32416 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_11240 32428 32865 gene locus_tag LOCUS_11250 gene dtd 32428 32865 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103447.1 protein_id gnl|my_center|LOCUS_11250 33655 32984 gene locus_tag LOCUS_11260 33655 32984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 34976 33714 gene locus_tag LOCUS_11270 34976 33714 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958118.1 protein_id gnl|my_center|LOCUS_11270 35167 36537 gene locus_tag LOCUS_11280 gene mpl 35167 36537 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266525.1 protein_id gnl|my_center|LOCUS_11280 36524 37132 gene locus_tag LOCUS_11290 36524 37132 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454680.1 protein_id gnl|my_center|LOCUS_11290 37132 37755 gene locus_tag LOCUS_11300 37132 37755 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_11300 38803 37769 gene locus_tag LOCUS_11310 38803 37769 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 protein_id gnl|my_center|LOCUS_11310 39266 38907 gene locus_tag LOCUS_11320 39266 38907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 41580 39301 gene locus_tag LOCUS_11330 41580 39301 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691589.1 protein_id gnl|my_center|LOCUS_11330 42253 41573 gene locus_tag LOCUS_11340 gene ytfE 42253 41573 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 protein_id gnl|my_center|LOCUS_11340 42411 43970 gene locus_tag LOCUS_11350 gene norR 42411 43970 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_11350 44656 43997 gene locus_tag LOCUS_11360 44656 43997 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925860.1 protein_id gnl|my_center|LOCUS_11360 44769 45422 gene locus_tag LOCUS_11370 44769 45422 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_11370 46207 45419 gene locus_tag LOCUS_11380 gene panB 46207 45419 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805455.1 protein_id gnl|my_center|LOCUS_11380 46905 46222 gene locus_tag LOCUS_11390 46905 46222 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_11390 47260 46889 gene locus_tag LOCUS_11400 47260 46889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 48569 47391 gene locus_tag LOCUS_11410 48569 47391 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_11410 48456 48755 gene locus_tag LOCUS_11420 48456 48755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 50556 49186 gene locus_tag LOCUS_11430 gene cbrB 50556 49186 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_11430 51063 50662 gene locus_tag LOCUS_11440 51063 50662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 51163 51483 gene locus_tag LOCUS_11450 51163 51483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 52047 51601 gene locus_tag LOCUS_11460 gene dksA 52047 51601 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095632.1 protein_id gnl|my_center|LOCUS_11460 52300 53460 gene locus_tag LOCUS_11470 52300 53460 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406662.1 protein_id gnl|my_center|LOCUS_11470 53457 54167 gene locus_tag LOCUS_11480 gene sfsA 53457 54167 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406665.1 protein_id gnl|my_center|LOCUS_11480 56274 54172 gene locus_tag LOCUS_11490 gene rep 56274 54172 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110454.1 protein_id gnl|my_center|LOCUS_11490 58077 56290 gene locus_tag LOCUS_11500 58077 56290 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009950383.1 protein_id gnl|my_center|LOCUS_11500 59650 58157 gene locus_tag LOCUS_11510 59650 58157 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481190.1 protein_id gnl|my_center|LOCUS_11510 59975 59718 gene locus_tag LOCUS_11520 59975 59718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 60291 61064 gene locus_tag LOCUS_11530 60291 61064 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_11530 61118 61456 gene locus_tag LOCUS_11540 gene glnK 61118 61456 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_11540 61476 62723 gene locus_tag LOCUS_11550 61476 62723 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_11550 62879 63217 gene locus_tag LOCUS_11560 gene glnK 62879 63217 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_11560 64052 63339 gene locus_tag LOCUS_11570 64052 63339 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300114.1 protein_id gnl|my_center|LOCUS_11570 64993 64142 gene locus_tag LOCUS_11580 gene xerC 64993 64142 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266244.1 protein_id gnl|my_center|LOCUS_11580 65759 65061 gene locus_tag LOCUS_11590 65759 65061 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_11590 66586 65756 gene locus_tag LOCUS_11600 gene dapF 66586 65756 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103038.1 protein_id gnl|my_center|LOCUS_11600 67891 66644 gene locus_tag LOCUS_11610 gene lysA 67891 66644 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_11610 68088 67915 gene locus_tag LOCUS_11620 68088 67915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 68207 68539 gene locus_tag LOCUS_11630 gene cyaY 68207 68539 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459084.1 protein_id gnl|my_center|LOCUS_11630 68786 69400 gene locus_tag LOCUS_11640 68786 69400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 70397 69354 gene locus_tag LOCUS_11650 70397 69354 CDS product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104652.1 protein_id gnl|my_center|LOCUS_11650 71332 70394 gene locus_tag LOCUS_11660 71332 70394 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_11660 72777 71332 gene locus_tag LOCUS_11670 72777 71332 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_11670 74371 72971 gene locus_tag LOCUS_11680 gene argH 74371 72971 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_11680 74489 75565 gene locus_tag LOCUS_11690 gene algZ 74489 75565 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_11690 75577 76314 gene locus_tag LOCUS_11700 gene algR 75577 76314 CDS product alginate biosynthesis regulator AlgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096397.1 protein_id gnl|my_center|LOCUS_11700 76327 77346 gene locus_tag LOCUS_11710 gene hemC 76327 77346 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_11710 77357 78118 gene locus_tag LOCUS_11720 77357 78118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 78241 79467 gene locus_tag LOCUS_11730 78241 79467 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704440.1 protein_id gnl|my_center|LOCUS_11730 79464 80678 gene locus_tag LOCUS_11740 79464 80678 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_11740 82313 80754 gene locus_tag LOCUS_11750 82313 80754 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613653.1 protein_id gnl|my_center|LOCUS_11750 83291 82401 gene locus_tag LOCUS_11760 gene hslO 83291 82401 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613652.1 protein_id gnl|my_center|LOCUS_11760 83822 83385 gene locus_tag LOCUS_11770 83822 83385 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_11770 84226 83819 gene locus_tag LOCUS_11780 84226 83819 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895698.1 protein_id gnl|my_center|LOCUS_11780 84878 84219 gene locus_tag LOCUS_11790 gene yrfG 84878 84219 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343604.1 protein_id gnl|my_center|LOCUS_11790 84919 85479 gene locus_tag LOCUS_11800 gene nudE 84919 85479 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_11800 85476 86315 gene locus_tag LOCUS_11810 gene cysQ 85476 86315 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269324.1 protein_id gnl|my_center|LOCUS_11810 88790 86307 gene locus_tag LOCUS_11820 88790 86307 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114576.1 protein_id gnl|my_center|LOCUS_11820 88925 89992 gene locus_tag LOCUS_11830 88925 89992 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_11830 89994 90581 gene locus_tag LOCUS_11840 89994 90581 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765503.1 protein_id gnl|my_center|LOCUS_11840 90581 91192 gene locus_tag LOCUS_11850 gene pilO 90581 91192 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_11850 91196 91732 gene locus_tag LOCUS_11860 gene pilP 91196 91732 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_11860 91756 93903 gene locus_tag LOCUS_11870 91756 93903 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_11870 93903 94427 gene locus_tag LOCUS_11880 gene aroK 93903 94427 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_11880 94475 95560 gene locus_tag LOCUS_11890 gene aroB 94475 95560 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_11890 95745 100199 gene locus_tag LOCUS_11900 gene gltB 95745 100199 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_11900 100228 101646 gene locus_tag LOCUS_11910 100228 101646 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_11910 101803 102729 gene locus_tag LOCUS_11920 gene hemE 101803 102729 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403024.1 protein_id gnl|my_center|LOCUS_11920 102891 104303 gene locus_tag LOCUS_11930 102891 104303 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706434.1 protein_id gnl|my_center|LOCUS_11930 105177 104332 gene locus_tag LOCUS_11940 gene asd 105177 104332 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063853.1 protein_id gnl|my_center|LOCUS_11940 105986 105174 gene locus_tag LOCUS_11950 105986 105174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 107058 106039 gene locus_tag LOCUS_11960 gene rsgA 107058 106039 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_11960 107124 108215 gene locus_tag LOCUS_11970 107124 108215 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021055.1 protein_id gnl|my_center|LOCUS_11970 108208 108783 gene locus_tag LOCUS_11980 gene orn 108208 108783 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099436.1 protein_id gnl|my_center|LOCUS_11980 109946 108834 gene locus_tag LOCUS_11990 gene queG 109946 108834 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244608.1 protein_id gnl|my_center|LOCUS_11990 110012 111505 gene locus_tag LOCUS_12000 110012 111505 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148264.1 protein_id gnl|my_center|LOCUS_12000 111502 111975 gene locus_tag LOCUS_12010 gene tsaE 111502 111975 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095283.1 protein_id gnl|my_center|LOCUS_12010 111986 113314 gene locus_tag LOCUS_12020 gene amiB 111986 113314 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_12020 113325 115121 gene locus_tag LOCUS_12030 gene mutL 113325 115121 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_12030 115125 115550 gene locus_tag LOCUS_12040 115125 115550 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946562.1 protein_id gnl|my_center|LOCUS_12040 116952 115705 gene locus_tag LOCUS_12050 116952 115705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 117019 118272 gene locus_tag LOCUS_12060 gene serB 117019 118272 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_12060 120360 118273 gene locus_tag LOCUS_12070 120360 118273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 121567 120560 gene locus_tag LOCUS_12080 gene epmB 121567 120560 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_12080 121614 122177 gene locus_tag LOCUS_12090 gene efp 121614 122177 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_12090 122301 123257 gene locus_tag LOCUS_12100 gene epmA 122301 123257 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065622721.1 protein_id gnl|my_center|LOCUS_12100 123250 124251 gene locus_tag LOCUS_12110 gene miaA 123250 124251 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280343.1 protein_id gnl|my_center|LOCUS_12110 124356 124604 gene locus_tag LOCUS_12120 gene hfq 124356 124604 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_12120 124617 125939 gene locus_tag LOCUS_12130 gene hflX 124617 125939 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_12130 126094 127224 gene locus_tag LOCUS_12140 gene hflK 126094 127224 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_12140 127224 128096 gene locus_tag LOCUS_12150 gene hflC 127224 128096 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_12150 128240 128428 gene locus_tag LOCUS_12160 128240 128428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 128431 129612 gene locus_tag LOCUS_12170 128431 129612 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_12170 129640 130935 gene locus_tag LOCUS_12180 129640 130935 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_12180 131065 131475 gene locus_tag LOCUS_12190 131065 131475 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870436.1 protein_id gnl|my_center|LOCUS_12190 131543 131920 gene locus_tag LOCUS_12200 131543 131920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 131963 132280 gene locus_tag LOCUS_12210 131963 132280 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_12210 132837 132277 gene locus_tag LOCUS_12220 132837 132277 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421963.1 protein_id gnl|my_center|LOCUS_12220 132910 133524 gene locus_tag LOCUS_12230 132910 133524 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 protein_id gnl|my_center|LOCUS_12230 133593 133775 gene locus_tag LOCUS_12240 133593 133775 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092660.1 protein_id gnl|my_center|LOCUS_12240 135017 133800 gene locus_tag LOCUS_12250 135017 133800 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_12250 136045 135257 gene locus_tag LOCUS_12260 136045 135257 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_12260 136179 137582 gene locus_tag LOCUS_12270 gene ffh 136179 137582 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092645.1 protein_id gnl|my_center|LOCUS_12270 137795 138043 gene locus_tag LOCUS_12280 gene rpsP 137795 138043 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209458.1 protein_id gnl|my_center|LOCUS_12280 138057 138596 gene locus_tag LOCUS_12290 gene rimM 138057 138596 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_12290 138632 139381 gene locus_tag LOCUS_12300 gene trmD 138632 139381 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 protein_id gnl|my_center|LOCUS_12300 139456 139812 gene locus_tag LOCUS_12310 gene rplS 139456 139812 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_12310 139938 140840 gene locus_tag LOCUS_12320 gene xerD 139938 140840 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_12320 140910 141665 gene locus_tag LOCUS_12330 gene dsbC 140910 141665 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_12330 141892 143196 gene locus_tag LOCUS_12340 141892 143196 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_12340 143232 144632 gene locus_tag LOCUS_12350 gene thrC 143232 144632 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 protein_id gnl|my_center|LOCUS_12350 146701 144656 gene locus_tag LOCUS_12360 gene ppk1 146701 144656 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706631.1 protein_id gnl|my_center|LOCUS_12360 147147 147908 gene locus_tag LOCUS_12370 147147 147908 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118774.1 protein_id gnl|my_center|LOCUS_12370 148300 150519 gene locus_tag LOCUS_12380 148300 150519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 151876 150593 gene locus_tag LOCUS_12390 151876 150593 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 protein_id gnl|my_center|LOCUS_12390 153846 151873 gene locus_tag LOCUS_12400 153846 151873 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947325.1 protein_id gnl|my_center|LOCUS_12400 153979 155730 gene locus_tag LOCUS_12410 gene recJ 153979 155730 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_12410 155803 156783 gene locus_tag LOCUS_12420 155803 156783 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_12420 156875 157129 gene locus_tag LOCUS_12430 156875 157129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 157427 158386 gene locus_tag LOCUS_12440 gene cas1f 157427 158386 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_12440 158383 161772 gene locus_tag LOCUS_12450 gene cas3f 158383 161772 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_12450 161774 163339 gene locus_tag LOCUS_12460 161774 163339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 163336 164277 gene locus_tag LOCUS_12470 gene csy2 163336 164277 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 protein_id gnl|my_center|LOCUS_12470 164298 165332 gene locus_tag LOCUS_12480 gene csy3 164298 165332 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 protein_id gnl|my_center|LOCUS_12480 165344 165895 gene locus_tag LOCUS_12490 gene cas6f 165344 165895 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769530.1 protein_id gnl|my_center|LOCUS_12490 166026 166274 gene locus_tag LOCUS_12500 166026 166274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 166271 166696 gene locus_tag LOCUS_12510 166271 166696 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_12510 166987 170313 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcacaggcagcttagaaa 170541 171029 gene locus_tag LOCUS_12520 170541 171029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 171506 171123 gene locus_tag LOCUS_12530 171506 171123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 173700 171802 gene locus_tag LOCUS_12540 173700 171802 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_12540 174385 173771 gene locus_tag LOCUS_12550 gene tesA 174385 173771 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_12550 174455 175144 gene locus_tag LOCUS_12560 174455 175144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_12560 175144 177648 gene locus_tag LOCUS_12570 175144 177648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765750.1 protein_id gnl|my_center|LOCUS_12570 178034 177654 gene locus_tag LOCUS_12580 178034 177654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 178453 179352 gene locus_tag LOCUS_12590 gene prfB 178453 179352 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096059895.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12590 179398 180924 gene locus_tag LOCUS_12600 gene lysS 179398 180924 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113846.1 protein_id gnl|my_center|LOCUS_12600 181109 182302 gene locus_tag LOCUS_12610 181109 182302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 185116 182327 gene locus_tag LOCUS_12620 185116 182327 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 protein_id gnl|my_center|LOCUS_12620 185613 185209 gene locus_tag LOCUS_12630 185613 185209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 186091 185666 gene locus_tag LOCUS_12640 186091 185666 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707423.1 protein_id gnl|my_center|LOCUS_12640 187575 186088 gene locus_tag LOCUS_12650 187575 186088 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_12650 187683 188810 gene locus_tag LOCUS_12660 gene lptF 187683 188810 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316899.1 protein_id gnl|my_center|LOCUS_12660 188807 189895 gene locus_tag LOCUS_12670 gene lptG 188807 189895 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_12670 190415 189924 gene locus_tag LOCUS_12680 190415 189924 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035894.1 protein_id gnl|my_center|LOCUS_12680 191345 190713 gene locus_tag LOCUS_12690 191345 190713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 191482 192135 gene locus_tag LOCUS_12700 191482 192135 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_12700 192184 192459 gene locus_tag LOCUS_12710 192184 192459 CDS product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036767.1 protein_id gnl|my_center|LOCUS_12710 193365 192490 gene locus_tag LOCUS_12720 193365 192490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 193898 193443 gene locus_tag LOCUS_12730 193898 193443 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_12730 194411 194325 gene locus_tag LOCUS_t00060 194411 194325 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 194473 195594 gene locus_tag LOCUS_12740 gene queA 194473 195594 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705623.1 protein_id gnl|my_center|LOCUS_12740 195591 196718 gene locus_tag LOCUS_12750 gene tgt 195591 196718 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 protein_id gnl|my_center|LOCUS_12750 196842 198695 gene locus_tag LOCUS_12760 gene secD 196842 198695 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100609.1 protein_id gnl|my_center|LOCUS_12760 198705 199625 gene locus_tag LOCUS_12770 gene secF 198705 199625 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_12770 199786 199998 gene locus_tag LOCUS_12780 199786 199998 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_12780 200710 200129 gene locus_tag LOCUS_12790 200710 200129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 202428 200707 gene locus_tag LOCUS_12800 202428 200707 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_12800 202514 202942 gene locus_tag LOCUS_12810 202514 202942 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406157.1 protein_id gnl|my_center|LOCUS_12810 203087 203371 gene locus_tag LOCUS_12820 203087 203371 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807023.1 protein_id gnl|my_center|LOCUS_12820 203429 205204 gene locus_tag LOCUS_12830 gene aspS 203429 205204 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554661.1 protein_id gnl|my_center|LOCUS_12830 205295 206041 gene locus_tag LOCUS_12840 205295 206041 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086107.1 protein_id gnl|my_center|LOCUS_12840 206119 206475 gene locus_tag LOCUS_12850 206119 206475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 206617 207135 gene locus_tag LOCUS_12860 gene ruvC 206617 207135 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112575.1 protein_id gnl|my_center|LOCUS_12860 207169 207771 gene locus_tag LOCUS_12870 gene ruvA 207169 207771 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707372.1 protein_id gnl|my_center|LOCUS_12870 207795 208832 gene locus_tag LOCUS_12880 gene ruvB 207795 208832 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_12880 208829 209230 gene locus_tag LOCUS_12890 gene ybgC 208829 209230 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 protein_id gnl|my_center|LOCUS_12890 209252 209923 gene locus_tag LOCUS_12900 gene tolQ 209252 209923 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_12900 209923 210360 gene locus_tag LOCUS_12910 gene tolR 209923 210360 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_12910 210366 211079 gene locus_tag LOCUS_12920 210366 211079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 211083 212369 gene locus_tag LOCUS_12930 gene tolB 211083 212369 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112572.1 protein_id gnl|my_center|LOCUS_12930 212400 212906 gene locus_tag LOCUS_12940 gene pal 212400 212906 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314369.1 protein_id gnl|my_center|LOCUS_12940 213016 213795 gene locus_tag LOCUS_12950 213016 213795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 213863 214513 gene locus_tag LOCUS_12960 gene queE 213863 214513 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_12960 214514 215206 gene locus_tag LOCUS_12970 gene queC 214514 215206 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 protein_id gnl|my_center|LOCUS_12970 215254 215329 gene locus_tag LOCUS_t00070 215254 215329 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 215787 216863 gene locus_tag LOCUS_12980 gene nadA 215787 216863 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115913.1 protein_id gnl|my_center|LOCUS_12980 218363 216912 gene locus_tag LOCUS_12990 218363 216912 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767670.1 protein_id gnl|my_center|LOCUS_12990 218582 219652 gene locus_tag LOCUS_13000 218582 219652 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_13000 219676 222498 gene locus_tag LOCUS_13010 219676 222498 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_13010 222725 225373 gene locus_tag LOCUS_13020 gene aceE 222725 225373 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_13020 225389 227158 gene locus_tag LOCUS_13030 gene aceF 225389 227158 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 protein_id gnl|my_center|LOCUS_13030 227315 227770 gene locus_tag LOCUS_13040 227315 227770 CDS product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531820.1 protein_id gnl|my_center|LOCUS_13040 229750 227936 gene locus_tag LOCUS_13050 229750 227936 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_13050 230305 229856 gene locus_tag LOCUS_13060 230305 229856 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704516.1 protein_id gnl|my_center|LOCUS_13060 231787 230327 gene locus_tag LOCUS_13070 231787 230327 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_13070 233622 231898 gene locus_tag LOCUS_13080 233622 231898 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_13080 234452 233736 gene locus_tag LOCUS_13090 234452 233736 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_13090 235128 234442 gene locus_tag LOCUS_13100 gene rsxG 235128 234442 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_13100 236192 235125 gene locus_tag LOCUS_13110 236192 235125 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 protein_id gnl|my_center|LOCUS_13110 238715 236205 gene locus_tag LOCUS_13120 238715 236205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 239344 238712 gene locus_tag LOCUS_13130 gene rsxB 239344 238712 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 protein_id gnl|my_center|LOCUS_13130 239929 239354 gene locus_tag LOCUS_13140 gene rsxA 239929 239354 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092041.1 protein_id gnl|my_center|LOCUS_13140 242127 240106 gene locus_tag LOCUS_13150 gene metG 242127 240106 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113898.1 protein_id gnl|my_center|LOCUS_13150 242256 243083 gene locus_tag LOCUS_13160 242256 243083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 243241 243813 gene locus_tag LOCUS_13170 gene dcd 243241 243813 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381535.1 protein_id gnl|my_center|LOCUS_13170 244227 243856 gene locus_tag LOCUS_13180 244227 243856 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_13180 244385 244924 gene locus_tag LOCUS_13190 244385 244924 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877414.1 protein_id gnl|my_center|LOCUS_13190 245199 245834 gene locus_tag LOCUS_13200 245199 245834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 247932 245884 gene locus_tag LOCUS_13210 247932 245884 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074224.1 protein_id gnl|my_center|LOCUS_13210 248132 249166 gene locus_tag LOCUS_13220 248132 249166 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456452.1 protein_id gnl|my_center|LOCUS_13220 251479 249323 gene locus_tag LOCUS_13230 251479 249323 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941205.1 protein_id gnl|my_center|LOCUS_13230 252396 251527 gene locus_tag LOCUS_13240 252396 251527 CDS product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_13240 252648 252400 gene locus_tag LOCUS_13250 252648 252400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 253413 252667 gene locus_tag LOCUS_13260 253413 252667 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_13260 254158 253496 gene locus_tag LOCUS_13270 gene purN 254158 253496 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209778.1 protein_id gnl|my_center|LOCUS_13270 255216 254164 gene locus_tag LOCUS_13280 gene purM 255216 254164 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381585.1 protein_id gnl|my_center|LOCUS_13280 255328 256428 gene locus_tag LOCUS_13290 255328 256428 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_13290 256429 257133 gene locus_tag LOCUS_13300 gene hda 256429 257133 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369632.1 protein_id gnl|my_center|LOCUS_13300 257672 257190 gene locus_tag LOCUS_13310 257672 257190 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268596.1 protein_id gnl|my_center|LOCUS_13310 257768 258112 gene locus_tag LOCUS_13320 gene arsC 257768 258112 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103671.1 protein_id gnl|my_center|LOCUS_13320 258112 258705 gene locus_tag LOCUS_13330 gene wrbA 258112 258705 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115189.1 protein_id gnl|my_center|LOCUS_13330 258702 259124 gene locus_tag LOCUS_13340 258702 259124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 259121 260974 gene locus_tag LOCUS_13350 gene sppA 259121 260974 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707123.1 protein_id gnl|my_center|LOCUS_13350 261387 261064 gene locus_tag LOCUS_13360 261387 261064 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_13360 264094 261512 gene locus_tag LOCUS_13370 gene mutS 264094 261512 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_13370 264338 265285 gene locus_tag LOCUS_13380 264338 265285 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_13380 265470 266615 gene locus_tag LOCUS_13390 gene rlmD 265470 266615 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167240.1 protein_id gnl|my_center|LOCUS_13390 266669 267157 gene locus_tag LOCUS_13400 gene pncC 266669 267157 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167419.1 protein_id gnl|my_center|LOCUS_13400 267240 268289 gene locus_tag LOCUS_13410 gene recA 267240 268289 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 protein_id gnl|my_center|LOCUS_13410 268457 269224 gene locus_tag LOCUS_13420 268457 269224 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947815.1 protein_id gnl|my_center|LOCUS_13420 269299 269979 gene locus_tag LOCUS_13430 269299 269979 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_13430 269976 270455 gene locus_tag LOCUS_13440 269976 270455 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957973.1 protein_id gnl|my_center|LOCUS_13440 271428 270427 gene locus_tag LOCUS_13450 271428 270427 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_13450 271536 271967 gene locus_tag LOCUS_13460 271536 271967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 272006 272839 gene locus_tag LOCUS_13470 272006 272839 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_13470 272939 273133 gene locus_tag LOCUS_13480 272939 273133 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381112.1 protein_id gnl|my_center|LOCUS_13480 273151 273501 gene locus_tag LOCUS_13490 273151 273501 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_13490 273563 276163 gene locus_tag LOCUS_13500 gene alaS 273563 276163 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_13500 276254 277486 gene locus_tag LOCUS_13510 276254 277486 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_13510 277656 277835 gene locus_tag LOCUS_13520 gene csrA 277656 277835 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 protein_id gnl|my_center|LOCUS_13520 278221 278311 gene locus_tag LOCUS_t00080 278221 278311 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 279007 278576 gene locus_tag LOCUS_13530 279007 278576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 279298 279077 gene locus_tag LOCUS_13540 279298 279077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 279943 279407 gene locus_tag LOCUS_13550 279943 279407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 280298 280765 gene locus_tag LOCUS_13560 280298 280765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 281172 283106 gene locus_tag LOCUS_13570 281172 283106 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089915.1 protein_id gnl|my_center|LOCUS_13570 283106 283510 gene locus_tag LOCUS_13580 283106 283510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 283566 285716 gene locus_tag LOCUS_13590 283566 285716 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827278.1 protein_id gnl|my_center|LOCUS_13590 285739 288015 gene locus_tag LOCUS_13600 285739 288015 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969299.1 protein_id gnl|my_center|LOCUS_13600 288017 288877 gene locus_tag LOCUS_13610 288017 288877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 288906 290471 gene locus_tag LOCUS_13620 288906 290471 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807889.1 protein_id gnl|my_center|LOCUS_13620 290563 291828 gene locus_tag LOCUS_13630 290563 291828 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_13630 292092 292814 gene locus_tag LOCUS_13640 gene phbB 292092 292814 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_13640 294900 292885 gene locus_tag LOCUS_13650 294900 292885 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086466.1 protein_id gnl|my_center|LOCUS_13650 295228 294968 gene locus_tag LOCUS_13660 295228 294968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 295502 297313 gene locus_tag LOCUS_13670 295502 297313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 297398 298846 gene locus_tag LOCUS_13680 297398 298846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 299021 300172 gene locus_tag LOCUS_13690 299021 300172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 300259 302607 gene locus_tag LOCUS_13700 300259 302607 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_13700 302833 303117 gene locus_tag LOCUS_13710 302833 303117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 304815 303187 gene locus_tag LOCUS_13720 gene pgi 304815 303187 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_13720 305948 304941 gene locus_tag LOCUS_13730 gene gap 305948 304941 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114837.1 protein_id gnl|my_center|LOCUS_13730 306108 306184 gene locus_tag LOCUS_t00090 306108 306184 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 306753 308240 gene locus_tag LOCUS_13740 306753 308240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13740 308233 309606 gene locus_tag LOCUS_13750 308233 309606 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_13750 309775 310158 gene locus_tag LOCUS_13760 309775 310158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 311752 310307 gene locus_tag LOCUS_13770 311752 310307 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860275.1 protein_id gnl|my_center|LOCUS_13770 315346 311831 gene locus_tag LOCUS_13780 315346 311831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 317082 315343 gene locus_tag LOCUS_13790 317082 315343 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402770.1 protein_id gnl|my_center|LOCUS_13790 317428 318543 gene locus_tag LOCUS_13800 gene ald 317428 318543 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_13800 318692 319219 gene locus_tag LOCUS_13810 gene fldA 318692 319219 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705429.1 protein_id gnl|my_center|LOCUS_13810 320219 319242 gene locus_tag LOCUS_13820 gene cmoB 320219 319242 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405349.1 protein_id gnl|my_center|LOCUS_13820 320987 320256 gene locus_tag LOCUS_13830 gene cmoA 320987 320256 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068374.1 protein_id gnl|my_center|LOCUS_13830 321391 320984 gene locus_tag LOCUS_13840 321391 320984 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_13840 324309 321391 gene locus_tag LOCUS_13850 324309 321391 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_13850 325356 324391 gene locus_tag LOCUS_13860 325356 324391 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 protein_id gnl|my_center|LOCUS_13860 327591 325492 gene locus_tag LOCUS_13870 327591 325492 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence05 230 556 gene locus_tag LOCUS_13880 230 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 939 2285 gene locus_tag LOCUS_13890 939 2285 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_13890 2986 2351 gene locus_tag LOCUS_13900 2986 2351 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 protein_id gnl|my_center|LOCUS_13900 3905 3192 gene locus_tag LOCUS_13910 3905 3192 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266363.1 protein_id gnl|my_center|LOCUS_13910 4212 4808 gene locus_tag LOCUS_13920 4212 4808 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261307.1 protein_id gnl|my_center|LOCUS_13920 5018 4942 gene locus_tag LOCUS_t00100 5018 4942 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5933 5151 gene locus_tag LOCUS_13930 5933 5151 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_13930 7864 6008 gene locus_tag LOCUS_13940 7864 6008 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_13940 8437 7961 gene locus_tag LOCUS_13950 8437 7961 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_13950 8644 9429 gene locus_tag LOCUS_13960 gene cmoM 8644 9429 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706222.1 protein_id gnl|my_center|LOCUS_13960 9896 9426 gene locus_tag LOCUS_13970 9896 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11337 10012 gene locus_tag LOCUS_13980 gene yegQ 11337 10012 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704950.1 protein_id gnl|my_center|LOCUS_13980 12754 11498 gene locus_tag LOCUS_13990 gene phaZ 12754 11498 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390504.1 protein_id gnl|my_center|LOCUS_13990 15473 12864 gene locus_tag LOCUS_14000 gene acnB 15473 12864 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087875.1 protein_id gnl|my_center|LOCUS_14000 15727 16404 gene locus_tag LOCUS_14010 15727 16404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 16437 17102 gene locus_tag LOCUS_14020 16437 17102 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_14020 17212 18843 gene locus_tag LOCUS_14030 17212 18843 CDS product dihydroorotate dehydrogenase/oxidoreductase, FAD-binding inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682296.1 protein_id gnl|my_center|LOCUS_14030 18977 20119 gene locus_tag LOCUS_14040 18977 20119 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384341.1 protein_id gnl|my_center|LOCUS_14040 20112 20816 gene locus_tag LOCUS_14050 20112 20816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_14050 20788 21999 gene locus_tag LOCUS_14060 20788 21999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_14060 21996 23192 gene locus_tag LOCUS_14070 21996 23192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_14070 23924 23202 gene locus_tag LOCUS_14080 gene lpxH 23924 23202 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212254.1 protein_id gnl|my_center|LOCUS_14080 24483 23974 gene locus_tag LOCUS_14090 24483 23974 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631302.1 protein_id gnl|my_center|LOCUS_14090 25494 24595 gene locus_tag LOCUS_14100 25494 24595 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_14100 25663 27372 gene locus_tag LOCUS_14110 25663 27372 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_14110 27406 28821 gene locus_tag LOCUS_14120 gene cysS 27406 28821 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_14120 28880 29761 gene locus_tag LOCUS_14130 28880 29761 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 protein_id gnl|my_center|LOCUS_14130 30049 30744 gene locus_tag LOCUS_14140 30049 30744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 30849 32105 gene locus_tag LOCUS_14150 30849 32105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 32388 33851 gene locus_tag LOCUS_14160 32388 33851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 35010 34504 gene locus_tag LOCUS_14170 35010 34504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 35524 35808 gene locus_tag LOCUS_14180 35524 35808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 35987 36586 gene locus_tag LOCUS_14190 35987 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 36869 37531 gene locus_tag LOCUS_14200 36869 37531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 38010 38810 gene locus_tag LOCUS_14210 38010 38810 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192554.1 protein_id gnl|my_center|LOCUS_14210 40206 39292 gene locus_tag LOCUS_14220 40206 39292 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266700.1 protein_id gnl|my_center|LOCUS_14220 40482 41912 gene locus_tag LOCUS_14230 gene glpK 40482 41912 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919105.1 protein_id gnl|my_center|LOCUS_14230 43130 41925 gene locus_tag LOCUS_14240 43130 41925 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_14240 43873 43133 gene locus_tag LOCUS_14250 43873 43133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 44852 43959 gene locus_tag LOCUS_14260 gene folD 44852 43959 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 protein_id gnl|my_center|LOCUS_14260 44970 45046 gene locus_tag LOCUS_t00110 44970 45046 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45084 45160 gene locus_tag LOCUS_t00120 45084 45160 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45198 45273 gene locus_tag LOCUS_t00130 45198 45273 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 46449 47021 gene locus_tag LOCUS_14270 46449 47021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 47717 47944 gene locus_tag LOCUS_14280 47717 47944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 48285 48476 gene locus_tag LOCUS_14290 48285 48476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 48715 49932 gene locus_tag LOCUS_14300 48715 49932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 50220 51893 gene locus_tag LOCUS_14310 50220 51893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 54260 51933 gene locus_tag LOCUS_14320 54260 51933 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_14320 54359 55033 gene locus_tag LOCUS_14330 54359 55033 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_14330 55184 57334 gene locus_tag LOCUS_14340 gene fadB 55184 57334 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704165.1 protein_id gnl|my_center|LOCUS_14340 57367 58545 gene locus_tag LOCUS_14350 gene fadA 57367 58545 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113978.1 protein_id gnl|my_center|LOCUS_14350 59037 58663 gene locus_tag LOCUS_14360 59037 58663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 59267 60619 gene locus_tag LOCUS_14370 59267 60619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 60752 60836 gene locus_tag LOCUS_t00140 60752 60836 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60876 62201 gene locus_tag LOCUS_14380 gene tig 60876 62201 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_14380 62385 63017 gene locus_tag LOCUS_14390 gene clpP 62385 63017 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_14390 63123 64412 gene locus_tag LOCUS_14400 gene clpX 63123 64412 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_14400 64562 66973 gene locus_tag LOCUS_14410 gene lon 64562 66973 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_14410 67057 67377 gene locus_tag LOCUS_14420 gene hupB 67057 67377 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_14420 67488 69365 gene locus_tag LOCUS_14430 67488 69365 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_14430 69509 70927 gene locus_tag LOCUS_14440 gene sthA 69509 70927 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_14440 71289 70981 gene locus_tag LOCUS_14450 71289 70981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 71475 72719 gene locus_tag LOCUS_14460 71475 72719 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771340.1 protein_id gnl|my_center|LOCUS_14460 72709 73428 gene locus_tag LOCUS_14470 gene lolD 72709 73428 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061290.1 protein_id gnl|my_center|LOCUS_14470 73435 74670 gene locus_tag LOCUS_14480 73435 74670 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244213.1 protein_id gnl|my_center|LOCUS_14480 75239 74685 gene locus_tag LOCUS_14490 75239 74685 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481854.1 protein_id gnl|my_center|LOCUS_14490 75415 76947 gene locus_tag LOCUS_14500 75415 76947 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_14500 77004 78506 gene locus_tag LOCUS_14510 77004 78506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731144.1 protein_id gnl|my_center|LOCUS_14510 78503 79579 gene locus_tag LOCUS_14520 78503 79579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 80311 79604 gene locus_tag LOCUS_14530 gene cobB 80311 79604 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 protein_id gnl|my_center|LOCUS_14530 80425 81399 gene locus_tag LOCUS_14540 gene arsS 80425 81399 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_14540 81399 82073 gene locus_tag LOCUS_14550 81399 82073 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_14550 82070 82717 gene locus_tag LOCUS_14560 82070 82717 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_14560 82836 83024 gene locus_tag LOCUS_14570 82836 83024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 83127 83765 gene locus_tag LOCUS_14580 gene ccmA 83127 83765 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 protein_id gnl|my_center|LOCUS_14580 83768 84439 gene locus_tag LOCUS_14590 gene ccmB 83768 84439 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_14590 84483 85226 gene locus_tag LOCUS_14600 84483 85226 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 protein_id gnl|my_center|LOCUS_14600 85233 85445 gene locus_tag LOCUS_14610 gene ccmD 85233 85445 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083136.1 protein_id gnl|my_center|LOCUS_14610 85481 85939 gene locus_tag LOCUS_14620 gene ccmE 85481 85939 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_14620 85963 87936 gene locus_tag LOCUS_14630 85963 87936 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_14630 87983 88477 gene locus_tag LOCUS_14640 gene dsbE 87983 88477 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083138.1 protein_id gnl|my_center|LOCUS_14640 88491 88862 gene locus_tag LOCUS_14650 88491 88862 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243700.1 protein_id gnl|my_center|LOCUS_14650 88982 89542 gene locus_tag LOCUS_14660 88982 89542 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_14660 89539 90729 gene locus_tag LOCUS_14670 gene ccmI 89539 90729 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_14670 90860 94360 gene locus_tag LOCUS_14680 gene smc 90860 94360 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_14680 94470 95468 gene locus_tag LOCUS_14690 gene zipA 94470 95468 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083352.1 protein_id gnl|my_center|LOCUS_14690 95468 97501 gene locus_tag LOCUS_14700 gene ligA 95468 97501 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 protein_id gnl|my_center|LOCUS_14700 97581 98822 gene locus_tag LOCUS_14710 97581 98822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 99619 98828 gene locus_tag LOCUS_14720 99619 98828 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_14720 99660 100025 gene locus_tag LOCUS_14730 99660 100025 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_14730 100841 100056 gene locus_tag LOCUS_14740 100841 100056 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_14740 101414 100845 gene locus_tag LOCUS_14750 gene ppiA 101414 100845 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 protein_id gnl|my_center|LOCUS_14750 102090 101419 gene locus_tag LOCUS_14760 102090 101419 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125332.1 protein_id gnl|my_center|LOCUS_14760 102416 102117 gene locus_tag LOCUS_14770 102416 102117 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_14770 103161 102421 gene locus_tag LOCUS_14780 103161 102421 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_14780 103387 105186 gene locus_tag LOCUS_14790 gene ilvB 103387 105186 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393741.1 protein_id gnl|my_center|LOCUS_14790 105189 106007 gene locus_tag LOCUS_14800 105189 106007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 106010 106810 gene locus_tag LOCUS_14810 106010 106810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 106847 108952 gene locus_tag LOCUS_14820 106847 108952 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097643.1 protein_id gnl|my_center|LOCUS_14820 109061 109933 gene locus_tag LOCUS_14830 109061 109933 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942090.1 protein_id gnl|my_center|LOCUS_14830 109944 114407 gene locus_tag LOCUS_14840 109944 114407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 114540 115163 gene locus_tag LOCUS_14850 114540 115163 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_14850 115259 116107 gene locus_tag LOCUS_14860 115259 116107 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 protein_id gnl|my_center|LOCUS_14860 116131 116829 gene locus_tag LOCUS_14870 116131 116829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 116829 117656 gene locus_tag LOCUS_14880 116829 117656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 117692 117931 gene locus_tag LOCUS_14890 117692 117931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 118697 117951 gene locus_tag LOCUS_14900 118697 117951 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 protein_id gnl|my_center|LOCUS_14900 119373 118666 gene locus_tag LOCUS_14910 gene mupP 119373 118666 CDS product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895650.1 protein_id gnl|my_center|LOCUS_14910 120118 119390 gene locus_tag LOCUS_14920 120118 119390 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_14920 121464 120139 gene locus_tag LOCUS_14930 121464 120139 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_14930 121642 124200 gene locus_tag LOCUS_14940 gene gyrA 121642 124200 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 protein_id gnl|my_center|LOCUS_14940 124213 125298 gene locus_tag LOCUS_14950 gene pheA 124213 125298 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091446.1 protein_id gnl|my_center|LOCUS_14950 125320 126435 gene locus_tag LOCUS_14960 gene hisC 125320 126435 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_14960 126435 128654 gene locus_tag LOCUS_14970 126435 128654 CDS product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 protein_id gnl|my_center|LOCUS_14970 128651 129349 gene locus_tag LOCUS_14980 gene cmk 128651 129349 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616463.1 protein_id gnl|my_center|LOCUS_14980 129465 131147 gene locus_tag LOCUS_14990 gene rpsA 129465 131147 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_14990 131203 131496 gene locus_tag LOCUS_15000 gene ihfB 131203 131496 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091441.1 protein_id gnl|my_center|LOCUS_15000 131597 131890 gene locus_tag LOCUS_15010 131597 131890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 131904 133094 gene locus_tag LOCUS_15020 gene lapB 131904 133094 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_15020 133135 133842 gene locus_tag LOCUS_15030 gene pyrF 133135 133842 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217549.1 protein_id gnl|my_center|LOCUS_15030 133904 134218 gene locus_tag LOCUS_15040 133904 134218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 134283 134705 gene locus_tag LOCUS_15050 134283 134705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 135980 134736 gene locus_tag LOCUS_15060 135980 134736 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_15060 136794 135967 gene locus_tag LOCUS_15070 136794 135967 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_15070 138202 136787 gene locus_tag LOCUS_15080 138202 136787 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_15080 138337 138957 gene locus_tag LOCUS_15090 138337 138957 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_15090 138947 139597 gene locus_tag LOCUS_15100 gene chrR 138947 139597 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 protein_id gnl|my_center|LOCUS_15100 139662 141077 gene locus_tag LOCUS_15110 gene phrB 139662 141077 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_15110 141544 141137 gene locus_tag LOCUS_15120 141544 141137 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940910.1 protein_id gnl|my_center|LOCUS_15120 142595 141585 gene locus_tag LOCUS_15130 142595 141585 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114698.1 protein_id gnl|my_center|LOCUS_15130 143232 142648 gene locus_tag LOCUS_15140 143232 142648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 143518 143246 gene locus_tag LOCUS_15150 143518 143246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 143680 144198 gene locus_tag LOCUS_15160 143680 144198 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036520.1 protein_id gnl|my_center|LOCUS_15160 144185 144688 gene locus_tag LOCUS_15170 144185 144688 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819977.1 protein_id gnl|my_center|LOCUS_15170 144704 145270 gene locus_tag LOCUS_15180 144704 145270 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705036.1 protein_id gnl|my_center|LOCUS_15180 145329 146117 gene locus_tag LOCUS_15190 145329 146117 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_15190 148597 146192 gene locus_tag LOCUS_15200 148597 146192 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 protein_id gnl|my_center|LOCUS_15200 148852 149676 gene locus_tag LOCUS_15210 gene bioC 148852 149676 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608914.1 protein_id gnl|my_center|LOCUS_15210 149689 150339 gene locus_tag LOCUS_15220 149689 150339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 150422 150589 gene locus_tag LOCUS_15230 150422 150589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 153882 150847 gene locus_tag LOCUS_15240 153882 150847 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772627.1 protein_id gnl|my_center|LOCUS_15240 154982 153882 gene locus_tag LOCUS_15250 154982 153882 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_15250 155178 156215 gene locus_tag LOCUS_15260 155178 156215 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_15260 156346 157611 gene locus_tag LOCUS_15270 156346 157611 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 protein_id gnl|my_center|LOCUS_15270 157739 158155 gene locus_tag LOCUS_15280 157739 158155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 158419 158994 gene locus_tag LOCUS_15290 158419 158994 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172525.1 protein_id gnl|my_center|LOCUS_15290 159287 160033 gene locus_tag LOCUS_15300 159287 160033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 160946 160764 gene locus_tag LOCUS_15310 160946 160764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 161118 162503 gene locus_tag LOCUS_15320 161118 162503 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_15320 162503 163606 gene locus_tag LOCUS_15330 162503 163606 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887673.1 protein_id gnl|my_center|LOCUS_15330 164016 163941 gene locus_tag LOCUS_t00150 164016 163941 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 164143 166161 gene locus_tag LOCUS_15340 gene uvrB 164143 166161 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769676.1 protein_id gnl|my_center|LOCUS_15340 166602 166189 gene locus_tag LOCUS_15350 166602 166189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 166983 166907 gene locus_tag LOCUS_t00160 166983 166907 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 167206 169122 gene locus_tag LOCUS_15360 gene thrS 167206 169122 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_15360 169188 169688 gene locus_tag LOCUS_15370 gene infC 169188 169688 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367017.1 protein_id gnl|my_center|LOCUS_15370 169811 170002 gene locus_tag LOCUS_15380 gene rpmI 169811 170002 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090673.1 protein_id gnl|my_center|LOCUS_15380 170031 170387 gene locus_tag LOCUS_15390 gene rplT 170031 170387 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 protein_id gnl|my_center|LOCUS_15390 170501 171514 gene locus_tag LOCUS_15400 gene pheS 170501 171514 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_15400 171566 173947 gene locus_tag LOCUS_15410 gene pheT 171566 173947 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114408.1 protein_id gnl|my_center|LOCUS_15410 173955 174257 gene locus_tag LOCUS_15420 gene ihfA 173955 174257 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_15420 174238 174594 gene locus_tag LOCUS_15430 174238 174594 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_15430 174646 174722 gene locus_tag LOCUS_t00170 174646 174722 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 175133 174981 gene locus_tag LOCUS_15440 175133 174981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 175599 176426 gene locus_tag LOCUS_15450 175599 176426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 176413 177267 gene locus_tag LOCUS_15460 176413 177267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 177257 178576 gene locus_tag LOCUS_15470 gene mgtE 177257 178576 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531112.1 protein_id gnl|my_center|LOCUS_15470 178795 179727 gene locus_tag LOCUS_15480 gene galU 178795 179727 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718997.1 protein_id gnl|my_center|LOCUS_15480 179787 181139 gene locus_tag LOCUS_15490 gene cpsG 179787 181139 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 protein_id gnl|my_center|LOCUS_15490 181218 182120 gene locus_tag LOCUS_15500 181218 182120 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_15500 182635 182117 gene locus_tag LOCUS_15510 gene thpR 182635 182117 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957982.1 protein_id gnl|my_center|LOCUS_15510 183019 182648 gene locus_tag LOCUS_15520 gene queD 183019 182648 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102949761.1 protein_id gnl|my_center|LOCUS_15520 183129 183204 gene locus_tag LOCUS_t00180 183129 183204 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 183225 183301 gene locus_tag LOCUS_t00190 183225 183301 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 183611 183426 gene locus_tag LOCUS_15530 183611 183426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 183892 183725 gene locus_tag LOCUS_15540 183892 183725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 184312 183941 gene locus_tag LOCUS_15550 184312 183941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 184969 184322 gene locus_tag LOCUS_15560 184969 184322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 185330 185503 gene locus_tag LOCUS_15570 185330 185503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 187511 185838 gene locus_tag LOCUS_15580 gene ilvD 187511 185838 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_15580 188748 187978 gene locus_tag LOCUS_15590 188748 187978 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388288.1 protein_id gnl|my_center|LOCUS_15590 188866 189735 gene locus_tag LOCUS_15600 188866 189735 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_15600 190144 189872 gene locus_tag LOCUS_15610 190144 189872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15610 192385 190631 gene locus_tag LOCUS_15620 192385 190631 CDS product protein adenylyltransferase SelO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 protein_id gnl|my_center|LOCUS_15620 193234 192992 gene locus_tag LOCUS_15630 193234 192992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 193485 194216 gene locus_tag LOCUS_15640 193485 194216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 194619 195539 gene locus_tag LOCUS_15650 194619 195539 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_15650 195545 196408 gene locus_tag LOCUS_15660 195545 196408 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463338.1 protein_id gnl|my_center|LOCUS_15660 196490 196762 gene locus_tag LOCUS_15670 196490 196762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 196766 197593 gene locus_tag LOCUS_15680 196766 197593 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_15680 197590 200235 gene locus_tag LOCUS_15690 gene pepN 197590 200235 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267176.1 protein_id gnl|my_center|LOCUS_15690 201248 200454 gene locus_tag LOCUS_15700 201248 200454 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_15700 203231 201519 gene locus_tag LOCUS_15710 203231 201519 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_15710 202410 202503 gene locus_tag LOCUS_t00200 202410 202503 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 205109 203238 gene locus_tag LOCUS_15720 205109 203238 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267198.1 protein_id gnl|my_center|LOCUS_15720 206098 205109 gene locus_tag LOCUS_15730 206098 205109 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_15730 206583 206092 gene locus_tag LOCUS_15740 206583 206092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 207515 206580 gene locus_tag LOCUS_15750 207515 206580 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 protein_id gnl|my_center|LOCUS_15750 208478 207519 gene locus_tag LOCUS_15760 208478 207519 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_15760 208678 213546 gene locus_tag LOCUS_15770 gene gdhB 208678 213546 CDS product NAD-glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103491.1 protein_id gnl|my_center|LOCUS_15770 213885 213679 gene locus_tag LOCUS_15780 gene rmf 213885 213679 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103238.1 protein_id gnl|my_center|LOCUS_15780 214105 216264 gene locus_tag LOCUS_15790 gene rlmKL 214105 216264 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_15790 216261 216503 gene locus_tag LOCUS_15800 216261 216503 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037977.1 protein_id gnl|my_center|LOCUS_15800 216588 218234 gene locus_tag LOCUS_15810 216588 218234 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_15810 218789 218325 gene locus_tag LOCUS_15820 218789 218325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 219783 218821 gene locus_tag LOCUS_15830 gene dmeF 219783 218821 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 protein_id gnl|my_center|LOCUS_15830 220383 219814 gene locus_tag LOCUS_15840 220383 219814 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_15840 221317 220496 gene locus_tag LOCUS_15850 221317 220496 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103918.1 protein_id gnl|my_center|LOCUS_15850 223281 221314 gene locus_tag LOCUS_15860 gene slt 223281 221314 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_15860 223819 223391 gene locus_tag LOCUS_15870 223819 223391 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_15870 223881 224405 gene locus_tag LOCUS_15880 223881 224405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 224521 227154 gene locus_tag LOCUS_15890 gene topA 224521 227154 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268332.1 protein_id gnl|my_center|LOCUS_15890 227167 227679 gene locus_tag LOCUS_15900 227167 227679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024638388.1 protein_id gnl|my_center|LOCUS_15900 227792 228040 gene locus_tag LOCUS_15910 227792 228040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 228733 228116 gene locus_tag LOCUS_15920 gene lexA 228733 228116 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646079.1 protein_id gnl|my_center|LOCUS_15920 228959 229615 gene locus_tag LOCUS_15930 228959 229615 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545458.1 protein_id gnl|my_center|LOCUS_15930 229962 229645 gene locus_tag LOCUS_15940 229962 229645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 230284 231300 gene locus_tag LOCUS_15950 gene nagZ 230284 231300 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118092.1 protein_id gnl|my_center|LOCUS_15950 231316 232419 gene locus_tag LOCUS_15960 231316 232419 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_15960 232416 233171 gene locus_tag LOCUS_15970 232416 233171 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_15970 234028 233225 gene locus_tag LOCUS_15980 234028 233225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 237478 234029 gene locus_tag LOCUS_15990 gene mfd 237478 234029 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_15990 237599 238249 gene locus_tag LOCUS_16000 237599 238249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091293.1 protein_id gnl|my_center|LOCUS_16000 238459 239919 gene locus_tag LOCUS_16010 238459 239919 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315085.1 protein_id gnl|my_center|LOCUS_16010 240325 241542 gene locus_tag LOCUS_16020 240325 241542 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_16020 241545 242747 gene locus_tag LOCUS_16030 241545 242747 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_16030 242740 243513 gene locus_tag LOCUS_16040 242740 243513 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_16040 243519 244178 gene locus_tag LOCUS_16050 gene nqrD 243519 244178 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_16050 244178 244795 gene locus_tag LOCUS_16060 gene nqrE 244178 244795 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_16060 244817 246040 gene locus_tag LOCUS_16070 gene nqrF 244817 246040 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_16070 246040 247086 gene locus_tag LOCUS_16080 246040 247086 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071353.1 protein_id gnl|my_center|LOCUS_16080 247087 247335 gene locus_tag LOCUS_16090 gene nqrM 247087 247335 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_16090 248721 247369 gene locus_tag LOCUS_16100 248721 247369 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 protein_id gnl|my_center|LOCUS_16100 249865 249098 gene locus_tag LOCUS_16110 gene gloB 249865 249098 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087949.1 protein_id gnl|my_center|LOCUS_16110 249945 250769 gene locus_tag LOCUS_16120 249945 250769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 250770 251219 gene locus_tag LOCUS_16130 gene rnhA 250770 251219 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957501.1 protein_id gnl|my_center|LOCUS_16130 251246 251986 gene locus_tag LOCUS_16140 gene dnaQ 251246 251986 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_16140 252437 254089 gene locus_tag LOCUS_16150 gene fimL 252437 254089 CDS product type IV pilus/biofilm regulator FimL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_16150 254116 254949 gene locus_tag LOCUS_16160 gene nudC 254116 254949 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_16160 254946 255593 gene locus_tag LOCUS_16170 254946 255593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_16170 255664 256686 gene locus_tag LOCUS_16180 gene sohB 255664 256686 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_16180 257876 256710 gene locus_tag LOCUS_16190 257876 256710 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_16190 258499 258011 gene locus_tag LOCUS_16200 258499 258011 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267699.1 protein_id gnl|my_center|LOCUS_16200 260147 258480 gene locus_tag LOCUS_16210 260147 258480 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_16210 260388 260519 gene locus_tag LOCUS_16220 260388 260519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 260844 260629 gene locus_tag LOCUS_16230 260844 260629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 264464 260847 gene locus_tag LOCUS_16240 gene metH 264464 260847 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_16240 264699 265319 gene locus_tag LOCUS_16250 gene nfuA 264699 265319 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_16250 265415 266005 gene locus_tag LOCUS_16260 265415 266005 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_16260 267145 266081 gene locus_tag LOCUS_16270 267145 266081 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382491.1 protein_id gnl|my_center|LOCUS_16270 270673 267275 gene locus_tag LOCUS_16280 270673 267275 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_16280 273327 270670 gene locus_tag LOCUS_16290 273327 270670 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862414.1 protein_id gnl|my_center|LOCUS_16290 273450 274787 gene locus_tag LOCUS_16300 273450 274787 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895536.1 protein_id gnl|my_center|LOCUS_16300 274859 275359 gene locus_tag LOCUS_16310 274859 275359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 275722 275925 gene locus_tag LOCUS_16320 275722 275925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 276353 276027 gene locus_tag LOCUS_16330 276353 276027 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530739.1 protein_id gnl|my_center|LOCUS_16330 276799 276395 gene locus_tag LOCUS_16340 276799 276395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 277231 276872 gene locus_tag LOCUS_16350 277231 276872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 277557 277874 gene locus_tag LOCUS_16360 277557 277874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 278466 278068 gene locus_tag LOCUS_16370 278466 278068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 279702 278614 gene locus_tag LOCUS_16380 gene trmA 279702 278614 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 protein_id gnl|my_center|LOCUS_16380 280177 279839 gene locus_tag LOCUS_16390 280177 279839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 protein_id gnl|my_center|LOCUS_16390 280709 281263 gene locus_tag LOCUS_16400 280709 281263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 281655 281299 gene locus_tag LOCUS_16410 281655 281299 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268522.1 protein_id gnl|my_center|LOCUS_16410 281992 281684 gene locus_tag LOCUS_16420 281992 281684 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 protein_id gnl|my_center|LOCUS_16420 282694 281999 gene locus_tag LOCUS_16430 282694 281999 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706488.1 protein_id gnl|my_center|LOCUS_16430 283931 282762 gene locus_tag LOCUS_16440 283931 282762 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_16440 284127 286391 gene locus_tag LOCUS_16450 284127 286391 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_16450 286538 287173 gene locus_tag LOCUS_16460 286538 287173 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_16460 287170 287592 gene locus_tag LOCUS_16470 287170 287592 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_16470 287602 289476 gene locus_tag LOCUS_16480 gene msbA 287602 289476 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266474.1 protein_id gnl|my_center|LOCUS_16480 289492 290502 gene locus_tag LOCUS_16490 gene lpxK 289492 290502 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091159.1 protein_id gnl|my_center|LOCUS_16490 290548 291315 gene locus_tag LOCUS_16500 gene kdsB 290548 291315 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011329.1 protein_id gnl|my_center|LOCUS_16500 291312 291788 gene locus_tag LOCUS_16510 291312 291788 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_16510 291788 292840 gene locus_tag LOCUS_16520 gene murB 291788 292840 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770641.1 protein_id gnl|my_center|LOCUS_16520 292851 293498 gene locus_tag LOCUS_16530 292851 293498 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_16530 293521 294189 gene locus_tag LOCUS_16540 gene uvrY 293521 294189 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737926.1 protein_id gnl|my_center|LOCUS_16540 294209 296032 gene locus_tag LOCUS_16550 gene uvrC 294209 296032 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_16550 296075 296632 gene locus_tag LOCUS_16560 gene pgsA 296075 296632 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_16560 296770 296843 gene locus_tag LOCUS_t00210 296770 296843 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 114 569 gene locus_tag LOCUS_16570 114 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 672 1415 gene locus_tag LOCUS_16580 672 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1530 2126 gene locus_tag LOCUS_16590 1530 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2231 2683 gene locus_tag LOCUS_16600 2231 2683 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730468.1 protein_id gnl|my_center|LOCUS_16600 3195 3548 gene locus_tag LOCUS_16610 3195 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3643 4236 gene locus_tag LOCUS_16620 3643 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4327 4869 gene locus_tag LOCUS_16630 4327 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4897 5094 gene locus_tag LOCUS_16640 4897 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 5102 5386 gene locus_tag LOCUS_16650 5102 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5390 5650 gene locus_tag LOCUS_16660 5390 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 6686 7948 gene locus_tag LOCUS_16670 gene cdeA 6686 7948 CDS product multidrug efflux MATE transporter CdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902537.1 protein_id gnl|my_center|LOCUS_16670 8252 9082 gene locus_tag LOCUS_16680 8252 9082 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 protein_id gnl|my_center|LOCUS_16680 10151 9210 gene locus_tag LOCUS_16690 10151 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 10566 11429 gene locus_tag LOCUS_16700 10566 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 11659 12144 gene locus_tag LOCUS_16710 11659 12144 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072219.1 protein_id gnl|my_center|LOCUS_16710 12144 13175 gene locus_tag LOCUS_16720 12144 13175 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_16720 13456 13181 gene locus_tag LOCUS_16730 13456 13181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 13684 14736 gene locus_tag LOCUS_16740 13684 14736 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_16740 14879 15607 gene locus_tag LOCUS_16750 14879 15607 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922379.1 protein_id gnl|my_center|LOCUS_16750 15663 15980 gene locus_tag LOCUS_16760 gene sugE 15663 15980 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111167.1 protein_id gnl|my_center|LOCUS_16760 16215 18332 gene locus_tag LOCUS_16770 16215 18332 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_16770 18827 19432 gene locus_tag LOCUS_16780 18827 19432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 20566 19493 gene locus_tag LOCUS_16790 gene modC 20566 19493 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267945.1 protein_id gnl|my_center|LOCUS_16790 21249 20563 gene locus_tag LOCUS_16800 gene modB 21249 20563 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_16800 22060 21293 gene locus_tag LOCUS_16810 gene modA 22060 21293 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_16810 22552 22196 gene locus_tag LOCUS_16820 22552 22196 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_16820 22858 23478 gene locus_tag LOCUS_16830 22858 23478 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389979.1 protein_id gnl|my_center|LOCUS_16830 23658 23897 gene locus_tag LOCUS_16840 23658 23897 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768492.1 protein_id gnl|my_center|LOCUS_16840 23954 24463 gene locus_tag LOCUS_16850 23954 24463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 24785 24495 gene locus_tag LOCUS_16860 24785 24495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 25556 24918 gene locus_tag LOCUS_16870 25556 24918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085577.1 protein_id gnl|my_center|LOCUS_16870 25730 26104 gene locus_tag LOCUS_16880 25730 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 26105 27082 gene locus_tag LOCUS_16890 26105 27082 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615949.1 protein_id gnl|my_center|LOCUS_16890 27159 27692 gene locus_tag LOCUS_16900 27159 27692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 27846 28187 gene locus_tag LOCUS_16910 27846 28187 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_16910 28193 28780 gene locus_tag LOCUS_16920 28193 28780 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_16920 29266 29042 gene locus_tag LOCUS_16930 29266 29042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 29349 29678 gene locus_tag LOCUS_16940 29349 29678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 29838 30188 gene locus_tag LOCUS_16950 29838 30188 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 protein_id gnl|my_center|LOCUS_16950 30229 30666 gene locus_tag LOCUS_16960 30229 30666 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_16960 30668 31093 gene locus_tag LOCUS_16970 30668 31093 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_16970 31159 32886 gene locus_tag LOCUS_16980 31159 32886 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_16980 32933 33637 gene locus_tag LOCUS_16990 32933 33637 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_16990 33722 34075 gene locus_tag LOCUS_17000 33722 34075 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392606.1 protein_id gnl|my_center|LOCUS_17000 34445 35176 gene locus_tag LOCUS_17010 34445 35176 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_17010 35505 35834 gene locus_tag LOCUS_17020 35505 35834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 36180 37727 gene locus_tag LOCUS_17030 36180 37727 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_17030 37873 39255 gene locus_tag LOCUS_17040 37873 39255 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071311.1 protein_id gnl|my_center|LOCUS_17040 39502 40158 gene locus_tag LOCUS_17050 39502 40158 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 protein_id gnl|my_center|LOCUS_17050 40202 40999 gene locus_tag LOCUS_17060 40202 40999 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_17060 41021 41632 gene locus_tag LOCUS_17070 41021 41632 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_17070 41762 42154 gene locus_tag LOCUS_17080 41762 42154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 42274 44988 gene locus_tag LOCUS_17090 gene acnA 42274 44988 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_17090 46128 45016 gene locus_tag LOCUS_17100 46128 45016 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 protein_id gnl|my_center|LOCUS_17100 46425 47447 gene locus_tag LOCUS_17110 46425 47447 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_17110 47519 49204 gene locus_tag LOCUS_17120 47519 49204 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765656.1 protein_id gnl|my_center|LOCUS_17120 49453 49662 gene locus_tag LOCUS_17130 49453 49662 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_17130 49821 50153 gene locus_tag LOCUS_17140 49821 50153 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727879.1 protein_id gnl|my_center|LOCUS_17140 50330 50980 gene locus_tag LOCUS_17150 50330 50980 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_17150 51485 51012 gene locus_tag LOCUS_17160 51485 51012 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004416966.1 protein_id gnl|my_center|LOCUS_17160 51983 51543 gene locus_tag LOCUS_17170 gene cynS 51983 51543 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103774.1 protein_id gnl|my_center|LOCUS_17170 52891 52004 gene locus_tag LOCUS_17180 52891 52004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_17180 53722 52895 gene locus_tag LOCUS_17190 gene ntrB 53722 52895 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_17190 55190 53724 gene locus_tag LOCUS_17200 55190 53724 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_17200 55535 57418 gene locus_tag LOCUS_17210 55535 57418 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 protein_id gnl|my_center|LOCUS_17210 57378 57608 gene locus_tag LOCUS_17220 57378 57608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 57644 58822 gene locus_tag LOCUS_17230 57644 58822 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 protein_id gnl|my_center|LOCUS_17230 60227 58872 gene locus_tag LOCUS_17240 gene rhlE 60227 58872 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_17240 61220 60477 gene locus_tag LOCUS_17250 61220 60477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 61355 62149 gene locus_tag LOCUS_17260 gene cysZ 61355 62149 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 protein_id gnl|my_center|LOCUS_17260 63439 62132 gene locus_tag LOCUS_17270 gene rhlB 63439 62132 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_17270 64685 63591 gene locus_tag LOCUS_17280 gene amrS 64685 63591 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_17280 64791 65603 gene locus_tag LOCUS_17290 gene amrB 64791 65603 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_17290 65590 66159 gene locus_tag LOCUS_17300 65590 66159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 66229 66720 gene locus_tag LOCUS_17310 66229 66720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 67563 66727 gene locus_tag LOCUS_17320 gene prmC 67563 66727 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456446.1 protein_id gnl|my_center|LOCUS_17320 68650 67568 gene locus_tag LOCUS_17330 gene prfA 68650 67568 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 protein_id gnl|my_center|LOCUS_17330 69950 68685 gene locus_tag LOCUS_17340 gene hemA 69950 68685 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_17340 70163 71926 gene locus_tag LOCUS_17350 70163 71926 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 protein_id gnl|my_center|LOCUS_17350 71931 72530 gene locus_tag LOCUS_17360 gene lolB 71931 72530 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_17360 72527 73369 gene locus_tag LOCUS_17370 gene ispE 72527 73369 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099284.1 protein_id gnl|my_center|LOCUS_17370 73373 73448 gene locus_tag LOCUS_t00220 73373 73448 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 73509 74450 gene locus_tag LOCUS_17380 73509 74450 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099281.1 protein_id gnl|my_center|LOCUS_17380 74566 75225 gene locus_tag LOCUS_17390 74566 75225 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_17390 75279 75866 gene locus_tag LOCUS_17400 gene pth 75279 75866 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099278.1 protein_id gnl|my_center|LOCUS_17400 75896 76987 gene locus_tag LOCUS_17410 gene ychF 75896 76987 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 protein_id gnl|my_center|LOCUS_17410 77102 78319 gene locus_tag LOCUS_17420 77102 78319 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040383028.1 protein_id gnl|my_center|LOCUS_17420 78472 78548 gene locus_tag LOCUS_t00230 78472 78548 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 80139 79108 gene locus_tag LOCUS_17430 80139 79108 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208816.1 protein_id gnl|my_center|LOCUS_17430 80951 81115 gene locus_tag LOCUS_17440 80951 81115 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 protein_id gnl|my_center|LOCUS_17440 82689 81547 gene locus_tag LOCUS_17450 82689 81547 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_17450 83509 83048 gene locus_tag LOCUS_17460 83509 83048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 83839 83516 gene locus_tag LOCUS_17470 83839 83516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 84094 84531 gene locus_tag LOCUS_17480 84094 84531 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 protein_id gnl|my_center|LOCUS_17480 84718 86070 gene locus_tag LOCUS_17490 84718 86070 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063841.1 protein_id gnl|my_center|LOCUS_17490 86242 86520 gene locus_tag LOCUS_17500 86242 86520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 86834 86634 gene locus_tag LOCUS_17510 86834 86634 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 protein_id gnl|my_center|LOCUS_17510 87616 86942 gene locus_tag LOCUS_17520 87616 86942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 88584 88420 gene locus_tag LOCUS_17530 88584 88420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 90918 90394 gene locus_tag LOCUS_17540 90918 90394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 92198 90921 gene locus_tag LOCUS_17550 92198 90921 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946961.1 protein_id gnl|my_center|LOCUS_17550 93461 92427 gene locus_tag LOCUS_17560 93461 92427 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027757.1 protein_id gnl|my_center|LOCUS_17560 94674 93526 gene locus_tag LOCUS_17570 94674 93526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 95018 94671 gene locus_tag LOCUS_17580 95018 94671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 96451 95021 gene locus_tag LOCUS_17590 96451 95021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 96790 96545 gene locus_tag LOCUS_17600 96790 96545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 97465 97151 gene locus_tag LOCUS_17610 97465 97151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 98728 97493 gene locus_tag LOCUS_17620 98728 97493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 98727 98990 gene locus_tag LOCUS_17630 98727 98990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 99357 99127 gene locus_tag LOCUS_17640 99357 99127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 99471 99737 gene locus_tag LOCUS_17650 99471 99737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 99795 100361 gene locus_tag LOCUS_17660 99795 100361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 100752 101111 gene locus_tag LOCUS_17670 100752 101111 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226731.1 protein_id gnl|my_center|LOCUS_17670 101181 102143 gene locus_tag LOCUS_17680 101181 102143 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974446.1 protein_id gnl|my_center|LOCUS_17680 102172 102483 gene locus_tag LOCUS_17690 102172 102483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 102480 102851 gene locus_tag LOCUS_17700 102480 102851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 102844 103140 gene locus_tag LOCUS_17710 102844 103140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 103895 103287 gene locus_tag LOCUS_17720 103895 103287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 104131 103919 gene locus_tag LOCUS_17730 104131 103919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 104311 105183 gene locus_tag LOCUS_17740 104311 105183 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_17740 105185 106669 gene locus_tag LOCUS_17750 105185 106669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 106763 109351 gene locus_tag LOCUS_17760 106763 109351 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_17760 112125 109348 gene locus_tag LOCUS_17770 112125 109348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 113383 112442 gene locus_tag LOCUS_17780 113383 112442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 113778 114851 gene locus_tag LOCUS_17790 113778 114851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 115736 114873 gene locus_tag LOCUS_17800 115736 114873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 116569 115811 gene locus_tag LOCUS_17810 116569 115811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 117324 116842 gene locus_tag LOCUS_17820 117324 116842 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_17820 119624 117321 gene locus_tag LOCUS_17830 119624 117321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 120431 119652 gene locus_tag LOCUS_17840 120431 119652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 120556 122151 gene locus_tag LOCUS_17850 120556 122151 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_17850 122148 123383 gene locus_tag LOCUS_17860 122148 123383 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_17860 123530 123778 gene locus_tag LOCUS_17870 123530 123778 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_17870 123883 124620 gene locus_tag LOCUS_17880 123883 124620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 124613 125521 gene locus_tag LOCUS_17890 124613 125521 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_17890 125601 127466 gene locus_tag LOCUS_17900 gene asnB 125601 127466 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_17900 128721 127531 gene locus_tag LOCUS_17910 128721 127531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 129969 128794 gene locus_tag LOCUS_17920 129969 128794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 131151 129985 gene locus_tag LOCUS_17930 131151 129985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 132217 131168 gene locus_tag LOCUS_17940 132217 131168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 133254 132229 gene locus_tag LOCUS_17950 133254 132229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 133463 133251 gene locus_tag LOCUS_17960 133463 133251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 133584 134138 gene locus_tag LOCUS_17970 133584 134138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 135106 134141 gene locus_tag LOCUS_17980 135106 134141 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_17980 135430 136869 gene locus_tag LOCUS_17990 135430 136869 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626578.1 protein_id gnl|my_center|LOCUS_17990 136924 137715 gene locus_tag LOCUS_18000 136924 137715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 137763 138647 gene locus_tag LOCUS_18010 137763 138647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 138654 140378 gene locus_tag LOCUS_18020 138654 140378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 140390 141325 gene locus_tag LOCUS_18030 140390 141325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 142313 141375 gene locus_tag LOCUS_18040 gene hflC 142313 141375 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_18040 143335 142310 gene locus_tag LOCUS_18050 gene hflK 143335 142310 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_18050 145888 143477 gene locus_tag LOCUS_18060 145888 143477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 147089 146103 gene locus_tag LOCUS_18070 147089 146103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 148475 147153 gene locus_tag LOCUS_18080 148475 147153 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_18080 149885 148539 gene locus_tag LOCUS_18090 149885 148539 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_18090 150985 149882 gene locus_tag LOCUS_18100 150985 149882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 152184 150982 gene locus_tag LOCUS_18110 152184 150982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 154089 152191 gene locus_tag LOCUS_18120 154089 152191 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_18120 155277 154093 gene locus_tag LOCUS_18130 155277 154093 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_18130 156893 155274 gene locus_tag LOCUS_18140 gene xrtA 156893 155274 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_18140 158122 156890 gene locus_tag LOCUS_18150 158122 156890 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_18150 159167 158136 gene locus_tag LOCUS_18160 159167 158136 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_18160 160050 159139 gene locus_tag LOCUS_18170 160050 159139 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_18170 161195 160050 gene locus_tag LOCUS_18180 gene wecB 161195 160050 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_18180 162672 161206 gene locus_tag LOCUS_18190 162672 161206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 163615 162665 gene locus_tag LOCUS_18200 163615 162665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 165230 163692 gene locus_tag LOCUS_18210 165230 163692 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_18210 165915 165274 gene locus_tag LOCUS_18220 165915 165274 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_18220 166392 167798 gene locus_tag LOCUS_18230 166392 167798 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_18230 169172 167817 gene locus_tag LOCUS_18240 gene prsR 169172 167817 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_18240 171265 169169 gene locus_tag LOCUS_18250 gene prsK 171265 169169 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_18250 171563 172591 gene locus_tag LOCUS_18260 171563 172591 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_18260 172633 173946 gene locus_tag LOCUS_18270 172633 173946 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_18270 174186 174842 gene locus_tag LOCUS_18280 174186 174842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 174940 175155 gene locus_tag LOCUS_18290 174940 175155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 175161 176069 gene locus_tag LOCUS_18300 175161 176069 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_18300 176062 177150 gene locus_tag LOCUS_18310 176062 177150 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_18310 177377 177183 gene locus_tag LOCUS_18320 177377 177183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 177559 178776 gene locus_tag LOCUS_18330 177559 178776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 178910 180187 gene locus_tag LOCUS_18340 178910 180187 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_18340 180594 180253 gene locus_tag LOCUS_18350 180594 180253 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_18350 180744 182108 gene locus_tag LOCUS_18360 gene miaB 180744 182108 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093158.1 protein_id gnl|my_center|LOCUS_18360 182213 183253 gene locus_tag LOCUS_18370 182213 183253 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_18370 183250 183738 gene locus_tag LOCUS_18380 gene ybeY 183250 183738 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071410.1 protein_id gnl|my_center|LOCUS_18380 183731 184567 gene locus_tag LOCUS_18390 183731 184567 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_18390 184597 186096 gene locus_tag LOCUS_18400 gene lnt 184597 186096 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 protein_id gnl|my_center|LOCUS_18400 186224 188752 gene locus_tag LOCUS_18410 gene leuS 186224 188752 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957661.1 protein_id gnl|my_center|LOCUS_18410 188799 189335 gene locus_tag LOCUS_18420 gene lptE 188799 189335 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097585.1 protein_id gnl|my_center|LOCUS_18420 189319 190374 gene locus_tag LOCUS_18430 gene holA 189319 190374 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_18430 190695 190330 gene locus_tag LOCUS_18440 190695 190330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 191438 190713 gene locus_tag LOCUS_18450 191438 190713 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 protein_id gnl|my_center|LOCUS_18450 192277 191462 gene locus_tag LOCUS_18460 192277 191462 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_18460 192689 195325 gene locus_tag LOCUS_18470 192689 195325 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463957.1 protein_id gnl|my_center|LOCUS_18470 195325 196638 gene locus_tag LOCUS_18480 195325 196638 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_18480 196635 197621 gene locus_tag LOCUS_18490 gene pdxA 196635 197621 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 protein_id gnl|my_center|LOCUS_18490 197618 198421 gene locus_tag LOCUS_18500 gene rsmA 197618 198421 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_18500 198418 198786 gene locus_tag LOCUS_18510 gene apaG 198418 198786 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_18510 198783 199586 gene locus_tag LOCUS_18520 198783 199586 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_18520 199689 201011 gene locus_tag LOCUS_18530 199689 201011 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580276.1 protein_id gnl|my_center|LOCUS_18530 201354 202802 gene locus_tag LOCUS_18540 201354 202802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 203865 202828 gene locus_tag LOCUS_18550 gene galE 203865 202828 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_18550 204402 204010 gene locus_tag LOCUS_18560 gene rplQ 204402 204010 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 protein_id gnl|my_center|LOCUS_18560 205487 204489 gene locus_tag LOCUS_18570 gene rpoA 205487 204489 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_18570 206159 205539 gene locus_tag LOCUS_18580 gene rpsD 206159 205539 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_18580 206567 206175 gene locus_tag LOCUS_18590 gene rpsK 206567 206175 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 protein_id gnl|my_center|LOCUS_18590 206933 206577 gene locus_tag LOCUS_18600 gene rpsM 206933 206577 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369429.1 protein_id gnl|my_center|LOCUS_18600 208510 207188 gene locus_tag LOCUS_18610 gene secY 208510 207188 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093694.1 protein_id gnl|my_center|LOCUS_18610 208951 208517 gene locus_tag LOCUS_18620 gene rplO 208951 208517 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369426.1 protein_id gnl|my_center|LOCUS_18620 209142 208954 gene locus_tag LOCUS_18630 gene rpmD 209142 208954 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_18630 209697 209185 gene locus_tag LOCUS_18640 gene rpsE 209697 209185 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_18640 210060 209710 gene locus_tag LOCUS_18650 gene rplR 210060 209710 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049741.1 protein_id gnl|my_center|LOCUS_18650 210603 210070 gene locus_tag LOCUS_18660 gene rplF 210603 210070 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_18660 211009 210617 gene locus_tag LOCUS_18670 gene rpsH 211009 210617 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 protein_id gnl|my_center|LOCUS_18670 211344 211039 gene locus_tag LOCUS_18680 gene rpsN 211344 211039 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014354.1 protein_id gnl|my_center|LOCUS_18680 211894 211355 gene locus_tag LOCUS_18690 gene rplE 211894 211355 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093703.1 protein_id gnl|my_center|LOCUS_18690 212229 211912 gene locus_tag LOCUS_18700 gene rplX 212229 211912 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555478.1 protein_id gnl|my_center|LOCUS_18700 212620 212252 gene locus_tag LOCUS_18710 gene rplN 212620 212252 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 protein_id gnl|my_center|LOCUS_18710 212943 212656 gene locus_tag LOCUS_18720 gene rpsQ 212943 212656 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_18720 213115 212924 gene locus_tag LOCUS_18730 gene rpmC 213115 212924 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 protein_id gnl|my_center|LOCUS_18730 213528 213115 gene locus_tag LOCUS_18740 gene rplP 213528 213115 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555482.1 protein_id gnl|my_center|LOCUS_18740 214234 213554 gene locus_tag LOCUS_18750 gene rpsC 214234 213554 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_18750 214581 214234 gene locus_tag LOCUS_18760 gene rplV 214581 214234 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555485.1 protein_id gnl|my_center|LOCUS_18760 214876 214601 gene locus_tag LOCUS_18770 gene rpsS 214876 214601 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555486.1 protein_id gnl|my_center|LOCUS_18770 215724 214900 gene locus_tag LOCUS_18780 gene rplB 215724 214900 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070620.1 protein_id gnl|my_center|LOCUS_18780 216036 215737 gene locus_tag LOCUS_18790 gene rplW 216036 215737 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_18790 216647 216033 gene locus_tag LOCUS_18800 gene rplD 216647 216033 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422344.1 protein_id gnl|my_center|LOCUS_18800 217294 216659 gene locus_tag LOCUS_18810 gene rplC 217294 216659 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579663.1 protein_id gnl|my_center|LOCUS_18810 217708 217397 gene locus_tag LOCUS_18820 gene rpsJ 217708 217397 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555491.1 protein_id gnl|my_center|LOCUS_18820 219133 217910 gene locus_tag LOCUS_18830 gene tuf 219133 217910 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 protein_id gnl|my_center|LOCUS_18830 221282 219177 gene locus_tag LOCUS_18840 gene fusA 221282 219177 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093741.1 protein_id gnl|my_center|LOCUS_18840 221846 221376 gene locus_tag LOCUS_18850 gene rpsG 221846 221376 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 protein_id gnl|my_center|LOCUS_18850 222316 221942 gene locus_tag LOCUS_18860 gene rpsL 222316 221942 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_18860 226682 222465 gene locus_tag LOCUS_18870 gene rpoC 226682 222465 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_18870 230876 226752 gene locus_tag LOCUS_18880 gene rpoB 230876 226752 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_18880 231410 231033 gene locus_tag LOCUS_18890 gene rplL 231410 231033 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093747.1 protein_id gnl|my_center|LOCUS_18890 231989 231459 gene locus_tag LOCUS_18900 gene rplJ 231989 231459 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023073.1 protein_id gnl|my_center|LOCUS_18900 232971 232276 gene locus_tag LOCUS_18910 gene rplA 232971 232276 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317112.1 protein_id gnl|my_center|LOCUS_18910 233403 232972 gene locus_tag LOCUS_18920 gene rplK 233403 232972 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555500.1 protein_id gnl|my_center|LOCUS_18920 234033 233506 gene locus_tag LOCUS_18930 gene nusG 234033 233506 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_18930 234411 234043 gene locus_tag LOCUS_18940 gene secE 234411 234043 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108030.1 protein_id gnl|my_center|LOCUS_18940 234548 234473 gene locus_tag LOCUS_t00240 234548 234473 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 235865 234642 gene locus_tag LOCUS_18950 gene tuf 235865 234642 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 protein_id gnl|my_center|LOCUS_18950 236010 235935 gene locus_tag LOCUS_t00250 236010 235935 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 236106 236033 gene locus_tag LOCUS_t00260 236106 236033 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 236447 236364 gene locus_tag LOCUS_t00270 236447 236364 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 236590 236515 gene locus_tag LOCUS_t00280 236590 236515 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 237486 236740 gene locus_tag LOCUS_18960 237486 236740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 238213 237497 gene locus_tag LOCUS_18970 238213 237497 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 protein_id gnl|my_center|LOCUS_18970 239178 238210 gene locus_tag LOCUS_18980 gene birA 239178 238210 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103219.1 protein_id gnl|my_center|LOCUS_18980 239988 239188 gene locus_tag LOCUS_18990 239988 239188 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_18990 242124 240211 gene locus_tag LOCUS_19000 242124 240211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 243491 243381 gene locus_tag LOCUS_r00010 243491 243381 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence07 740 1219 gene locus_tag LOCUS_19010 gene smpB 740 1219 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 protein_id gnl|my_center|LOCUS_19010 1340 1717 gene locus_tag LOCUS_tm00010 1340 1717 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4148 1974 gene locus_tag LOCUS_19020 gene katG 4148 1974 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_19020 4323 4490 gene locus_tag LOCUS_19030 4323 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 4576 6621 gene locus_tag LOCUS_19040 gene katG 4576 6621 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167181779.1 protein_id gnl|my_center|LOCUS_19040 6908 8605 gene locus_tag LOCUS_19050 6908 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 8931 8749 gene locus_tag LOCUS_19060 8931 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 10123 9101 gene locus_tag LOCUS_19070 10123 9101 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104312.1 protein_id gnl|my_center|LOCUS_19070 10712 10308 gene locus_tag LOCUS_19080 10712 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 11352 10828 gene locus_tag LOCUS_19090 gene hutZ 11352 10828 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 protein_id gnl|my_center|LOCUS_19090 11770 11372 gene locus_tag LOCUS_19100 11770 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 13869 11797 gene locus_tag LOCUS_19110 13869 11797 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_19110 14091 14846 gene locus_tag LOCUS_19120 14091 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 15049 15600 gene locus_tag LOCUS_19130 15049 15600 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445085.1 protein_id gnl|my_center|LOCUS_19130 15597 16010 gene locus_tag LOCUS_19140 15597 16010 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597688.1 protein_id gnl|my_center|LOCUS_19140 16007 16849 gene locus_tag LOCUS_19150 16007 16849 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073468.1 protein_id gnl|my_center|LOCUS_19150 16849 17871 gene locus_tag LOCUS_19160 16849 17871 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491087.1 protein_id gnl|my_center|LOCUS_19160 17862 18641 gene locus_tag LOCUS_19170 17862 18641 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073470.1 protein_id gnl|my_center|LOCUS_19170 19332 18652 gene locus_tag LOCUS_19180 19332 18652 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_19180 19640 20824 gene locus_tag LOCUS_19190 19640 20824 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388642.1 protein_id gnl|my_center|LOCUS_19190 20852 24004 gene locus_tag LOCUS_19200 20852 24004 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388641.1 protein_id gnl|my_center|LOCUS_19200 24818 24015 gene locus_tag LOCUS_19210 24818 24015 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_19210 25366 24986 gene locus_tag LOCUS_19220 25366 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 27006 25639 gene locus_tag LOCUS_19230 27006 25639 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_19230 27714 27223 gene locus_tag LOCUS_19240 27714 27223 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066931.1 protein_id gnl|my_center|LOCUS_19240 28320 27901 gene locus_tag LOCUS_19250 28320 27901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 28536 29543 gene locus_tag LOCUS_19260 28536 29543 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_19260 29670 30953 gene locus_tag LOCUS_19270 29670 30953 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014164074.1 protein_id gnl|my_center|LOCUS_19270 31730 30963 gene locus_tag LOCUS_19280 31730 30963 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 protein_id gnl|my_center|LOCUS_19280 32421 31846 gene locus_tag LOCUS_19290 32421 31846 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_19290 32953 33186 gene locus_tag LOCUS_19300 32953 33186 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379121.1 protein_id gnl|my_center|LOCUS_19300 33186 34076 gene locus_tag LOCUS_19310 33186 34076 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_19310 34166 36103 gene locus_tag LOCUS_19320 gene dxs 34166 36103 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266507.1 protein_id gnl|my_center|LOCUS_19320 36984 36145 gene locus_tag LOCUS_19330 36984 36145 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 protein_id gnl|my_center|LOCUS_19330 37425 37060 gene locus_tag LOCUS_19340 37425 37060 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406693.1 protein_id gnl|my_center|LOCUS_19340 39583 37451 gene locus_tag LOCUS_19350 gene dinG 39583 37451 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 protein_id gnl|my_center|LOCUS_19350 40734 39586 gene locus_tag LOCUS_19360 40734 39586 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421706.1 protein_id gnl|my_center|LOCUS_19360 41809 40793 gene locus_tag LOCUS_19370 41809 40793 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_19370 43323 41884 gene locus_tag LOCUS_19380 gene sbcB 43323 41884 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 protein_id gnl|my_center|LOCUS_19380 44375 43392 gene locus_tag LOCUS_19390 44375 43392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 46018 44504 gene locus_tag LOCUS_19400 46018 44504 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_19400 46670 46068 gene locus_tag LOCUS_19410 46670 46068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 47614 46976 gene locus_tag LOCUS_19420 47614 46976 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_19420 48086 48667 gene locus_tag LOCUS_19430 gene sodB 48086 48667 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072792.1 protein_id gnl|my_center|LOCUS_19430 49872 49246 gene locus_tag LOCUS_19440 49872 49246 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_19440 51805 50084 gene locus_tag LOCUS_19450 51805 50084 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_19450 53495 51822 gene locus_tag LOCUS_19460 53495 51822 CDS product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_19460 54444 53548 gene locus_tag LOCUS_19470 54444 53548 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_19470 55459 54467 gene locus_tag LOCUS_19480 55459 54467 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966235.1 protein_id gnl|my_center|LOCUS_19480 56883 55459 gene locus_tag LOCUS_19490 56883 55459 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_19490 57090 58397 gene locus_tag LOCUS_19500 57090 58397 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266169.1 protein_id gnl|my_center|LOCUS_19500 60259 58607 gene locus_tag LOCUS_19510 gene groL 60259 58607 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 protein_id gnl|my_center|LOCUS_19510 60606 60313 gene locus_tag LOCUS_19520 60606 60313 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304675.1 protein_id gnl|my_center|LOCUS_19520 61207 60740 gene locus_tag LOCUS_19530 gene fxsA 61207 60740 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_19530 61302 61616 gene locus_tag LOCUS_19540 61302 61616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 62953 61574 gene locus_tag LOCUS_19550 62953 61574 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_19550 63022 63906 gene locus_tag LOCUS_19560 63022 63906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_19560 63911 64945 gene locus_tag LOCUS_19570 63911 64945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_19570 65792 64953 gene locus_tag LOCUS_19580 gene ampE 65792 64953 CDS product regulatory signaling modulator protein AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412346.1 protein_id gnl|my_center|LOCUS_19580 66252 65794 gene locus_tag LOCUS_19590 gene ampD 66252 65794 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 protein_id gnl|my_center|LOCUS_19590 68744 66468 gene locus_tag LOCUS_19600 68744 66468 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_19600 71212 68939 gene locus_tag LOCUS_19610 71212 68939 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103361.1 protein_id gnl|my_center|LOCUS_19610 71470 72324 gene locus_tag LOCUS_19620 gene nadC 71470 72324 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_19620 73415 72321 gene locus_tag LOCUS_19630 73415 72321 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_19630 73840 73448 gene locus_tag LOCUS_19640 73840 73448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 74587 73844 gene locus_tag LOCUS_19650 74587 73844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 74913 75938 gene locus_tag LOCUS_19660 74913 75938 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_19660 75956 77620 gene locus_tag LOCUS_19670 75956 77620 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_19670 77622 78689 gene locus_tag LOCUS_19680 77622 78689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_19680 78876 80348 gene locus_tag LOCUS_19690 78876 80348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 80551 80333 gene locus_tag LOCUS_19700 80551 80333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 80966 80757 gene locus_tag LOCUS_19710 80966 80757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 81307 80915 gene locus_tag LOCUS_19720 81307 80915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 82204 81374 gene locus_tag LOCUS_19730 82204 81374 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898901.1 protein_id gnl|my_center|LOCUS_19730 83144 82194 gene locus_tag LOCUS_19740 83144 82194 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407612.1 protein_id gnl|my_center|LOCUS_19740 83836 83141 gene locus_tag LOCUS_19750 83836 83141 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407623.1 protein_id gnl|my_center|LOCUS_19750 85144 84149 gene locus_tag LOCUS_19760 85144 84149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 88000 85880 gene locus_tag LOCUS_19770 88000 85880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 88628 88140 gene locus_tag LOCUS_19780 88628 88140 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038213.1 protein_id gnl|my_center|LOCUS_19780 89041 90777 gene locus_tag LOCUS_19790 gene pilB 89041 90777 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_19790 90781 91989 gene locus_tag LOCUS_19800 90781 91989 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_19800 92261 93124 gene locus_tag LOCUS_19810 gene pilD 92261 93124 CDS product type IV prepilin peptidase/methyltransferase PilD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112839.1 protein_id gnl|my_center|LOCUS_19810 93222 93830 gene locus_tag LOCUS_19820 gene coaE 93222 93830 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707572.1 protein_id gnl|my_center|LOCUS_19820 94047 94265 gene locus_tag LOCUS_19830 gene yacG 94047 94265 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856332.1 protein_id gnl|my_center|LOCUS_19830 94713 94309 gene locus_tag LOCUS_19840 94713 94309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 95927 94710 gene locus_tag LOCUS_19850 gene argJ 95927 94710 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_19850 98683 95984 gene locus_tag LOCUS_19860 gene secA 98683 95984 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 protein_id gnl|my_center|LOCUS_19860 99681 98761 gene locus_tag LOCUS_19870 99681 98761 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_19870 100638 99724 gene locus_tag LOCUS_19880 gene lpxC 100638 99724 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_19880 101965 100781 gene locus_tag LOCUS_19890 gene ftsZ 101965 100781 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555041.1 protein_id gnl|my_center|LOCUS_19890 103242 102004 gene locus_tag LOCUS_19900 gene ftsA 103242 102004 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_19900 104081 103251 gene locus_tag LOCUS_19910 104081 103251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 105102 104176 gene locus_tag LOCUS_19920 105102 104176 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_19920 106545 105121 gene locus_tag LOCUS_19930 gene murC 106545 105121 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_19930 107593 106535 gene locus_tag LOCUS_19940 gene murG 107593 106535 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103107.1 protein_id gnl|my_center|LOCUS_19940 108785 107601 gene locus_tag LOCUS_19950 gene ftsW 108785 107601 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_19950 110131 108782 gene locus_tag LOCUS_19960 gene murD 110131 108782 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_19960 111229 110147 gene locus_tag LOCUS_19970 gene mraY 111229 110147 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_19970 112590 111232 gene locus_tag LOCUS_19980 112590 111232 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105004.1 protein_id gnl|my_center|LOCUS_19980 114089 112587 gene locus_tag LOCUS_19990 gene murE 114089 112587 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848752.1 protein_id gnl|my_center|LOCUS_19990 115831 114089 gene locus_tag LOCUS_20000 gene ftsI 115831 114089 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_20000 116133 115828 gene locus_tag LOCUS_20010 116133 115828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 117065 116130 gene locus_tag LOCUS_20020 gene rsmH 117065 116130 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_20020 117607 117083 gene locus_tag LOCUS_20030 gene mraZ 117607 117083 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_20030 118572 119261 gene locus_tag LOCUS_20040 118572 119261 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_20040 120119 119283 gene locus_tag LOCUS_20050 gene rsmI 120119 119283 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_20050 120134 122026 gene locus_tag LOCUS_20060 120134 122026 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_20060 122100 122489 gene locus_tag LOCUS_20070 122100 122489 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_20070 122513 123100 gene locus_tag LOCUS_20080 122513 123100 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_20080 123100 123672 gene locus_tag LOCUS_20090 123100 123672 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_20090 124921 123743 gene locus_tag LOCUS_20100 124921 123743 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_20100 125370 124933 gene locus_tag LOCUS_20110 125370 124933 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_20110 126067 125468 gene locus_tag LOCUS_20120 126067 125468 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_20120 128199 126166 gene locus_tag LOCUS_20130 128199 126166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 128792 128199 gene locus_tag LOCUS_20140 gene petA 128792 128199 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 protein_id gnl|my_center|LOCUS_20140 129366 128974 gene locus_tag LOCUS_20150 gene rpsI 129366 128974 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210133.1 protein_id gnl|my_center|LOCUS_20150 129808 129380 gene locus_tag LOCUS_20160 gene rplM 129808 129380 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094164.1 protein_id gnl|my_center|LOCUS_20160 131095 129959 gene locus_tag LOCUS_20170 gene zapE 131095 129959 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_20170 131314 131829 gene locus_tag LOCUS_20180 131314 131829 CDS product DUF1043 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620321.1 protein_id gnl|my_center|LOCUS_20180 131916 133067 gene locus_tag LOCUS_20190 gene algW 131916 133067 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 protein_id gnl|my_center|LOCUS_20190 134141 133077 gene locus_tag LOCUS_20200 gene hisC 134141 133077 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_20200 135471 134152 gene locus_tag LOCUS_20210 gene hisD 135471 134152 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_20210 136100 135468 gene locus_tag LOCUS_20220 gene hisG 136100 135468 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766526.1 protein_id gnl|my_center|LOCUS_20220 137419 136154 gene locus_tag LOCUS_20230 gene murA 137419 136154 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_20230 137724 137491 gene locus_tag LOCUS_20240 gene ibaG 137724 137491 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429656.1 protein_id gnl|my_center|LOCUS_20240 138372 137728 gene locus_tag LOCUS_20250 138372 137728 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400251.1 protein_id gnl|my_center|LOCUS_20250 138709 139680 gene locus_tag LOCUS_20260 gene kdsD 138709 139680 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_20260 139683 140216 gene locus_tag LOCUS_20270 139683 140216 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_20270 140221 140802 gene locus_tag LOCUS_20280 140221 140802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 140792 141295 gene locus_tag LOCUS_20290 gene lptA 140792 141295 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 protein_id gnl|my_center|LOCUS_20290 141296 142021 gene locus_tag LOCUS_20300 gene lptB 141296 142021 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_20300 142146 143597 gene locus_tag LOCUS_20310 142146 143597 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 protein_id gnl|my_center|LOCUS_20310 143618 143905 gene locus_tag LOCUS_20320 gene raiA 143618 143905 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_20320 143911 144369 gene locus_tag LOCUS_20330 gene ptsN 143911 144369 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_20330 144382 145242 gene locus_tag LOCUS_20340 gene rapZ 144382 145242 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_20340 145268 145549 gene locus_tag LOCUS_20350 145268 145549 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094362.1 protein_id gnl|my_center|LOCUS_20350 145644 147002 gene locus_tag LOCUS_20360 gene mgtE 145644 147002 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 protein_id gnl|my_center|LOCUS_20360 147008 147523 gene locus_tag LOCUS_20370 gene yjgA 147008 147523 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 protein_id gnl|my_center|LOCUS_20370 147520 148158 gene locus_tag LOCUS_20380 147520 148158 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_20380 149990 148179 gene locus_tag LOCUS_20390 gene typA 149990 148179 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737390.1 protein_id gnl|my_center|LOCUS_20390 150282 151235 gene locus_tag LOCUS_20400 150282 151235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 153142 151370 gene locus_tag LOCUS_20410 153142 151370 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_20410 154717 153263 gene locus_tag LOCUS_20420 gene thiI 154717 153263 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096011.1 protein_id gnl|my_center|LOCUS_20420 155055 156461 gene locus_tag LOCUS_20430 gene glnA 155055 156461 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096016.1 protein_id gnl|my_center|LOCUS_20430 156594 157124 gene locus_tag LOCUS_20440 156594 157124 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114474.1 protein_id gnl|my_center|LOCUS_20440 157305 158372 gene locus_tag LOCUS_20450 gene ntrB 157305 158372 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_20450 158374 159789 gene locus_tag LOCUS_20460 gene ntrC 158374 159789 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_20460 160372 159854 gene locus_tag LOCUS_20470 gene secB 160372 159854 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096050.1 protein_id gnl|my_center|LOCUS_20470 160709 160449 gene locus_tag LOCUS_20480 gene grxC 160709 160449 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096057.1 protein_id gnl|my_center|LOCUS_20480 161121 160711 gene locus_tag LOCUS_20490 161121 160711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 161285 162835 gene locus_tag LOCUS_20500 gene gpmM 161285 162835 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208979.1 protein_id gnl|my_center|LOCUS_20500 162859 164007 gene locus_tag LOCUS_20510 162859 164007 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_20510 164061 165344 gene locus_tag LOCUS_20520 gene cptA 164061 165344 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_20520 165488 165721 gene locus_tag LOCUS_20530 165488 165721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 166517 165747 gene locus_tag LOCUS_20540 gene hisF 166517 165747 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_20540 167131 166517 gene locus_tag LOCUS_20550 gene ribA 167131 166517 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110510.1 protein_id gnl|my_center|LOCUS_20550 167790 167224 gene locus_tag LOCUS_20560 167790 167224 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_20560 168424 167936 gene locus_tag LOCUS_20570 168424 167936 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_20570 169444 168482 gene locus_tag LOCUS_20580 gene thiL 169444 168482 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752121.1 protein_id gnl|my_center|LOCUS_20580 169916 169476 gene locus_tag LOCUS_20590 gene nusB 169916 169476 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_20590 170396 169926 gene locus_tag LOCUS_20600 gene ribE 170396 169926 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864130.1 protein_id gnl|my_center|LOCUS_20600 171578 170466 gene locus_tag LOCUS_20610 gene ribBA 171578 170466 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_20610 172249 171620 gene locus_tag LOCUS_20620 172249 171620 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_20620 173389 172286 gene locus_tag LOCUS_20630 gene ribD 173389 172286 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_20630 173868 173395 gene locus_tag LOCUS_20640 gene nrdR 173868 173395 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_20640 173867 174043 gene locus_tag LOCUS_20650 173867 174043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 175299 174040 gene locus_tag LOCUS_20660 175299 174040 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707102.1 protein_id gnl|my_center|LOCUS_20660 177465 175459 gene locus_tag LOCUS_20670 177465 175459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 178684 177458 gene locus_tag LOCUS_20680 178684 177458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 182431 178988 gene locus_tag LOCUS_20690 182431 178988 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449873.1 protein_id gnl|my_center|LOCUS_20690 182639 183370 gene locus_tag LOCUS_20700 182639 183370 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 protein_id gnl|my_center|LOCUS_20700 183556 184080 gene locus_tag LOCUS_20710 183556 184080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 187586 184587 gene locus_tag LOCUS_20720 187586 184587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 188132 188551 gene locus_tag LOCUS_20730 188132 188551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 188670 188885 gene locus_tag LOCUS_20740 188670 188885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 188900 189151 gene locus_tag LOCUS_20750 188900 189151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 189362 189847 gene locus_tag LOCUS_20760 189362 189847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 190796 189975 gene locus_tag LOCUS_20770 190796 189975 CDS product UDP-galactose-lipid carrier transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427312.1 protein_id gnl|my_center|LOCUS_20770 191239 192123 gene locus_tag LOCUS_20780 gene dgcZ 191239 192123 CDS product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592829.1 protein_id gnl|my_center|LOCUS_20780 192360 194024 gene locus_tag LOCUS_20790 gene ettA 192360 194024 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_20790 194187 194762 gene locus_tag LOCUS_20800 194187 194762 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_20800 194816 195781 gene locus_tag LOCUS_20810 194816 195781 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_20810 196121 195786 gene locus_tag LOCUS_20820 196121 195786 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_20820 196501 196121 gene locus_tag LOCUS_20830 196501 196121 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640610.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence08 1388 585 gene locus_tag LOCUS_20840 1388 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4353 1768 gene locus_tag LOCUS_20850 4353 1768 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236179.1 protein_id gnl|my_center|LOCUS_20850 4742 4990 gene locus_tag LOCUS_20860 4742 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 5229 4996 gene locus_tag LOCUS_20870 5229 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 6020 5367 gene locus_tag LOCUS_20880 6020 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269004.1 protein_id gnl|my_center|LOCUS_20880 6898 6017 gene locus_tag LOCUS_20890 6898 6017 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763178.1 protein_id gnl|my_center|LOCUS_20890 7784 6900 gene locus_tag LOCUS_20900 7784 6900 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244655.1 protein_id gnl|my_center|LOCUS_20900 9056 7818 gene locus_tag LOCUS_20910 9056 7818 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763182.1 protein_id gnl|my_center|LOCUS_20910 10219 9056 gene locus_tag LOCUS_20920 10219 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244656.1 protein_id gnl|my_center|LOCUS_20920 11475 10234 gene locus_tag LOCUS_20930 11475 10234 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269002.1 protein_id gnl|my_center|LOCUS_20930 12440 11493 gene locus_tag LOCUS_20940 gene cpaB 12440 11493 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399732.1 protein_id gnl|my_center|LOCUS_20940 12703 12933 gene locus_tag LOCUS_20950 12703 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 13040 13489 gene locus_tag LOCUS_20960 13040 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 13520 15781 gene locus_tag LOCUS_20970 13520 15781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 15795 16364 gene locus_tag LOCUS_20980 15795 16364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 17144 16383 gene locus_tag LOCUS_20990 17144 16383 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032699777.1 protein_id gnl|my_center|LOCUS_20990 18679 17558 gene locus_tag LOCUS_21000 18679 17558 CDS product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_21000 19674 18676 gene locus_tag LOCUS_21010 19674 18676 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_21010 19925 20521 gene locus_tag LOCUS_21020 gene msrA 19925 20521 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_21020 20727 21899 gene locus_tag LOCUS_21030 20727 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 21956 22669 gene locus_tag LOCUS_21040 gene fnr 21956 22669 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244356.1 protein_id gnl|my_center|LOCUS_21040 23464 22772 gene locus_tag LOCUS_21050 23464 22772 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_21050 23995 23573 gene locus_tag LOCUS_21060 23995 23573 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_21060 24392 24084 gene locus_tag LOCUS_21070 24392 24084 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705060.1 protein_id gnl|my_center|LOCUS_21070 24651 26387 gene locus_tag LOCUS_21080 gene argS 24651 26387 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025318.1 protein_id gnl|my_center|LOCUS_21080 26474 26833 gene locus_tag LOCUS_21090 26474 26833 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_21090 28285 26870 gene locus_tag LOCUS_21100 28285 26870 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766716.1 protein_id gnl|my_center|LOCUS_21100 28585 29070 gene locus_tag LOCUS_21110 28585 29070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 protein_id gnl|my_center|LOCUS_21110 30494 29103 gene locus_tag LOCUS_21120 gene der 30494 29103 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_21120 31790 30630 gene locus_tag LOCUS_21130 gene bamB 31790 30630 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_21130 32491 31787 gene locus_tag LOCUS_21140 32491 31787 CDS product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106650.1 protein_id gnl|my_center|LOCUS_21140 33780 32494 gene locus_tag LOCUS_21150 gene hisS 33780 32494 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 protein_id gnl|my_center|LOCUS_21150 34892 33780 gene locus_tag LOCUS_21160 gene ispG 34892 33780 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_21160 35729 34899 gene locus_tag LOCUS_21170 35729 34899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 36537 35710 gene locus_tag LOCUS_21180 gene pilW 36537 35710 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_21180 37693 36527 gene locus_tag LOCUS_21190 gene rlmN 37693 36527 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092809.1 protein_id gnl|my_center|LOCUS_21190 38156 37731 gene locus_tag LOCUS_21200 gene ndk 38156 37731 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705641.1 protein_id gnl|my_center|LOCUS_21200 40132 38306 gene locus_tag LOCUS_21210 40132 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 40365 40171 gene locus_tag LOCUS_21220 gene iscX 40365 40171 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 protein_id gnl|my_center|LOCUS_21220 40725 40387 gene locus_tag LOCUS_21230 gene fdx 40725 40387 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_21230 42595 40727 gene locus_tag LOCUS_21240 gene hscA 42595 40727 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_21240 43139 42609 gene locus_tag LOCUS_21250 gene hscB 43139 42609 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209833.1 protein_id gnl|my_center|LOCUS_21250 43554 43231 gene locus_tag LOCUS_21260 gene iscA 43554 43231 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_21260 43973 43554 gene locus_tag LOCUS_21270 gene iscU 43973 43554 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654861.1 protein_id gnl|my_center|LOCUS_21270 45205 43991 gene locus_tag LOCUS_21280 45205 43991 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092832.1 protein_id gnl|my_center|LOCUS_21280 45728 45216 gene locus_tag LOCUS_21290 gene iscR 45728 45216 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_21290 46574 45804 gene locus_tag LOCUS_21300 gene trmJ 46574 45804 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113799.1 protein_id gnl|my_center|LOCUS_21300 46768 47577 gene locus_tag LOCUS_21310 gene suhB 46768 47577 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 protein_id gnl|my_center|LOCUS_21310 48551 47625 gene locus_tag LOCUS_21320 gene rpoS 48551 47625 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703292.1 protein_id gnl|my_center|LOCUS_21320 49440 48745 gene locus_tag LOCUS_21330 49440 48745 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 protein_id gnl|my_center|LOCUS_21330 50514 49576 gene locus_tag LOCUS_21340 50514 49576 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_21340 51203 50532 gene locus_tag LOCUS_21350 51203 50532 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_21350 52267 51248 gene locus_tag LOCUS_21360 gene truD 52267 51248 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_21360 53010 52516 gene locus_tag LOCUS_21370 gene ispF 53010 52516 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687916.1 protein_id gnl|my_center|LOCUS_21370 53737 53012 gene locus_tag LOCUS_21380 gene ispD 53737 53012 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_21380 54085 53804 gene locus_tag LOCUS_21390 gene ftsB 54085 53804 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 protein_id gnl|my_center|LOCUS_21390 55650 54361 gene locus_tag LOCUS_21400 gene eno 55650 54361 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_21400 56578 55721 gene locus_tag LOCUS_21410 gene kdsA 56578 55721 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161312.1 protein_id gnl|my_center|LOCUS_21410 58207 56582 gene locus_tag LOCUS_21420 58207 56582 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_21420 59722 58391 gene locus_tag LOCUS_21430 gene tilS 59722 58391 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_21430 59926 61266 gene locus_tag LOCUS_21440 59926 61266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 62284 61334 gene locus_tag LOCUS_21450 gene accA 62284 61334 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_21450 65868 62374 gene locus_tag LOCUS_21460 gene dnaE 65868 62374 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266980.1 protein_id gnl|my_center|LOCUS_21460 67435 65924 gene locus_tag LOCUS_21470 67435 65924 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_21470 68310 67699 gene locus_tag LOCUS_21480 gene rnhB 68310 67699 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765997.1 protein_id gnl|my_center|LOCUS_21480 69458 68307 gene locus_tag LOCUS_21490 gene lpxB 69458 68307 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_21490 70238 69462 gene locus_tag LOCUS_21500 gene lpxA 70238 69462 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 protein_id gnl|my_center|LOCUS_21500 70676 70242 gene locus_tag LOCUS_21510 gene fabZ 70676 70242 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092375.1 protein_id gnl|my_center|LOCUS_21510 71735 70719 gene locus_tag LOCUS_21520 gene lpxD 71735 70719 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_21520 72299 71769 gene locus_tag LOCUS_21530 72299 71769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 74684 72330 gene locus_tag LOCUS_21540 gene bamA 74684 72330 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_21540 76080 74725 gene locus_tag LOCUS_21550 gene rseP 76080 74725 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 protein_id gnl|my_center|LOCUS_21550 77317 76142 gene locus_tag LOCUS_21560 gene ispC 77317 76142 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_21560 78164 77322 gene locus_tag LOCUS_21570 gene cdsA 78164 77322 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 protein_id gnl|my_center|LOCUS_21570 78915 78157 gene locus_tag LOCUS_21580 gene uppS 78915 78157 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314296.1 protein_id gnl|my_center|LOCUS_21580 79498 78941 gene locus_tag LOCUS_21590 gene frr 79498 78941 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 protein_id gnl|my_center|LOCUS_21590 80228 79491 gene locus_tag LOCUS_21600 gene pyrH 80228 79491 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_21600 81167 80304 gene locus_tag LOCUS_21610 gene tsf 81167 80304 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092393.1 protein_id gnl|my_center|LOCUS_21610 82022 81261 gene locus_tag LOCUS_21620 gene rpsB 82022 81261 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_21620 82286 83056 gene locus_tag LOCUS_21630 gene map 82286 83056 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266973.1 protein_id gnl|my_center|LOCUS_21630 83056 85767 gene locus_tag LOCUS_21640 83056 85767 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_21640 85816 87030 gene locus_tag LOCUS_21650 gene dapC 85816 87030 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_21650 87034 87687 gene locus_tag LOCUS_21660 gene nth 87034 87687 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_21660 88581 87688 gene locus_tag LOCUS_21670 88581 87688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 89110 88589 gene locus_tag LOCUS_21680 89110 88589 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_21680 89230 89583 gene locus_tag LOCUS_21690 89230 89583 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 protein_id gnl|my_center|LOCUS_21690 89606 90637 gene locus_tag LOCUS_21700 gene dapD 89606 90637 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 protein_id gnl|my_center|LOCUS_21700 90775 91911 gene locus_tag LOCUS_21710 gene dapE 90775 91911 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082377.1 protein_id gnl|my_center|LOCUS_21710 92092 93096 gene locus_tag LOCUS_21720 92092 93096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 93807 93130 gene locus_tag LOCUS_21730 93807 93130 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_21730 94594 93944 gene locus_tag LOCUS_21740 94594 93944 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 protein_id gnl|my_center|LOCUS_21740 94733 95167 gene locus_tag LOCUS_21750 94733 95167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 96314 95541 gene locus_tag LOCUS_21760 96314 95541 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_21760 97360 96317 gene locus_tag LOCUS_21770 gene bamC 97360 96317 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 protein_id gnl|my_center|LOCUS_21770 98271 97357 gene locus_tag LOCUS_21780 gene dapA 98271 97357 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_21780 99467 98535 gene locus_tag LOCUS_21790 99467 98535 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_21790 99785 99552 gene locus_tag LOCUS_21800 99785 99552 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456658.1 protein_id gnl|my_center|LOCUS_21800 101087 99900 gene locus_tag LOCUS_21810 gene fabV 101087 99900 CDS product enoyl-ACP reductase FabV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102929.1 protein_id gnl|my_center|LOCUS_21810 101262 101657 gene locus_tag LOCUS_21820 101262 101657 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930300.1 protein_id gnl|my_center|LOCUS_21820 101796 102899 gene locus_tag LOCUS_21830 101796 102899 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073777.1 protein_id gnl|my_center|LOCUS_21830 103488 102931 gene locus_tag LOCUS_21840 gene cosR 103488 102931 CDS product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_21840 103721 104230 gene locus_tag LOCUS_21850 gene ectA 103721 104230 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640101.1 protein_id gnl|my_center|LOCUS_21850 104259 105620 gene locus_tag LOCUS_21860 gene ectB 104259 105620 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 protein_id gnl|my_center|LOCUS_21860 105711 106115 gene locus_tag LOCUS_21870 105711 106115 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 protein_id gnl|my_center|LOCUS_21870 106177 107616 gene locus_tag LOCUS_21880 106177 107616 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 protein_id gnl|my_center|LOCUS_21880 107543 107782 gene locus_tag LOCUS_21890 107543 107782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 107790 109211 gene locus_tag LOCUS_21900 107790 109211 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867906.1 protein_id gnl|my_center|LOCUS_21900 110293 109199 gene locus_tag LOCUS_21910 gene alr 110293 109199 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769528.1 protein_id gnl|my_center|LOCUS_21910 111192 110335 gene locus_tag LOCUS_21920 111192 110335 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947239.1 protein_id gnl|my_center|LOCUS_21920 112163 111297 gene locus_tag LOCUS_21930 112163 111297 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_21930 113126 112185 gene locus_tag LOCUS_21940 113126 112185 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261966.1 protein_id gnl|my_center|LOCUS_21940 113794 113123 gene locus_tag LOCUS_21950 gene pxpB 113794 113123 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_21950 114534 113800 gene locus_tag LOCUS_21960 114534 113800 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 protein_id gnl|my_center|LOCUS_21960 115342 114560 gene locus_tag LOCUS_21970 115342 114560 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930607.1 protein_id gnl|my_center|LOCUS_21970 116046 115528 gene locus_tag LOCUS_21980 116046 115528 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172875.1 protein_id gnl|my_center|LOCUS_21980 116308 117063 gene locus_tag LOCUS_21990 116308 117063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 117038 118531 gene locus_tag LOCUS_22000 117038 118531 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_22000 118528 119220 gene locus_tag LOCUS_22010 118528 119220 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_22010 119233 120042 gene locus_tag LOCUS_22020 119233 120042 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477831.1 protein_id gnl|my_center|LOCUS_22020 120054 120710 gene locus_tag LOCUS_22030 120054 120710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_22030 120720 121379 gene locus_tag LOCUS_22040 120720 121379 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_22040 121376 122686 gene locus_tag LOCUS_22050 121376 122686 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_22050 122687 123049 gene locus_tag LOCUS_22060 122687 123049 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813580.1 protein_id gnl|my_center|LOCUS_22060 123057 123854 gene locus_tag LOCUS_22070 123057 123854 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599446.1 protein_id gnl|my_center|LOCUS_22070 123856 124593 gene locus_tag LOCUS_22080 123856 124593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 125002 124619 gene locus_tag LOCUS_22090 gene gloA 125002 124619 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_22090 125300 126034 gene locus_tag LOCUS_22100 125300 126034 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094029.1 protein_id gnl|my_center|LOCUS_22100 126710 126111 gene locus_tag LOCUS_22110 126710 126111 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_22110 127583 126849 gene locus_tag LOCUS_22120 127583 126849 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_22120 130199 127842 gene locus_tag LOCUS_22130 130199 127842 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_22130 130711 130283 gene locus_tag LOCUS_22140 130711 130283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 132294 130867 gene locus_tag LOCUS_22150 gene ccoG 132294 130867 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_22150 133229 132330 gene locus_tag LOCUS_22160 gene ccoP 133229 132330 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 protein_id gnl|my_center|LOCUS_22160 133423 133244 gene locus_tag LOCUS_22170 133423 133244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 134037 133423 gene locus_tag LOCUS_22180 gene ccoO 134037 133423 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_22180 135496 134051 gene locus_tag LOCUS_22190 gene ccoN 135496 134051 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_22190 136854 135631 gene locus_tag LOCUS_22200 136854 135631 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_22200 137085 138116 gene locus_tag LOCUS_22210 gene pyrC 137085 138116 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_22210 138119 138733 gene locus_tag LOCUS_22220 gene rnt 138119 138733 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_22220 138805 139122 gene locus_tag LOCUS_22230 138805 139122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 139519 139199 gene locus_tag LOCUS_22240 139519 139199 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_22240 140771 139551 gene locus_tag LOCUS_22250 140771 139551 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_22250 141176 143446 gene locus_tag LOCUS_22260 gene maeB 141176 143446 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344299.1 protein_id gnl|my_center|LOCUS_22260 143730 143521 gene locus_tag LOCUS_22270 143730 143521 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086099.1 protein_id gnl|my_center|LOCUS_22270 144415 143810 gene locus_tag LOCUS_22280 144415 143810 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_22280 144913 144578 gene locus_tag LOCUS_22290 gene grxD 144913 144578 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_22290 145167 146336 gene locus_tag LOCUS_22300 145167 146336 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_22300 146343 147266 gene locus_tag LOCUS_22310 gene argF 146343 147266 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_22310 147796 147272 gene locus_tag LOCUS_22320 147796 147272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 148766 147978 gene locus_tag LOCUS_22330 gene murI 148766 147978 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence09 1 77 gene locus_tag LOCUS_t00290 1 77 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 478 1128 gene locus_tag LOCUS_22340 478 1128 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393845.1 protein_id gnl|my_center|LOCUS_22340 1139 1759 gene locus_tag LOCUS_22350 gene cysC 1139 1759 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_22350 1828 3018 gene locus_tag LOCUS_22360 gene sat 1828 3018 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_22360 3089 4051 gene locus_tag LOCUS_22370 3089 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_22370 4176 5654 gene locus_tag LOCUS_22380 4176 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 6126 5722 gene locus_tag LOCUS_22390 gene mce 6126 5722 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969152.1 protein_id gnl|my_center|LOCUS_22390 7170 6193 gene locus_tag LOCUS_22400 gene meaB 7170 6193 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_22400 9244 7256 gene locus_tag LOCUS_22410 9244 7256 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_22410 10859 9327 gene locus_tag LOCUS_22420 10859 9327 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_22420 13122 10981 gene locus_tag LOCUS_22430 gene scpA 13122 10981 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_22430 13433 14425 gene locus_tag LOCUS_22440 13433 14425 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_22440 15246 14422 gene locus_tag LOCUS_22450 gene fabG 15246 14422 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_22450 15456 16913 gene locus_tag LOCUS_22460 gene gabD 15456 16913 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772868.1 protein_id gnl|my_center|LOCUS_22460 16980 17759 gene locus_tag LOCUS_22470 16980 17759 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_22470 17835 18722 gene locus_tag LOCUS_22480 17835 18722 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388937.1 protein_id gnl|my_center|LOCUS_22480 19864 18650 gene locus_tag LOCUS_22490 gene nhaA 19864 18650 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387889.1 protein_id gnl|my_center|LOCUS_22490 20579 20031 gene locus_tag LOCUS_22500 20579 20031 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201528.1 protein_id gnl|my_center|LOCUS_22500 21467 20610 gene locus_tag LOCUS_22510 21467 20610 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_22510 24706 21851 gene locus_tag LOCUS_22520 gene gcvP 24706 21851 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115850.1 protein_id gnl|my_center|LOCUS_22520 25949 24891 gene locus_tag LOCUS_22530 gene gcvT 25949 24891 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266821.1 protein_id gnl|my_center|LOCUS_22530 26132 26980 gene locus_tag LOCUS_22540 26132 26980 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_22540 27020 27538 gene locus_tag LOCUS_22550 27020 27538 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_22550 28342 27635 gene locus_tag LOCUS_22560 28342 27635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_22560 30507 28357 gene locus_tag LOCUS_22570 30507 28357 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_22570 30980 31462 gene locus_tag LOCUS_22580 30980 31462 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_22580 32848 31580 gene locus_tag LOCUS_22590 gene rimO 32848 31580 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064698.1 protein_id gnl|my_center|LOCUS_22590 32938 33093 gene locus_tag LOCUS_22600 32938 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 33810 33028 gene locus_tag LOCUS_22610 33810 33028 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 protein_id gnl|my_center|LOCUS_22610 34578 34009 gene locus_tag LOCUS_22620 34578 34009 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 protein_id gnl|my_center|LOCUS_22620 35386 34730 gene locus_tag LOCUS_22630 35386 34730 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 protein_id gnl|my_center|LOCUS_22630 36103 35402 gene locus_tag LOCUS_22640 36103 35402 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_22640 36249 37142 gene locus_tag LOCUS_22650 36249 37142 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 protein_id gnl|my_center|LOCUS_22650 37195 37635 gene locus_tag LOCUS_22660 37195 37635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 37724 38278 gene locus_tag LOCUS_22670 37724 38278 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 protein_id gnl|my_center|LOCUS_22670 38575 38288 gene locus_tag LOCUS_22680 38575 38288 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764940.1 protein_id gnl|my_center|LOCUS_22680 39816 38599 gene locus_tag LOCUS_22690 39816 38599 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_22690 39905 40192 gene locus_tag LOCUS_22700 39905 40192 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_22700 40493 40236 gene locus_tag LOCUS_22710 40493 40236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 40864 40490 gene locus_tag LOCUS_22720 40864 40490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 40769 41047 gene locus_tag LOCUS_22730 40769 41047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 41055 41876 gene locus_tag LOCUS_22740 41055 41876 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356902.1 protein_id gnl|my_center|LOCUS_22740 41878 42228 gene locus_tag LOCUS_22750 41878 42228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 42337 42732 gene locus_tag LOCUS_22760 42337 42732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 42899 44086 gene locus_tag LOCUS_22770 42899 44086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 44724 44242 gene locus_tag LOCUS_22780 44724 44242 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 protein_id gnl|my_center|LOCUS_22780 45563 44769 gene locus_tag LOCUS_22790 45563 44769 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986856.1 protein_id gnl|my_center|LOCUS_22790 46572 45592 gene locus_tag LOCUS_22800 gene lipA 46572 45592 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_22800 47336 46626 gene locus_tag LOCUS_22810 gene lipB 47336 46626 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261452.1 protein_id gnl|my_center|LOCUS_22810 47602 47333 gene locus_tag LOCUS_22820 47602 47333 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_22820 48774 47602 gene locus_tag LOCUS_22830 48774 47602 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_22830 49719 48847 gene locus_tag LOCUS_22840 gene rlpA 49719 48847 CDS product septal ring lytic transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100310.1 protein_id gnl|my_center|LOCUS_22840 50683 49703 gene locus_tag LOCUS_22850 gene mltB 50683 49703 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_22850 51779 50721 gene locus_tag LOCUS_22860 gene mrdB 51779 50721 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_22860 53673 51850 gene locus_tag LOCUS_22870 gene mrdA 53673 51850 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_22870 55999 53846 gene locus_tag LOCUS_22880 gene pnp 55999 53846 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 protein_id gnl|my_center|LOCUS_22880 56324 56058 gene locus_tag LOCUS_22890 gene rpsO 56324 56058 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555121.1 protein_id gnl|my_center|LOCUS_22890 57397 56453 gene locus_tag LOCUS_22900 gene truB 57397 56453 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_22900 57798 57400 gene locus_tag LOCUS_22910 gene rbfA 57798 57400 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 protein_id gnl|my_center|LOCUS_22910 60369 57820 gene locus_tag LOCUS_22920 gene infB 60369 57820 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 protein_id gnl|my_center|LOCUS_22920 61871 60399 gene locus_tag LOCUS_22930 gene nusA 61871 60399 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_22930 62340 61912 gene locus_tag LOCUS_22940 gene rimP 62340 61912 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_22940 62587 62511 gene locus_tag LOCUS_t00300 62587 62511 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 62975 64726 gene locus_tag LOCUS_22950 62975 64726 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112847.1 protein_id gnl|my_center|LOCUS_22950 64900 65232 gene locus_tag LOCUS_22960 64900 65232 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509441.1 protein_id gnl|my_center|LOCUS_22960 65311 66357 gene locus_tag LOCUS_22970 65311 66357 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_22970 66382 67263 gene locus_tag LOCUS_22980 66382 67263 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_22980 67472 67388 gene locus_tag LOCUS_t00310 67472 67388 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67881 67492 gene locus_tag LOCUS_22990 gene secG 67881 67492 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095194.1 protein_id gnl|my_center|LOCUS_22990 68635 67895 gene locus_tag LOCUS_23000 gene tpiA 68635 67895 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100513.1 protein_id gnl|my_center|LOCUS_23000 70137 68797 gene locus_tag LOCUS_23010 gene glmM 70137 68797 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_23010 70980 70141 gene locus_tag LOCUS_23020 gene folP 70980 70141 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_23020 73006 71093 gene locus_tag LOCUS_23030 gene ftsH 73006 71093 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_23030 73730 73104 gene locus_tag LOCUS_23040 gene rlmE 73730 73104 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071426.1 protein_id gnl|my_center|LOCUS_23040 73787 74107 gene locus_tag LOCUS_23050 gene yhbY 73787 74107 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207458.1 protein_id gnl|my_center|LOCUS_23050 74602 74126 gene locus_tag LOCUS_23060 gene greA 74602 74126 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 protein_id gnl|my_center|LOCUS_23060 77820 74602 gene locus_tag LOCUS_23070 gene carB 77820 74602 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 protein_id gnl|my_center|LOCUS_23070 79140 77941 gene locus_tag LOCUS_23080 gene carA 79140 77941 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 protein_id gnl|my_center|LOCUS_23080 80383 79580 gene locus_tag LOCUS_23090 gene dapB 80383 79580 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_23090 81573 80443 gene locus_tag LOCUS_23100 gene dnaJ 81573 80443 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377482.1 protein_id gnl|my_center|LOCUS_23100 83652 81733 gene locus_tag LOCUS_23110 gene dnaK 83652 81733 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400158.1 protein_id gnl|my_center|LOCUS_23110 84313 83729 gene locus_tag LOCUS_23120 gene grpE 84313 83729 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095213.1 protein_id gnl|my_center|LOCUS_23120 84470 86152 gene locus_tag LOCUS_23130 gene recN 84470 86152 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 protein_id gnl|my_center|LOCUS_23130 86457 86834 gene locus_tag LOCUS_23140 86457 86834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 87535 86831 gene locus_tag LOCUS_23150 87535 86831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 87764 88981 gene locus_tag LOCUS_23160 87764 88981 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054775797.1 protein_id gnl|my_center|LOCUS_23160 89400 88993 gene locus_tag LOCUS_23170 gene fur 89400 88993 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 protein_id gnl|my_center|LOCUS_23170 89546 89857 gene locus_tag LOCUS_23180 89546 89857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 90178 89858 gene locus_tag LOCUS_23190 90178 89858 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095218.1 protein_id gnl|my_center|LOCUS_23190 90612 90175 gene locus_tag LOCUS_23200 90612 90175 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 protein_id gnl|my_center|LOCUS_23200 91433 90612 gene locus_tag LOCUS_23210 91433 90612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence10 1210 332 gene locus_tag LOCUS_23220 gene prmA 1210 332 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_23220 2633 1293 gene locus_tag LOCUS_23230 gene accC 2633 1293 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095391.1 protein_id gnl|my_center|LOCUS_23230 3117 2659 gene locus_tag LOCUS_23240 gene accB 3117 2659 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_23240 3591 3151 gene locus_tag LOCUS_23250 gene aroQ 3591 3151 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_23250 5594 3864 gene locus_tag LOCUS_23260 5594 3864 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035768.1 protein_id gnl|my_center|LOCUS_23260 5792 6238 gene locus_tag LOCUS_23270 5792 6238 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105385.1 protein_id gnl|my_center|LOCUS_23270 6235 7287 gene locus_tag LOCUS_23280 6235 7287 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_23280 7339 9849 gene locus_tag LOCUS_23290 7339 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 10872 9841 gene locus_tag LOCUS_23300 10872 9841 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_23300 11021 13306 gene locus_tag LOCUS_23310 gene mrcB 11021 13306 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_23310 13300 13791 gene locus_tag LOCUS_23320 13300 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 13956 16151 gene locus_tag LOCUS_23330 13956 16151 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036078.1 protein_id gnl|my_center|LOCUS_23330 16141 16521 gene locus_tag LOCUS_23340 16141 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 17570 16515 gene locus_tag LOCUS_23350 17570 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 18279 17563 gene locus_tag LOCUS_23360 gene rsuA 18279 17563 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365676.1 protein_id gnl|my_center|LOCUS_23360 18996 18340 gene locus_tag LOCUS_23370 18996 18340 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_23370 19129 19617 gene locus_tag LOCUS_23380 19129 19617 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555745.1 protein_id gnl|my_center|LOCUS_23380 19618 21897 gene locus_tag LOCUS_23390 gene ptsP 19618 21897 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_23390 22671 21913 gene locus_tag LOCUS_23400 22671 21913 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_23400 22753 23556 gene locus_tag LOCUS_23410 gene lgt 22753 23556 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_23410 23576 24481 gene locus_tag LOCUS_23420 gene thyA 23576 24481 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679609.1 protein_id gnl|my_center|LOCUS_23420 24486 24998 gene locus_tag LOCUS_23430 gene folA 24486 24998 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_23430 25086 25931 gene locus_tag LOCUS_23440 25086 25931 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_23440 25928 27298 gene locus_tag LOCUS_23450 25928 27298 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_23450 27302 27817 gene locus_tag LOCUS_23460 27302 27817 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_23460 27835 28236 gene locus_tag LOCUS_23470 27835 28236 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_23470 28242 28847 gene locus_tag LOCUS_23480 28242 28847 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263092.1 protein_id gnl|my_center|LOCUS_23480 28851 30203 gene locus_tag LOCUS_23490 28851 30203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_23490 32123 30282 gene locus_tag LOCUS_23500 gene ilvD 32123 30282 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105291.1 protein_id gnl|my_center|LOCUS_23500 33502 32195 gene locus_tag LOCUS_23510 gene argA 33502 32195 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403912.1 protein_id gnl|my_center|LOCUS_23510 34735 33533 gene locus_tag LOCUS_23520 gene argE 34735 33533 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419049.1 protein_id gnl|my_center|LOCUS_23520 34994 34755 gene locus_tag LOCUS_23530 34994 34755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 35205 36983 gene locus_tag LOCUS_23540 35205 36983 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_23540 37056 39959 gene locus_tag LOCUS_23550 gene glnE 37056 39959 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266458.1 protein_id gnl|my_center|LOCUS_23550 40013 40942 gene locus_tag LOCUS_23560 gene ilvE 40013 40942 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_23560 41023 42003 gene locus_tag LOCUS_23570 gene waaF 41023 42003 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266459.1 protein_id gnl|my_center|LOCUS_23570 42000 43064 gene locus_tag LOCUS_23580 gene waaC 42000 43064 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_23580 43064 44197 gene locus_tag LOCUS_23590 43064 44197 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_23590 44194 45009 gene locus_tag LOCUS_23600 gene rfaP 44194 45009 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001357918.1 protein_id gnl|my_center|LOCUS_23600 45009 45740 gene locus_tag LOCUS_23610 45009 45740 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_23610 45741 46511 gene locus_tag LOCUS_23620 45741 46511 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266464.1 protein_id gnl|my_center|LOCUS_23620 46504 47922 gene locus_tag LOCUS_23630 46504 47922 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_23630 47925 49661 gene locus_tag LOCUS_23640 47925 49661 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377131.1 protein_id gnl|my_center|LOCUS_23640 49681 50562 gene locus_tag LOCUS_23650 49681 50562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 50589 51437 gene locus_tag LOCUS_23660 50589 51437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 52400 51489 gene locus_tag LOCUS_23670 52400 51489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 53566 52424 gene locus_tag LOCUS_23680 53566 52424 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109898.1 protein_id gnl|my_center|LOCUS_23680 54775 53573 gene locus_tag LOCUS_23690 54775 53573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 55480 54827 gene locus_tag LOCUS_23700 55480 54827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762975.1 protein_id gnl|my_center|LOCUS_23700 55564 56988 gene locus_tag LOCUS_23710 gene hldE 55564 56988 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095747.1 protein_id gnl|my_center|LOCUS_23710 57800 56997 gene locus_tag LOCUS_23720 57800 56997 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_23720 59029 57803 gene locus_tag LOCUS_23730 59029 57803 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_23730 59187 60467 gene locus_tag LOCUS_23740 gene waaA 59187 60467 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698007.1 protein_id gnl|my_center|LOCUS_23740 61860 60445 gene locus_tag LOCUS_23750 gene opmH 61860 60445 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_23750 62134 62781 gene locus_tag LOCUS_23760 gene nudF 62134 62781 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150037.1 protein_id gnl|my_center|LOCUS_23760 62853 63311 gene locus_tag LOCUS_23770 62853 63311 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551796.1 protein_id gnl|my_center|LOCUS_23770 63363 64160 gene locus_tag LOCUS_23780 gene cpdA 63363 64160 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703511.1 protein_id gnl|my_center|LOCUS_23780 64254 64844 gene locus_tag LOCUS_23790 gene yqiA 64254 64844 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077091.1 protein_id gnl|my_center|LOCUS_23790 64841 66724 gene locus_tag LOCUS_23800 gene parE 64841 66724 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_23800 66787 69603 gene locus_tag LOCUS_23810 66787 69603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 69648 71903 gene locus_tag LOCUS_23820 gene parC 69648 71903 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762992.1 protein_id gnl|my_center|LOCUS_23820 72025 72189 gene locus_tag LOCUS_23830 72025 72189 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262271.1 protein_id gnl|my_center|LOCUS_23830 72221 72433 gene locus_tag LOCUS_23840 72221 72433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 72437 72823 gene locus_tag LOCUS_23850 72437 72823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 72847 73653 gene locus_tag LOCUS_23860 gene mscS 72847 73653 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_23860 73716 73964 gene locus_tag LOCUS_23870 73716 73964 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 protein_id gnl|my_center|LOCUS_23870 74011 74409 gene locus_tag LOCUS_23880 74011 74409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 76244 74493 gene locus_tag LOCUS_23890 gene aceK 76244 74493 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706819.1 protein_id gnl|my_center|LOCUS_23890 76937 76263 gene locus_tag LOCUS_23900 76937 76263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 77970 76846 gene locus_tag LOCUS_23910 77970 76846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 77942 78061 gene locus_tag LOCUS_23920 77942 78061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 78188 80158 gene locus_tag LOCUS_23930 78188 80158 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_23930 80233 81603 gene locus_tag LOCUS_23940 gene radA 80233 81603 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 protein_id gnl|my_center|LOCUS_23940 82032 83981 gene locus_tag LOCUS_23950 82032 83981 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_23950 84009 84704 gene locus_tag LOCUS_23960 84009 84704 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_23960 84701 85624 gene locus_tag LOCUS_23970 84701 85624 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_23970 85634 86227 gene locus_tag LOCUS_23980 gene cobO 85634 86227 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210626.1 protein_id gnl|my_center|LOCUS_23980 86251 87267 gene locus_tag LOCUS_23990 86251 87267 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073469.1 protein_id gnl|my_center|LOCUS_23990 87272 88042 gene locus_tag LOCUS_24000 87272 88042 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095098.1 protein_id gnl|my_center|LOCUS_24000 88044 88907 gene locus_tag LOCUS_24010 88044 88907 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_24010 90317 89007 gene locus_tag LOCUS_24020 90317 89007 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739890.1 protein_id gnl|my_center|LOCUS_24020 90621 90896 gene locus_tag LOCUS_24030 90621 90896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence11 <1 1607 gene locus_tag LOCUS_24040 <1 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147473.1:Ig-like domain-containing protein 1724 2719 gene locus_tag LOCUS_24050 1724 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2807 4927 gene locus_tag LOCUS_24060 2807 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 4924 7110 gene locus_tag LOCUS_24070 4924 7110 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739071.1 protein_id gnl|my_center|LOCUS_24070 7111 8418 gene locus_tag LOCUS_24080 7111 8418 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528237.1 protein_id gnl|my_center|LOCUS_24080 8434 10713 gene locus_tag LOCUS_24090 8434 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 14048 10761 gene locus_tag LOCUS_24100 14048 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 14586 14191 gene locus_tag LOCUS_24110 14586 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 15009 14821 gene locus_tag LOCUS_24120 15009 14821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 15183 15093 gene locus_tag LOCUS_t00320 15183 15093 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18255 15325 gene locus_tag LOCUS_24130 gene rne 18255 15325 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895645.1 protein_id gnl|my_center|LOCUS_24130 18931 19878 gene locus_tag LOCUS_24140 gene rluC 18931 19878 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104143.1 protein_id gnl|my_center|LOCUS_24140 19885 20541 gene locus_tag LOCUS_24150 19885 20541 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770637.1 protein_id gnl|my_center|LOCUS_24150 21131 20562 gene locus_tag LOCUS_24160 21131 20562 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 protein_id gnl|my_center|LOCUS_24160 21285 21788 gene locus_tag LOCUS_24170 21285 21788 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_24170 21813 21992 gene locus_tag LOCUS_24180 gene rpmF 21813 21992 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010368401.1 protein_id gnl|my_center|LOCUS_24180 22278 23033 gene locus_tag LOCUS_24190 22278 23033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 23058 23993 gene locus_tag LOCUS_24200 gene fabD 23058 23993 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097121.1 protein_id gnl|my_center|LOCUS_24200 24022 24765 gene locus_tag LOCUS_24210 gene fabG 24022 24765 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091137.1 protein_id gnl|my_center|LOCUS_24210 24940 25176 gene locus_tag LOCUS_24220 gene acpP 24940 25176 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081231.1 protein_id gnl|my_center|LOCUS_24220 25272 26111 gene locus_tag LOCUS_24230 gene pabC 25272 26111 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_24230 26099 27130 gene locus_tag LOCUS_24240 gene mltG 26099 27130 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_24240 27151 27789 gene locus_tag LOCUS_24250 gene tmk 27151 27789 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_24250 27789 28739 gene locus_tag LOCUS_24260 27789 28739 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770613.1 protein_id gnl|my_center|LOCUS_24260 28831 29190 gene locus_tag LOCUS_24270 28831 29190 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_24270 29216 30016 gene locus_tag LOCUS_24280 29216 30016 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104742.1 protein_id gnl|my_center|LOCUS_24280 31105 30134 gene locus_tag LOCUS_24290 31105 30134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 34003 31121 gene locus_tag LOCUS_24300 34003 31121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 34973 33993 gene locus_tag LOCUS_24310 34973 33993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence12 956 399 gene locus_tag LOCUS_24320 956 399 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_24320 1065 2441 gene locus_tag LOCUS_24330 1065 2441 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_24330 3279 2458 gene locus_tag LOCUS_24340 gene queF 3279 2458 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459155.1 protein_id gnl|my_center|LOCUS_24340 4061 3288 gene locus_tag LOCUS_24350 4061 3288 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090884.1 protein_id gnl|my_center|LOCUS_24350 4999 4058 gene locus_tag LOCUS_24360 4999 4058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_24360 5548 6612 gene locus_tag LOCUS_24370 5548 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 6609 7007 gene locus_tag LOCUS_24380 6609 7007 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142269.1 protein_id gnl|my_center|LOCUS_24380 7007 9070 gene locus_tag LOCUS_24390 7007 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 9281 10486 gene locus_tag LOCUS_24400 9281 10486 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_24400 10486 14448 gene locus_tag LOCUS_24410 10486 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 16569 14485 gene locus_tag LOCUS_24420 16569 14485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 16906 16586 gene locus_tag LOCUS_24430 16906 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 17269 16958 gene locus_tag LOCUS_24440 17269 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 17528 17453 gene locus_tag LOCUS_t00330 17528 17453 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17627 17552 gene locus_tag LOCUS_t00340 17627 17552 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 18154 17759 gene locus_tag LOCUS_24450 gene msrB 18154 17759 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766799.1 protein_id gnl|my_center|LOCUS_24450 18244 19500 gene locus_tag LOCUS_24460 18244 19500 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_24460 20618 19485 gene locus_tag LOCUS_24470 20618 19485 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_24470 20719 20895 gene locus_tag LOCUS_24480 20719 20895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 21989 20892 gene locus_tag LOCUS_24490 gene pdxB 21989 20892 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706175.1 protein_id gnl|my_center|LOCUS_24490 22927 21986 gene locus_tag LOCUS_24500 22927 21986 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_24500 23445 22927 gene locus_tag LOCUS_24510 23445 22927 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947623.1 protein_id gnl|my_center|LOCUS_24510 23947 23480 gene locus_tag LOCUS_24520 23947 23480 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200916.1 protein_id gnl|my_center|LOCUS_24520 24095 24790 gene locus_tag LOCUS_24530 24095 24790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 25733 25080 gene locus_tag LOCUS_24540 25733 25080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_24540 25966 25730 gene locus_tag LOCUS_24550 25966 25730 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 protein_id gnl|my_center|LOCUS_24550 26775 25963 gene locus_tag LOCUS_24560 26775 25963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_24560 26897 27421 gene locus_tag LOCUS_24570 26897 27421 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269179.1 protein_id gnl|my_center|LOCUS_24570 28198 27428 gene locus_tag LOCUS_24580 28198 27428 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_24580 29245 28262 gene locus_tag LOCUS_24590 29245 28262 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_24590 29850 29386 gene locus_tag LOCUS_24600 gene trmL 29850 29386 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 protein_id gnl|my_center|LOCUS_24600 30119 31336 gene locus_tag LOCUS_24610 gene zigA 30119 31336 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 protein_id gnl|my_center|LOCUS_24610 31333 32007 gene locus_tag LOCUS_24620 31333 32007 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269410.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence13 298 960 gene locus_tag LOCUS_24630 298 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 967 2493 gene locus_tag LOCUS_24640 967 2493 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_24640 2490 3449 gene locus_tag LOCUS_24650 2490 3449 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457241.1 protein_id gnl|my_center|LOCUS_24650 3557 3997 gene locus_tag LOCUS_24660 3557 3997 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455203.1 protein_id gnl|my_center|LOCUS_24660 4173 4679 gene locus_tag LOCUS_24670 4173 4679 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_24670 4865 5869 gene locus_tag LOCUS_24680 gene moaA 4865 5869 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_24680 5936 6523 gene locus_tag LOCUS_24690 5936 6523 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090904.1 protein_id gnl|my_center|LOCUS_24690 6727 7296 gene locus_tag LOCUS_24700 6727 7296 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_24700 8322 8588 gene locus_tag LOCUS_24710 8322 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 8625 9980 gene locus_tag LOCUS_24720 8625 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 10038 11042 gene locus_tag LOCUS_24730 10038 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24730 11050 12195 gene locus_tag LOCUS_24740 11050 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24740 12329 12643 gene locus_tag LOCUS_24750 12329 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 13410 14795 gene locus_tag LOCUS_24760 13410 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 14831 15127 gene locus_tag LOCUS_24770 14831 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 15147 16043 gene locus_tag LOCUS_24780 15147 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 17254 16118 gene locus_tag LOCUS_24790 gene moeB 17254 16118 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_24790 18783 17263 gene locus_tag LOCUS_24800 gene thiE 18783 17263 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957510.1 protein_id gnl|my_center|LOCUS_24800 19562 18786 gene locus_tag LOCUS_24810 19562 18786 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444472.1 protein_id gnl|my_center|LOCUS_24810 19769 19566 gene locus_tag LOCUS_24820 19769 19566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 20951 19797 gene locus_tag LOCUS_24830 gene thiO 20951 19797 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957508.1 protein_id gnl|my_center|LOCUS_24830 22845 21004 gene locus_tag LOCUS_24840 gene thiC 22845 21004 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_24840 24370 23129 gene locus_tag LOCUS_24850 24370 23129 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_24850 24637 25641 gene locus_tag LOCUS_24860 gene moaA 24637 25641 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_24860 25653 26861 gene locus_tag LOCUS_24870 25653 26861 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_24870 26934 27281 gene locus_tag LOCUS_24880 26934 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 27701 27225 gene locus_tag LOCUS_24890 27701 27225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence14 203 880 gene locus_tag LOCUS_24900 203 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 892 1440 gene locus_tag LOCUS_24910 892 1440 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938122.1 protein_id gnl|my_center|LOCUS_24910 2361 1633 gene locus_tag LOCUS_24920 gene hisA 2361 1633 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246848.1 protein_id gnl|my_center|LOCUS_24920 3094 2441 gene locus_tag LOCUS_24930 gene hisH 3094 2441 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_24930 3702 3109 gene locus_tag LOCUS_24940 gene hisB 3702 3109 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_24940 3830 4108 gene locus_tag LOCUS_24950 3830 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 4161 6173 gene locus_tag LOCUS_24960 4161 6173 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_24960 6311 8428 gene locus_tag LOCUS_24970 6311 8428 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072519.1 protein_id gnl|my_center|LOCUS_24970 8428 9495 gene locus_tag LOCUS_24980 gene mutY 8428 9495 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148958.1 protein_id gnl|my_center|LOCUS_24980 9500 9772 gene locus_tag LOCUS_24990 9500 9772 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_24990 9849 9924 gene locus_tag LOCUS_t00350 9849 9924 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11278 10115 gene locus_tag LOCUS_25000 11278 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 12027 11434 gene locus_tag LOCUS_25010 12027 11434 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_25010 12481 12020 gene locus_tag LOCUS_25020 12481 12020 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891185.1 protein_id gnl|my_center|LOCUS_25020 13431 12961 gene locus_tag LOCUS_25030 13431 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 14062 13541 gene locus_tag LOCUS_25040 14062 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence15 260 730 gene locus_tag LOCUS_25050 260 730 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389664.1 protein_id gnl|my_center|LOCUS_25050 735 1742 gene locus_tag LOCUS_25060 735 1742 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 protein_id gnl|my_center|LOCUS_25060 2358 1750 gene locus_tag LOCUS_25070 2358 1750 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 protein_id gnl|my_center|LOCUS_25070 2474 3181 gene locus_tag LOCUS_25080 2474 3181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_25080 3171 4421 gene locus_tag LOCUS_25090 3171 4421 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400343.1 protein_id gnl|my_center|LOCUS_25090 4489 5028 gene locus_tag LOCUS_25100 gene fldB 4489 5028 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261228.1 protein_id gnl|my_center|LOCUS_25100 5515 5117 gene locus_tag LOCUS_25110 5515 5117 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365982.1 protein_id gnl|my_center|LOCUS_25110 5602 7653 gene locus_tag LOCUS_25120 gene mnmC 5602 7653 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_25120 8067 7666 gene locus_tag LOCUS_25130 8067 7666 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207714.1 protein_id gnl|my_center|LOCUS_25130 8512 8114 gene locus_tag LOCUS_25140 8512 8114 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_25140 9174 8560 gene locus_tag LOCUS_25150 9174 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 9942 9292 gene locus_tag LOCUS_25160 9942 9292 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903563.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence16 188 340 gene locus_tag LOCUS_25170 188 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 354 1661 gene locus_tag LOCUS_25180 354 1661 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_25180 1673 2578 gene locus_tag LOCUS_25190 1673 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190