>Feature sequence001 1497 328 gene locus_tag LOCUS_00010 1497 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1952 2320 gene locus_tag LOCUS_00020 1952 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2248 2829 gene locus_tag LOCUS_00030 2248 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3095 3736 gene locus_tag LOCUS_00040 3095 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3797 4183 gene locus_tag LOCUS_00050 3797 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4528 4956 gene locus_tag LOCUS_00060 4528 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6376 5294 gene locus_tag LOCUS_00070 6376 5294 CDS product IS110-like element IS1618 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211760.1 protein_id gnl|my_center|LOCUS_00070 6839 7180 gene locus_tag LOCUS_00080 6839 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7961 7590 gene locus_tag LOCUS_00090 7961 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9893 7974 gene locus_tag LOCUS_00100 gene pvdE 9893 7974 CDS product pyoverdine export ABC transporter PvdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103601.1 protein_id gnl|my_center|LOCUS_00100 10351 9890 gene locus_tag LOCUS_00110 10351 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11000 10419 gene locus_tag LOCUS_00120 11000 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11500 10997 gene locus_tag LOCUS_00130 11500 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12215 11487 gene locus_tag LOCUS_00140 12215 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12777 13055 gene locus_tag LOCUS_00150 12777 13055 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038251.1 protein_id gnl|my_center|LOCUS_00150 13427 14287 gene locus_tag LOCUS_00160 13427 14287 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480548.1 protein_id gnl|my_center|LOCUS_00160 14698 15774 gene locus_tag LOCUS_00170 14698 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15774 16907 gene locus_tag LOCUS_00180 gene hxsC 15774 16907 CDS product His-Xaa-Ser system radical SAM maturase HxsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457560.1 protein_id gnl|my_center|LOCUS_00180 17390 17566 gene locus_tag LOCUS_00190 17390 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22467 17986 gene locus_tag LOCUS_00200 22467 17986 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389337.1 protein_id gnl|my_center|LOCUS_00200 24949 22601 gene locus_tag LOCUS_00210 24949 22601 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094782041.1 protein_id gnl|my_center|LOCUS_00210 26289 25414 gene locus_tag LOCUS_00220 26289 25414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27096 26293 gene locus_tag LOCUS_00230 27096 26293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29472 27517 gene locus_tag LOCUS_00240 29472 27517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29647 29558 gene locus_tag LOCUS_t00010 29647 29558 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30997 29681 gene locus_tag LOCUS_00250 gene serS 30997 29681 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_00250 31986 31045 gene locus_tag LOCUS_00260 31986 31045 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084230.1 protein_id gnl|my_center|LOCUS_00260 32210 32896 gene locus_tag LOCUS_00270 32210 32896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34305 32950 gene locus_tag LOCUS_00280 34305 32950 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_00280 35491 34490 gene locus_tag LOCUS_00290 gene ispH 35491 34490 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 protein_id gnl|my_center|LOCUS_00290 35984 35496 gene locus_tag LOCUS_00300 35984 35496 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_00300 36045 36755 gene locus_tag LOCUS_00310 gene radC 36045 36755 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053959.1 protein_id gnl|my_center|LOCUS_00310 36752 37945 gene locus_tag LOCUS_00320 36752 37945 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231036.1 protein_id gnl|my_center|LOCUS_00320 38001 38663 gene locus_tag LOCUS_00330 38001 38663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38774 40156 gene locus_tag LOCUS_00340 38774 40156 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 protein_id gnl|my_center|LOCUS_00340 41382 40264 gene locus_tag LOCUS_00350 41382 40264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41993 41400 gene locus_tag LOCUS_00360 41993 41400 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_00360 44560 42458 gene locus_tag LOCUS_00370 44560 42458 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536127.1 protein_id gnl|my_center|LOCUS_00370 45124 44717 gene locus_tag LOCUS_00380 45124 44717 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_00380 45934 45179 gene locus_tag LOCUS_00390 45934 45179 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_00390 48650 46041 gene locus_tag LOCUS_00400 48650 46041 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204961.1 protein_id gnl|my_center|LOCUS_00400 49640 48726 gene locus_tag LOCUS_00410 49640 48726 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706862.1 protein_id gnl|my_center|LOCUS_00410 50141 49734 gene locus_tag LOCUS_00420 50141 49734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567447.1 protein_id gnl|my_center|LOCUS_00420 51361 50138 gene locus_tag LOCUS_00430 51361 50138 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812663.1 protein_id gnl|my_center|LOCUS_00430 51624 51379 gene locus_tag LOCUS_00440 51624 51379 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812666.1 protein_id gnl|my_center|LOCUS_00440 52244 51621 gene locus_tag LOCUS_00450 gene fdh3B 52244 51621 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_00450 55309 52340 gene locus_tag LOCUS_00460 55309 52340 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812670.1 protein_id gnl|my_center|LOCUS_00460 55542 55327 gene locus_tag LOCUS_00470 55542 55327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 56315 55683 gene locus_tag LOCUS_00480 56315 55683 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812672.1 protein_id gnl|my_center|LOCUS_00480 58408 56312 gene locus_tag LOCUS_00490 58408 56312 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607923.1 protein_id gnl|my_center|LOCUS_00490 59066 58332 gene locus_tag LOCUS_00500 59066 58332 CDS product DUF3306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119012887.1 protein_id gnl|my_center|LOCUS_00500 59646 59059 gene locus_tag LOCUS_00510 59646 59059 CDS product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812677.1 protein_id gnl|my_center|LOCUS_00510 60955 59750 gene locus_tag LOCUS_00520 60955 59750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63273 60952 gene locus_tag LOCUS_00530 63273 60952 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037497.1 protein_id gnl|my_center|LOCUS_00530 64966 63443 gene locus_tag LOCUS_00540 64966 63443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 66657 64981 gene locus_tag LOCUS_00550 66657 64981 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037499.1 protein_id gnl|my_center|LOCUS_00550 67018 68265 gene locus_tag LOCUS_00560 67018 68265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 68533 70656 gene locus_tag LOCUS_00570 68533 70656 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_00570 71655 70699 gene locus_tag LOCUS_00580 71655 70699 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338699.1 protein_id gnl|my_center|LOCUS_00580 72806 71715 gene locus_tag LOCUS_00590 gene apbC 72806 71715 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_00590 72923 73507 gene locus_tag LOCUS_00600 72923 73507 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928921.1 protein_id gnl|my_center|LOCUS_00600 73529 74779 gene locus_tag LOCUS_00610 73529 74779 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809440.1 protein_id gnl|my_center|LOCUS_00610 74854 76605 gene locus_tag LOCUS_00620 gene poxB 74854 76605 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994147.1 protein_id gnl|my_center|LOCUS_00620 76706 78832 gene locus_tag LOCUS_00630 gene metG 76706 78832 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929666.1 protein_id gnl|my_center|LOCUS_00630 78888 79169 gene locus_tag LOCUS_00640 78888 79169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 79914 79282 gene locus_tag LOCUS_00650 79914 79282 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970933.1 protein_id gnl|my_center|LOCUS_00650 80512 80006 gene locus_tag LOCUS_00660 80512 80006 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814003.1 protein_id gnl|my_center|LOCUS_00660 80691 80894 gene locus_tag LOCUS_00670 80691 80894 CDS product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193782.1 protein_id gnl|my_center|LOCUS_00670 80964 81842 gene locus_tag LOCUS_00680 80964 81842 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_00680 81988 83589 gene locus_tag LOCUS_00690 gene nadB 81988 83589 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_00690 83646 84026 gene locus_tag LOCUS_00700 83646 84026 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_00700 84023 85399 gene locus_tag LOCUS_00710 gene bioA 84023 85399 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189232.1 protein_id gnl|my_center|LOCUS_00710 85396 86076 gene locus_tag LOCUS_00720 gene bioD 85396 86076 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_00720 86067 87323 gene locus_tag LOCUS_00730 gene bioF 86067 87323 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_00730 87320 87958 gene locus_tag LOCUS_00740 gene queE 87320 87958 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085270.1 protein_id gnl|my_center|LOCUS_00740 88112 88474 gene locus_tag LOCUS_00750 88112 88474 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920994.1 protein_id gnl|my_center|LOCUS_00750 88535 88894 gene locus_tag LOCUS_00760 88535 88894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 89702 89307 gene locus_tag LOCUS_00770 gene arfB 89702 89307 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_00770 90593 89727 gene locus_tag LOCUS_00780 90593 89727 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028646.1 protein_id gnl|my_center|LOCUS_00780 91213 90818 gene locus_tag LOCUS_00790 91213 90818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 91442 93250 gene locus_tag LOCUS_00800 91442 93250 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814246.1 protein_id gnl|my_center|LOCUS_00800 93290 93697 gene locus_tag LOCUS_00810 93290 93697 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_00810 94130 93729 gene locus_tag LOCUS_00820 94130 93729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 94369 95310 gene locus_tag LOCUS_00830 94369 95310 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463551.1 protein_id gnl|my_center|LOCUS_00830 96678 95395 gene locus_tag LOCUS_00840 96678 95395 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275477.1 protein_id gnl|my_center|LOCUS_00840 99108 96877 gene locus_tag LOCUS_00850 99108 96877 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_00850 100523 99234 gene locus_tag LOCUS_00860 gene icd 100523 99234 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_00860 100675 100884 gene locus_tag LOCUS_00870 100675 100884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 101078 101515 gene locus_tag LOCUS_00880 101078 101515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 101692 101617 gene locus_tag LOCUS_t00020 101692 101617 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 102563 101736 gene locus_tag LOCUS_00890 gene tcdA 102563 101736 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_00890 103345 102560 gene locus_tag LOCUS_00900 gene ybgF 103345 102560 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_00900 103887 103345 gene locus_tag LOCUS_00910 gene pal 103887 103345 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_00910 105197 103935 gene locus_tag LOCUS_00920 gene tolB 105197 103935 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_00920 105420 107168 gene locus_tag LOCUS_00930 gene msbA 105420 107168 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186431.1 protein_id gnl|my_center|LOCUS_00930 107951 107277 gene locus_tag LOCUS_00940 107951 107277 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527196.1 protein_id gnl|my_center|LOCUS_00940 108757 107948 gene locus_tag LOCUS_00950 108757 107948 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_00950 109266 108943 gene locus_tag LOCUS_00960 109266 108943 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_00960 110371 109364 gene locus_tag LOCUS_00970 110371 109364 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_00970 111090 110368 gene locus_tag LOCUS_00980 gene tmk 111090 110368 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193022.1 protein_id gnl|my_center|LOCUS_00980 112034 111099 gene locus_tag LOCUS_00990 gene mltG 112034 111099 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446696.1 protein_id gnl|my_center|LOCUS_00990 111919 112140 gene locus_tag LOCUS_01000 111919 112140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 112160 113122 gene locus_tag LOCUS_01010 112160 113122 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_01010 114216 113266 gene locus_tag LOCUS_01020 114216 113266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 115127 114213 gene locus_tag LOCUS_01030 115127 114213 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521279.1 protein_id gnl|my_center|LOCUS_01030 115486 115229 gene locus_tag LOCUS_01040 115486 115229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 115585 118101 gene locus_tag LOCUS_01050 115585 118101 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009956704.1 protein_id gnl|my_center|LOCUS_01050 118146 119306 gene locus_tag LOCUS_01060 118146 119306 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_01060 119331 120410 gene locus_tag LOCUS_01070 119331 120410 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186126.1 protein_id gnl|my_center|LOCUS_01070 120427 120855 gene locus_tag LOCUS_01080 120427 120855 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_01080 120855 121958 gene locus_tag LOCUS_01090 120855 121958 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_01090 122063 123265 gene locus_tag LOCUS_01100 122063 123265 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036849.1 protein_id gnl|my_center|LOCUS_01100 126126 126626 gene locus_tag LOCUS_01110 126126 126626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 126764 127756 gene locus_tag LOCUS_01120 126764 127756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 127746 128981 gene locus_tag LOCUS_01130 127746 128981 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_01130 129105 130250 gene locus_tag LOCUS_01140 129105 130250 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203397.1 protein_id gnl|my_center|LOCUS_01140 132068 132805 gene locus_tag LOCUS_01150 132068 132805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 132927 134354 gene locus_tag LOCUS_01160 gene cpsB 132927 134354 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079256.1 protein_id gnl|my_center|LOCUS_01160 135414 134527 gene locus_tag LOCUS_01170 135414 134527 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088574.1 protein_id gnl|my_center|LOCUS_01170 135476 136615 gene locus_tag LOCUS_01180 135476 136615 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 protein_id gnl|my_center|LOCUS_01180 137895 136660 gene locus_tag LOCUS_01190 137895 136660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_01190 138736 137903 gene locus_tag LOCUS_01200 138736 137903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 141119 138831 gene locus_tag LOCUS_01210 141119 138831 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_01210 141354 141617 gene locus_tag LOCUS_01220 141354 141617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 142000 143553 gene locus_tag LOCUS_01230 142000 143553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 143753 143544 gene locus_tag LOCUS_01240 143753 143544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 143650 144057 gene locus_tag LOCUS_01250 143650 144057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809291.1 protein_id gnl|my_center|LOCUS_01250 144086 145168 gene locus_tag LOCUS_01260 144086 145168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 146677 145241 gene locus_tag LOCUS_01270 146677 145241 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534176.1 protein_id gnl|my_center|LOCUS_01270 147855 146674 gene locus_tag LOCUS_01280 147855 146674 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531018.1 protein_id gnl|my_center|LOCUS_01280 147788 148045 gene locus_tag LOCUS_01290 147788 148045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 149285 148077 gene locus_tag LOCUS_01300 149285 148077 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 protein_id gnl|my_center|LOCUS_01300 149487 150173 gene locus_tag LOCUS_01310 149487 150173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 150440 150916 gene locus_tag LOCUS_01320 150440 150916 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087465.1 protein_id gnl|my_center|LOCUS_01320 151852 150947 gene locus_tag LOCUS_01330 151852 150947 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236296.1 protein_id gnl|my_center|LOCUS_01330 152855 151920 gene locus_tag LOCUS_01340 152855 151920 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_01340 153371 152898 gene locus_tag LOCUS_01350 153371 152898 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 protein_id gnl|my_center|LOCUS_01350 154394 153378 gene locus_tag LOCUS_01360 154394 153378 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 protein_id gnl|my_center|LOCUS_01360 154974 154549 gene locus_tag LOCUS_01370 154974 154549 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193935.1 protein_id gnl|my_center|LOCUS_01370 155825 155034 gene locus_tag LOCUS_01380 155825 155034 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_01380 157823 155970 gene locus_tag LOCUS_01390 157823 155970 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206873.1 protein_id gnl|my_center|LOCUS_01390 158761 157901 gene locus_tag LOCUS_01400 158761 157901 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061777.1 protein_id gnl|my_center|LOCUS_01400 159600 158758 gene locus_tag LOCUS_01410 159600 158758 CDS product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061776.1 protein_id gnl|my_center|LOCUS_01410 160646 159621 gene locus_tag LOCUS_01420 gene tauA 160646 159621 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105422.1 protein_id gnl|my_center|LOCUS_01420 160827 162314 gene locus_tag LOCUS_01430 160827 162314 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_01430 163723 162311 gene locus_tag LOCUS_01440 163723 162311 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975813.1 protein_id gnl|my_center|LOCUS_01440 163903 164298 gene locus_tag LOCUS_01450 163903 164298 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061778.1 protein_id gnl|my_center|LOCUS_01450 164295 165224 gene locus_tag LOCUS_01460 164295 165224 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189104.1 protein_id gnl|my_center|LOCUS_01460 166546 165371 gene locus_tag LOCUS_01470 166546 165371 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 protein_id gnl|my_center|LOCUS_01470 168741 166585 gene locus_tag LOCUS_01480 168741 166585 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192524.1 protein_id gnl|my_center|LOCUS_01480 169555 168860 gene locus_tag LOCUS_01490 169555 168860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_01490 170397 169558 gene locus_tag LOCUS_01500 170397 169558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 171717 170398 gene locus_tag LOCUS_01510 171717 170398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 172676 171723 gene locus_tag LOCUS_01520 172676 171723 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 protein_id gnl|my_center|LOCUS_01520 174012 172816 gene locus_tag LOCUS_01530 174012 172816 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_01530 175854 174214 gene locus_tag LOCUS_01540 175854 174214 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_01540 >Feature sequence002 <1 599 gene locus_tag LOCUS_01550 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194043.1:tyrosine--tRNA ligase 1337 636 gene locus_tag LOCUS_01560 1337 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 2260 1334 gene locus_tag LOCUS_01570 2260 1334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316999.1 protein_id gnl|my_center|LOCUS_01570 3400 2279 gene locus_tag LOCUS_01580 3400 2279 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266763.1 protein_id gnl|my_center|LOCUS_01580 4901 3393 gene locus_tag LOCUS_01590 4901 3393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266762.1 protein_id gnl|my_center|LOCUS_01590 6017 4917 gene locus_tag LOCUS_01600 6017 4917 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406878.1 protein_id gnl|my_center|LOCUS_01600 6490 6104 gene locus_tag LOCUS_01610 6490 6104 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104311.1 protein_id gnl|my_center|LOCUS_01610 7514 6510 gene locus_tag LOCUS_01620 7514 6510 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268040.1 protein_id gnl|my_center|LOCUS_01620 7751 8449 gene locus_tag LOCUS_01630 gene rutR 7751 8449 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083125.1 protein_id gnl|my_center|LOCUS_01630 9485 8487 gene locus_tag LOCUS_01640 gene gcvA 9485 8487 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528901.1 protein_id gnl|my_center|LOCUS_01640 9719 10108 gene locus_tag LOCUS_01650 9719 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 10607 10230 gene locus_tag LOCUS_01660 10607 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 10778 11536 gene locus_tag LOCUS_01670 10778 11536 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529286.1 protein_id gnl|my_center|LOCUS_01670 11681 13177 gene locus_tag LOCUS_01680 gene glmU 11681 13177 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818080.1 protein_id gnl|my_center|LOCUS_01680 13174 13992 gene locus_tag LOCUS_01690 13174 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 14532 14032 gene locus_tag LOCUS_01700 14532 14032 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064827.1 protein_id gnl|my_center|LOCUS_01700 14756 16678 gene locus_tag LOCUS_01710 gene glmS 14756 16678 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_01710 17806 17267 gene locus_tag LOCUS_01720 17806 17267 CDS product CbrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071180.1 protein_id gnl|my_center|LOCUS_01720 19101 18511 gene locus_tag LOCUS_01730 19101 18511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 19497 19219 gene locus_tag LOCUS_01740 19497 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01740 20211 21980 gene locus_tag LOCUS_01750 20211 21980 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525719.1 protein_id gnl|my_center|LOCUS_01750 23488 22028 gene locus_tag LOCUS_01760 23488 22028 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390069.1 protein_id gnl|my_center|LOCUS_01760 23648 24046 gene locus_tag LOCUS_01770 23648 24046 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530049.1 protein_id gnl|my_center|LOCUS_01770 24043 25233 gene locus_tag LOCUS_01780 gene prpC 24043 25233 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065153.1 protein_id gnl|my_center|LOCUS_01780 25271 27925 gene locus_tag LOCUS_01790 gene acnD 25271 27925 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 protein_id gnl|my_center|LOCUS_01790 27922 29124 gene locus_tag LOCUS_01800 gene prpF 27922 29124 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 protein_id gnl|my_center|LOCUS_01800 29151 30011 gene locus_tag LOCUS_01810 29151 30011 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_01810 30944 30033 gene locus_tag LOCUS_01820 30944 30033 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_01820 31053 33344 gene locus_tag LOCUS_01830 gene metE 31053 33344 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114925.1 protein_id gnl|my_center|LOCUS_01830 33668 33787 gene locus_tag LOCUS_01840 33668 33787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 33835 34026 gene locus_tag LOCUS_01850 33835 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 34080 34328 gene locus_tag LOCUS_01860 34080 34328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 34451 36820 gene locus_tag LOCUS_01870 34451 36820 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_01870 36820 37632 gene locus_tag LOCUS_01880 36820 37632 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_01880 37634 38311 gene locus_tag LOCUS_01890 37634 38311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 38308 39159 gene locus_tag LOCUS_01900 38308 39159 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_01900 39277 40494 gene locus_tag LOCUS_01910 39277 40494 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_01910 40573 42201 gene locus_tag LOCUS_01920 40573 42201 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814996.1 protein_id gnl|my_center|LOCUS_01920 42276 43475 gene locus_tag LOCUS_01930 42276 43475 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_01930 43519 44439 gene locus_tag LOCUS_01940 43519 44439 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_01940 44458 45468 gene locus_tag LOCUS_01950 44458 45468 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 protein_id gnl|my_center|LOCUS_01950 45465 46235 gene locus_tag LOCUS_01960 45465 46235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040563.1 protein_id gnl|my_center|LOCUS_01960 46232 46981 gene locus_tag LOCUS_01970 46232 46981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446410.1 protein_id gnl|my_center|LOCUS_01970 46978 47454 gene locus_tag LOCUS_01980 46978 47454 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086198.1 protein_id gnl|my_center|LOCUS_01980 47507 47899 gene locus_tag LOCUS_01990 47507 47899 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814990.1 protein_id gnl|my_center|LOCUS_01990 47911 48777 gene locus_tag LOCUS_02000 47911 48777 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_02000 50685 49111 gene locus_tag LOCUS_02010 50685 49111 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966103.1 protein_id gnl|my_center|LOCUS_02010 51862 50846 gene locus_tag LOCUS_02020 51862 50846 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547256.1 protein_id gnl|my_center|LOCUS_02020 52123 52761 gene locus_tag LOCUS_02030 gene paoA 52123 52761 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275317.1 protein_id gnl|my_center|LOCUS_02030 52765 53715 gene locus_tag LOCUS_02040 52765 53715 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037858.1 protein_id gnl|my_center|LOCUS_02040 53721 55958 gene locus_tag LOCUS_02050 53721 55958 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037857.1 protein_id gnl|my_center|LOCUS_02050 55967 57037 gene locus_tag LOCUS_02060 55967 57037 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812183.1 protein_id gnl|my_center|LOCUS_02060 57051 57731 gene locus_tag LOCUS_02070 57051 57731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 59838 57739 gene locus_tag LOCUS_02080 59838 57739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 60459 59905 gene locus_tag LOCUS_02090 60459 59905 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372548.1 protein_id gnl|my_center|LOCUS_02090 60772 61893 gene locus_tag LOCUS_02100 60772 61893 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_02100 61898 63601 gene locus_tag LOCUS_02110 61898 63601 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268710.1 protein_id gnl|my_center|LOCUS_02110 63685 66663 gene locus_tag LOCUS_02120 63685 66663 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_02120 66688 67413 gene locus_tag LOCUS_02130 gene pdeM 66688 67413 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_02130 69129 67738 gene locus_tag LOCUS_02140 69129 67738 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071311.1 protein_id gnl|my_center|LOCUS_02140 69364 70212 gene locus_tag LOCUS_02150 69364 70212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930753.1 protein_id gnl|my_center|LOCUS_02150 70402 73875 gene locus_tag LOCUS_02160 70402 73875 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036382.1 protein_id gnl|my_center|LOCUS_02160 73881 74732 gene locus_tag LOCUS_02170 73881 74732 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036381.1 protein_id gnl|my_center|LOCUS_02170 74729 75361 gene locus_tag LOCUS_02180 74729 75361 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036380.1 protein_id gnl|my_center|LOCUS_02180 75358 76527 gene locus_tag LOCUS_02190 75358 76527 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036379.1 protein_id gnl|my_center|LOCUS_02190 76950 76570 gene locus_tag LOCUS_02200 76950 76570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 77267 78184 gene locus_tag LOCUS_02210 77267 78184 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_02210 78373 79059 gene locus_tag LOCUS_02220 78373 79059 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_02220 79659 79159 gene locus_tag LOCUS_02230 79659 79159 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197812.1 protein_id gnl|my_center|LOCUS_02230 82261 79676 gene locus_tag LOCUS_02240 gene cphA 82261 79676 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_02240 84675 82333 gene locus_tag LOCUS_02250 gene cphA 84675 82333 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_02250 84897 87137 gene locus_tag LOCUS_02260 84897 87137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_02260 87175 87672 gene locus_tag LOCUS_02270 87175 87672 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_02270 87863 88330 gene locus_tag LOCUS_02280 87863 88330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 88904 88425 gene locus_tag LOCUS_02290 88904 88425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 89842 88904 gene locus_tag LOCUS_02300 89842 88904 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_02300 91277 89886 gene locus_tag LOCUS_02310 gene gspF 91277 89886 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_02310 91346 92899 gene locus_tag LOCUS_02320 91346 92899 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_02320 93105 93764 gene locus_tag LOCUS_02330 93105 93764 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_02330 93761 95209 gene locus_tag LOCUS_02340 93761 95209 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_02340 95206 96594 gene locus_tag LOCUS_02350 95206 96594 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038211423.1 protein_id gnl|my_center|LOCUS_02350 96790 98085 gene locus_tag LOCUS_02360 96790 98085 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528489.1 protein_id gnl|my_center|LOCUS_02360 99580 98543 gene locus_tag LOCUS_02370 99580 98543 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877566.1 protein_id gnl|my_center|LOCUS_02370 100057 100977 gene locus_tag LOCUS_02380 100057 100977 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_02380 101066 101782 gene locus_tag LOCUS_02390 101066 101782 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030074.1 protein_id gnl|my_center|LOCUS_02390 101785 103692 gene locus_tag LOCUS_02400 101785 103692 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_02400 104435 103653 gene locus_tag LOCUS_02410 104435 103653 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 protein_id gnl|my_center|LOCUS_02410 105257 104508 gene locus_tag LOCUS_02420 105257 104508 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529311.1 protein_id gnl|my_center|LOCUS_02420 106609 105368 gene locus_tag LOCUS_02430 106609 105368 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084303.1 protein_id gnl|my_center|LOCUS_02430 106803 106729 gene locus_tag LOCUS_t00030 106803 106729 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 111286 106976 gene locus_tag LOCUS_02440 111286 106976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 113140 111311 gene locus_tag LOCUS_02450 113140 111311 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_02450 114490 113303 gene locus_tag LOCUS_02460 114490 113303 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_02460 115147 114539 gene locus_tag LOCUS_02470 115147 114539 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 protein_id gnl|my_center|LOCUS_02470 116024 115170 gene locus_tag LOCUS_02480 116024 115170 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 protein_id gnl|my_center|LOCUS_02480 116180 116788 gene locus_tag LOCUS_02490 116180 116788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 119475 116908 gene locus_tag LOCUS_02500 119475 116908 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105617.1 protein_id gnl|my_center|LOCUS_02500 120060 119626 gene locus_tag LOCUS_02510 120060 119626 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_02510 121983 120136 gene locus_tag LOCUS_02520 121983 120136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 122942 122139 gene locus_tag LOCUS_02530 122942 122139 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533811.1 protein_id gnl|my_center|LOCUS_02530 123062 123763 gene locus_tag LOCUS_02540 123062 123763 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_02540 123793 124440 gene locus_tag LOCUS_02550 123793 124440 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807676.1 protein_id gnl|my_center|LOCUS_02550 124464 125672 gene locus_tag LOCUS_02560 gene pcaF 124464 125672 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 protein_id gnl|my_center|LOCUS_02560 125687 126487 gene locus_tag LOCUS_02570 gene pcaD 125687 126487 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084070.1 protein_id gnl|my_center|LOCUS_02570 126502 127584 gene locus_tag LOCUS_02580 126502 127584 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038933.1 protein_id gnl|my_center|LOCUS_02580 127696 127992 gene locus_tag LOCUS_02590 127696 127992 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807672.1 protein_id gnl|my_center|LOCUS_02590 128033 128761 gene locus_tag LOCUS_02600 128033 128761 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807684.1 protein_id gnl|my_center|LOCUS_02600 128834 130171 gene locus_tag LOCUS_02610 128834 130171 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446639.1 protein_id gnl|my_center|LOCUS_02610 130230 130514 gene locus_tag LOCUS_02620 gene catC 130230 130514 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807674.1 protein_id gnl|my_center|LOCUS_02620 130586 131578 gene locus_tag LOCUS_02630 130586 131578 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_02630 132168 131626 gene locus_tag LOCUS_02640 132168 131626 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104590.1 protein_id gnl|my_center|LOCUS_02640 132110 132370 gene locus_tag LOCUS_02650 132110 132370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 134457 132289 gene locus_tag LOCUS_02660 134457 132289 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207927.1 protein_id gnl|my_center|LOCUS_02660 136443 134557 gene locus_tag LOCUS_02670 gene kefC 136443 134557 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377098.1 protein_id gnl|my_center|LOCUS_02670 136712 137359 gene locus_tag LOCUS_02680 136712 137359 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266152.1 protein_id gnl|my_center|LOCUS_02680 137515 138135 gene locus_tag LOCUS_02690 137515 138135 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_02690 138222 138686 gene locus_tag LOCUS_02700 gene htdZ 138222 138686 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_02700 139732 138740 gene locus_tag LOCUS_02710 139732 138740 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038941.1 protein_id gnl|my_center|LOCUS_02710 140713 139748 gene locus_tag LOCUS_02720 140713 139748 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808079.1 protein_id gnl|my_center|LOCUS_02720 141369 140734 gene locus_tag LOCUS_02730 gene gstA 141369 140734 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808078.1 protein_id gnl|my_center|LOCUS_02730 142101 141613 gene locus_tag LOCUS_02740 gene trmL 142101 141613 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522909.1 protein_id gnl|my_center|LOCUS_02740 142904 142173 gene locus_tag LOCUS_02750 142904 142173 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_02750 142976 143887 gene locus_tag LOCUS_02760 142976 143887 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788683.1 protein_id gnl|my_center|LOCUS_02760 144388 145557 gene locus_tag LOCUS_02770 144388 145557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 145595 147226 gene locus_tag LOCUS_02780 gene ctaD 145595 147226 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197996.1 protein_id gnl|my_center|LOCUS_02780 147372 147989 gene locus_tag LOCUS_02790 147372 147989 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_02790 148055 148219 gene locus_tag LOCUS_02800 148055 148219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 148279 149160 gene locus_tag LOCUS_02810 148279 149160 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197994.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence003 1173 1559 gene locus_tag LOCUS_02820 1173 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 1556 2704 gene locus_tag LOCUS_02830 1556 2704 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_02830 3652 2867 gene locus_tag LOCUS_02840 gene tatC 3652 2867 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_02840 4207 3722 gene locus_tag LOCUS_02850 gene tatB 4207 3722 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531855.1 protein_id gnl|my_center|LOCUS_02850 4507 4256 gene locus_tag LOCUS_02860 gene tatA 4507 4256 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_02860 4988 4632 gene locus_tag LOCUS_02870 4988 4632 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 protein_id gnl|my_center|LOCUS_02870 6086 5055 gene locus_tag LOCUS_02880 6086 5055 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388793.1 protein_id gnl|my_center|LOCUS_02880 6468 6079 gene locus_tag LOCUS_02890 6468 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 6910 6497 gene locus_tag LOCUS_02900 6910 6497 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202813.1 protein_id gnl|my_center|LOCUS_02900 7332 6907 gene locus_tag LOCUS_02910 gene hisI 7332 6907 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 protein_id gnl|my_center|LOCUS_02910 8270 7422 gene locus_tag LOCUS_02920 gene hisF 8270 7422 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_02920 9136 8276 gene locus_tag LOCUS_02930 9136 8276 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365085.1 protein_id gnl|my_center|LOCUS_02930 10253 9213 gene locus_tag LOCUS_02940 gene galE 10253 9213 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707765.1 protein_id gnl|my_center|LOCUS_02940 10320 11363 gene locus_tag LOCUS_02950 10320 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 11459 12628 gene locus_tag LOCUS_02960 11459 12628 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_02960 12708 12941 gene locus_tag LOCUS_02970 12708 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13039 14478 gene locus_tag LOCUS_02980 13039 14478 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927112.1 protein_id gnl|my_center|LOCUS_02980 15174 14482 gene locus_tag LOCUS_02990 15174 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 16765 15188 gene locus_tag LOCUS_03000 16765 15188 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336811.1 protein_id gnl|my_center|LOCUS_03000 17818 16772 gene locus_tag LOCUS_03010 17818 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 18898 17891 gene locus_tag LOCUS_03020 18898 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 22327 18974 gene locus_tag LOCUS_03030 22327 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 24030 22324 gene locus_tag LOCUS_03040 24030 22324 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764227.1 protein_id gnl|my_center|LOCUS_03040 26276 24072 gene locus_tag LOCUS_03050 26276 24072 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266779.1 protein_id gnl|my_center|LOCUS_03050 27467 26334 gene locus_tag LOCUS_03060 gene wecB 27467 26334 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406828.1 protein_id gnl|my_center|LOCUS_03060 28786 28049 gene locus_tag LOCUS_03070 gene hisA 28786 28049 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_03070 29509 28853 gene locus_tag LOCUS_03080 gene hisH 29509 28853 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_03080 30200 29562 gene locus_tag LOCUS_03090 gene hisB 30200 29562 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_03090 31324 30197 gene locus_tag LOCUS_03100 gene hisC 31324 30197 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_03100 32688 31321 gene locus_tag LOCUS_03110 gene hisD 32688 31321 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_03110 33349 32696 gene locus_tag LOCUS_03120 gene hisG 33349 32696 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_03120 34659 33352 gene locus_tag LOCUS_03130 gene murA 34659 33352 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927222.1 protein_id gnl|my_center|LOCUS_03130 35014 34766 gene locus_tag LOCUS_03140 35014 34766 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_03140 35775 35020 gene locus_tag LOCUS_03150 35775 35020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_03150 36761 35772 gene locus_tag LOCUS_03160 36761 35772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_03160 37389 37120 gene locus_tag LOCUS_03170 37389 37120 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199923.1 protein_id gnl|my_center|LOCUS_03170 38054 37410 gene locus_tag LOCUS_03180 38054 37410 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_03180 39043 38225 gene locus_tag LOCUS_03190 39043 38225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 39573 39040 gene locus_tag LOCUS_03200 gene mlaD 39573 39040 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03200 40355 39573 gene locus_tag LOCUS_03210 gene mlaE 40355 39573 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_03210 41197 40352 gene locus_tag LOCUS_03220 41197 40352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_03220 42141 41389 gene locus_tag LOCUS_03230 42141 41389 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063819.1 protein_id gnl|my_center|LOCUS_03230 42817 42164 gene locus_tag LOCUS_03240 42817 42164 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811435.1 protein_id gnl|my_center|LOCUS_03240 43806 43006 gene locus_tag LOCUS_03250 43806 43006 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_03250 45619 44141 gene locus_tag LOCUS_03260 45619 44141 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886828.1 protein_id gnl|my_center|LOCUS_03260 50503 45722 gene locus_tag LOCUS_03270 50503 45722 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_03270 50674 52059 gene locus_tag LOCUS_03280 50674 52059 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084793.1 protein_id gnl|my_center|LOCUS_03280 52787 52086 gene locus_tag LOCUS_03290 52787 52086 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_03290 53938 53003 gene locus_tag LOCUS_03300 53938 53003 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198065.1 protein_id gnl|my_center|LOCUS_03300 54579 53935 gene locus_tag LOCUS_03310 54579 53935 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926460.1 protein_id gnl|my_center|LOCUS_03310 55965 54772 gene locus_tag LOCUS_03320 55965 54772 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806949.1 protein_id gnl|my_center|LOCUS_03320 57218 56079 gene locus_tag LOCUS_03330 gene aroB 57218 56079 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_03330 59441 57426 gene locus_tag LOCUS_03340 59441 57426 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073787.1 protein_id gnl|my_center|LOCUS_03340 61537 59459 gene locus_tag LOCUS_03350 gene pilQ 61537 59459 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_03350 62155 61610 gene locus_tag LOCUS_03360 gene pilP 62155 61610 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_03360 62826 62152 gene locus_tag LOCUS_03370 62826 62152 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262702.1 protein_id gnl|my_center|LOCUS_03370 63448 62831 gene locus_tag LOCUS_03380 gene pilN 63448 62831 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_03380 64452 63445 gene locus_tag LOCUS_03390 64452 63445 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_03390 64928 67264 gene locus_tag LOCUS_03400 64928 67264 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_03400 67690 67358 gene locus_tag LOCUS_03410 gene cyaY 67690 67358 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211469.1 protein_id gnl|my_center|LOCUS_03410 67703 67960 gene locus_tag LOCUS_03420 67703 67960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 67957 69246 gene locus_tag LOCUS_03430 gene lysA 67957 69246 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196768.1 protein_id gnl|my_center|LOCUS_03430 69346 70167 gene locus_tag LOCUS_03440 69346 70167 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207926.1 protein_id gnl|my_center|LOCUS_03440 70878 70243 gene locus_tag LOCUS_03450 gene msrQ 70878 70243 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_03450 72008 71010 gene locus_tag LOCUS_03460 gene msrP 72008 71010 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813837.1 protein_id gnl|my_center|LOCUS_03460 73552 72194 gene locus_tag LOCUS_03470 gene ccsB 73552 72194 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806943.1 protein_id gnl|my_center|LOCUS_03470 75699 73549 gene locus_tag LOCUS_03480 75699 73549 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527907.1 protein_id gnl|my_center|LOCUS_03480 76491 75859 gene locus_tag LOCUS_03490 76491 75859 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_03490 76650 77339 gene locus_tag LOCUS_03500 gene yihA 76650 77339 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 protein_id gnl|my_center|LOCUS_03500 77392 78324 gene locus_tag LOCUS_03510 77392 78324 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 protein_id gnl|my_center|LOCUS_03510 79238 78372 gene locus_tag LOCUS_03520 79238 78372 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038711.1 protein_id gnl|my_center|LOCUS_03520 80041 79238 gene locus_tag LOCUS_03530 80041 79238 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_03530 80262 81443 gene locus_tag LOCUS_03540 gene metK 80262 81443 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925730.1 protein_id gnl|my_center|LOCUS_03540 82267 82452 gene locus_tag LOCUS_03550 82267 82452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 82463 82939 gene locus_tag LOCUS_03560 82463 82939 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369485.1 protein_id gnl|my_center|LOCUS_03560 83902 83219 gene locus_tag LOCUS_03570 83902 83219 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 protein_id gnl|my_center|LOCUS_03570 84110 84967 gene locus_tag LOCUS_03580 84110 84967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 84971 86248 gene locus_tag LOCUS_03590 gene pncB 84971 86248 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358295.1 protein_id gnl|my_center|LOCUS_03590 86272 87975 gene locus_tag LOCUS_03600 86272 87975 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_03600 88132 89175 gene locus_tag LOCUS_03610 88132 89175 CDS product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 protein_id gnl|my_center|LOCUS_03610 89361 90377 gene locus_tag LOCUS_03620 89361 90377 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_03620 91574 90480 gene locus_tag LOCUS_03630 91574 90480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 92010 92300 gene locus_tag LOCUS_03640 gene groES 92010 92300 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_03640 92470 94119 gene locus_tag LOCUS_03650 gene groL 92470 94119 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_03650 95697 94240 gene locus_tag LOCUS_03660 gene xylB 95697 94240 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706072.1 protein_id gnl|my_center|LOCUS_03660 96681 95731 gene locus_tag LOCUS_03670 96681 95731 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434154.1 protein_id gnl|my_center|LOCUS_03670 97669 96701 gene locus_tag LOCUS_03680 97669 96701 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 protein_id gnl|my_center|LOCUS_03680 98366 97689 gene locus_tag LOCUS_03690 gene fsa 98366 97689 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983569.1 protein_id gnl|my_center|LOCUS_03690 99171 98377 gene locus_tag LOCUS_03700 99171 98377 CDS product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189447.1 protein_id gnl|my_center|LOCUS_03700 100572 99178 gene locus_tag LOCUS_03710 100572 99178 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198875.1 protein_id gnl|my_center|LOCUS_03710 101715 100678 gene locus_tag LOCUS_03720 101715 100678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086008.1 protein_id gnl|my_center|LOCUS_03720 102606 101767 gene locus_tag LOCUS_03730 102606 101767 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969939.1 protein_id gnl|my_center|LOCUS_03730 103447 102617 gene locus_tag LOCUS_03740 103447 102617 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267681.1 protein_id gnl|my_center|LOCUS_03740 104996 103680 gene locus_tag LOCUS_03750 104996 103680 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133415011.1 protein_id gnl|my_center|LOCUS_03750 106952 105324 gene locus_tag LOCUS_03760 gene pgi 106952 105324 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_03760 107863 106949 gene locus_tag LOCUS_03770 gene tal 107863 106949 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 protein_id gnl|my_center|LOCUS_03770 108132 109598 gene locus_tag LOCUS_03780 gene zwf 108132 109598 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186165.1 protein_id gnl|my_center|LOCUS_03780 109674 110519 gene locus_tag LOCUS_03790 gene hexR 109674 110519 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 protein_id gnl|my_center|LOCUS_03790 111248 112894 gene locus_tag LOCUS_03800 111248 112894 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 protein_id gnl|my_center|LOCUS_03800 113176 113355 gene locus_tag LOCUS_03810 113176 113355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 115446 113446 gene locus_tag LOCUS_03820 gene nadN 115446 113446 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence004 2467 1475 gene locus_tag LOCUS_03830 2467 1475 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 protein_id gnl|my_center|LOCUS_03830 3302 2532 gene locus_tag LOCUS_03840 3302 2532 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114490.1 protein_id gnl|my_center|LOCUS_03840 4372 3362 gene locus_tag LOCUS_03850 4372 3362 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064844.1 protein_id gnl|my_center|LOCUS_03850 5726 4461 gene locus_tag LOCUS_03860 5726 4461 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526008.1 protein_id gnl|my_center|LOCUS_03860 5858 6496 gene locus_tag LOCUS_03870 5858 6496 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812310.1 protein_id gnl|my_center|LOCUS_03870 7418 6549 gene locus_tag LOCUS_03880 gene htpX 7418 6549 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_03880 8303 7533 gene locus_tag LOCUS_03890 8303 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03890 9394 8333 gene locus_tag LOCUS_03900 gene pyrC 9394 8333 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_03900 10628 9465 gene locus_tag LOCUS_03910 10628 9465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086340.1 protein_id gnl|my_center|LOCUS_03910 11389 10628 gene locus_tag LOCUS_03920 11389 10628 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705233.1 protein_id gnl|my_center|LOCUS_03920 11612 13030 gene locus_tag LOCUS_03930 11612 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 13027 14163 gene locus_tag LOCUS_03940 13027 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 14160 14930 gene locus_tag LOCUS_03950 14160 14930 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_03950 14927 15952 gene locus_tag LOCUS_03960 14927 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 15982 16749 gene locus_tag LOCUS_03970 15982 16749 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_03970 16746 17693 gene locus_tag LOCUS_03980 16746 17693 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 protein_id gnl|my_center|LOCUS_03980 17690 18076 gene locus_tag LOCUS_03990 17690 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 18081 18491 gene locus_tag LOCUS_04000 18081 18491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 18481 19719 gene locus_tag LOCUS_04010 18481 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 20705 19767 gene locus_tag LOCUS_04020 20705 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 21775 20702 gene locus_tag LOCUS_04030 21775 20702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 23297 21924 gene locus_tag LOCUS_04040 23297 21924 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868396.1 protein_id gnl|my_center|LOCUS_04040 24026 23532 gene locus_tag LOCUS_04050 24026 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 24374 24201 gene locus_tag LOCUS_04060 24374 24201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 24337 24924 gene locus_tag LOCUS_04070 24337 24924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 30841 24938 gene locus_tag LOCUS_04080 gene uvrA 30841 24938 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939035.1 protein_id gnl|my_center|LOCUS_04080 31284 31090 gene locus_tag LOCUS_04090 31284 31090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 32484 31471 gene locus_tag LOCUS_04100 32484 31471 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939921.1 protein_id gnl|my_center|LOCUS_04100 34409 32751 gene locus_tag LOCUS_04110 34409 32751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064062.1 protein_id gnl|my_center|LOCUS_04110 35401 34727 gene locus_tag LOCUS_04120 35401 34727 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 protein_id gnl|my_center|LOCUS_04120 35657 35448 gene locus_tag LOCUS_04130 35657 35448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 36262 35753 gene locus_tag LOCUS_04140 36262 35753 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_04140 37817 36363 gene locus_tag LOCUS_04150 37817 36363 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762889.1 protein_id gnl|my_center|LOCUS_04150 38719 37817 gene locus_tag LOCUS_04160 38719 37817 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762887.1 protein_id gnl|my_center|LOCUS_04160 39714 38716 gene locus_tag LOCUS_04170 39714 38716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267552.1 protein_id gnl|my_center|LOCUS_04170 40648 39737 gene locus_tag LOCUS_04180 40648 39737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762883.1 protein_id gnl|my_center|LOCUS_04180 41581 40664 gene locus_tag LOCUS_04190 41581 40664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617711.1 protein_id gnl|my_center|LOCUS_04190 43172 41634 gene locus_tag LOCUS_04200 43172 41634 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267554.1 protein_id gnl|my_center|LOCUS_04200 43365 44300 gene locus_tag LOCUS_04210 43365 44300 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762877.1 protein_id gnl|my_center|LOCUS_04210 45350 44436 gene locus_tag LOCUS_04220 45350 44436 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_04220 46343 45423 gene locus_tag LOCUS_04230 46343 45423 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813179.1 protein_id gnl|my_center|LOCUS_04230 48408 46381 gene locus_tag LOCUS_04240 48408 46381 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555739.1 protein_id gnl|my_center|LOCUS_04240 49128 48409 gene locus_tag LOCUS_04250 49128 48409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 49948 49151 gene locus_tag LOCUS_04260 49948 49151 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_04260 50460 49945 gene locus_tag LOCUS_04270 50460 49945 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531618.1 protein_id gnl|my_center|LOCUS_04270 51383 50457 gene locus_tag LOCUS_04280 51383 50457 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967309.1 protein_id gnl|my_center|LOCUS_04280 52555 51380 gene locus_tag LOCUS_04290 52555 51380 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189895.1 protein_id gnl|my_center|LOCUS_04290 54212 52608 gene locus_tag LOCUS_04300 54212 52608 CDS product biotin-dependent carboxyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528747.1 protein_id gnl|my_center|LOCUS_04300 56017 54290 gene locus_tag LOCUS_04310 56017 54290 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_04310 56272 57306 gene locus_tag LOCUS_04320 56272 57306 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087190.1 protein_id gnl|my_center|LOCUS_04320 58906 57284 gene locus_tag LOCUS_04330 58906 57284 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551511.1 protein_id gnl|my_center|LOCUS_04330 59614 58943 gene locus_tag LOCUS_04340 59614 58943 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448378.1 protein_id gnl|my_center|LOCUS_04340 60677 59727 gene locus_tag LOCUS_04350 60677 59727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 61055 61753 gene locus_tag LOCUS_04360 61055 61753 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098693.1 protein_id gnl|my_center|LOCUS_04360 63713 61854 gene locus_tag LOCUS_04370 63713 61854 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098692.1 protein_id gnl|my_center|LOCUS_04370 64156 63740 gene locus_tag LOCUS_04380 64156 63740 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 protein_id gnl|my_center|LOCUS_04380 64288 64764 gene locus_tag LOCUS_04390 64288 64764 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962904.1 protein_id gnl|my_center|LOCUS_04390 65993 64863 gene locus_tag LOCUS_04400 65993 64863 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_04400 66735 66070 gene locus_tag LOCUS_04410 66735 66070 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522956.1 protein_id gnl|my_center|LOCUS_04410 67470 66844 gene locus_tag LOCUS_04420 67470 66844 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966396.1 protein_id gnl|my_center|LOCUS_04420 68720 67503 gene locus_tag LOCUS_04430 68720 67503 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_04430 70555 68717 gene locus_tag LOCUS_04440 gene aceK 70555 68717 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_04440 71283 70594 gene locus_tag LOCUS_04450 gene can 71283 70594 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_04450 72495 71308 gene locus_tag LOCUS_04460 72495 71308 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_04460 73151 72720 gene locus_tag LOCUS_04470 73151 72720 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 protein_id gnl|my_center|LOCUS_04470 74155 73325 gene locus_tag LOCUS_04480 74155 73325 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382904.1 protein_id gnl|my_center|LOCUS_04480 75606 74173 gene locus_tag LOCUS_04490 75606 74173 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390892.1 protein_id gnl|my_center|LOCUS_04490 77934 75799 gene locus_tag LOCUS_04500 77934 75799 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275293.1 protein_id gnl|my_center|LOCUS_04500 78499 78095 gene locus_tag LOCUS_04510 78499 78095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 79560 78508 gene locus_tag LOCUS_04520 gene aphA 79560 78508 CDS product acetylpolyamine amidohydrolase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112424.1 protein_id gnl|my_center|LOCUS_04520 80667 79615 gene locus_tag LOCUS_04530 80667 79615 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392403.1 protein_id gnl|my_center|LOCUS_04530 80842 81273 gene locus_tag LOCUS_04540 80842 81273 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931297.1 protein_id gnl|my_center|LOCUS_04540 83437 81302 gene locus_tag LOCUS_04550 83437 81302 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035914.1 protein_id gnl|my_center|LOCUS_04550 83726 83517 gene locus_tag LOCUS_04560 83726 83517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 83617 85173 gene locus_tag LOCUS_04570 83617 85173 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036400.1 protein_id gnl|my_center|LOCUS_04570 85562 86446 gene locus_tag LOCUS_04580 85562 86446 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530722.1 protein_id gnl|my_center|LOCUS_04580 86528 87595 gene locus_tag LOCUS_04590 86528 87595 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530723.1 protein_id gnl|my_center|LOCUS_04590 87607 88440 gene locus_tag LOCUS_04600 87607 88440 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339543.1 protein_id gnl|my_center|LOCUS_04600 88437 89708 gene locus_tag LOCUS_04610 88437 89708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530725.1 protein_id gnl|my_center|LOCUS_04610 89742 90473 gene locus_tag LOCUS_04620 89742 90473 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565148.1 protein_id gnl|my_center|LOCUS_04620 90473 92110 gene locus_tag LOCUS_04630 90473 92110 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339545.1 protein_id gnl|my_center|LOCUS_04630 94267 92192 gene locus_tag LOCUS_04640 94267 92192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 94908 94264 gene locus_tag LOCUS_04650 94908 94264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 95417 94908 gene locus_tag LOCUS_04660 95417 94908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 95633 96388 gene locus_tag LOCUS_04670 95633 96388 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106155.1 protein_id gnl|my_center|LOCUS_04670 96455 98650 gene locus_tag LOCUS_04680 96455 98650 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_04680 98816 100222 gene locus_tag LOCUS_04690 98816 100222 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_04690 100245 103397 gene locus_tag LOCUS_04700 100245 103397 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 protein_id gnl|my_center|LOCUS_04700 103394 106633 gene locus_tag LOCUS_04710 gene mdtC 103394 106633 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667528.1 protein_id gnl|my_center|LOCUS_04710 106630 108078 gene locus_tag LOCUS_04720 106630 108078 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196794.1 protein_id gnl|my_center|LOCUS_04720 108213 109331 gene locus_tag LOCUS_04730 108213 109331 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524498.1 protein_id gnl|my_center|LOCUS_04730 110483 109404 gene locus_tag LOCUS_04740 110483 109404 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121674.1 protein_id gnl|my_center|LOCUS_04740 111194 110613 gene locus_tag LOCUS_04750 111194 110613 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766294.1 protein_id gnl|my_center|LOCUS_04750 111327 112526 gene locus_tag LOCUS_04760 111327 112526 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104410.1 protein_id gnl|my_center|LOCUS_04760 >Feature sequence005 568 320 gene locus_tag LOCUS_04770 568 320 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269393.1 protein_id gnl|my_center|LOCUS_04770 1330 872 gene locus_tag LOCUS_04780 1330 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1635 2840 gene locus_tag LOCUS_04790 1635 2840 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_04790 2965 3579 gene locus_tag LOCUS_04800 2965 3579 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814256.1 protein_id gnl|my_center|LOCUS_04800 3727 5637 gene locus_tag LOCUS_04810 3727 5637 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_04810 9627 5776 gene locus_tag LOCUS_04820 9627 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 10674 9739 gene locus_tag LOCUS_04830 10674 9739 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807047.1 protein_id gnl|my_center|LOCUS_04830 11243 10671 gene locus_tag LOCUS_04840 11243 10671 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929781.1 protein_id gnl|my_center|LOCUS_04840 12882 11299 gene locus_tag LOCUS_04850 12882 11299 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_04850 13092 14480 gene locus_tag LOCUS_04860 13092 14480 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_04860 14480 15250 gene locus_tag LOCUS_04870 14480 15250 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 protein_id gnl|my_center|LOCUS_04870 15247 16596 gene locus_tag LOCUS_04880 15247 16596 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038697.1 protein_id gnl|my_center|LOCUS_04880 16636 19419 gene locus_tag LOCUS_04890 16636 19419 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_04890 20913 19573 gene locus_tag LOCUS_04900 20913 19573 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_04900 21346 21005 gene locus_tag LOCUS_04910 21346 21005 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_04910 22185 21472 gene locus_tag LOCUS_04920 22185 21472 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_04920 22930 22217 gene locus_tag LOCUS_04930 22930 22217 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 protein_id gnl|my_center|LOCUS_04930 23096 23662 gene locus_tag LOCUS_04940 gene msrA 23096 23662 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189960.1 protein_id gnl|my_center|LOCUS_04940 23823 24344 gene locus_tag LOCUS_04950 23823 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 24341 25054 gene locus_tag LOCUS_04960 24341 25054 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975187.1 protein_id gnl|my_center|LOCUS_04960 25051 26289 gene locus_tag LOCUS_04970 25051 26289 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_04970 26355 26606 gene locus_tag LOCUS_04980 26355 26606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 26663 27238 gene locus_tag LOCUS_04990 26663 27238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 27278 27694 gene locus_tag LOCUS_05000 27278 27694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 27896 30031 gene locus_tag LOCUS_05010 27896 30031 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_05010 32638 30140 gene locus_tag LOCUS_05020 32638 30140 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086926.1 protein_id gnl|my_center|LOCUS_05020 33676 32702 gene locus_tag LOCUS_05030 gene foxR 33676 32702 CDS product anti-sigma factor FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113290.1 protein_id gnl|my_center|LOCUS_05030 34137 33673 gene locus_tag LOCUS_05040 34137 33673 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406806.1 protein_id gnl|my_center|LOCUS_05040 35198 34290 gene locus_tag LOCUS_05050 35198 34290 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085908.1 protein_id gnl|my_center|LOCUS_05050 35297 36199 gene locus_tag LOCUS_05060 35297 36199 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_05060 36277 37440 gene locus_tag LOCUS_05070 36277 37440 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_05070 37460 38641 gene locus_tag LOCUS_05080 37460 38641 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807546.1 protein_id gnl|my_center|LOCUS_05080 38717 40114 gene locus_tag LOCUS_05090 38717 40114 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_05090 40111 40974 gene locus_tag LOCUS_05100 40111 40974 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925778.1 protein_id gnl|my_center|LOCUS_05100 41029 42078 gene locus_tag LOCUS_05110 41029 42078 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395829.1 protein_id gnl|my_center|LOCUS_05110 42093 42491 gene locus_tag LOCUS_05120 42093 42491 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346527.1 protein_id gnl|my_center|LOCUS_05120 42625 43578 gene locus_tag LOCUS_05130 42625 43578 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088482926.1 protein_id gnl|my_center|LOCUS_05130 44317 43634 gene locus_tag LOCUS_05140 gene pdxH 44317 43634 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_05140 44907 44377 gene locus_tag LOCUS_05150 44907 44377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 45602 44991 gene locus_tag LOCUS_05160 45602 44991 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 protein_id gnl|my_center|LOCUS_05160 45663 46187 gene locus_tag LOCUS_05170 45663 46187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 46302 46976 gene locus_tag LOCUS_05180 46302 46976 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 protein_id gnl|my_center|LOCUS_05180 46973 48436 gene locus_tag LOCUS_05190 46973 48436 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202892.1 protein_id gnl|my_center|LOCUS_05190 48575 49813 gene locus_tag LOCUS_05200 48575 49813 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_05200 49856 53041 gene locus_tag LOCUS_05210 49856 53041 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_05210 53049 54467 gene locus_tag LOCUS_05220 53049 54467 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544562.1 protein_id gnl|my_center|LOCUS_05220 55540 54509 gene locus_tag LOCUS_05230 gene gntR 55540 54509 CDS product LacI family DNA-binding transcriptional regulator GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107131.1 protein_id gnl|my_center|LOCUS_05230 55715 56263 gene locus_tag LOCUS_05240 55715 56263 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245315.1 protein_id gnl|my_center|LOCUS_05240 56353 57675 gene locus_tag LOCUS_05250 56353 57675 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968439.1 protein_id gnl|my_center|LOCUS_05250 57770 59593 gene locus_tag LOCUS_05260 gene edd 57770 59593 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527741.1 protein_id gnl|my_center|LOCUS_05260 59617 60243 gene locus_tag LOCUS_05270 59617 60243 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211190.1 protein_id gnl|my_center|LOCUS_05270 60335 60547 gene locus_tag LOCUS_05280 60335 60547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 60560 61069 gene locus_tag LOCUS_05290 60560 61069 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246884.1 protein_id gnl|my_center|LOCUS_05290 61563 61165 gene locus_tag LOCUS_05300 gene gloA 61563 61165 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237796.1 protein_id gnl|my_center|LOCUS_05300 61853 62062 gene locus_tag LOCUS_05310 61853 62062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 62435 63322 gene locus_tag LOCUS_05320 62435 63322 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064098.1 protein_id gnl|my_center|LOCUS_05320 63634 63374 gene locus_tag LOCUS_05330 63634 63374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 64815 63751 gene locus_tag LOCUS_05340 gene bioB 64815 63751 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_05340 65632 65141 gene locus_tag LOCUS_05350 65632 65141 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_05350 66510 65704 gene locus_tag LOCUS_05360 66510 65704 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207551.1 protein_id gnl|my_center|LOCUS_05360 68570 66522 gene locus_tag LOCUS_05370 68570 66522 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_05370 68940 68710 gene locus_tag LOCUS_05380 68940 68710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 70480 68948 gene locus_tag LOCUS_05390 70480 68948 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_05390 71564 70506 gene locus_tag LOCUS_05400 gene meaB 71564 70506 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 protein_id gnl|my_center|LOCUS_05400 73789 71561 gene locus_tag LOCUS_05410 gene scpA 73789 71561 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_05410 73889 74542 gene locus_tag LOCUS_05420 73889 74542 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930715.1 protein_id gnl|my_center|LOCUS_05420 75937 74630 gene locus_tag LOCUS_05430 75937 74630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 76198 76013 gene locus_tag LOCUS_05440 76198 76013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 76323 76616 gene locus_tag LOCUS_05450 76323 76616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 76752 77753 gene locus_tag LOCUS_05460 gene dusA 76752 77753 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009920631.1 protein_id gnl|my_center|LOCUS_05460 77896 78999 gene locus_tag LOCUS_05470 77896 78999 CDS product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706810.1 protein_id gnl|my_center|LOCUS_05470 79144 80517 gene locus_tag LOCUS_05480 gene phaZ 79144 80517 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185678.1 protein_id gnl|my_center|LOCUS_05480 80514 81206 gene locus_tag LOCUS_05490 80514 81206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 82750 81245 gene locus_tag LOCUS_05500 82750 81245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 83007 84209 gene locus_tag LOCUS_05510 gene dapC 83007 84209 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_05510 84298 85122 gene locus_tag LOCUS_05520 gene dapD 84298 85122 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_05520 85191 86348 gene locus_tag LOCUS_05530 85191 86348 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439300.1 protein_id gnl|my_center|LOCUS_05530 86446 87621 gene locus_tag LOCUS_05540 gene dapE 86446 87621 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521179.1 protein_id gnl|my_center|LOCUS_05540 87618 88550 gene locus_tag LOCUS_05550 gene prmB 87618 88550 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930547.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence006 <1 1323 gene locus_tag LOCUS_05560 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014330452.1:MFS transporter 2296 1586 gene locus_tag LOCUS_05570 2296 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2519 2971 gene locus_tag LOCUS_05580 2519 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 3085 3564 gene locus_tag LOCUS_05590 3085 3564 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965150.1 protein_id gnl|my_center|LOCUS_05590 3656 4072 gene locus_tag LOCUS_05600 3656 4072 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161190.1 protein_id gnl|my_center|LOCUS_05600 4132 5289 gene locus_tag LOCUS_05610 4132 5289 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_05610 8178 5338 gene locus_tag LOCUS_05620 8178 5338 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205406.1 protein_id gnl|my_center|LOCUS_05620 8936 8307 gene locus_tag LOCUS_05630 8936 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 9368 9063 gene locus_tag LOCUS_05640 9368 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 11462 9504 gene locus_tag LOCUS_05650 gene htpG 11462 9504 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208203.1 protein_id gnl|my_center|LOCUS_05650 11694 12395 gene locus_tag LOCUS_05660 gene aqpZ 11694 12395 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313332.1 protein_id gnl|my_center|LOCUS_05660 13245 12517 gene locus_tag LOCUS_05670 13245 12517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05670 13482 13748 gene locus_tag LOCUS_05680 13482 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 15970 13646 gene locus_tag LOCUS_05690 15970 13646 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405354.1 protein_id gnl|my_center|LOCUS_05690 16644 16009 gene locus_tag LOCUS_05700 16644 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 16921 18657 gene locus_tag LOCUS_05710 16921 18657 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05710 19447 18644 gene locus_tag LOCUS_05720 19447 18644 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807272.1 protein_id gnl|my_center|LOCUS_05720 20336 19581 gene locus_tag LOCUS_05730 20336 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 22013 20343 gene locus_tag LOCUS_05740 22013 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 22266 24203 gene locus_tag LOCUS_05750 22266 24203 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_05750 24238 25023 gene locus_tag LOCUS_05760 24238 25023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_05760 25038 25967 gene locus_tag LOCUS_05770 25038 25967 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 protein_id gnl|my_center|LOCUS_05770 26113 27177 gene locus_tag LOCUS_05780 26113 27177 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_05780 27278 28594 gene locus_tag LOCUS_05790 27278 28594 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_05790 28785 29609 gene locus_tag LOCUS_05800 28785 29609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_05800 29858 31105 gene locus_tag LOCUS_05810 29858 31105 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818460.1 protein_id gnl|my_center|LOCUS_05810 31364 32353 gene locus_tag LOCUS_05820 31364 32353 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529607.1 protein_id gnl|my_center|LOCUS_05820 32773 32453 gene locus_tag LOCUS_05830 32773 32453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 34088 32796 gene locus_tag LOCUS_05840 34088 32796 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926799.1 protein_id gnl|my_center|LOCUS_05840 34250 34420 gene locus_tag LOCUS_05850 34250 34420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 35211 34528 gene locus_tag LOCUS_05860 35211 34528 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971055.1 protein_id gnl|my_center|LOCUS_05860 36302 35298 gene locus_tag LOCUS_05870 36302 35298 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089161.1 protein_id gnl|my_center|LOCUS_05870 37297 36302 gene locus_tag LOCUS_05880 37297 36302 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089162.1 protein_id gnl|my_center|LOCUS_05880 37900 37319 gene locus_tag LOCUS_05890 37900 37319 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921523.1 protein_id gnl|my_center|LOCUS_05890 38734 37919 gene locus_tag LOCUS_05900 38734 37919 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_05900 39958 38786 gene locus_tag LOCUS_05910 39958 38786 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921524.1 protein_id gnl|my_center|LOCUS_05910 41099 39969 gene locus_tag LOCUS_05920 41099 39969 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089165.1 protein_id gnl|my_center|LOCUS_05920 41446 41096 gene locus_tag LOCUS_05930 41446 41096 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089166.1 protein_id gnl|my_center|LOCUS_05930 42405 41476 gene locus_tag LOCUS_05940 42405 41476 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089167.1 protein_id gnl|my_center|LOCUS_05940 43614 42445 gene locus_tag LOCUS_05950 43614 42445 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921526.1 protein_id gnl|my_center|LOCUS_05950 44139 43624 gene locus_tag LOCUS_05960 44139 43624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 45002 44136 gene locus_tag LOCUS_05970 45002 44136 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921527.1 protein_id gnl|my_center|LOCUS_05970 44899 45216 gene locus_tag LOCUS_05980 44899 45216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 45350 46276 gene locus_tag LOCUS_05990 45350 46276 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089169.1 protein_id gnl|my_center|LOCUS_05990 46339 47508 gene locus_tag LOCUS_06000 46339 47508 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 protein_id gnl|my_center|LOCUS_06000 47501 47827 gene locus_tag LOCUS_06010 47501 47827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 48188 47934 gene locus_tag LOCUS_06020 48188 47934 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_06020 49878 48253 gene locus_tag LOCUS_06030 49878 48253 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 protein_id gnl|my_center|LOCUS_06030 50024 50203 gene locus_tag LOCUS_06040 50024 50203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 51360 50140 gene locus_tag LOCUS_06050 51360 50140 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_06050 52649 51507 gene locus_tag LOCUS_06060 52649 51507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 protein_id gnl|my_center|LOCUS_06060 52840 54924 gene locus_tag LOCUS_06070 52840 54924 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_06070 55131 55568 gene locus_tag LOCUS_06080 55131 55568 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192748.1 protein_id gnl|my_center|LOCUS_06080 55638 56063 gene locus_tag LOCUS_06090 55638 56063 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535286.1 protein_id gnl|my_center|LOCUS_06090 56805 56065 gene locus_tag LOCUS_06100 56805 56065 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534628.1 protein_id gnl|my_center|LOCUS_06100 57776 56802 gene locus_tag LOCUS_06110 57776 56802 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589798.1 protein_id gnl|my_center|LOCUS_06110 58631 57861 gene locus_tag LOCUS_06120 58631 57861 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836211.1 protein_id gnl|my_center|LOCUS_06120 59487 58642 gene locus_tag LOCUS_06130 59487 58642 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269057.1 protein_id gnl|my_center|LOCUS_06130 59581 60531 gene locus_tag LOCUS_06140 59581 60531 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064273.1 protein_id gnl|my_center|LOCUS_06140 61518 60553 gene locus_tag LOCUS_06150 61518 60553 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089050.1 protein_id gnl|my_center|LOCUS_06150 61638 62666 gene locus_tag LOCUS_06160 61638 62666 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_06160 62779 64560 gene locus_tag LOCUS_06170 gene xylD 62779 64560 CDS product xylonate dehydratase XylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640069.1 protein_id gnl|my_center|LOCUS_06170 64578 65762 gene locus_tag LOCUS_06180 64578 65762 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978505.1 protein_id gnl|my_center|LOCUS_06180 65846 66463 gene locus_tag LOCUS_06190 65846 66463 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974960.1 protein_id gnl|my_center|LOCUS_06190 66477 67757 gene locus_tag LOCUS_06200 66477 67757 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243758.1 protein_id gnl|my_center|LOCUS_06200 68515 67793 gene locus_tag LOCUS_06210 68515 67793 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766806.1 protein_id gnl|my_center|LOCUS_06210 68698 69600 gene locus_tag LOCUS_06220 68698 69600 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 protein_id gnl|my_center|LOCUS_06220 69773 70945 gene locus_tag LOCUS_06230 69773 70945 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971503.1 protein_id gnl|my_center|LOCUS_06230 71433 71212 gene locus_tag LOCUS_06240 71433 71212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 71578 72087 gene locus_tag LOCUS_06250 71578 72087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 73577 73969 gene locus_tag LOCUS_06260 73577 73969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 73973 74854 gene locus_tag LOCUS_06270 73973 74854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 75239 75460 gene locus_tag LOCUS_06280 75239 75460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06280 76494 75802 gene locus_tag LOCUS_06290 76494 75802 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054996466.1 protein_id gnl|my_center|LOCUS_06290 77501 76632 gene locus_tag LOCUS_06300 77501 76632 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807281.1 protein_id gnl|my_center|LOCUS_06300 78678 77644 gene locus_tag LOCUS_06310 78678 77644 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_06310 79688 78675 gene locus_tag LOCUS_06320 79688 78675 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 protein_id gnl|my_center|LOCUS_06320 79791 80579 gene locus_tag LOCUS_06330 79791 80579 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936086.1 protein_id gnl|my_center|LOCUS_06330 80668 81990 gene locus_tag LOCUS_06340 80668 81990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06340 82307 82600 gene locus_tag LOCUS_06350 82307 82600 CDS product DUF3567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189087.1 protein_id gnl|my_center|LOCUS_06350 83041 82676 gene locus_tag LOCUS_06360 83041 82676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 84522 83893 gene locus_tag LOCUS_06370 84522 83893 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064361.1 protein_id gnl|my_center|LOCUS_06370 84658 85044 gene locus_tag LOCUS_06380 84658 85044 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_06380 85194 86006 gene locus_tag LOCUS_06390 gene modA 85194 86006 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195689.1 protein_id gnl|my_center|LOCUS_06390 86029 86682 gene locus_tag LOCUS_06400 gene modB 86029 86682 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937491.1 protein_id gnl|my_center|LOCUS_06400 86688 87368 gene locus_tag LOCUS_06410 86688 87368 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544627.1 protein_id gnl|my_center|LOCUS_06410 <88677 87494 gene locus_tag LOCUS_06420 <88677 87494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529996.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase >Feature sequence007 3 215 gene locus_tag LOCUS_06430 3 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 205 1278 gene locus_tag LOCUS_06440 205 1278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815920.1 protein_id gnl|my_center|LOCUS_06440 1295 2143 gene locus_tag LOCUS_06450 1295 2143 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_06450 3339 2284 gene locus_tag LOCUS_06460 3339 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5162 3336 gene locus_tag LOCUS_06470 5162 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6664 5159 gene locus_tag LOCUS_06480 6664 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 7955 6657 gene locus_tag LOCUS_06490 7955 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 8038 8391 gene locus_tag LOCUS_06500 8038 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 8574 10241 gene locus_tag LOCUS_06510 8574 10241 CDS product sodium-dependent inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096931.1 protein_id gnl|my_center|LOCUS_06510 10353 10544 gene locus_tag LOCUS_06520 10353 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 10741 11805 gene locus_tag LOCUS_06530 10741 11805 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 protein_id gnl|my_center|LOCUS_06530 12882 11848 gene locus_tag LOCUS_06540 12882 11848 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_06540 12982 13920 gene locus_tag LOCUS_06550 12982 13920 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193481.1 protein_id gnl|my_center|LOCUS_06550 13971 14927 gene locus_tag LOCUS_06560 gene pip 13971 14927 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974918.1 protein_id gnl|my_center|LOCUS_06560 16154 15234 gene locus_tag LOCUS_06570 16154 15234 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_06570 16266 17300 gene locus_tag LOCUS_06580 16266 17300 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205699.1 protein_id gnl|my_center|LOCUS_06580 17514 18686 gene locus_tag LOCUS_06590 17514 18686 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965168.1 protein_id gnl|my_center|LOCUS_06590 19611 18745 gene locus_tag LOCUS_06600 19611 18745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 20594 19608 gene locus_tag LOCUS_06610 20594 19608 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_06610 20721 21620 gene locus_tag LOCUS_06620 20721 21620 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_06620 24497 21684 gene locus_tag LOCUS_06630 24497 21684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 25459 24494 gene locus_tag LOCUS_06640 25459 24494 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383445.1 protein_id gnl|my_center|LOCUS_06640 25398 25697 gene locus_tag LOCUS_06650 25398 25697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 26678 25848 gene locus_tag LOCUS_06660 26678 25848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813987.1 protein_id gnl|my_center|LOCUS_06660 27752 26799 gene locus_tag LOCUS_06670 27752 26799 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_06670 29433 27922 gene locus_tag LOCUS_06680 29433 27922 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039080.1 protein_id gnl|my_center|LOCUS_06680 29940 29452 gene locus_tag LOCUS_06690 29940 29452 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124220547.1 protein_id gnl|my_center|LOCUS_06690 31892 30105 gene locus_tag LOCUS_06700 31892 30105 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130432088.1 protein_id gnl|my_center|LOCUS_06700 32718 31909 gene locus_tag LOCUS_06710 32718 31909 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930714.1 protein_id gnl|my_center|LOCUS_06710 33316 32750 gene locus_tag LOCUS_06720 33316 32750 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_06720 34237 33398 gene locus_tag LOCUS_06730 34237 33398 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_06730 34444 35361 gene locus_tag LOCUS_06740 34444 35361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 35462 35710 gene locus_tag LOCUS_06750 35462 35710 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048897891.1 protein_id gnl|my_center|LOCUS_06750 35999 36343 gene locus_tag LOCUS_06760 35999 36343 CDS product DUF3649 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244063.1 protein_id gnl|my_center|LOCUS_06760 36340 38043 gene locus_tag LOCUS_06770 36340 38043 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 protein_id gnl|my_center|LOCUS_06770 38040 38402 gene locus_tag LOCUS_06780 38040 38402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 38547 39800 gene locus_tag LOCUS_06790 38547 39800 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_06790 40557 39871 gene locus_tag LOCUS_06800 gene lolD 40557 39871 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_06800 41985 40732 gene locus_tag LOCUS_06810 41985 40732 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_06810 42086 43039 gene locus_tag LOCUS_06820 42086 43039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 43036 44751 gene locus_tag LOCUS_06830 gene recJ 43036 44751 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_06830 44773 46056 gene locus_tag LOCUS_06840 44773 46056 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 protein_id gnl|my_center|LOCUS_06840 46822 46157 gene locus_tag LOCUS_06850 46822 46157 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 protein_id gnl|my_center|LOCUS_06850 47196 46819 gene locus_tag LOCUS_06860 47196 46819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 47873 47193 gene locus_tag LOCUS_06870 47873 47193 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111706.1 protein_id gnl|my_center|LOCUS_06870 48053 48916 gene locus_tag LOCUS_06880 48053 48916 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193008.1 protein_id gnl|my_center|LOCUS_06880 48936 49571 gene locus_tag LOCUS_06890 48936 49571 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_06890 49642 50310 gene locus_tag LOCUS_06900 49642 50310 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192745.1 protein_id gnl|my_center|LOCUS_06900 50379 51707 gene locus_tag LOCUS_06910 50379 51707 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922084.1 protein_id gnl|my_center|LOCUS_06910 51937 52683 gene locus_tag LOCUS_06920 51937 52683 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 protein_id gnl|my_center|LOCUS_06920 52680 54461 gene locus_tag LOCUS_06930 52680 54461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 54498 56855 gene locus_tag LOCUS_06940 54498 56855 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925685.1 protein_id gnl|my_center|LOCUS_06940 57011 59425 gene locus_tag LOCUS_06950 gene katE 57011 59425 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266295.1 protein_id gnl|my_center|LOCUS_06950 60124 59546 gene locus_tag LOCUS_06960 60124 59546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 61147 60719 gene locus_tag LOCUS_06970 61147 60719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 61323 62195 gene locus_tag LOCUS_06980 61323 62195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 63654 62311 gene locus_tag LOCUS_06990 63654 62311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 64013 65338 gene locus_tag LOCUS_07000 64013 65338 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383580.1 protein_id gnl|my_center|LOCUS_07000 66018 65626 gene locus_tag LOCUS_07010 66018 65626 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_07010 67399 66032 gene locus_tag LOCUS_07020 67399 66032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 67836 67399 gene locus_tag LOCUS_07030 67836 67399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 69111 70505 gene locus_tag LOCUS_07040 69111 70505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 71798 70620 gene locus_tag LOCUS_07050 71798 70620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 73714 71798 gene locus_tag LOCUS_07060 73714 71798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 74821 73715 gene locus_tag LOCUS_07070 74821 73715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 76799 74814 gene locus_tag LOCUS_07080 76799 74814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 77398 76796 gene locus_tag LOCUS_07090 77398 76796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 77592 77398 gene locus_tag LOCUS_07100 77592 77398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence008 41 421 gene locus_tag LOCUS_07110 41 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07110 369 839 gene locus_tag LOCUS_07120 369 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07120 994 1179 gene locus_tag LOCUS_07130 994 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 1709 1422 gene locus_tag LOCUS_07140 1709 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4636 1706 gene locus_tag LOCUS_07150 4636 1706 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_07150 4769 5386 gene locus_tag LOCUS_07160 4769 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 5383 6285 gene locus_tag LOCUS_07170 5383 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 6322 7176 gene locus_tag LOCUS_07180 6322 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 7261 7746 gene locus_tag LOCUS_07190 7261 7746 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_07190 8037 8825 gene locus_tag LOCUS_07200 8037 8825 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206710.1 protein_id gnl|my_center|LOCUS_07200 8899 10146 gene locus_tag LOCUS_07210 8899 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206711.1 protein_id gnl|my_center|LOCUS_07210 10143 10745 gene locus_tag LOCUS_07220 10143 10745 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206712.1 protein_id gnl|my_center|LOCUS_07220 10808 11617 gene locus_tag LOCUS_07230 10808 11617 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965976.1 protein_id gnl|my_center|LOCUS_07230 11623 13230 gene locus_tag LOCUS_07240 11623 13230 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_07240 13315 14217 gene locus_tag LOCUS_07250 13315 14217 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267926.1 protein_id gnl|my_center|LOCUS_07250 14408 15577 gene locus_tag LOCUS_07260 14408 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 16676 15651 gene locus_tag LOCUS_07270 16676 15651 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_07270 17281 19644 gene locus_tag LOCUS_07280 17281 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 19678 20985 gene locus_tag LOCUS_07290 19678 20985 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183081.1 protein_id gnl|my_center|LOCUS_07290 21044 22561 gene locus_tag LOCUS_07300 21044 22561 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_07300 22558 23010 gene locus_tag LOCUS_07310 22558 23010 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086198.1 protein_id gnl|my_center|LOCUS_07310 23030 25357 gene locus_tag LOCUS_07320 23030 25357 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_07320 25401 26546 gene locus_tag LOCUS_07330 25401 26546 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 protein_id gnl|my_center|LOCUS_07330 26610 27548 gene locus_tag LOCUS_07340 26610 27548 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_07340 27561 28595 gene locus_tag LOCUS_07350 27561 28595 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089142.1 protein_id gnl|my_center|LOCUS_07350 28592 29359 gene locus_tag LOCUS_07360 28592 29359 CDS product maleate cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064689.1 protein_id gnl|my_center|LOCUS_07360 29541 29984 gene locus_tag LOCUS_07370 29541 29984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 30174 30875 gene locus_tag LOCUS_07380 30174 30875 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097603.1 protein_id gnl|my_center|LOCUS_07380 31646 30900 gene locus_tag LOCUS_07390 31646 30900 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704560.1 protein_id gnl|my_center|LOCUS_07390 32200 31799 gene locus_tag LOCUS_07400 32200 31799 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 protein_id gnl|my_center|LOCUS_07400 33303 32335 gene locus_tag LOCUS_07410 33303 32335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 34712 33447 gene locus_tag LOCUS_07420 gene glcF 34712 33447 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_07420 35592 34753 gene locus_tag LOCUS_07430 35592 34753 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_07430 36713 35586 gene locus_tag LOCUS_07440 gene glcE 36713 35586 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_07440 37766 36834 gene locus_tag LOCUS_07450 37766 36834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 37954 40170 gene locus_tag LOCUS_07460 37954 40170 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_07460 40145 40621 gene locus_tag LOCUS_07470 40145 40621 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_07470 40614 43220 gene locus_tag LOCUS_07480 40614 43220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 44906 43500 gene locus_tag LOCUS_07490 44906 43500 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275136.1 protein_id gnl|my_center|LOCUS_07490 45321 44989 gene locus_tag LOCUS_07500 45321 44989 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_07500 45589 47121 gene locus_tag LOCUS_07510 45589 47121 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550927.1 protein_id gnl|my_center|LOCUS_07510 47675 47175 gene locus_tag LOCUS_07520 47675 47175 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240991.1 protein_id gnl|my_center|LOCUS_07520 49047 47689 gene locus_tag LOCUS_07530 49047 47689 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 protein_id gnl|my_center|LOCUS_07530 50039 49044 gene locus_tag LOCUS_07540 50039 49044 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532988.1 protein_id gnl|my_center|LOCUS_07540 50812 50147 gene locus_tag LOCUS_07550 50812 50147 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243598.1 protein_id gnl|my_center|LOCUS_07550 51127 51939 gene locus_tag LOCUS_07560 51127 51939 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098249.1 protein_id gnl|my_center|LOCUS_07560 52863 52114 gene locus_tag LOCUS_07570 52863 52114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_07570 53645 52860 gene locus_tag LOCUS_07580 53645 52860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 protein_id gnl|my_center|LOCUS_07580 55552 53642 gene locus_tag LOCUS_07590 55552 53642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930654.1 protein_id gnl|my_center|LOCUS_07590 56805 55582 gene locus_tag LOCUS_07600 56805 55582 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930653.1 protein_id gnl|my_center|LOCUS_07600 57051 57824 gene locus_tag LOCUS_07610 57051 57824 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_07610 58779 57970 gene locus_tag LOCUS_07620 58779 57970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 59910 58948 gene locus_tag LOCUS_07630 59910 58948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 60085 60603 gene locus_tag LOCUS_07640 60085 60603 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_07640 60677 62080 gene locus_tag LOCUS_07650 60677 62080 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_07650 62534 62163 gene locus_tag LOCUS_07660 62534 62163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 63143 62766 gene locus_tag LOCUS_07670 63143 62766 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 protein_id gnl|my_center|LOCUS_07670 63993 63640 gene locus_tag LOCUS_07680 63993 63640 CDS product 50S ribosome-binding protein YggL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346101.1 protein_id gnl|my_center|LOCUS_07680 64579 64163 gene locus_tag LOCUS_07690 64579 64163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 64479 64682 gene locus_tag LOCUS_07700 64479 64682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 65345 65103 gene locus_tag LOCUS_07710 65345 65103 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810028.1 protein_id gnl|my_center|LOCUS_07710 66144 65455 gene locus_tag LOCUS_07720 66144 65455 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence009 3662 1431 gene locus_tag LOCUS_07730 gene katG 3662 1431 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036402.1 protein_id gnl|my_center|LOCUS_07730 4749 3826 gene locus_tag LOCUS_07740 4749 3826 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966538.1 protein_id gnl|my_center|LOCUS_07740 5722 4820 gene locus_tag LOCUS_07750 5722 4820 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494199.1 protein_id gnl|my_center|LOCUS_07750 6863 5907 gene locus_tag LOCUS_07760 6863 5907 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_07760 7919 6915 gene locus_tag LOCUS_07770 7919 6915 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_07770 8959 8027 gene locus_tag LOCUS_07780 8959 8027 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704945.1 protein_id gnl|my_center|LOCUS_07780 9642 8956 gene locus_tag LOCUS_07790 9642 8956 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704944.1 protein_id gnl|my_center|LOCUS_07790 10732 9695 gene locus_tag LOCUS_07800 10732 9695 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 protein_id gnl|my_center|LOCUS_07800 11687 10773 gene locus_tag LOCUS_07810 11687 10773 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441905.1 protein_id gnl|my_center|LOCUS_07810 12741 11731 gene locus_tag LOCUS_07820 12741 11731 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368481.1 protein_id gnl|my_center|LOCUS_07820 12855 13652 gene locus_tag LOCUS_07830 12855 13652 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368482.1 protein_id gnl|my_center|LOCUS_07830 13764 14354 gene locus_tag LOCUS_07840 13764 14354 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_07840 15483 14464 gene locus_tag LOCUS_07850 15483 14464 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037078874.1 protein_id gnl|my_center|LOCUS_07850 15858 16817 gene locus_tag LOCUS_07860 15858 16817 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812927.1 protein_id gnl|my_center|LOCUS_07860 16846 18033 gene locus_tag LOCUS_07870 16846 18033 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_07870 18194 19726 gene locus_tag LOCUS_07880 gene garD 18194 19726 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088615.1 protein_id gnl|my_center|LOCUS_07880 20489 19812 gene locus_tag LOCUS_07890 20489 19812 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640299.1 protein_id gnl|my_center|LOCUS_07890 20607 21521 gene locus_tag LOCUS_07900 20607 21521 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_07900 22456 21548 gene locus_tag LOCUS_07910 22456 21548 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036055.1 protein_id gnl|my_center|LOCUS_07910 23235 22453 gene locus_tag LOCUS_07920 23235 22453 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_07920 23372 24724 gene locus_tag LOCUS_07930 23372 24724 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07930 24782 25078 gene locus_tag LOCUS_07940 24782 25078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07940 25208 26176 gene locus_tag LOCUS_07950 25208 26176 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039423.1 protein_id gnl|my_center|LOCUS_07950 26268 27149 gene locus_tag LOCUS_07960 26268 27149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810324.1 protein_id gnl|my_center|LOCUS_07960 27325 28119 gene locus_tag LOCUS_07970 27325 28119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810326.1 protein_id gnl|my_center|LOCUS_07970 28985 28212 gene locus_tag LOCUS_07980 28985 28212 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 protein_id gnl|my_center|LOCUS_07980 29548 28982 gene locus_tag LOCUS_07990 29548 28982 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 protein_id gnl|my_center|LOCUS_07990 30247 29666 gene locus_tag LOCUS_08000 30247 29666 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765561.1 protein_id gnl|my_center|LOCUS_08000 30772 31914 gene locus_tag LOCUS_08010 gene gcvT 30772 31914 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 protein_id gnl|my_center|LOCUS_08010 32088 32462 gene locus_tag LOCUS_08020 gene gcvH 32088 32462 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_08020 32542 35508 gene locus_tag LOCUS_08030 gene gcvP 32542 35508 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266822.1 protein_id gnl|my_center|LOCUS_08030 36210 36791 gene locus_tag LOCUS_08040 36210 36791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 36817 37155 gene locus_tag LOCUS_08050 36817 37155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 37366 37833 gene locus_tag LOCUS_08060 37366 37833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 38115 38330 gene locus_tag LOCUS_08070 38115 38330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 38427 38837 gene locus_tag LOCUS_08080 38427 38837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 39627 40244 gene locus_tag LOCUS_08090 39627 40244 CDS product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091021504.1 protein_id gnl|my_center|LOCUS_08090 40263 41183 gene locus_tag LOCUS_08100 40263 41183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 41286 41714 gene locus_tag LOCUS_08110 41286 41714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 41828 44077 gene locus_tag LOCUS_08120 41828 44077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 44064 44777 gene locus_tag LOCUS_08130 44064 44777 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973520.1 protein_id gnl|my_center|LOCUS_08130 44958 45764 gene locus_tag LOCUS_08140 44958 45764 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926447.1 protein_id gnl|my_center|LOCUS_08140 45896 46879 gene locus_tag LOCUS_08150 45896 46879 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_08150 47457 47020 gene locus_tag LOCUS_08160 47457 47020 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120966.1 protein_id gnl|my_center|LOCUS_08160 48346 47579 gene locus_tag LOCUS_08170 48346 47579 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_08170 48493 48873 gene locus_tag LOCUS_08180 48493 48873 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268933.1 protein_id gnl|my_center|LOCUS_08180 50599 48911 gene locus_tag LOCUS_08190 50599 48911 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879007.1 protein_id gnl|my_center|LOCUS_08190 50926 51933 gene locus_tag LOCUS_08200 50926 51933 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 protein_id gnl|my_center|LOCUS_08200 52680 51949 gene locus_tag LOCUS_08210 52680 51949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 52930 52854 gene locus_tag LOCUS_t00040 52930 52854 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 53273 53049 gene locus_tag LOCUS_08220 53273 53049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 53652 54509 gene locus_tag LOCUS_08230 gene asd 53652 54509 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 protein_id gnl|my_center|LOCUS_08230 54744 54502 gene locus_tag LOCUS_08240 54744 54502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 55788 54958 gene locus_tag LOCUS_08250 gene hutG 55788 54958 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193651.1 protein_id gnl|my_center|LOCUS_08250 57252 55843 gene locus_tag LOCUS_08260 57252 55843 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197961.1 protein_id gnl|my_center|LOCUS_08260 58627 57245 gene locus_tag LOCUS_08270 58627 57245 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 protein_id gnl|my_center|LOCUS_08270 59898 58624 gene locus_tag LOCUS_08280 gene hutI 59898 58624 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524690.1 protein_id gnl|my_center|LOCUS_08280 60554 59895 gene locus_tag LOCUS_08290 60554 59895 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809213.1 protein_id gnl|my_center|LOCUS_08290 62146 60554 gene locus_tag LOCUS_08300 62146 60554 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174873167.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence010 1913 1737 gene locus_tag LOCUS_08310 1913 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2862 1939 gene locus_tag LOCUS_08320 gene lpxC 2862 1939 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194158.1 protein_id gnl|my_center|LOCUS_08320 4265 3033 gene locus_tag LOCUS_08330 gene ftsZ 4265 3033 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_08330 5682 4453 gene locus_tag LOCUS_08340 gene ftsA 5682 4453 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_08340 6555 5698 gene locus_tag LOCUS_08350 6555 5698 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_08350 7553 6561 gene locus_tag LOCUS_08360 7553 6561 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_08360 8983 7550 gene locus_tag LOCUS_08370 gene murC 8983 7550 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 protein_id gnl|my_center|LOCUS_08370 10050 8980 gene locus_tag LOCUS_08380 gene murG 10050 8980 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_08380 11333 10047 gene locus_tag LOCUS_08390 gene ftsW 11333 10047 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_08390 13249 11330 gene locus_tag LOCUS_08400 gene murD 13249 11330 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_08400 14427 13246 gene locus_tag LOCUS_08410 gene mraY 14427 13246 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194370.1 protein_id gnl|my_center|LOCUS_08410 15884 14421 gene locus_tag LOCUS_08420 gene murF 15884 14421 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_08420 17389 15881 gene locus_tag LOCUS_08430 17389 15881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 19137 17386 gene locus_tag LOCUS_08440 19137 17386 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532007.1 protein_id gnl|my_center|LOCUS_08440 19481 19134 gene locus_tag LOCUS_08450 19481 19134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 20407 19478 gene locus_tag LOCUS_08460 gene rsmH 20407 19478 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 protein_id gnl|my_center|LOCUS_08460 20844 20416 gene locus_tag LOCUS_08470 gene mraZ 20844 20416 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194130.1 protein_id gnl|my_center|LOCUS_08470 22428 21106 gene locus_tag LOCUS_08480 gene hslU 22428 21106 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198316.1 protein_id gnl|my_center|LOCUS_08480 23091 22546 gene locus_tag LOCUS_08490 gene hslV 23091 22546 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_08490 24942 23203 gene locus_tag LOCUS_08500 24942 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 25501 25004 gene locus_tag LOCUS_08510 gene dksA 25501 25004 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807164.1 protein_id gnl|my_center|LOCUS_08510 26989 25901 gene locus_tag LOCUS_08520 26989 25901 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199061.1 protein_id gnl|my_center|LOCUS_08520 27194 28576 gene locus_tag LOCUS_08530 27194 28576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 29768 28545 gene locus_tag LOCUS_08540 29768 28545 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204773.1 protein_id gnl|my_center|LOCUS_08540 29941 30900 gene locus_tag LOCUS_08550 29941 30900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223952.1 protein_id gnl|my_center|LOCUS_08550 32902 30920 gene locus_tag LOCUS_08560 32902 30920 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 protein_id gnl|my_center|LOCUS_08560 32917 33489 gene locus_tag LOCUS_08570 32917 33489 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197233.1 protein_id gnl|my_center|LOCUS_08570 33685 34383 gene locus_tag LOCUS_08580 33685 34383 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 protein_id gnl|my_center|LOCUS_08580 34929 34405 gene locus_tag LOCUS_08590 34929 34405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 34967 36214 gene locus_tag LOCUS_08600 34967 36214 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525896.1 protein_id gnl|my_center|LOCUS_08600 36281 37021 gene locus_tag LOCUS_08610 gene otsB 36281 37021 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 protein_id gnl|my_center|LOCUS_08610 37018 38943 gene locus_tag LOCUS_08620 37018 38943 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_08620 39002 40414 gene locus_tag LOCUS_08630 gene otsA 39002 40414 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338617.1 protein_id gnl|my_center|LOCUS_08630 41371 40499 gene locus_tag LOCUS_08640 41371 40499 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974559.1 protein_id gnl|my_center|LOCUS_08640 41478 42782 gene locus_tag LOCUS_08650 41478 42782 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974558.1 protein_id gnl|my_center|LOCUS_08650 43768 42830 gene locus_tag LOCUS_08660 43768 42830 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_08660 44054 43860 gene locus_tag LOCUS_08670 44054 43860 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189988.1 protein_id gnl|my_center|LOCUS_08670 44507 45037 gene locus_tag LOCUS_08680 44507 45037 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406469.1 protein_id gnl|my_center|LOCUS_08680 45501 46415 gene locus_tag LOCUS_08690 45501 46415 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971943.1 protein_id gnl|my_center|LOCUS_08690 46412 47368 gene locus_tag LOCUS_08700 46412 47368 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067336.1 protein_id gnl|my_center|LOCUS_08700 47382 48851 gene locus_tag LOCUS_08710 47382 48851 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067337.1 protein_id gnl|my_center|LOCUS_08710 48881 49864 gene locus_tag LOCUS_08720 48881 49864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246911.1 protein_id gnl|my_center|LOCUS_08720 49909 50844 gene locus_tag LOCUS_08730 49909 50844 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971941.1 protein_id gnl|my_center|LOCUS_08730 50939 52450 gene locus_tag LOCUS_08740 50939 52450 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103981.1 protein_id gnl|my_center|LOCUS_08740 52568 53335 gene locus_tag LOCUS_08750 52568 53335 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103980.1 protein_id gnl|my_center|LOCUS_08750 53442 54422 gene locus_tag LOCUS_08760 53442 54422 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046798190.1 protein_id gnl|my_center|LOCUS_08760 55400 54486 gene locus_tag LOCUS_08770 55400 54486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113092.1 protein_id gnl|my_center|LOCUS_08770 56431 55397 gene locus_tag LOCUS_08780 56431 55397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266332.1 protein_id gnl|my_center|LOCUS_08780 57443 56418 gene locus_tag LOCUS_08790 57443 56418 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266334.1 protein_id gnl|my_center|LOCUS_08790 58537 57485 gene locus_tag LOCUS_08800 58537 57485 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816034.1 protein_id gnl|my_center|LOCUS_08800 59572 58661 gene locus_tag LOCUS_08810 59572 58661 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence011 435 1655 gene locus_tag LOCUS_08820 435 1655 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_08820 1677 2090 gene locus_tag LOCUS_08830 gene iscU 1677 2090 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_08830 2095 2418 gene locus_tag LOCUS_08840 gene iscA 2095 2418 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_08840 2509 3027 gene locus_tag LOCUS_08850 gene hscB 2509 3027 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_08850 3170 5065 gene locus_tag LOCUS_08860 gene hscA 3170 5065 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_08860 5106 5444 gene locus_tag LOCUS_08870 gene fdx 5106 5444 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_08870 5444 6157 gene locus_tag LOCUS_08880 gene dnaQ 5444 6157 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_08880 6199 6273 gene locus_tag LOCUS_t00050 6199 6273 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8317 6500 gene locus_tag LOCUS_08890 8317 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 9529 8477 gene locus_tag LOCUS_08900 9529 8477 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390680.1 protein_id gnl|my_center|LOCUS_08900 10305 9526 gene locus_tag LOCUS_08910 10305 9526 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390679.1 protein_id gnl|my_center|LOCUS_08910 10419 11537 gene locus_tag LOCUS_08920 10419 11537 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976012.1 protein_id gnl|my_center|LOCUS_08920 11562 14699 gene locus_tag LOCUS_08930 11562 14699 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705231.1 protein_id gnl|my_center|LOCUS_08930 14702 16162 gene locus_tag LOCUS_08940 14702 16162 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390676.1 protein_id gnl|my_center|LOCUS_08940 16159 17430 gene locus_tag LOCUS_08950 16159 17430 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769298.1 protein_id gnl|my_center|LOCUS_08950 17592 18314 gene locus_tag LOCUS_08960 17592 18314 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100181062.1 protein_id gnl|my_center|LOCUS_08960 18455 20461 gene locus_tag LOCUS_08970 18455 20461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 20661 22037 gene locus_tag LOCUS_08980 20661 22037 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218121790.1 protein_id gnl|my_center|LOCUS_08980 22501 23448 gene locus_tag LOCUS_08990 22501 23448 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808874.1 protein_id gnl|my_center|LOCUS_08990 23499 25061 gene locus_tag LOCUS_09000 23499 25061 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729754.1 protein_id gnl|my_center|LOCUS_09000 25141 25935 gene locus_tag LOCUS_09010 25141 25935 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728686.1 protein_id gnl|my_center|LOCUS_09010 25965 27002 gene locus_tag LOCUS_09020 25965 27002 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808077.1 protein_id gnl|my_center|LOCUS_09020 27021 27518 gene locus_tag LOCUS_09030 27021 27518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 27580 28182 gene locus_tag LOCUS_09040 27580 28182 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808076.1 protein_id gnl|my_center|LOCUS_09040 28218 29123 gene locus_tag LOCUS_09050 28218 29123 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808075.1 protein_id gnl|my_center|LOCUS_09050 29120 29416 gene locus_tag LOCUS_09060 29120 29416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 29464 31143 gene locus_tag LOCUS_09070 29464 31143 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878169.1 protein_id gnl|my_center|LOCUS_09070 31204 32637 gene locus_tag LOCUS_09080 31204 32637 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806915.1 protein_id gnl|my_center|LOCUS_09080 32682 34130 gene locus_tag LOCUS_09090 gene gabD 32682 34130 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_09090 34220 34819 gene locus_tag LOCUS_09100 34220 34819 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770403.1 protein_id gnl|my_center|LOCUS_09100 35938 34895 gene locus_tag LOCUS_09110 35938 34895 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_09110 38369 35982 gene locus_tag LOCUS_09120 38369 35982 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_09120 40170 38491 gene locus_tag LOCUS_09130 40170 38491 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_09130 41637 40228 gene locus_tag LOCUS_09140 41637 40228 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_09140 41981 41625 gene locus_tag LOCUS_09150 41981 41625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 43591 42137 gene locus_tag LOCUS_09160 43591 42137 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536404.1 protein_id gnl|my_center|LOCUS_09160 44051 45004 gene locus_tag LOCUS_09170 44051 45004 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523980.1 protein_id gnl|my_center|LOCUS_09170 45198 46670 gene locus_tag LOCUS_09180 45198 46670 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528554.1 protein_id gnl|my_center|LOCUS_09180 46785 46859 gene locus_tag LOCUS_t00060 46785 46859 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 47003 48115 gene locus_tag LOCUS_09190 47003 48115 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_09190 48265 48573 gene locus_tag LOCUS_09200 48265 48573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 48633 49028 gene locus_tag LOCUS_09210 48633 49028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 49025 49342 gene locus_tag LOCUS_09220 49025 49342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 50573 49491 gene locus_tag LOCUS_09230 50573 49491 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931480.1 protein_id gnl|my_center|LOCUS_09230 50609 51298 gene locus_tag LOCUS_09240 gene rpiA 50609 51298 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192848.1 protein_id gnl|my_center|LOCUS_09240 52039 51395 gene locus_tag LOCUS_09250 52039 51395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 54150 52084 gene locus_tag LOCUS_09260 54150 52084 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_09260 55099 54242 gene locus_tag LOCUS_09270 gene folD 55099 54242 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_09270 55826 55200 gene locus_tag LOCUS_09280 gene fixJ 55826 55200 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_09280 58333 55823 gene locus_tag LOCUS_09290 gene fixL 58333 55823 CDS product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557112.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence012 <1 1592 gene locus_tag LOCUS_09300 <1 1592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084436.1:dihydroxy-acid dehydratase 2292 1810 gene locus_tag LOCUS_09310 gene bfr 2292 1810 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036585.1 protein_id gnl|my_center|LOCUS_09310 2605 3321 gene locus_tag LOCUS_09320 2605 3321 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706774.1 protein_id gnl|my_center|LOCUS_09320 3401 4234 gene locus_tag LOCUS_09330 gene lgt 3401 4234 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_09330 5402 4245 gene locus_tag LOCUS_09340 5402 4245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113605.1 protein_id gnl|my_center|LOCUS_09340 6607 5537 gene locus_tag LOCUS_09350 6607 5537 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113607.1 protein_id gnl|my_center|LOCUS_09350 6928 7620 gene locus_tag LOCUS_09360 6928 7620 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039419.1 protein_id gnl|my_center|LOCUS_09360 7617 9083 gene locus_tag LOCUS_09370 7617 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 9202 10272 gene locus_tag LOCUS_09380 9202 10272 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039422.1 protein_id gnl|my_center|LOCUS_09380 10302 11165 gene locus_tag LOCUS_09390 10302 11165 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930717.1 protein_id gnl|my_center|LOCUS_09390 11226 12824 gene locus_tag LOCUS_09400 11226 12824 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064005.1 protein_id gnl|my_center|LOCUS_09400 12942 13835 gene locus_tag LOCUS_09410 12942 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 14844 13894 gene locus_tag LOCUS_09420 gene gcvA 14844 13894 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813028.1 protein_id gnl|my_center|LOCUS_09420 15071 16300 gene locus_tag LOCUS_09430 15071 16300 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104203.1 protein_id gnl|my_center|LOCUS_09430 16338 17693 gene locus_tag LOCUS_09440 16338 17693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088244.1 protein_id gnl|my_center|LOCUS_09440 17690 18289 gene locus_tag LOCUS_09450 17690 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 18760 18317 gene locus_tag LOCUS_09460 18760 18317 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530565.1 protein_id gnl|my_center|LOCUS_09460 18887 21259 gene locus_tag LOCUS_09470 18887 21259 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268428.1 protein_id gnl|my_center|LOCUS_09470 21261 21404 gene locus_tag LOCUS_09480 21261 21404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 21617 23056 gene locus_tag LOCUS_09490 gene ccoN 21617 23056 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216619.1 protein_id gnl|my_center|LOCUS_09490 23075 23707 gene locus_tag LOCUS_09500 gene ccoO 23075 23707 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_09500 23959 24879 gene locus_tag LOCUS_09510 gene ccoP 23959 24879 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 protein_id gnl|my_center|LOCUS_09510 25019 26449 gene locus_tag LOCUS_09520 gene ccoG 25019 26449 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_09520 26517 26801 gene locus_tag LOCUS_09530 26517 26801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 26788 27120 gene locus_tag LOCUS_09540 26788 27120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 27902 27177 gene locus_tag LOCUS_09550 gene fnr 27902 27177 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_09550 28115 29497 gene locus_tag LOCUS_09560 gene hemN 28115 29497 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064046.1 protein_id gnl|my_center|LOCUS_09560 29510 30247 gene locus_tag LOCUS_09570 29510 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 30429 31706 gene locus_tag LOCUS_09580 30429 31706 CDS product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349264.1 protein_id gnl|my_center|LOCUS_09580 31724 34195 gene locus_tag LOCUS_09590 31724 34195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 34960 34556 gene locus_tag LOCUS_09600 34960 34556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 35178 34957 gene locus_tag LOCUS_09610 35178 34957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 35594 37456 gene locus_tag LOCUS_09620 35594 37456 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815090.1 protein_id gnl|my_center|LOCUS_09620 37453 38877 gene locus_tag LOCUS_09630 37453 38877 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038178.1 protein_id gnl|my_center|LOCUS_09630 38874 39473 gene locus_tag LOCUS_09640 gene cobU 38874 39473 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198615.1 protein_id gnl|my_center|LOCUS_09640 40258 41151 gene locus_tag LOCUS_09650 40258 41151 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228165.1 protein_id gnl|my_center|LOCUS_09650 41148 42194 gene locus_tag LOCUS_09660 41148 42194 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228166.1 protein_id gnl|my_center|LOCUS_09660 42191 42985 gene locus_tag LOCUS_09670 42191 42985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013807.1 protein_id gnl|my_center|LOCUS_09670 43045 43614 gene locus_tag LOCUS_09680 gene cobO 43045 43614 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_09680 43614 44450 gene locus_tag LOCUS_09690 43614 44450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 44443 45435 gene locus_tag LOCUS_09700 gene cbiB 44443 45435 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174539.1 protein_id gnl|my_center|LOCUS_09700 45432 46466 gene locus_tag LOCUS_09710 45432 46466 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926108.1 protein_id gnl|my_center|LOCUS_09710 47621 46476 gene locus_tag LOCUS_09720 47621 46476 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206816.1 protein_id gnl|my_center|LOCUS_09720 47997 48824 gene locus_tag LOCUS_09730 47997 48824 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_09730 49001 50500 gene locus_tag LOCUS_09740 49001 50500 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012695322.1 protein_id gnl|my_center|LOCUS_09740 50601 51653 gene locus_tag LOCUS_09750 gene cobT 50601 51653 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_09750 51799 52287 gene locus_tag LOCUS_09760 51799 52287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 54091 52385 gene locus_tag LOCUS_09770 54091 52385 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102300.1 protein_id gnl|my_center|LOCUS_09770 54709 54410 gene locus_tag LOCUS_09780 54709 54410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 54832 56397 gene locus_tag LOCUS_09790 gene murJ 54832 56397 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064095.1 protein_id gnl|my_center|LOCUS_09790 56452 57309 gene locus_tag LOCUS_09800 56452 57309 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence013 1856 225 gene locus_tag LOCUS_09810 1856 225 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_09810 2004 3071 gene locus_tag LOCUS_09820 2004 3071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_09820 3905 3204 gene locus_tag LOCUS_09830 3905 3204 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_09830 5359 4058 gene locus_tag LOCUS_09840 5359 4058 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_09840 6389 5427 gene locus_tag LOCUS_09850 6389 5427 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_09850 6943 6392 gene locus_tag LOCUS_09860 gene pyrR 6943 6392 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_09860 7380 6940 gene locus_tag LOCUS_09870 gene ruvX 7380 6940 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 protein_id gnl|my_center|LOCUS_09870 7994 7377 gene locus_tag LOCUS_09880 7994 7377 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_09880 8017 9471 gene locus_tag LOCUS_09890 8017 9471 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_09890 15547 9524 gene locus_tag LOCUS_09900 15547 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 17883 15616 gene locus_tag LOCUS_09910 17883 15616 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621029.1 protein_id gnl|my_center|LOCUS_09910 18451 17924 gene locus_tag LOCUS_09920 18451 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 18869 18504 gene locus_tag LOCUS_09930 gene pilH 18869 18504 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_09930 19240 18869 gene locus_tag LOCUS_09940 gene pilG 19240 18869 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_09940 19501 19328 gene locus_tag LOCUS_09950 19501 19328 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_09950 19601 20566 gene locus_tag LOCUS_09960 19601 20566 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 protein_id gnl|my_center|LOCUS_09960 20550 21863 gene locus_tag LOCUS_09970 gene hemL 20550 21863 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_09970 21865 22761 gene locus_tag LOCUS_09980 21865 22761 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103454.1 protein_id gnl|my_center|LOCUS_09980 24543 22942 gene locus_tag LOCUS_09990 gene purH 24543 22942 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_09990 24880 24647 gene locus_tag LOCUS_10000 24880 24647 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_10000 25988 24861 gene locus_tag LOCUS_10010 gene dusB 25988 24861 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_10010 26111 26581 gene locus_tag LOCUS_10020 26111 26581 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 protein_id gnl|my_center|LOCUS_10020 28085 26730 gene locus_tag LOCUS_10030 28085 26730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 28288 28560 gene locus_tag LOCUS_10040 28288 28560 CDS product nickel-sensing transcriptional repressor NcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196355.1 protein_id gnl|my_center|LOCUS_10040 31045 28697 gene locus_tag LOCUS_10050 31045 28697 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207594.1 protein_id gnl|my_center|LOCUS_10050 32444 31350 gene locus_tag LOCUS_10060 gene ychF 32444 31350 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_10060 33454 32579 gene locus_tag LOCUS_10070 33454 32579 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194630.1 protein_id gnl|my_center|LOCUS_10070 33649 34725 gene locus_tag LOCUS_10080 33649 34725 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815378.1 protein_id gnl|my_center|LOCUS_10080 34792 35520 gene locus_tag LOCUS_10090 34792 35520 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_10090 35621 37405 gene locus_tag LOCUS_10100 35621 37405 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931383.1 protein_id gnl|my_center|LOCUS_10100 37470 38249 gene locus_tag LOCUS_10110 37470 38249 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_10110 38274 38350 gene locus_tag LOCUS_t00070 38274 38350 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 38459 38932 gene locus_tag LOCUS_10120 38459 38932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 39043 40386 gene locus_tag LOCUS_10130 gene miaB 39043 40386 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809403.1 protein_id gnl|my_center|LOCUS_10130 40403 41851 gene locus_tag LOCUS_10140 gene qseE 40403 41851 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602450.1 protein_id gnl|my_center|LOCUS_10140 41841 42566 gene locus_tag LOCUS_10150 41841 42566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 42588 43997 gene locus_tag LOCUS_10160 gene glrR 42588 43997 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_10160 44320 46338 gene locus_tag LOCUS_10170 44320 46338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 47828 46449 gene locus_tag LOCUS_10180 gene ffh 47828 46449 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_10180 47917 48714 gene locus_tag LOCUS_10190 gene ccsA 47917 48714 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929606.1 protein_id gnl|my_center|LOCUS_10190 48711 48944 gene locus_tag LOCUS_10200 48711 48944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 48966 50684 gene locus_tag LOCUS_10210 48966 50684 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_10210 50699 52189 gene locus_tag LOCUS_10220 gene pilR 50699 52189 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_10220 52179 52790 gene locus_tag LOCUS_10230 gene ampD 52179 52790 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence014 1426 476 gene locus_tag LOCUS_10240 gene gshB 1426 476 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 protein_id gnl|my_center|LOCUS_10240 3531 1663 gene locus_tag LOCUS_10250 3531 1663 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 protein_id gnl|my_center|LOCUS_10250 5008 3713 gene locus_tag LOCUS_10260 gene gshA 5008 3713 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_10260 6602 5136 gene locus_tag LOCUS_10270 6602 5136 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807338.1 protein_id gnl|my_center|LOCUS_10270 8072 6615 gene locus_tag LOCUS_10280 gene trkA 8072 6615 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038750.1 protein_id gnl|my_center|LOCUS_10280 9408 8128 gene locus_tag LOCUS_10290 9408 8128 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557250.1 protein_id gnl|my_center|LOCUS_10290 10151 9462 gene locus_tag LOCUS_10300 10151 9462 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_10300 10314 11078 gene locus_tag LOCUS_10310 10314 11078 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067148.1 protein_id gnl|my_center|LOCUS_10310 11078 11716 gene locus_tag LOCUS_10320 11078 11716 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_10320 11758 12462 gene locus_tag LOCUS_10330 gene blrA 11758 12462 CDS product beta-lactam response regulator transcription factor BlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707903.1 protein_id gnl|my_center|LOCUS_10330 12564 14027 gene locus_tag LOCUS_10340 gene creC 12564 14027 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_10340 14177 15613 gene locus_tag LOCUS_10350 gene creD 14177 15613 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_10350 15610 15864 gene locus_tag LOCUS_10360 15610 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 16460 15933 gene locus_tag LOCUS_10370 16460 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 17281 16703 gene locus_tag LOCUS_10380 17281 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 17610 17392 gene locus_tag LOCUS_10390 17610 17392 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686626.1 protein_id gnl|my_center|LOCUS_10390 18492 17872 gene locus_tag LOCUS_10400 18492 17872 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038282.1 protein_id gnl|my_center|LOCUS_10400 18818 21004 gene locus_tag LOCUS_10410 18818 21004 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704434.1 protein_id gnl|my_center|LOCUS_10410 21761 21087 gene locus_tag LOCUS_10420 21761 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 22828 21842 gene locus_tag LOCUS_10430 22828 21842 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064730.1 protein_id gnl|my_center|LOCUS_10430 23691 22828 gene locus_tag LOCUS_10440 23691 22828 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807131.1 protein_id gnl|my_center|LOCUS_10440 24883 23696 gene locus_tag LOCUS_10450 24883 23696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449702.1 protein_id gnl|my_center|LOCUS_10450 25129 26814 gene locus_tag LOCUS_10460 25129 26814 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393021.1 protein_id gnl|my_center|LOCUS_10460 27126 27884 gene locus_tag LOCUS_10470 27126 27884 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_10470 27919 28842 gene locus_tag LOCUS_10480 gene rocF 27919 28842 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808362.1 protein_id gnl|my_center|LOCUS_10480 29051 29815 gene locus_tag LOCUS_10490 29051 29815 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479931.1 protein_id gnl|my_center|LOCUS_10490 29885 30664 gene locus_tag LOCUS_10500 29885 30664 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479930.1 protein_id gnl|my_center|LOCUS_10500 30661 31413 gene locus_tag LOCUS_10510 30661 31413 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888285.1 protein_id gnl|my_center|LOCUS_10510 31607 32500 gene locus_tag LOCUS_10520 31607 32500 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227640.1 protein_id gnl|my_center|LOCUS_10520 34522 32579 gene locus_tag LOCUS_10530 gene mrdA 34522 32579 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10530 35157 34639 gene locus_tag LOCUS_10540 gene mreD 35157 34639 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_10540 36077 35154 gene locus_tag LOCUS_10550 gene mreC 36077 35154 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10550 37256 36213 gene locus_tag LOCUS_10560 37256 36213 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_10560 37470 37769 gene locus_tag LOCUS_10570 gene gatC 37470 37769 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189769.1 protein_id gnl|my_center|LOCUS_10570 37783 39309 gene locus_tag LOCUS_10580 gene gatA 37783 39309 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_10580 39311 40762 gene locus_tag LOCUS_10590 gene gatB 39311 40762 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929770.1 protein_id gnl|my_center|LOCUS_10590 41515 40820 gene locus_tag LOCUS_10600 41515 40820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 42275 41556 gene locus_tag LOCUS_10610 gene pyrE 42275 41556 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929769.1 protein_id gnl|my_center|LOCUS_10610 42274 43089 gene locus_tag LOCUS_10620 42274 43089 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_10620 45267 43090 gene locus_tag LOCUS_10630 45267 43090 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973426.1 protein_id gnl|my_center|LOCUS_10630 46318 45389 gene locus_tag LOCUS_10640 46318 45389 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820327.1 protein_id gnl|my_center|LOCUS_10640 46727 47902 gene locus_tag LOCUS_10650 gene yiuA 46727 47902 CDS product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 protein_id gnl|my_center|LOCUS_10650 47899 48912 gene locus_tag LOCUS_10660 47899 48912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 48909 49991 gene locus_tag LOCUS_10670 48909 49991 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243562.1 protein_id gnl|my_center|LOCUS_10670 49988 50848 gene locus_tag LOCUS_10680 49988 50848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208783.1 protein_id gnl|my_center|LOCUS_10680 50845 51186 gene locus_tag LOCUS_10690 50845 51186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 52036 51203 gene locus_tag LOCUS_10700 gene dkgB 52036 51203 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811193.1 protein_id gnl|my_center|LOCUS_10700 53334 52132 gene locus_tag LOCUS_10710 53334 52132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence015 1 1803 gene locus_tag LOCUS_10720 1 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2414 1839 gene locus_tag LOCUS_10730 gene greB 2414 1839 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_10730 2855 2547 gene locus_tag LOCUS_10740 2855 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3049 2973 gene locus_tag LOCUS_t00080 3049 2973 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4577 3291 gene locus_tag LOCUS_10750 4577 3291 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970441.1 protein_id gnl|my_center|LOCUS_10750 6214 4739 gene locus_tag LOCUS_10760 6214 4739 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973449.1 protein_id gnl|my_center|LOCUS_10760 7259 6465 gene locus_tag LOCUS_10770 7259 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7565 7489 gene locus_tag LOCUS_t00090 7565 7489 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8627 7623 gene locus_tag LOCUS_10780 gene hrcA 8627 7623 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_10780 8656 9552 gene locus_tag LOCUS_10790 8656 9552 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_10790 9555 11225 gene locus_tag LOCUS_10800 gene recN 9555 11225 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 protein_id gnl|my_center|LOCUS_10800 11236 12099 gene locus_tag LOCUS_10810 gene rapZ 11236 12099 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530937.1 protein_id gnl|my_center|LOCUS_10810 13343 12267 gene locus_tag LOCUS_10820 gene mutY 13343 12267 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_10820 15340 13340 gene locus_tag LOCUS_10830 15340 13340 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_10830 16276 15458 gene locus_tag LOCUS_10840 gene mutM 16276 15458 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925978.1 protein_id gnl|my_center|LOCUS_10840 16387 18111 gene locus_tag LOCUS_10850 16387 18111 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_10850 18108 18614 gene locus_tag LOCUS_10860 18108 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 18625 19488 gene locus_tag LOCUS_10870 gene ispE 18625 19488 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808500.1 protein_id gnl|my_center|LOCUS_10870 19513 19589 gene locus_tag LOCUS_t00100 19513 19589 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19661 20596 gene locus_tag LOCUS_10880 19661 20596 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195243.1 protein_id gnl|my_center|LOCUS_10880 20766 21401 gene locus_tag LOCUS_10890 20766 21401 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_10890 21543 22211 gene locus_tag LOCUS_10900 gene pth 21543 22211 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_10900 22548 22291 gene locus_tag LOCUS_10910 22548 22291 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_10910 22710 23735 gene locus_tag LOCUS_10920 22710 23735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086014.1 protein_id gnl|my_center|LOCUS_10920 23732 24574 gene locus_tag LOCUS_10930 23732 24574 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 protein_id gnl|my_center|LOCUS_10930 24595 25629 gene locus_tag LOCUS_10940 24595 25629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966043.1 protein_id gnl|my_center|LOCUS_10940 25629 26570 gene locus_tag LOCUS_10950 25629 26570 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 protein_id gnl|my_center|LOCUS_10950 26647 28140 gene locus_tag LOCUS_10960 26647 28140 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086018.1 protein_id gnl|my_center|LOCUS_10960 28298 28903 gene locus_tag LOCUS_10970 28298 28903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 29007 29663 gene locus_tag LOCUS_10980 29007 29663 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019238149.1 protein_id gnl|my_center|LOCUS_10980 29660 31909 gene locus_tag LOCUS_10990 gene bphP 29660 31909 CDS product bacteriophytochrome BphP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101278.1 protein_id gnl|my_center|LOCUS_10990 32090 32584 gene locus_tag LOCUS_11000 32090 32584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 32715 33332 gene locus_tag LOCUS_11010 32715 33332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 33653 33393 gene locus_tag LOCUS_11020 33653 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 34554 33688 gene locus_tag LOCUS_11030 34554 33688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 34973 34551 gene locus_tag LOCUS_11040 34973 34551 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_11040 35789 34977 gene locus_tag LOCUS_11050 35789 34977 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 protein_id gnl|my_center|LOCUS_11050 37129 35852 gene locus_tag LOCUS_11060 gene clsB 37129 35852 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_11060 37902 37126 gene locus_tag LOCUS_11070 37902 37126 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113649.1 protein_id gnl|my_center|LOCUS_11070 38063 39820 gene locus_tag LOCUS_11080 38063 39820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 40324 39845 gene locus_tag LOCUS_11090 gene nudB 40324 39845 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_11090 42241 40427 gene locus_tag LOCUS_11100 gene aspS 42241 40427 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_11100 42970 42347 gene locus_tag LOCUS_11110 42970 42347 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_11110 43315 43013 gene locus_tag LOCUS_11120 43315 43013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 44858 43410 gene locus_tag LOCUS_11130 44858 43410 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_11130 46514 44949 gene locus_tag LOCUS_11140 gene ubiB 46514 44949 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_11140 47095 46511 gene locus_tag LOCUS_11150 47095 46511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 48240 47197 gene locus_tag LOCUS_11160 48240 47197 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064917.1 protein_id gnl|my_center|LOCUS_11160 49007 48276 gene locus_tag LOCUS_11170 gene ubiE 49007 48276 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189973.1 protein_id gnl|my_center|LOCUS_11170 49428 49063 gene locus_tag LOCUS_11180 49428 49063 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_11180 49667 50734 gene locus_tag LOCUS_11190 49667 50734 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762418.1 protein_id gnl|my_center|LOCUS_11190 51203 50742 gene locus_tag LOCUS_11200 51203 50742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 <53500 51203 gene locus_tag LOCUS_11210 <53500 51203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189879.1:FAD/FMN-binding oxidoreductase >Feature sequence016 3073 1301 gene locus_tag LOCUS_11220 3073 1301 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 protein_id gnl|my_center|LOCUS_11220 4073 3225 gene locus_tag LOCUS_11230 gene phnX 4073 3225 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064130.1 protein_id gnl|my_center|LOCUS_11230 5232 4087 gene locus_tag LOCUS_11240 5232 4087 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073077526.1 protein_id gnl|my_center|LOCUS_11240 6995 5271 gene locus_tag LOCUS_11250 6995 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8197 7010 gene locus_tag LOCUS_11260 8197 7010 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527142.1 protein_id gnl|my_center|LOCUS_11260 9231 8197 gene locus_tag LOCUS_11270 9231 8197 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930836.1 protein_id gnl|my_center|LOCUS_11270 9364 10140 gene locus_tag LOCUS_11280 9364 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 10137 11006 gene locus_tag LOCUS_11290 10137 11006 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390999.1 protein_id gnl|my_center|LOCUS_11290 11191 11736 gene locus_tag LOCUS_11300 11191 11736 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_11300 11733 12401 gene locus_tag LOCUS_11310 11733 12401 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266695.1 protein_id gnl|my_center|LOCUS_11310 12913 12500 gene locus_tag LOCUS_11320 12913 12500 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316411.1 protein_id gnl|my_center|LOCUS_11320 13751 12963 gene locus_tag LOCUS_11330 13751 12963 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_11330 14823 13789 gene locus_tag LOCUS_11340 14823 13789 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207172.1 protein_id gnl|my_center|LOCUS_11340 14967 15140 gene locus_tag LOCUS_11350 14967 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 15989 15234 gene locus_tag LOCUS_11360 15989 15234 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 protein_id gnl|my_center|LOCUS_11360 17512 16061 gene locus_tag LOCUS_11370 17512 16061 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005135.1 protein_id gnl|my_center|LOCUS_11370 17869 17681 gene locus_tag LOCUS_11380 17869 17681 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230573.1 protein_id gnl|my_center|LOCUS_11380 18220 17933 gene locus_tag LOCUS_11390 18220 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 19852 18305 gene locus_tag LOCUS_11400 19852 18305 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 protein_id gnl|my_center|LOCUS_11400 22256 20043 gene locus_tag LOCUS_11410 22256 20043 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931587.1 protein_id gnl|my_center|LOCUS_11410 22619 23551 gene locus_tag LOCUS_11420 22619 23551 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_11420 23631 24248 gene locus_tag LOCUS_11430 23631 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 24396 24851 gene locus_tag LOCUS_11440 24396 24851 CDS product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124734.1 protein_id gnl|my_center|LOCUS_11440 25313 24951 gene locus_tag LOCUS_11450 25313 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 25447 27156 gene locus_tag LOCUS_11460 gene argS 25447 27156 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522947.1 protein_id gnl|my_center|LOCUS_11460 27222 27866 gene locus_tag LOCUS_11470 27222 27866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 27969 28625 gene locus_tag LOCUS_11480 27969 28625 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_11480 28939 29592 gene locus_tag LOCUS_11490 gene lptA 28939 29592 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_11490 29589 30389 gene locus_tag LOCUS_11500 gene lptB 29589 30389 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_11500 30389 31963 gene locus_tag LOCUS_11510 30389 31963 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_11510 32485 31964 gene locus_tag LOCUS_11520 32485 31964 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_11520 34518 32686 gene locus_tag LOCUS_11530 34518 32686 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525719.1 protein_id gnl|my_center|LOCUS_11530 34641 35948 gene locus_tag LOCUS_11540 34641 35948 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_11540 35938 36465 gene locus_tag LOCUS_11550 35938 36465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 38486 36510 gene locus_tag LOCUS_11560 38486 36510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 39444 38659 gene locus_tag LOCUS_11570 39444 38659 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402690.1 protein_id gnl|my_center|LOCUS_11570 39657 40580 gene locus_tag LOCUS_11580 39657 40580 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530407.1 protein_id gnl|my_center|LOCUS_11580 40637 41470 gene locus_tag LOCUS_11590 40637 41470 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367002.1 protein_id gnl|my_center|LOCUS_11590 41534 42736 gene locus_tag LOCUS_11600 41534 42736 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267447.1 protein_id gnl|my_center|LOCUS_11600 42961 44871 gene locus_tag LOCUS_11610 42961 44871 CDS product bifunctional sugar phosphate isomerase/epimerase/4-hydroxyphenylpyruvate dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738807.1 protein_id gnl|my_center|LOCUS_11610 44987 46381 gene locus_tag LOCUS_11620 44987 46381 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088210.1 protein_id gnl|my_center|LOCUS_11620 46638 47465 gene locus_tag LOCUS_11630 46638 47465 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688556.1 protein_id gnl|my_center|LOCUS_11630 47560 49062 gene locus_tag LOCUS_11640 47560 49062 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993982.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence017 <1 1301 gene locus_tag LOCUS_11650 <1 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003820367.1:argininosuccinate synthase 2524 1451 gene locus_tag LOCUS_11660 gene murB 2524 1451 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 protein_id gnl|my_center|LOCUS_11660 2590 3075 gene locus_tag LOCUS_11670 2590 3075 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_11670 3145 3768 gene locus_tag LOCUS_11680 3145 3768 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_11680 3776 4804 gene locus_tag LOCUS_11690 3776 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4860 5612 gene locus_tag LOCUS_11700 gene aat 4860 5612 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900429.1 protein_id gnl|my_center|LOCUS_11700 5609 6361 gene locus_tag LOCUS_11710 5609 6361 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192823.1 protein_id gnl|my_center|LOCUS_11710 6481 7293 gene locus_tag LOCUS_11720 6481 7293 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_11720 8531 7428 gene locus_tag LOCUS_11730 gene pbpG 8531 7428 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557110.1 protein_id gnl|my_center|LOCUS_11730 10187 8649 gene locus_tag LOCUS_11740 10187 8649 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_11740 11197 10361 gene locus_tag LOCUS_11750 gene pssA 11197 10361 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_11750 12422 11406 gene locus_tag LOCUS_11760 gene ilvC 12422 11406 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814005.1 protein_id gnl|my_center|LOCUS_11760 12978 12487 gene locus_tag LOCUS_11770 gene ilvN 12978 12487 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_11770 14958 13177 gene locus_tag LOCUS_11780 14958 13177 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_11780 15249 15818 gene locus_tag LOCUS_11790 15249 15818 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_11790 15815 16270 gene locus_tag LOCUS_11800 15815 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 16290 17174 gene locus_tag LOCUS_11810 16290 17174 CDS product DUF3106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526454.1 protein_id gnl|my_center|LOCUS_11810 17247 17816 gene locus_tag LOCUS_11820 17247 17816 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 protein_id gnl|my_center|LOCUS_11820 17937 18338 gene locus_tag LOCUS_11830 17937 18338 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808610.1 protein_id gnl|my_center|LOCUS_11830 18331 18933 gene locus_tag LOCUS_11840 18331 18933 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_11840 19364 19026 gene locus_tag LOCUS_11850 19364 19026 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193987.1 protein_id gnl|my_center|LOCUS_11850 21108 19456 gene locus_tag LOCUS_11860 21108 19456 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198600.1 protein_id gnl|my_center|LOCUS_11860 21746 21171 gene locus_tag LOCUS_11870 21746 21171 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207122.1 protein_id gnl|my_center|LOCUS_11870 22693 21743 gene locus_tag LOCUS_11880 22693 21743 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198295.1 protein_id gnl|my_center|LOCUS_11880 22763 24013 gene locus_tag LOCUS_11890 22763 24013 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526008.1 protein_id gnl|my_center|LOCUS_11890 24105 25127 gene locus_tag LOCUS_11900 24105 25127 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817045.1 protein_id gnl|my_center|LOCUS_11900 25246 26523 gene locus_tag LOCUS_11910 25246 26523 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832356.1 protein_id gnl|my_center|LOCUS_11910 27181 26672 gene locus_tag LOCUS_11920 27181 26672 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_11920 27888 27352 gene locus_tag LOCUS_11930 gene ppa 27888 27352 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930982.1 protein_id gnl|my_center|LOCUS_11930 29411 28026 gene locus_tag LOCUS_11940 29411 28026 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031687.1 protein_id gnl|my_center|LOCUS_11940 30066 29518 gene locus_tag LOCUS_11950 30066 29518 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403937.1 protein_id gnl|my_center|LOCUS_11950 30214 31659 gene locus_tag LOCUS_11960 30214 31659 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448980.1 protein_id gnl|my_center|LOCUS_11960 32705 31773 gene locus_tag LOCUS_11970 32705 31773 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929674.1 protein_id gnl|my_center|LOCUS_11970 33383 32748 gene locus_tag LOCUS_11980 33383 32748 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098862.1 protein_id gnl|my_center|LOCUS_11980 33686 34456 gene locus_tag LOCUS_11990 33686 34456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_11990 34611 35717 gene locus_tag LOCUS_12000 gene moaA 34611 35717 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_12000 35818 36447 gene locus_tag LOCUS_12010 gene mobA 35818 36447 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446521.1 protein_id gnl|my_center|LOCUS_12010 36444 37769 gene locus_tag LOCUS_12020 36444 37769 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812683.1 protein_id gnl|my_center|LOCUS_12020 37841 38173 gene locus_tag LOCUS_12030 37841 38173 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_12030 38650 38204 gene locus_tag LOCUS_12040 gene rnhA 38650 38204 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_12040 39510 38749 gene locus_tag LOCUS_12050 39510 38749 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931355.1 protein_id gnl|my_center|LOCUS_12050 39530 40342 gene locus_tag LOCUS_12060 gene gloB 39530 40342 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927090.1 protein_id gnl|my_center|LOCUS_12060 40339 41913 gene locus_tag LOCUS_12070 40339 41913 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192263.1 protein_id gnl|my_center|LOCUS_12070 42094 41942 gene locus_tag LOCUS_12080 42094 41942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 43313 42201 gene locus_tag LOCUS_12090 43313 42201 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 protein_id gnl|my_center|LOCUS_12090 43915 43520 gene locus_tag LOCUS_12100 43915 43520 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931059.1 protein_id gnl|my_center|LOCUS_12100 44615 44025 gene locus_tag LOCUS_12110 gene recR 44615 44025 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_12110 45095 44763 gene locus_tag LOCUS_12120 45095 44763 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_12120 47285 45267 gene locus_tag LOCUS_12130 47285 45267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence018 7680 7108 gene locus_tag LOCUS_12140 7680 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 9155 7692 gene locus_tag LOCUS_12150 9155 7692 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210212.1 protein_id gnl|my_center|LOCUS_12150 10588 9869 gene locus_tag LOCUS_12160 10588 9869 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112419.1 protein_id gnl|my_center|LOCUS_12160 10755 11171 gene locus_tag LOCUS_12170 10755 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 11233 12114 gene locus_tag LOCUS_12180 11233 12114 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206895.1 protein_id gnl|my_center|LOCUS_12180 12116 13717 gene locus_tag LOCUS_12190 12116 13717 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_12190 13714 14370 gene locus_tag LOCUS_12200 13714 14370 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892716.1 protein_id gnl|my_center|LOCUS_12200 14439 15929 gene locus_tag LOCUS_12210 gene hemL 14439 15929 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045277.1 protein_id gnl|my_center|LOCUS_12210 15934 16572 gene locus_tag LOCUS_12220 15934 16572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 16767 16480 gene locus_tag LOCUS_12230 16767 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 16700 17893 gene locus_tag LOCUS_12240 16700 17893 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532385.1 protein_id gnl|my_center|LOCUS_12240 17918 19342 gene locus_tag LOCUS_12250 17918 19342 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_12250 19335 20234 gene locus_tag LOCUS_12260 19335 20234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 20246 21685 gene locus_tag LOCUS_12270 20246 21685 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_12270 20676 20765 gene locus_tag LOCUS_t00110 20676 20765 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22144 23694 gene locus_tag LOCUS_12280 22144 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 25558 23801 gene locus_tag LOCUS_12290 25558 23801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12290 28029 25558 gene locus_tag LOCUS_12300 28029 25558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 28832 28044 gene locus_tag LOCUS_12310 28832 28044 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195836.1 protein_id gnl|my_center|LOCUS_12310 29581 28829 gene locus_tag LOCUS_12320 29581 28829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 29964 29578 gene locus_tag LOCUS_12330 29964 29578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 30227 31876 gene locus_tag LOCUS_12340 30227 31876 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193473.1 protein_id gnl|my_center|LOCUS_12340 32885 32178 gene locus_tag LOCUS_12350 32885 32178 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036470.1 protein_id gnl|my_center|LOCUS_12350 33506 32907 gene locus_tag LOCUS_12360 33506 32907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 33596 34342 gene locus_tag LOCUS_12370 33596 34342 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815414.1 protein_id gnl|my_center|LOCUS_12370 35164 34358 gene locus_tag LOCUS_12380 35164 34358 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_12380 36182 35169 gene locus_tag LOCUS_12390 36182 35169 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_12390 36362 36532 gene locus_tag LOCUS_12400 36362 36532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 36620 38071 gene locus_tag LOCUS_12410 36620 38071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 38187 38519 gene locus_tag LOCUS_12420 38187 38519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 39815 38565 gene locus_tag LOCUS_12430 gene hemW 39815 38565 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_12430 40438 39839 gene locus_tag LOCUS_12440 gene rdgB 40438 39839 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 protein_id gnl|my_center|LOCUS_12440 41230 40484 gene locus_tag LOCUS_12450 gene rph 41230 40484 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_12450 42338 41427 gene locus_tag LOCUS_12460 42338 41427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 43351 42335 gene locus_tag LOCUS_12470 43351 42335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 43439 44332 gene locus_tag LOCUS_12480 43439 44332 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811148.1 protein_id gnl|my_center|LOCUS_12480 44373 44993 gene locus_tag LOCUS_12490 gene gmk 44373 44993 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_12490 45018 45221 gene locus_tag LOCUS_12500 gene rpoZ 45018 45221 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence019 <1 1826 gene locus_tag LOCUS_12510 <1 1826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037515.1:fructose-specific PTS transporter subunit EIIC 1823 2644 gene locus_tag LOCUS_12520 1823 2644 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886725.1 protein_id gnl|my_center|LOCUS_12520 3888 2674 gene locus_tag LOCUS_12530 3888 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5437 3956 gene locus_tag LOCUS_12540 5437 3956 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190957.1 protein_id gnl|my_center|LOCUS_12540 5570 6964 gene locus_tag LOCUS_12550 gene dbpA 5570 6964 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203996.1 protein_id gnl|my_center|LOCUS_12550 7050 7829 gene locus_tag LOCUS_12560 7050 7829 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235372.1 protein_id gnl|my_center|LOCUS_12560 7865 8869 gene locus_tag LOCUS_12570 7865 8869 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 protein_id gnl|my_center|LOCUS_12570 8874 9692 gene locus_tag LOCUS_12580 8874 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 9928 9683 gene locus_tag LOCUS_12590 9928 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 9822 10772 gene locus_tag LOCUS_12600 9822 10772 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_12600 10769 11230 gene locus_tag LOCUS_12610 gene dtd 10769 11230 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200499.1 protein_id gnl|my_center|LOCUS_12610 13410 11572 gene locus_tag LOCUS_12620 13410 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 14866 13430 gene locus_tag LOCUS_12630 14866 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 15861 15037 gene locus_tag LOCUS_12640 15861 15037 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524730.1 protein_id gnl|my_center|LOCUS_12640 16781 15897 gene locus_tag LOCUS_12650 16781 15897 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_12650 19493 16878 gene locus_tag LOCUS_12660 gene mutS 19493 16878 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_12660 20125 19646 gene locus_tag LOCUS_12670 20125 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 21753 20212 gene locus_tag LOCUS_12680 21753 20212 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 protein_id gnl|my_center|LOCUS_12680 22851 21877 gene locus_tag LOCUS_12690 22851 21877 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479781.1 protein_id gnl|my_center|LOCUS_12690 23002 23826 gene locus_tag LOCUS_12700 gene surE 23002 23826 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_12700 23823 24608 gene locus_tag LOCUS_12710 23823 24608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12710 24662 25492 gene locus_tag LOCUS_12720 24662 25492 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192107.1 protein_id gnl|my_center|LOCUS_12720 25489 26508 gene locus_tag LOCUS_12730 25489 26508 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_12730 26660 27385 gene locus_tag LOCUS_12740 26660 27385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 27382 28677 gene locus_tag LOCUS_12750 27382 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 28764 29189 gene locus_tag LOCUS_12760 gene ndk 28764 29189 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_12760 29289 30410 gene locus_tag LOCUS_12770 gene rlmN 29289 30410 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 protein_id gnl|my_center|LOCUS_12770 30442 31275 gene locus_tag LOCUS_12780 gene pilW 30442 31275 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037146.1 protein_id gnl|my_center|LOCUS_12780 31295 32239 gene locus_tag LOCUS_12790 31295 32239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 32255 33523 gene locus_tag LOCUS_12800 gene ispG 32255 33523 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 protein_id gnl|my_center|LOCUS_12800 33606 34937 gene locus_tag LOCUS_12810 gene hisS 33606 34937 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_12810 34950 35636 gene locus_tag LOCUS_12820 34950 35636 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_12820 35636 36784 gene locus_tag LOCUS_12830 gene bamB 35636 36784 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 protein_id gnl|my_center|LOCUS_12830 36796 38139 gene locus_tag LOCUS_12840 gene der 36796 38139 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_12840 38240 38491 gene locus_tag LOCUS_12850 gene hfq 38240 38491 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_12850 38646 39728 gene locus_tag LOCUS_12860 gene hflX 38646 39728 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_12860 40095 41168 gene locus_tag LOCUS_12870 gene hflK 40095 41168 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_12870 41178 42074 gene locus_tag LOCUS_12880 gene hflC 41178 42074 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930787.1 protein_id gnl|my_center|LOCUS_12880 42351 43499 gene locus_tag LOCUS_12890 42351 43499 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_12890 43529 44905 gene locus_tag LOCUS_12900 43529 44905 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 protein_id gnl|my_center|LOCUS_12900 44969 45490 gene locus_tag LOCUS_12910 44969 45490 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810720.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence020 <1 984 gene locus_tag LOCUS_12920 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227138.1:FAD-binding oxidoreductase 2369 1062 gene locus_tag LOCUS_12930 2369 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3450 2626 gene locus_tag LOCUS_12940 3450 2626 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_12940 3647 4213 gene locus_tag LOCUS_12950 3647 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4232 5356 gene locus_tag LOCUS_12960 4232 5356 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970562.1 protein_id gnl|my_center|LOCUS_12960 5335 6195 gene locus_tag LOCUS_12970 5335 6195 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_12970 7378 6218 gene locus_tag LOCUS_12980 7378 6218 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929834.1 protein_id gnl|my_center|LOCUS_12980 8374 7514 gene locus_tag LOCUS_12990 8374 7514 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200991.1 protein_id gnl|my_center|LOCUS_12990 10849 8510 gene locus_tag LOCUS_13000 10849 8510 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204397.1 protein_id gnl|my_center|LOCUS_13000 12821 11019 gene locus_tag LOCUS_13010 12821 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 19160 13152 gene locus_tag LOCUS_13020 19160 13152 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266335.1 protein_id gnl|my_center|LOCUS_13020 19462 19277 gene locus_tag LOCUS_13030 19462 19277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 19410 20603 gene locus_tag LOCUS_13040 19410 20603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 20672 21784 gene locus_tag LOCUS_13050 20672 21784 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_13050 22597 21800 gene locus_tag LOCUS_13060 22597 21800 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_13060 24231 22762 gene locus_tag LOCUS_13070 gene argH 24231 22762 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191886.1 protein_id gnl|my_center|LOCUS_13070 24282 25352 gene locus_tag LOCUS_13080 24282 25352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 25424 26179 gene locus_tag LOCUS_13090 25424 26179 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_13090 27120 26317 gene locus_tag LOCUS_13100 27120 26317 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_13100 28169 27261 gene locus_tag LOCUS_13110 28169 27261 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446869.1 protein_id gnl|my_center|LOCUS_13110 28479 29396 gene locus_tag LOCUS_13120 28479 29396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 30221 29439 gene locus_tag LOCUS_13130 30221 29439 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_13130 31105 30218 gene locus_tag LOCUS_13140 31105 30218 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 protein_id gnl|my_center|LOCUS_13140 31431 32675 gene locus_tag LOCUS_13150 31431 32675 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196258.1 protein_id gnl|my_center|LOCUS_13150 33221 32703 gene locus_tag LOCUS_13160 33221 32703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13160 33501 33121 gene locus_tag LOCUS_13170 33501 33121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13170 34302 33640 gene locus_tag LOCUS_13180 34302 33640 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385044.1 protein_id gnl|my_center|LOCUS_13180 35482 34274 gene locus_tag LOCUS_13190 35482 34274 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537514.1 protein_id gnl|my_center|LOCUS_13190 36321 35479 gene locus_tag LOCUS_13200 36321 35479 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188447.1 protein_id gnl|my_center|LOCUS_13200 37133 36318 gene locus_tag LOCUS_13210 37133 36318 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188447.1 protein_id gnl|my_center|LOCUS_13210 38092 37199 gene locus_tag LOCUS_13220 38092 37199 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385041.1 protein_id gnl|my_center|LOCUS_13220 39501 38089 gene locus_tag LOCUS_13230 39501 38089 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115003.1 protein_id gnl|my_center|LOCUS_13230 40349 39516 gene locus_tag LOCUS_13240 40349 39516 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385041.1 protein_id gnl|my_center|LOCUS_13240 41707 40421 gene locus_tag LOCUS_13250 41707 40421 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089457.1 protein_id gnl|my_center|LOCUS_13250 43130 41871 gene locus_tag LOCUS_13260 43130 41871 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105350.1 protein_id gnl|my_center|LOCUS_13260 43271 43657 gene locus_tag LOCUS_13270 43271 43657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13270 43654 43827 gene locus_tag LOCUS_13280 43654 43827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13280 43900 44139 gene locus_tag LOCUS_13290 43900 44139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13290 >Feature sequence021 392 991 gene locus_tag LOCUS_13300 392 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6899 2064 gene locus_tag LOCUS_13310 6899 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 8288 7179 gene locus_tag LOCUS_13320 8288 7179 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812176.1 protein_id gnl|my_center|LOCUS_13320 8844 8335 gene locus_tag LOCUS_13330 8844 8335 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 protein_id gnl|my_center|LOCUS_13330 10716 9019 gene locus_tag LOCUS_13340 gene leuA 10716 9019 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114718.1 protein_id gnl|my_center|LOCUS_13340 13494 11026 gene locus_tag LOCUS_13350 13494 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 14410 13766 gene locus_tag LOCUS_13360 14410 13766 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463347.1 protein_id gnl|my_center|LOCUS_13360 14635 17214 gene locus_tag LOCUS_13370 14635 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 17216 17974 gene locus_tag LOCUS_13380 17216 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 17999 18475 gene locus_tag LOCUS_13390 17999 18475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 19190 18438 gene locus_tag LOCUS_13400 19190 18438 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812947.1 protein_id gnl|my_center|LOCUS_13400 21157 19175 gene locus_tag LOCUS_13410 21157 19175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 21738 21235 gene locus_tag LOCUS_13420 21738 21235 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869958.1 protein_id gnl|my_center|LOCUS_13420 22316 21951 gene locus_tag LOCUS_13430 22316 21951 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185161.1 protein_id gnl|my_center|LOCUS_13430 24612 22396 gene locus_tag LOCUS_13440 gene dinG 24612 22396 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224852.1 protein_id gnl|my_center|LOCUS_13440 24714 25070 gene locus_tag LOCUS_13450 24714 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 25621 25181 gene locus_tag LOCUS_13460 25621 25181 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388338.1 protein_id gnl|my_center|LOCUS_13460 25871 26947 gene locus_tag LOCUS_13470 25871 26947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 27195 26959 gene locus_tag LOCUS_13480 27195 26959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 27697 27272 gene locus_tag LOCUS_13490 27697 27272 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074009.1 protein_id gnl|my_center|LOCUS_13490 27884 29875 gene locus_tag LOCUS_13500 27884 29875 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 protein_id gnl|my_center|LOCUS_13500 30941 29925 gene locus_tag LOCUS_13510 30941 29925 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041807480.1 protein_id gnl|my_center|LOCUS_13510 33679 31049 gene locus_tag LOCUS_13520 gene gyrB 33679 31049 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_13520 34981 33863 gene locus_tag LOCUS_13530 gene dnaN 34981 33863 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_13530 36567 35146 gene locus_tag LOCUS_13540 gene dnaA 36567 35146 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929554.1 protein_id gnl|my_center|LOCUS_13540 36908 37042 gene locus_tag LOCUS_13550 gene rpmH 36908 37042 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816025.1 protein_id gnl|my_center|LOCUS_13550 37351 37710 gene locus_tag LOCUS_13560 37351 37710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 37710 38003 gene locus_tag LOCUS_13570 37710 38003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 38000 39706 gene locus_tag LOCUS_13580 gene yidC 38000 39706 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927254.1 protein_id gnl|my_center|LOCUS_13580 39867 41453 gene locus_tag LOCUS_13590 39867 41453 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931365.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence022 281 1393 gene locus_tag LOCUS_13600 281 1393 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026433798.1 protein_id gnl|my_center|LOCUS_13600 1415 5809 gene locus_tag LOCUS_13610 1415 5809 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157768866.1 protein_id gnl|my_center|LOCUS_13610 5958 6818 gene locus_tag LOCUS_13620 gene motA 5958 6818 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_13620 6848 7786 gene locus_tag LOCUS_13630 gene motB 6848 7786 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938926.1 protein_id gnl|my_center|LOCUS_13630 7852 8238 gene locus_tag LOCUS_13640 gene cheY 7852 8238 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_13640 8241 8897 gene locus_tag LOCUS_13650 gene cheZ 8241 8897 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817162.1 protein_id gnl|my_center|LOCUS_13650 9009 10181 gene locus_tag LOCUS_13660 gene flhB 9009 10181 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_13660 10178 12259 gene locus_tag LOCUS_13670 gene flhA 10178 12259 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_13670 12256 13782 gene locus_tag LOCUS_13680 gene flhF 12256 13782 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 protein_id gnl|my_center|LOCUS_13680 13772 14578 gene locus_tag LOCUS_13690 13772 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 14584 15303 gene locus_tag LOCUS_13700 14584 15303 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_13700 15780 15430 gene locus_tag LOCUS_13710 15780 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 16180 15842 gene locus_tag LOCUS_13720 16180 15842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 17008 16259 gene locus_tag LOCUS_13730 gene flgA 17008 16259 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_13730 17323 17754 gene locus_tag LOCUS_13740 gene flgB 17323 17754 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884694.1 protein_id gnl|my_center|LOCUS_13740 17808 18212 gene locus_tag LOCUS_13750 gene flgC 17808 18212 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197251.1 protein_id gnl|my_center|LOCUS_13750 18259 18921 gene locus_tag LOCUS_13760 gene flgD 18259 18921 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535718.1 protein_id gnl|my_center|LOCUS_13760 18983 20239 gene locus_tag LOCUS_13770 gene flgE 18983 20239 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_13770 20283 21023 gene locus_tag LOCUS_13780 gene flgF 20283 21023 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_13780 21064 21846 gene locus_tag LOCUS_13790 gene flgG 21064 21846 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192166.1 protein_id gnl|my_center|LOCUS_13790 21875 22573 gene locus_tag LOCUS_13800 21875 22573 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_13800 22796 23965 gene locus_tag LOCUS_13810 22796 23965 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_13810 24061 25023 gene locus_tag LOCUS_13820 gene flgJ 24061 25023 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 protein_id gnl|my_center|LOCUS_13820 25040 27061 gene locus_tag LOCUS_13830 gene flgK 25040 27061 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 protein_id gnl|my_center|LOCUS_13830 27106 28356 gene locus_tag LOCUS_13840 gene flgL 27106 28356 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_13840 28562 29797 gene locus_tag LOCUS_13850 28562 29797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 31875 29836 gene locus_tag LOCUS_13860 31875 29836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 32529 33398 gene locus_tag LOCUS_13870 32529 33398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 34906 33437 gene locus_tag LOCUS_13880 34906 33437 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040493.1 protein_id gnl|my_center|LOCUS_13880 35071 35670 gene locus_tag LOCUS_13890 35071 35670 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533855.1 protein_id gnl|my_center|LOCUS_13890 35711 36697 gene locus_tag LOCUS_13900 35711 36697 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064436.1 protein_id gnl|my_center|LOCUS_13900 36849 38063 gene locus_tag LOCUS_13910 36849 38063 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275469.1 protein_id gnl|my_center|LOCUS_13910 38083 38703 gene locus_tag LOCUS_13920 38083 38703 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108953.1 protein_id gnl|my_center|LOCUS_13920 38842 39726 gene locus_tag LOCUS_13930 38842 39726 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_13930 39723 40442 gene locus_tag LOCUS_13940 39723 40442 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186239.1 protein_id gnl|my_center|LOCUS_13940 40525 41505 gene locus_tag LOCUS_13950 40525 41505 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_13950 41701 42417 gene locus_tag LOCUS_13960 41701 42417 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence023 <1 756 gene locus_tag LOCUS_13970 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211480.1:magnesium/cobalt transporter CorA 1690 953 gene locus_tag LOCUS_13980 1690 953 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193777.1 protein_id gnl|my_center|LOCUS_13980 3435 1687 gene locus_tag LOCUS_13990 3435 1687 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 protein_id gnl|my_center|LOCUS_13990 4917 3508 gene locus_tag LOCUS_14000 gene pntB 4917 3508 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014056.1 protein_id gnl|my_center|LOCUS_14000 6559 4946 gene locus_tag LOCUS_14010 gene pntA 6559 4946 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707743.1 protein_id gnl|my_center|LOCUS_14010 7822 6758 gene locus_tag LOCUS_14020 gene fba 7822 6758 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809510.1 protein_id gnl|my_center|LOCUS_14020 9337 7919 gene locus_tag LOCUS_14030 9337 7919 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339306.1 protein_id gnl|my_center|LOCUS_14030 10043 9348 gene locus_tag LOCUS_14040 gene pmrA 10043 9348 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_14040 10122 10880 gene locus_tag LOCUS_14050 10122 10880 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418992.1 protein_id gnl|my_center|LOCUS_14050 12079 10898 gene locus_tag LOCUS_14060 gene pyk 12079 10898 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14060 12333 12079 gene locus_tag LOCUS_14070 12333 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14070 13383 12433 gene locus_tag LOCUS_14080 13383 12433 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064573.1 protein_id gnl|my_center|LOCUS_14080 13580 14458 gene locus_tag LOCUS_14090 13580 14458 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767820.1 protein_id gnl|my_center|LOCUS_14090 14522 16051 gene locus_tag LOCUS_14100 14522 16051 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268490.1 protein_id gnl|my_center|LOCUS_14100 16124 17482 gene locus_tag LOCUS_14110 16124 17482 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626156.1 protein_id gnl|my_center|LOCUS_14110 17496 18692 gene locus_tag LOCUS_14120 17496 18692 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 protein_id gnl|my_center|LOCUS_14120 20121 18724 gene locus_tag LOCUS_14130 20121 18724 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 protein_id gnl|my_center|LOCUS_14130 21030 20233 gene locus_tag LOCUS_14140 21030 20233 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 protein_id gnl|my_center|LOCUS_14140 21156 23249 gene locus_tag LOCUS_14150 gene tkt 21156 23249 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064313.1 protein_id gnl|my_center|LOCUS_14150 23344 24345 gene locus_tag LOCUS_14160 gene gap 23344 24345 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_14160 24519 26234 gene locus_tag LOCUS_14170 24519 26234 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_14170 26280 27665 gene locus_tag LOCUS_14180 26280 27665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 27913 28464 gene locus_tag LOCUS_14190 27913 28464 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 protein_id gnl|my_center|LOCUS_14190 28616 29929 gene locus_tag LOCUS_14200 28616 29929 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038748.1 protein_id gnl|my_center|LOCUS_14200 29950 30810 gene locus_tag LOCUS_14210 29950 30810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 31246 30842 gene locus_tag LOCUS_14220 31246 30842 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227402.1 protein_id gnl|my_center|LOCUS_14220 32414 31302 gene locus_tag LOCUS_14230 32414 31302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 32592 33464 gene locus_tag LOCUS_14240 32592 33464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14240 35456 33594 gene locus_tag LOCUS_14250 gene recQ 35456 33594 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 protein_id gnl|my_center|LOCUS_14250 36557 35778 gene locus_tag LOCUS_14260 36557 35778 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719513.1 protein_id gnl|my_center|LOCUS_14260 38281 36566 gene locus_tag LOCUS_14270 38281 36566 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355198.1 protein_id gnl|my_center|LOCUS_14270 38517 40058 gene locus_tag LOCUS_14280 38517 40058 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533079.1 protein_id gnl|my_center|LOCUS_14280 40159 41901 gene locus_tag LOCUS_14290 40159 41901 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence024 553 17 gene locus_tag LOCUS_14300 gene iscR 553 17 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_14300 2880 811 gene locus_tag LOCUS_14310 gene uvrB 2880 811 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_14310 3012 4208 gene locus_tag LOCUS_14320 3012 4208 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198124.1 protein_id gnl|my_center|LOCUS_14320 5495 4356 gene locus_tag LOCUS_14330 5495 4356 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083251.1 protein_id gnl|my_center|LOCUS_14330 6845 5613 gene locus_tag LOCUS_14340 6845 5613 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382911.1 protein_id gnl|my_center|LOCUS_14340 7978 7010 gene locus_tag LOCUS_14350 7978 7010 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 protein_id gnl|my_center|LOCUS_14350 8263 10083 gene locus_tag LOCUS_14360 8263 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 12071 10317 gene locus_tag LOCUS_14370 12071 10317 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 protein_id gnl|my_center|LOCUS_14370 12306 12382 gene locus_tag LOCUS_t00120 12306 12382 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12546 12749 gene locus_tag LOCUS_14380 12546 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 13133 12855 gene locus_tag LOCUS_14390 13133 12855 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 protein_id gnl|my_center|LOCUS_14390 13359 13589 gene locus_tag LOCUS_14400 13359 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 14333 13773 gene locus_tag LOCUS_14410 14333 13773 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_14410 14596 14669 gene locus_tag LOCUS_t00130 14596 14669 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15658 14723 gene locus_tag LOCUS_14420 15658 14723 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235933.1 protein_id gnl|my_center|LOCUS_14420 16001 18322 gene locus_tag LOCUS_14430 16001 18322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 19189 18377 gene locus_tag LOCUS_14440 19189 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 20148 19267 gene locus_tag LOCUS_14450 20148 19267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 20895 20185 gene locus_tag LOCUS_14460 20895 20185 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_14460 21600 22034 gene locus_tag LOCUS_14470 21600 22034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 22196 22639 gene locus_tag LOCUS_14480 22196 22639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 22785 24569 gene locus_tag LOCUS_14490 22785 24569 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388628.1 protein_id gnl|my_center|LOCUS_14490 24613 25938 gene locus_tag LOCUS_14500 24613 25938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 29250 26035 gene locus_tag LOCUS_14510 29250 26035 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063897.1 protein_id gnl|my_center|LOCUS_14510 30167 29313 gene locus_tag LOCUS_14520 gene thiD 30167 29313 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975923.1 protein_id gnl|my_center|LOCUS_14520 30472 31599 gene locus_tag LOCUS_14530 30472 31599 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199940.1 protein_id gnl|my_center|LOCUS_14530 31614 31811 gene locus_tag LOCUS_14540 gene thiS 31614 31811 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199938.1 protein_id gnl|my_center|LOCUS_14540 31860 32684 gene locus_tag LOCUS_14550 31860 32684 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221723.1 protein_id gnl|my_center|LOCUS_14550 32677 33630 gene locus_tag LOCUS_14560 gene thiE 32677 33630 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205266.1 protein_id gnl|my_center|LOCUS_14560 35807 33732 gene locus_tag LOCUS_14570 35807 33732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 36014 37492 gene locus_tag LOCUS_14580 36014 37492 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 protein_id gnl|my_center|LOCUS_14580 37547 38326 gene locus_tag LOCUS_14590 37547 38326 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196422.1 protein_id gnl|my_center|LOCUS_14590 38576 39295 gene locus_tag LOCUS_14600 38576 39295 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 protein_id gnl|my_center|LOCUS_14600 39330 40415 gene locus_tag LOCUS_14610 39330 40415 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_14610 40510 41784 gene locus_tag LOCUS_14620 40510 41784 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence025 3057 823 gene locus_tag LOCUS_14630 3057 823 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039372.1 protein_id gnl|my_center|LOCUS_14630 4409 3498 gene locus_tag LOCUS_14640 4409 3498 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_14640 5665 4526 gene locus_tag LOCUS_14650 5665 4526 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_14650 5945 6190 gene locus_tag LOCUS_14660 5945 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 6193 7092 gene locus_tag LOCUS_14670 6193 7092 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190235.1 protein_id gnl|my_center|LOCUS_14670 7206 9083 gene locus_tag LOCUS_14680 gene dxs 7206 9083 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_14680 9437 10516 gene locus_tag LOCUS_14690 9437 10516 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567739.1 protein_id gnl|my_center|LOCUS_14690 11144 10626 gene locus_tag LOCUS_14700 11144 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 12694 11153 gene locus_tag LOCUS_14710 12694 11153 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315176.1 protein_id gnl|my_center|LOCUS_14710 13288 12749 gene locus_tag LOCUS_14720 13288 12749 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315177.1 protein_id gnl|my_center|LOCUS_14720 14658 13504 gene locus_tag LOCUS_14730 14658 13504 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812659.1 protein_id gnl|my_center|LOCUS_14730 14711 15448 gene locus_tag LOCUS_14740 14711 15448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812658.1 protein_id gnl|my_center|LOCUS_14740 15445 16188 gene locus_tag LOCUS_14750 15445 16188 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930378.1 protein_id gnl|my_center|LOCUS_14750 16185 17024 gene locus_tag LOCUS_14760 16185 17024 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567445.1 protein_id gnl|my_center|LOCUS_14760 18593 16947 gene locus_tag LOCUS_14770 18593 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 18493 18933 gene locus_tag LOCUS_14780 18493 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 20852 19074 gene locus_tag LOCUS_14790 20852 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 21853 21497 gene locus_tag LOCUS_14800 gene nirD 21853 21497 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_14800 24432 21901 gene locus_tag LOCUS_14810 gene nirB 24432 21901 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197731.1 protein_id gnl|my_center|LOCUS_14810 25943 24828 gene locus_tag LOCUS_14820 gene modC 25943 24828 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_14820 26617 25940 gene locus_tag LOCUS_14830 gene modB 26617 25940 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_14830 27444 26644 gene locus_tag LOCUS_14840 gene modA 27444 26644 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_14840 27554 28366 gene locus_tag LOCUS_14850 27554 28366 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190826.1 protein_id gnl|my_center|LOCUS_14850 28505 29275 gene locus_tag LOCUS_14860 28505 29275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821323.1 protein_id gnl|my_center|LOCUS_14860 29275 29988 gene locus_tag LOCUS_14870 29275 29988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_14870 30057 31268 gene locus_tag LOCUS_14880 30057 31268 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185183.1 protein_id gnl|my_center|LOCUS_14880 31376 32617 gene locus_tag LOCUS_14890 31376 32617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524520.1 protein_id gnl|my_center|LOCUS_14890 32707 33591 gene locus_tag LOCUS_14900 32707 33591 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185119.1 protein_id gnl|my_center|LOCUS_14900 33647 34657 gene locus_tag LOCUS_14910 33647 34657 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195809.1 protein_id gnl|my_center|LOCUS_14910 35984 34812 gene locus_tag LOCUS_14920 35984 34812 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_14920 37100 36015 gene locus_tag LOCUS_14930 37100 36015 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095867.1 protein_id gnl|my_center|LOCUS_14930 37324 39624 gene locus_tag LOCUS_14940 37324 39624 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091102695.1 protein_id gnl|my_center|LOCUS_14940 40521 39793 gene locus_tag LOCUS_14950 40521 39793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence026 401 1279 gene locus_tag LOCUS_14960 gene urtD 401 1279 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_14960 2113 2817 gene locus_tag LOCUS_14970 gene urtE 2113 2817 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816777.1 protein_id gnl|my_center|LOCUS_14970 2935 3591 gene locus_tag LOCUS_14980 2935 3591 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038447.1 protein_id gnl|my_center|LOCUS_14980 6388 3659 gene locus_tag LOCUS_14990 6388 3659 CDS product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038446.1 protein_id gnl|my_center|LOCUS_14990 6614 7957 gene locus_tag LOCUS_15000 6614 7957 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038444.1 protein_id gnl|my_center|LOCUS_15000 8128 9354 gene locus_tag LOCUS_15010 8128 9354 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968609.1 protein_id gnl|my_center|LOCUS_15010 10199 9369 gene locus_tag LOCUS_15020 10199 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 10445 11530 gene locus_tag LOCUS_15030 10445 11530 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065071.1 protein_id gnl|my_center|LOCUS_15030 11541 12353 gene locus_tag LOCUS_15040 11541 12353 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 protein_id gnl|my_center|LOCUS_15040 13199 12369 gene locus_tag LOCUS_15050 13199 12369 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185533.1 protein_id gnl|my_center|LOCUS_15050 13808 13284 gene locus_tag LOCUS_15060 13808 13284 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839848.1 protein_id gnl|my_center|LOCUS_15060 14851 13805 gene locus_tag LOCUS_15070 14851 13805 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_15070 14808 15011 gene locus_tag LOCUS_15080 14808 15011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 15358 16401 gene locus_tag LOCUS_15090 15358 16401 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139593.1 protein_id gnl|my_center|LOCUS_15090 17290 16484 gene locus_tag LOCUS_15100 17290 16484 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524357.1 protein_id gnl|my_center|LOCUS_15100 18329 17316 gene locus_tag LOCUS_15110 18329 17316 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089417.1 protein_id gnl|my_center|LOCUS_15110 19080 18352 gene locus_tag LOCUS_15120 19080 18352 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194988.1 protein_id gnl|my_center|LOCUS_15120 20348 19077 gene locus_tag LOCUS_15130 20348 19077 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765391.1 protein_id gnl|my_center|LOCUS_15130 21250 20345 gene locus_tag LOCUS_15140 21250 20345 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105293.1 protein_id gnl|my_center|LOCUS_15140 22684 21296 gene locus_tag LOCUS_15150 22684 21296 CDS product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104428.1 protein_id gnl|my_center|LOCUS_15150 23708 22929 gene locus_tag LOCUS_15160 23708 22929 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200845.1 protein_id gnl|my_center|LOCUS_15160 24843 23854 gene locus_tag LOCUS_15170 24843 23854 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 protein_id gnl|my_center|LOCUS_15170 25804 25052 gene locus_tag LOCUS_15180 25804 25052 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_15180 26459 25881 gene locus_tag LOCUS_15190 26459 25881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 27599 26481 gene locus_tag LOCUS_15200 27599 26481 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266995.1 protein_id gnl|my_center|LOCUS_15200 29997 27673 gene locus_tag LOCUS_15210 29997 27673 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533185.1 protein_id gnl|my_center|LOCUS_15210 30919 30140 gene locus_tag LOCUS_15220 30919 30140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_15220 31752 30928 gene locus_tag LOCUS_15230 31752 30928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_15230 32898 31864 gene locus_tag LOCUS_15240 32898 31864 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_15240 35404 33110 gene locus_tag LOCUS_15250 35404 33110 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446507.1 protein_id gnl|my_center|LOCUS_15250 37093 35585 gene locus_tag LOCUS_15260 37093 35585 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970358.1 protein_id gnl|my_center|LOCUS_15260 38049 37228 gene locus_tag LOCUS_15270 38049 37228 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812213.1 protein_id gnl|my_center|LOCUS_15270 38834 38088 gene locus_tag LOCUS_15280 38834 38088 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556467.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15280 <39688 38859 gene locus_tag LOCUS_15290 <39688 38859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206510.1:NCS1 family nucleobase:cation symporter-1 >Feature sequence027 1958 300 gene locus_tag LOCUS_15300 1958 300 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095915.1 protein_id gnl|my_center|LOCUS_15300 1994 2311 gene locus_tag LOCUS_15310 1994 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2316 4613 gene locus_tag LOCUS_15320 gene bglX 2316 4613 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993324.1 protein_id gnl|my_center|LOCUS_15320 4737 5585 gene locus_tag LOCUS_15330 4737 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5551 6912 gene locus_tag LOCUS_15340 5551 6912 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928130.1 protein_id gnl|my_center|LOCUS_15340 8061 6994 gene locus_tag LOCUS_15350 8061 6994 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088624.1 protein_id gnl|my_center|LOCUS_15350 8256 8074 gene locus_tag LOCUS_15360 8256 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 8584 8261 gene locus_tag LOCUS_15370 8584 8261 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 protein_id gnl|my_center|LOCUS_15370 10053 8689 gene locus_tag LOCUS_15380 10053 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 11009 10062 gene locus_tag LOCUS_15390 gene cysD 11009 10062 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_15390 11399 11064 gene locus_tag LOCUS_15400 11399 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 13326 11479 gene locus_tag LOCUS_15410 13326 11479 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553995.1 protein_id gnl|my_center|LOCUS_15410 14162 13356 gene locus_tag LOCUS_15420 14162 13356 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_15420 14356 15615 gene locus_tag LOCUS_15430 14356 15615 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_15430 17517 15601 gene locus_tag LOCUS_15440 gene mnmC 17517 15601 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204185.1 protein_id gnl|my_center|LOCUS_15440 18336 17563 gene locus_tag LOCUS_15450 18336 17563 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929766.1 protein_id gnl|my_center|LOCUS_15450 18862 18590 gene locus_tag LOCUS_15460 18862 18590 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_15460 19008 20030 gene locus_tag LOCUS_15470 19008 20030 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965384.1 protein_id gnl|my_center|LOCUS_15470 20366 21328 gene locus_tag LOCUS_15480 20366 21328 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767090.1 protein_id gnl|my_center|LOCUS_15480 21380 21604 gene locus_tag LOCUS_15490 21380 21604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 21681 22844 gene locus_tag LOCUS_15500 gene ssuD 21681 22844 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192866.1 protein_id gnl|my_center|LOCUS_15500 22867 23250 gene locus_tag LOCUS_15510 22867 23250 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975682.1 protein_id gnl|my_center|LOCUS_15510 23247 24110 gene locus_tag LOCUS_15520 gene ssuC 23247 24110 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_15520 24130 24963 gene locus_tag LOCUS_15530 24130 24963 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550532.1 protein_id gnl|my_center|LOCUS_15530 25066 25281 gene locus_tag LOCUS_15540 25066 25281 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191306.1 protein_id gnl|my_center|LOCUS_15540 26077 28290 gene locus_tag LOCUS_15550 26077 28290 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165637096.1 protein_id gnl|my_center|LOCUS_15550 28301 29083 gene locus_tag LOCUS_15560 28301 29083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532381.1 protein_id gnl|my_center|LOCUS_15560 29095 30063 gene locus_tag LOCUS_15570 29095 30063 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532380.1 protein_id gnl|my_center|LOCUS_15570 30066 31079 gene locus_tag LOCUS_15580 30066 31079 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532379.1 protein_id gnl|my_center|LOCUS_15580 31266 32213 gene locus_tag LOCUS_15590 31266 32213 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_15590 32224 32721 gene locus_tag LOCUS_15600 gene nikR 32224 32721 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_15600 33005 34924 gene locus_tag LOCUS_15610 33005 34924 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 protein_id gnl|my_center|LOCUS_15610 34924 35667 gene locus_tag LOCUS_15620 34924 35667 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005689200.1 protein_id gnl|my_center|LOCUS_15620 36617 35703 gene locus_tag LOCUS_15630 36617 35703 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775915.1 protein_id gnl|my_center|LOCUS_15630 36627 37355 gene locus_tag LOCUS_15640 36627 37355 CDS product DUF3348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808944.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence028 <1 1757 gene locus_tag LOCUS_15650 <1 1757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640069.1:xylonate dehydratase XylD 1806 2990 gene locus_tag LOCUS_15660 1806 2990 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206835.1 protein_id gnl|my_center|LOCUS_15660 3018 3629 gene locus_tag LOCUS_15670 3018 3629 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243841.1 protein_id gnl|my_center|LOCUS_15670 3643 4923 gene locus_tag LOCUS_15680 3643 4923 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243758.1 protein_id gnl|my_center|LOCUS_15680 5681 4959 gene locus_tag LOCUS_15690 5681 4959 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766806.1 protein_id gnl|my_center|LOCUS_15690 5844 6746 gene locus_tag LOCUS_15700 5844 6746 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 protein_id gnl|my_center|LOCUS_15700 7083 8255 gene locus_tag LOCUS_15710 7083 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 9486 8485 gene locus_tag LOCUS_15720 9486 8485 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 protein_id gnl|my_center|LOCUS_15720 10322 9483 gene locus_tag LOCUS_15730 10322 9483 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268502.1 protein_id gnl|my_center|LOCUS_15730 11047 10442 gene locus_tag LOCUS_15740 11047 10442 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086729.1 protein_id gnl|my_center|LOCUS_15740 11349 11107 gene locus_tag LOCUS_15750 11349 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 12103 11384 gene locus_tag LOCUS_15760 12103 11384 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_15760 13209 12226 gene locus_tag LOCUS_15770 13209 12226 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807281.1 protein_id gnl|my_center|LOCUS_15770 14373 13318 gene locus_tag LOCUS_15780 14373 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 15389 14379 gene locus_tag LOCUS_15790 15389 14379 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 protein_id gnl|my_center|LOCUS_15790 15490 16314 gene locus_tag LOCUS_15800 15490 16314 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203772.1 protein_id gnl|my_center|LOCUS_15800 16339 17625 gene locus_tag LOCUS_15810 16339 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 17905 18198 gene locus_tag LOCUS_15820 17905 18198 CDS product DUF3567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189087.1 protein_id gnl|my_center|LOCUS_15820 18880 18236 gene locus_tag LOCUS_15830 18880 18236 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531973.1 protein_id gnl|my_center|LOCUS_15830 22506 18895 gene locus_tag LOCUS_15840 22506 18895 CDS product ribonucleotide reductase N-terminal alpha domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459011.1 protein_id gnl|my_center|LOCUS_15840 22760 23419 gene locus_tag LOCUS_15850 22760 23419 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_15850 26268 23530 gene locus_tag LOCUS_15860 26268 23530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 26338 27186 gene locus_tag LOCUS_15870 gene purU 26338 27186 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_15870 27197 28144 gene locus_tag LOCUS_15880 27197 28144 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190485.1 protein_id gnl|my_center|LOCUS_15880 28283 30286 gene locus_tag LOCUS_15890 28283 30286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 30477 32000 gene locus_tag LOCUS_15900 30477 32000 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194074.1 protein_id gnl|my_center|LOCUS_15900 33404 32106 gene locus_tag LOCUS_15910 33404 32106 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602676.1 protein_id gnl|my_center|LOCUS_15910 33985 33419 gene locus_tag LOCUS_15920 33985 33419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 35155 34106 gene locus_tag LOCUS_15930 35155 34106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 35339 35737 gene locus_tag LOCUS_15940 35339 35737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 37090 35777 gene locus_tag LOCUS_15950 37090 35777 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552069.1 protein_id gnl|my_center|LOCUS_15950 38285 37152 gene locus_tag LOCUS_15960 38285 37152 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence029 1516 515 gene locus_tag LOCUS_15970 gene pstS 1516 515 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199345.1 protein_id gnl|my_center|LOCUS_15970 1949 3415 gene locus_tag LOCUS_15980 gene ppx 1949 3415 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809631.1 protein_id gnl|my_center|LOCUS_15980 3613 3522 gene locus_tag LOCUS_t00140 3613 3522 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4608 4147 gene locus_tag LOCUS_15990 gene sixA 4608 4147 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_15990 6827 4608 gene locus_tag LOCUS_16000 gene ppk1 6827 4608 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039238.1 protein_id gnl|my_center|LOCUS_16000 7988 7152 gene locus_tag LOCUS_16010 7988 7152 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_16010 8191 9015 gene locus_tag LOCUS_16020 8191 9015 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_16020 9644 9108 gene locus_tag LOCUS_16030 gene soxR 9644 9108 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820813.1 protein_id gnl|my_center|LOCUS_16030 9835 10296 gene locus_tag LOCUS_16040 9835 10296 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172160.1 protein_id gnl|my_center|LOCUS_16040 10302 11591 gene locus_tag LOCUS_16050 10302 11591 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098426.1 protein_id gnl|my_center|LOCUS_16050 11746 12267 gene locus_tag LOCUS_16060 11746 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 12439 14370 gene locus_tag LOCUS_16070 12439 14370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 15377 14457 gene locus_tag LOCUS_16080 gene ylqF 15377 14457 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687704.1 protein_id gnl|my_center|LOCUS_16080 15466 15711 gene locus_tag LOCUS_16090 15466 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 15725 16060 gene locus_tag LOCUS_16100 15725 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 16244 17404 gene locus_tag LOCUS_16110 16244 17404 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628869.1 protein_id gnl|my_center|LOCUS_16110 19835 17559 gene locus_tag LOCUS_16120 19835 17559 CDS product FUSC family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193403.1 protein_id gnl|my_center|LOCUS_16120 21462 19927 gene locus_tag LOCUS_16130 gene gshA 21462 19927 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535409.1 protein_id gnl|my_center|LOCUS_16130 21873 22925 gene locus_tag LOCUS_16140 21873 22925 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104730.1 protein_id gnl|my_center|LOCUS_16140 24132 24419 gene locus_tag LOCUS_16150 24132 24419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 24620 25741 gene locus_tag LOCUS_16160 gene ribBA 24620 25741 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009921779.1 protein_id gnl|my_center|LOCUS_16160 25747 26211 gene locus_tag LOCUS_16170 gene ribH 25747 26211 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_16170 26208 26744 gene locus_tag LOCUS_16180 gene nusB 26208 26744 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_16180 26819 28003 gene locus_tag LOCUS_16190 26819 28003 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194932.1 protein_id gnl|my_center|LOCUS_16190 28037 28459 gene locus_tag LOCUS_16200 gene ybgC 28037 28459 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_16200 28471 28746 gene locus_tag LOCUS_16210 28471 28746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16210 28795 29157 gene locus_tag LOCUS_16220 28795 29157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16220 29174 29599 gene locus_tag LOCUS_16230 gene tolR 29174 29599 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_16230 29692 30750 gene locus_tag LOCUS_16240 29692 30750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 32151 30925 gene locus_tag LOCUS_16250 32151 30925 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191662.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16250 32509 34152 gene locus_tag LOCUS_16260 32509 34152 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_16260 35612 34275 gene locus_tag LOCUS_16270 35612 34275 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931103.1 protein_id gnl|my_center|LOCUS_16270 35894 36964 gene locus_tag LOCUS_16280 gene cyoA 35894 36964 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392423.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence030 475 795 gene locus_tag LOCUS_16290 475 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 792 1436 gene locus_tag LOCUS_16300 792 1436 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_16300 1436 2521 gene locus_tag LOCUS_16310 1436 2521 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_16310 4212 2953 gene locus_tag LOCUS_16320 4212 2953 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112212.1 protein_id gnl|my_center|LOCUS_16320 5088 4258 gene locus_tag LOCUS_16330 5088 4258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171068.1 protein_id gnl|my_center|LOCUS_16330 6437 5103 gene locus_tag LOCUS_16340 6437 5103 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115478.1 protein_id gnl|my_center|LOCUS_16340 7823 6468 gene locus_tag LOCUS_16350 7823 6468 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528156.1 protein_id gnl|my_center|LOCUS_16350 8960 7908 gene locus_tag LOCUS_16360 8960 7908 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974743.1 protein_id gnl|my_center|LOCUS_16360 9864 8965 gene locus_tag LOCUS_16370 9864 8965 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171066.1 protein_id gnl|my_center|LOCUS_16370 10760 9864 gene locus_tag LOCUS_16380 10760 9864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528159.1 protein_id gnl|my_center|LOCUS_16380 12069 10888 gene locus_tag LOCUS_16390 gene sfnG 12069 10888 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104098.1 protein_id gnl|my_center|LOCUS_16390 12710 12129 gene locus_tag LOCUS_16400 gene msuE 12710 12129 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275172.1 protein_id gnl|my_center|LOCUS_16400 15812 13011 gene locus_tag LOCUS_16410 gene glnE 15812 13011 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951341.1 protein_id gnl|my_center|LOCUS_16410 16133 20080 gene locus_tag LOCUS_16420 16133 20080 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 protein_id gnl|my_center|LOCUS_16420 20077 20892 gene locus_tag LOCUS_16430 20077 20892 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813061.1 protein_id gnl|my_center|LOCUS_16430 20889 23063 gene locus_tag LOCUS_16440 20889 23063 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 protein_id gnl|my_center|LOCUS_16440 23067 23696 gene locus_tag LOCUS_16450 23067 23696 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_16450 24966 23773 gene locus_tag LOCUS_16460 24966 23773 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 protein_id gnl|my_center|LOCUS_16460 25237 26271 gene locus_tag LOCUS_16470 25237 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 27014 26361 gene locus_tag LOCUS_16480 27014 26361 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192130.1 protein_id gnl|my_center|LOCUS_16480 27379 28506 gene locus_tag LOCUS_16490 27379 28506 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549948.1 protein_id gnl|my_center|LOCUS_16490 28640 30631 gene locus_tag LOCUS_16500 28640 30631 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964060.1 protein_id gnl|my_center|LOCUS_16500 33216 30715 gene locus_tag LOCUS_16510 33216 30715 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063676826.1 protein_id gnl|my_center|LOCUS_16510 33161 33364 gene locus_tag LOCUS_16520 33161 33364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 34467 33439 gene locus_tag LOCUS_16530 34467 33439 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 protein_id gnl|my_center|LOCUS_16530 34991 34464 gene locus_tag LOCUS_16540 34991 34464 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092999.1 protein_id gnl|my_center|LOCUS_16540 36767 35100 gene locus_tag LOCUS_16550 36767 35100 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195844.1 protein_id gnl|my_center|LOCUS_16550 37793 36861 gene locus_tag LOCUS_16560 37793 36861 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089777.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence031 493 1839 gene locus_tag LOCUS_16570 493 1839 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112297.1 protein_id gnl|my_center|LOCUS_16570 1885 2595 gene locus_tag LOCUS_16580 1885 2595 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 protein_id gnl|my_center|LOCUS_16580 3919 2630 gene locus_tag LOCUS_16590 3919 2630 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057204.1 protein_id gnl|my_center|LOCUS_16590 4108 5094 gene locus_tag LOCUS_16600 4108 5094 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_16600 5203 6105 gene locus_tag LOCUS_16610 5203 6105 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_16610 6123 6788 gene locus_tag LOCUS_16620 6123 6788 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_16620 6785 7585 gene locus_tag LOCUS_16630 6785 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 8624 7653 gene locus_tag LOCUS_16640 8624 7653 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089137.1 protein_id gnl|my_center|LOCUS_16640 8737 9666 gene locus_tag LOCUS_16650 8737 9666 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_16650 9701 10111 gene locus_tag LOCUS_16660 9701 10111 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921517.1 protein_id gnl|my_center|LOCUS_16660 10137 10616 gene locus_tag LOCUS_16670 10137 10616 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089134.1 protein_id gnl|my_center|LOCUS_16670 10613 11878 gene locus_tag LOCUS_16680 10613 11878 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 protein_id gnl|my_center|LOCUS_16680 11875 12696 gene locus_tag LOCUS_16690 gene aroE 11875 12696 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089132.1 protein_id gnl|my_center|LOCUS_16690 12725 13171 gene locus_tag LOCUS_16700 gene aroQ 12725 13171 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_16700 14390 13221 gene locus_tag LOCUS_16710 gene tarD 14390 13221 CDS product D(-)-tartrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089469.1 protein_id gnl|my_center|LOCUS_16710 15155 14439 gene locus_tag LOCUS_16720 15155 14439 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705315.1 protein_id gnl|my_center|LOCUS_16720 16119 15145 gene locus_tag LOCUS_16730 16119 15145 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813902.1 protein_id gnl|my_center|LOCUS_16730 17136 16198 gene locus_tag LOCUS_16740 17136 16198 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 protein_id gnl|my_center|LOCUS_16740 17263 18267 gene locus_tag LOCUS_16750 17263 18267 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 protein_id gnl|my_center|LOCUS_16750 18765 18451 gene locus_tag LOCUS_16760 18765 18451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 19771 18770 gene locus_tag LOCUS_16770 19771 18770 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_16770 21164 19920 gene locus_tag LOCUS_16780 21164 19920 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_16780 21411 21716 gene locus_tag LOCUS_16790 21411 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 21837 22196 gene locus_tag LOCUS_16800 21837 22196 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_16800 22734 22318 gene locus_tag LOCUS_16810 22734 22318 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205349.1 protein_id gnl|my_center|LOCUS_16810 23356 22880 gene locus_tag LOCUS_16820 23356 22880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 25576 23477 gene locus_tag LOCUS_16830 25576 23477 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_16830 25925 25569 gene locus_tag LOCUS_16840 25925 25569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 28353 25963 gene locus_tag LOCUS_16850 gene ppsA 28353 25963 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193522.1 protein_id gnl|my_center|LOCUS_16850 28593 29414 gene locus_tag LOCUS_16860 28593 29414 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 protein_id gnl|my_center|LOCUS_16860 30568 29504 gene locus_tag LOCUS_16870 gene tsaD 30568 29504 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_16870 30794 33196 gene locus_tag LOCUS_16880 30794 33196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 33346 33972 gene locus_tag LOCUS_16890 33346 33972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 34327 35625 gene locus_tag LOCUS_16900 34327 35625 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 protein_id gnl|my_center|LOCUS_16900 35694 36641 gene locus_tag LOCUS_16910 gene ntrB 35694 36641 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_16910 36749 37561 gene locus_tag LOCUS_16920 36749 37561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence032 1010 105 gene locus_tag LOCUS_16930 1010 105 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811588.1 protein_id gnl|my_center|LOCUS_16930 2085 1108 gene locus_tag LOCUS_16940 2085 1108 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808874.1 protein_id gnl|my_center|LOCUS_16940 2734 2174 gene locus_tag LOCUS_16950 2734 2174 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808796.1 protein_id gnl|my_center|LOCUS_16950 2867 3820 gene locus_tag LOCUS_16960 2867 3820 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812144.1 protein_id gnl|my_center|LOCUS_16960 4721 3828 gene locus_tag LOCUS_16970 gene yghU 4721 3828 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_16970 7627 4838 gene locus_tag LOCUS_16980 gene polA 7627 4838 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_16980 7687 8061 gene locus_tag LOCUS_16990 7687 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 8172 9131 gene locus_tag LOCUS_17000 8172 9131 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_17000 9399 10229 gene locus_tag LOCUS_17010 9399 10229 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190835.1 protein_id gnl|my_center|LOCUS_17010 10406 12361 gene locus_tag LOCUS_17020 10406 12361 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199580.1 protein_id gnl|my_center|LOCUS_17020 13056 12457 gene locus_tag LOCUS_17030 gene nudK 13056 12457 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540486.1 protein_id gnl|my_center|LOCUS_17030 15666 13189 gene locus_tag LOCUS_17040 15666 13189 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555925.1 protein_id gnl|my_center|LOCUS_17040 16656 15787 gene locus_tag LOCUS_17050 gene qapR 16656 15787 CDS product transcriptional repressor QapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099726.1 protein_id gnl|my_center|LOCUS_17050 16816 18000 gene locus_tag LOCUS_17060 16816 18000 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104091.1 protein_id gnl|my_center|LOCUS_17060 18093 19097 gene locus_tag LOCUS_17070 18093 19097 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 protein_id gnl|my_center|LOCUS_17070 19210 19938 gene locus_tag LOCUS_17080 19210 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 20151 21128 gene locus_tag LOCUS_17090 gene guaC 20151 21128 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432434.1 protein_id gnl|my_center|LOCUS_17090 21248 21323 gene locus_tag LOCUS_t00150 21248 21323 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22006 23637 gene locus_tag LOCUS_17100 22006 23637 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 protein_id gnl|my_center|LOCUS_17100 24071 24292 gene locus_tag LOCUS_17110 24071 24292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 24540 24298 gene locus_tag LOCUS_17120 24540 24298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 24485 24997 gene locus_tag LOCUS_17130 24485 24997 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267564.1 protein_id gnl|my_center|LOCUS_17130 25085 26317 gene locus_tag LOCUS_17140 25085 26317 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_17140 27802 26378 gene locus_tag LOCUS_17150 27802 26378 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257454.1 protein_id gnl|my_center|LOCUS_17150 29922 28024 gene locus_tag LOCUS_17160 29922 28024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 30811 30233 gene locus_tag LOCUS_17170 gene orn 30811 30233 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535917.1 protein_id gnl|my_center|LOCUS_17170 30952 32235 gene locus_tag LOCUS_17180 30952 32235 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_17180 32247 32576 gene locus_tag LOCUS_17190 32247 32576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 32607 33608 gene locus_tag LOCUS_17200 gene rsgA 32607 33608 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_17200 34687 33686 gene locus_tag LOCUS_17210 34687 33686 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_17210 35582 34779 gene locus_tag LOCUS_17220 35582 34779 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence033 1179 2069 gene locus_tag LOCUS_17230 1179 2069 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529258.1 protein_id gnl|my_center|LOCUS_17230 2658 2005 gene locus_tag LOCUS_17240 2658 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2916 5885 gene locus_tag LOCUS_17250 2916 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 7359 6016 gene locus_tag LOCUS_17260 7359 6016 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_17260 8351 7377 gene locus_tag LOCUS_17270 8351 7377 CDS product Bug family tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930661.1 protein_id gnl|my_center|LOCUS_17270 8245 8622 gene locus_tag LOCUS_17280 8245 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 8610 9734 gene locus_tag LOCUS_17290 gene hemE 8610 9734 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 protein_id gnl|my_center|LOCUS_17290 10373 12550 gene locus_tag LOCUS_17300 10373 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 14747 12777 gene locus_tag LOCUS_17310 gene ggt 14747 12777 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205994.1 protein_id gnl|my_center|LOCUS_17310 15815 14946 gene locus_tag LOCUS_17320 15815 14946 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853020.1 protein_id gnl|my_center|LOCUS_17320 16846 15812 gene locus_tag LOCUS_17330 16846 15812 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071246.1 protein_id gnl|my_center|LOCUS_17330 18403 16913 gene locus_tag LOCUS_17340 18403 16913 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530792.1 protein_id gnl|my_center|LOCUS_17340 18535 18879 gene locus_tag LOCUS_17350 18535 18879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 19934 18963 gene locus_tag LOCUS_17360 19934 18963 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 protein_id gnl|my_center|LOCUS_17360 20096 22162 gene locus_tag LOCUS_17370 20096 22162 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195888.1 protein_id gnl|my_center|LOCUS_17370 23774 22188 gene locus_tag LOCUS_17380 23774 22188 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452234.1 protein_id gnl|my_center|LOCUS_17380 24074 25291 gene locus_tag LOCUS_17390 24074 25291 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_17390 25518 25904 gene locus_tag LOCUS_17400 25518 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 26445 25954 gene locus_tag LOCUS_17410 26445 25954 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_17410 26541 27713 gene locus_tag LOCUS_17420 gene tgt 26541 27713 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_17420 27826 29280 gene locus_tag LOCUS_17430 27826 29280 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205898.1 protein_id gnl|my_center|LOCUS_17430 29312 30001 gene locus_tag LOCUS_17440 29312 30001 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_17440 31811 30264 gene locus_tag LOCUS_17450 31811 30264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 33820 31808 gene locus_tag LOCUS_17460 33820 31808 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104008.1 protein_id gnl|my_center|LOCUS_17460 33752 34063 gene locus_tag LOCUS_17470 33752 34063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 35154 34090 gene locus_tag LOCUS_17480 35154 34090 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155710829.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence034 <1 953 gene locus_tag LOCUS_17490 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104156.1:response regulator 1230 2294 gene locus_tag LOCUS_17500 1230 2294 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190044.1 protein_id gnl|my_center|LOCUS_17500 2300 2965 gene locus_tag LOCUS_17510 2300 2965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522364.1 protein_id gnl|my_center|LOCUS_17510 3142 4722 gene locus_tag LOCUS_17520 3142 4722 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193473.1 protein_id gnl|my_center|LOCUS_17520 4874 5671 gene locus_tag LOCUS_17530 4874 5671 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931144.1 protein_id gnl|my_center|LOCUS_17530 5956 6435 gene locus_tag LOCUS_17540 5956 6435 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528650.1 protein_id gnl|my_center|LOCUS_17540 6554 7498 gene locus_tag LOCUS_17550 6554 7498 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528649.1 protein_id gnl|my_center|LOCUS_17550 7602 8534 gene locus_tag LOCUS_17560 7602 8534 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184450.1 protein_id gnl|my_center|LOCUS_17560 8554 10611 gene locus_tag LOCUS_17570 8554 10611 CDS product family 2A encapsulin nanocompartment cargo protein cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536863.1 protein_id gnl|my_center|LOCUS_17570 12782 10665 gene locus_tag LOCUS_17580 12782 10665 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931098.1 protein_id gnl|my_center|LOCUS_17580 12867 13325 gene locus_tag LOCUS_17590 gene cadR 12867 13325 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 protein_id gnl|my_center|LOCUS_17590 13449 14267 gene locus_tag LOCUS_17600 13449 14267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 14290 15297 gene locus_tag LOCUS_17610 14290 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 15294 15986 gene locus_tag LOCUS_17620 15294 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 16305 16117 gene locus_tag LOCUS_17630 16305 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 18085 16550 gene locus_tag LOCUS_17640 18085 16550 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_17640 19391 18138 gene locus_tag LOCUS_17650 19391 18138 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384399.1 protein_id gnl|my_center|LOCUS_17650 19676 20428 gene locus_tag LOCUS_17660 gene rpsB 19676 20428 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_17660 20535 21461 gene locus_tag LOCUS_17670 gene tsf 20535 21461 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 protein_id gnl|my_center|LOCUS_17670 21581 22243 gene locus_tag LOCUS_17680 gene pyrH 21581 22243 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_17680 22290 22850 gene locus_tag LOCUS_17690 gene frr 22290 22850 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_17690 22902 23642 gene locus_tag LOCUS_17700 22902 23642 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690027.1 protein_id gnl|my_center|LOCUS_17700 23701 24555 gene locus_tag LOCUS_17710 23701 24555 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 protein_id gnl|my_center|LOCUS_17710 24552 25736 gene locus_tag LOCUS_17720 24552 25736 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527290.1 protein_id gnl|my_center|LOCUS_17720 25758 27122 gene locus_tag LOCUS_17730 gene rseP 25758 27122 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192799.1 protein_id gnl|my_center|LOCUS_17730 27189 29465 gene locus_tag LOCUS_17740 gene bamA 27189 29465 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_17740 29465 30001 gene locus_tag LOCUS_17750 29465 30001 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_17750 30029 31012 gene locus_tag LOCUS_17760 gene lpxD 30029 31012 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039864.1 protein_id gnl|my_center|LOCUS_17760 31025 31465 gene locus_tag LOCUS_17770 gene fabZ 31025 31465 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_17770 31486 32274 gene locus_tag LOCUS_17780 gene lpxA 31486 32274 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 protein_id gnl|my_center|LOCUS_17780 32264 33460 gene locus_tag LOCUS_17790 gene lpxB 32264 33460 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930356.1 protein_id gnl|my_center|LOCUS_17790 33471 34115 gene locus_tag LOCUS_17800 gene rnhB 33471 34115 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191384.1 protein_id gnl|my_center|LOCUS_17800 34204 34977 gene locus_tag LOCUS_17810 34204 34977 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence035 852 514 gene locus_tag LOCUS_17820 852 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1407 964 gene locus_tag LOCUS_17830 1407 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2080 1457 gene locus_tag LOCUS_17840 2080 1457 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970933.1 protein_id gnl|my_center|LOCUS_17840 3208 2411 gene locus_tag LOCUS_17850 gene fabI 3208 2411 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 protein_id gnl|my_center|LOCUS_17850 3365 5131 gene locus_tag LOCUS_17860 3365 5131 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 protein_id gnl|my_center|LOCUS_17860 5375 6412 gene locus_tag LOCUS_17870 5375 6412 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 protein_id gnl|my_center|LOCUS_17870 6419 7498 gene locus_tag LOCUS_17880 6419 7498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_17880 7495 9180 gene locus_tag LOCUS_17890 7495 9180 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192088.1 protein_id gnl|my_center|LOCUS_17890 9567 9187 gene locus_tag LOCUS_17900 9567 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 9676 10605 gene locus_tag LOCUS_17910 9676 10605 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523002.1 protein_id gnl|my_center|LOCUS_17910 12833 10746 gene locus_tag LOCUS_17920 12833 10746 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479992.1 protein_id gnl|my_center|LOCUS_17920 12742 12945 gene locus_tag LOCUS_17930 12742 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 13957 12995 gene locus_tag LOCUS_17940 13957 12995 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818676.1 protein_id gnl|my_center|LOCUS_17940 14069 15484 gene locus_tag LOCUS_17950 14069 15484 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063958.1 protein_id gnl|my_center|LOCUS_17950 15481 15849 gene locus_tag LOCUS_17960 15481 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247553.1 protein_id gnl|my_center|LOCUS_17960 15907 16935 gene locus_tag LOCUS_17970 15907 16935 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_17970 19361 17100 gene locus_tag LOCUS_17980 19361 17100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 20555 19482 gene locus_tag LOCUS_17990 20555 19482 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_17990 20789 23668 gene locus_tag LOCUS_18000 20789 23668 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_18000 23723 24988 gene locus_tag LOCUS_18010 gene odhB 23723 24988 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521670.1 protein_id gnl|my_center|LOCUS_18010 25242 26669 gene locus_tag LOCUS_18020 gene lpdA 25242 26669 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813626.1 protein_id gnl|my_center|LOCUS_18020 26794 27891 gene locus_tag LOCUS_18030 gene zapE 26794 27891 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_18030 27891 28652 gene locus_tag LOCUS_18040 27891 28652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 29458 28670 gene locus_tag LOCUS_18050 29458 28670 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339357.1 protein_id gnl|my_center|LOCUS_18050 29590 31743 gene locus_tag LOCUS_18060 29590 31743 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065179.1 protein_id gnl|my_center|LOCUS_18060 32515 31718 gene locus_tag LOCUS_18070 32515 31718 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813594.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence036 <1 1304 gene locus_tag LOCUS_18080 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038717.1:lytic transglycosylase domain-containing protein 2349 1399 gene locus_tag LOCUS_18090 2349 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2586 3110 gene locus_tag LOCUS_18100 2586 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3510 3118 gene locus_tag LOCUS_18110 gene rbsD 3510 3118 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911632.1 protein_id gnl|my_center|LOCUS_18110 4487 3507 gene locus_tag LOCUS_18120 gene rbsK 4487 3507 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_18120 5545 4484 gene locus_tag LOCUS_18130 5545 4484 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521613.1 protein_id gnl|my_center|LOCUS_18130 6557 5562 gene locus_tag LOCUS_18140 6557 5562 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088303.1 protein_id gnl|my_center|LOCUS_18140 8179 6554 gene locus_tag LOCUS_18150 8179 6554 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205086.1 protein_id gnl|my_center|LOCUS_18150 9202 8249 gene locus_tag LOCUS_18160 9202 8249 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531229.1 protein_id gnl|my_center|LOCUS_18160 9711 10646 gene locus_tag LOCUS_18170 9711 10646 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817216.1 protein_id gnl|my_center|LOCUS_18170 10760 11065 gene locus_tag LOCUS_18180 10760 11065 CDS product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114086.1 protein_id gnl|my_center|LOCUS_18180 11927 11082 gene locus_tag LOCUS_18190 gene phhA 11927 11082 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_18190 13147 12011 gene locus_tag LOCUS_18200 gene hppD 13147 12011 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 protein_id gnl|my_center|LOCUS_18200 14297 13308 gene locus_tag LOCUS_18210 14297 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 15297 14302 gene locus_tag LOCUS_18220 15297 14302 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033424.1 protein_id gnl|my_center|LOCUS_18220 15436 15918 gene locus_tag LOCUS_18230 15436 15918 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202739.1 protein_id gnl|my_center|LOCUS_18230 16151 16840 gene locus_tag LOCUS_18240 16151 16840 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202737.1 protein_id gnl|my_center|LOCUS_18240 16934 17812 gene locus_tag LOCUS_18250 16934 17812 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_18250 17812 19434 gene locus_tag LOCUS_18260 gene lnt 17812 19434 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064331.1 protein_id gnl|my_center|LOCUS_18260 19599 20711 gene locus_tag LOCUS_18270 19599 20711 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104093.1 protein_id gnl|my_center|LOCUS_18270 21025 21567 gene locus_tag LOCUS_18280 gene fabA 21025 21567 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035827.1 protein_id gnl|my_center|LOCUS_18280 21564 22790 gene locus_tag LOCUS_18290 gene fabB 21564 22790 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_18290 23041 23979 gene locus_tag LOCUS_18300 gene glyQ 23041 23979 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_18300 24012 26183 gene locus_tag LOCUS_18310 gene glyS 24012 26183 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_18310 26238 26849 gene locus_tag LOCUS_18320 gene gmhB 26238 26849 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_18320 27002 27790 gene locus_tag LOCUS_18330 27002 27790 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_18330 27900 28790 gene locus_tag LOCUS_18340 27900 28790 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_18340 28831 29271 gene locus_tag LOCUS_18350 28831 29271 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528650.1 protein_id gnl|my_center|LOCUS_18350 29932 29360 gene locus_tag LOCUS_18360 gene lysM 29932 29360 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_18360 30022 30798 gene locus_tag LOCUS_18370 30022 30798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 31518 30847 gene locus_tag LOCUS_18380 31518 30847 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_18380 31733 32806 gene locus_tag LOCUS_18390 gene rfbB 31733 32806 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_18390 32803 33693 gene locus_tag LOCUS_18400 gene rfbD 32803 33693 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706708.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence037 43 351 gene locus_tag LOCUS_18410 43 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 429 1757 gene locus_tag LOCUS_18420 429 1757 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943582.1 protein_id gnl|my_center|LOCUS_18420 1989 3044 gene locus_tag LOCUS_18430 1989 3044 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706561.1 protein_id gnl|my_center|LOCUS_18430 3154 5076 gene locus_tag LOCUS_18440 3154 5076 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_18440 6639 5128 gene locus_tag LOCUS_18450 6639 5128 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200631.1 protein_id gnl|my_center|LOCUS_18450 6759 8027 gene locus_tag LOCUS_18460 6759 8027 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187149.1 protein_id gnl|my_center|LOCUS_18460 8062 9198 gene locus_tag LOCUS_18470 8062 9198 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552010.1 protein_id gnl|my_center|LOCUS_18470 9249 10283 gene locus_tag LOCUS_18480 9249 10283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525160.1 protein_id gnl|my_center|LOCUS_18480 10303 11619 gene locus_tag LOCUS_18490 10303 11619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196172.1 protein_id gnl|my_center|LOCUS_18490 11642 12475 gene locus_tag LOCUS_18500 11642 12475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552009.1 protein_id gnl|my_center|LOCUS_18500 12488 13951 gene locus_tag LOCUS_18510 gene gabD 12488 13951 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_18510 16673 14082 gene locus_tag LOCUS_18520 16673 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 18192 16840 gene locus_tag LOCUS_18530 18192 16840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 18479 19762 gene locus_tag LOCUS_18540 18479 19762 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197818.1 protein_id gnl|my_center|LOCUS_18540 19893 21431 gene locus_tag LOCUS_18550 19893 21431 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 protein_id gnl|my_center|LOCUS_18550 21594 22016 gene locus_tag LOCUS_18560 21594 22016 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_18560 22679 22050 gene locus_tag LOCUS_18570 22679 22050 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246306.1 protein_id gnl|my_center|LOCUS_18570 23527 22676 gene locus_tag LOCUS_18580 23527 22676 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268144.1 protein_id gnl|my_center|LOCUS_18580 24630 23515 gene locus_tag LOCUS_18590 24630 23515 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766234.1 protein_id gnl|my_center|LOCUS_18590 25313 24627 gene locus_tag LOCUS_18600 25313 24627 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104399.1 protein_id gnl|my_center|LOCUS_18600 25663 26613 gene locus_tag LOCUS_18610 25663 26613 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268643.1 protein_id gnl|my_center|LOCUS_18610 27179 26652 gene locus_tag LOCUS_18620 27179 26652 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112637.1 protein_id gnl|my_center|LOCUS_18620 27442 27200 gene locus_tag LOCUS_18630 27442 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 28044 27481 gene locus_tag LOCUS_18640 28044 27481 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_18640 28651 30075 gene locus_tag LOCUS_18650 28651 30075 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039542.1 protein_id gnl|my_center|LOCUS_18650 30479 30243 gene locus_tag LOCUS_18660 30479 30243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18660 30804 30418 gene locus_tag LOCUS_18670 30804 30418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18670 31358 31678 gene locus_tag LOCUS_18680 31358 31678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 31755 32054 gene locus_tag LOCUS_18690 31755 32054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 32086 32751 gene locus_tag LOCUS_18700 32086 32751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 32834 33247 gene locus_tag LOCUS_18710 32834 33247 CDS product DUF2251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687072.1 protein_id gnl|my_center|LOCUS_18710 33321 33635 gene locus_tag LOCUS_18720 33321 33635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 33721 34008 gene locus_tag LOCUS_18730 33721 34008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence038 1192 149 gene locus_tag LOCUS_18740 1192 149 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 protein_id gnl|my_center|LOCUS_18740 2978 1302 gene locus_tag LOCUS_18750 2978 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 3108 3401 gene locus_tag LOCUS_18760 3108 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3598 4107 gene locus_tag LOCUS_18770 3598 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4104 4319 gene locus_tag LOCUS_18780 4104 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18780 6513 4471 gene locus_tag LOCUS_18790 6513 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 8236 6872 gene locus_tag LOCUS_18800 gene gspE 8236 6872 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533498.1 protein_id gnl|my_center|LOCUS_18800 10658 8268 gene locus_tag LOCUS_18810 gene gspD 10658 8268 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551118.1 protein_id gnl|my_center|LOCUS_18810 11490 10672 gene locus_tag LOCUS_18820 11490 10672 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525775.1 protein_id gnl|my_center|LOCUS_18820 12204 11560 gene locus_tag LOCUS_18830 12204 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 13457 12201 gene locus_tag LOCUS_18840 13457 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 14678 13524 gene locus_tag LOCUS_18850 gene gspK 14678 13524 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204164.1 protein_id gnl|my_center|LOCUS_18850 15382 14675 gene locus_tag LOCUS_18860 15382 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 15771 15382 gene locus_tag LOCUS_18870 15771 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 16205 15771 gene locus_tag LOCUS_18880 gene gspH 16205 15771 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112728.1 protein_id gnl|my_center|LOCUS_18880 16882 16355 gene locus_tag LOCUS_18890 gene gspG 16882 16355 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_18890 16906 17346 gene locus_tag LOCUS_18900 16906 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 17947 17336 gene locus_tag LOCUS_18910 gene cobC 17947 17336 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193433.1 protein_id gnl|my_center|LOCUS_18910 18771 17947 gene locus_tag LOCUS_18920 18771 17947 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_18920 20399 18840 gene locus_tag LOCUS_18930 gene ilvA 20399 18840 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 protein_id gnl|my_center|LOCUS_18930 20695 21144 gene locus_tag LOCUS_18940 20695 21144 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_18940 21823 21206 gene locus_tag LOCUS_18950 gene coq7 21823 21206 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194286.1 protein_id gnl|my_center|LOCUS_18950 22178 23161 gene locus_tag LOCUS_18960 22178 23161 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813945.1 protein_id gnl|my_center|LOCUS_18960 23355 24554 gene locus_tag LOCUS_18970 23355 24554 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523033.1 protein_id gnl|my_center|LOCUS_18970 24998 25978 gene locus_tag LOCUS_18980 24998 25978 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814271.1 protein_id gnl|my_center|LOCUS_18980 25980 27227 gene locus_tag LOCUS_18990 25980 27227 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 protein_id gnl|my_center|LOCUS_18990 27389 28855 gene locus_tag LOCUS_19000 27389 28855 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815878.1 protein_id gnl|my_center|LOCUS_19000 30172 28880 gene locus_tag LOCUS_19010 30172 28880 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_19010 30391 31308 gene locus_tag LOCUS_19020 30391 31308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065035.1 protein_id gnl|my_center|LOCUS_19020 31483 32493 gene locus_tag LOCUS_19030 31483 32493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 protein_id gnl|my_center|LOCUS_19030 32490 33563 gene locus_tag LOCUS_19040 32490 33563 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 protein_id gnl|my_center|LOCUS_19040 34113 33670 gene locus_tag LOCUS_19050 34113 33670 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence039 530 96 gene locus_tag LOCUS_19060 530 96 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038593.1 protein_id gnl|my_center|LOCUS_19060 684 1223 gene locus_tag LOCUS_19070 gene def 684 1223 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_19070 3977 1314 gene locus_tag LOCUS_19080 3977 1314 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197089.1 protein_id gnl|my_center|LOCUS_19080 4896 4081 gene locus_tag LOCUS_19090 gene map 4896 4081 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_19090 5079 9077 gene locus_tag LOCUS_19100 gene purL 5079 9077 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039715.1 protein_id gnl|my_center|LOCUS_19100 11010 9220 gene locus_tag LOCUS_19110 11010 9220 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036950.1 protein_id gnl|my_center|LOCUS_19110 11220 12224 gene locus_tag LOCUS_19120 11220 12224 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_19120 12356 13018 gene locus_tag LOCUS_19130 12356 13018 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_19130 14183 13152 gene locus_tag LOCUS_19140 14183 13152 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035998.1 protein_id gnl|my_center|LOCUS_19140 14418 15335 gene locus_tag LOCUS_19150 gene egtD 14418 15335 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_19150 15408 16700 gene locus_tag LOCUS_19160 gene egtB 15408 16700 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_19160 17192 16740 gene locus_tag LOCUS_19170 17192 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 18598 17315 gene locus_tag LOCUS_19180 18598 17315 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 protein_id gnl|my_center|LOCUS_19180 20803 18797 gene locus_tag LOCUS_19190 20803 18797 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249757.1 protein_id gnl|my_center|LOCUS_19190 20901 22061 gene locus_tag LOCUS_19200 20901 22061 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195762.1 protein_id gnl|my_center|LOCUS_19200 22183 23616 gene locus_tag LOCUS_19210 22183 23616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 23713 24714 gene locus_tag LOCUS_19220 23713 24714 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810987.1 protein_id gnl|my_center|LOCUS_19220 24843 27350 gene locus_tag LOCUS_19230 24843 27350 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_19230 28139 27369 gene locus_tag LOCUS_19240 28139 27369 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200872.1 protein_id gnl|my_center|LOCUS_19240 28519 29559 gene locus_tag LOCUS_19250 28519 29559 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115105549.1 protein_id gnl|my_center|LOCUS_19250 30714 29728 gene locus_tag LOCUS_19260 gene ylqF 30714 29728 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687704.1 protein_id gnl|my_center|LOCUS_19260 30924 31184 gene locus_tag LOCUS_19270 30924 31184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 31154 31435 gene locus_tag LOCUS_19280 31154 31435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence040 1085 522 gene locus_tag LOCUS_19290 1085 522 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 protein_id gnl|my_center|LOCUS_19290 1201 2139 gene locus_tag LOCUS_19300 1201 2139 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968515.1 protein_id gnl|my_center|LOCUS_19300 2782 2144 gene locus_tag LOCUS_19310 2782 2144 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 protein_id gnl|my_center|LOCUS_19310 2872 4116 gene locus_tag LOCUS_19320 2872 4116 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767725.1 protein_id gnl|my_center|LOCUS_19320 4109 4852 gene locus_tag LOCUS_19330 4109 4852 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194445.1 protein_id gnl|my_center|LOCUS_19330 6196 4880 gene locus_tag LOCUS_19340 6196 4880 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268262.1 protein_id gnl|my_center|LOCUS_19340 7662 6340 gene locus_tag LOCUS_19350 7662 6340 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161632413.1 protein_id gnl|my_center|LOCUS_19350 9201 7810 gene locus_tag LOCUS_19360 gene rimO 9201 7810 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 protein_id gnl|my_center|LOCUS_19360 9808 9269 gene locus_tag LOCUS_19370 gene phaR 9808 9269 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 protein_id gnl|my_center|LOCUS_19370 10196 10645 gene locus_tag LOCUS_19380 10196 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 11732 10740 gene locus_tag LOCUS_19390 11732 10740 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 protein_id gnl|my_center|LOCUS_19390 13115 11820 gene locus_tag LOCUS_19400 13115 11820 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088797.1 protein_id gnl|my_center|LOCUS_19400 13579 13130 gene locus_tag LOCUS_19410 13579 13130 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088798.1 protein_id gnl|my_center|LOCUS_19410 14678 13701 gene locus_tag LOCUS_19420 14678 13701 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088799.1 protein_id gnl|my_center|LOCUS_19420 15783 14761 gene locus_tag LOCUS_19430 15783 14761 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 protein_id gnl|my_center|LOCUS_19430 16610 15798 gene locus_tag LOCUS_19440 16610 15798 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 protein_id gnl|my_center|LOCUS_19440 16682 17461 gene locus_tag LOCUS_19450 16682 17461 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 protein_id gnl|my_center|LOCUS_19450 17919 18890 gene locus_tag LOCUS_19460 17919 18890 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 protein_id gnl|my_center|LOCUS_19460 18987 19871 gene locus_tag LOCUS_19470 gene kdgD 18987 19871 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620479.1 protein_id gnl|my_center|LOCUS_19470 19962 21302 gene locus_tag LOCUS_19480 gene gudD 19962 21302 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 protein_id gnl|my_center|LOCUS_19480 21790 21413 gene locus_tag LOCUS_tm00010 21790 21413 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 22477 21803 gene locus_tag LOCUS_19490 gene gph 22477 21803 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_19490 23187 22474 gene locus_tag LOCUS_19500 gene ubiG 23187 22474 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_19500 23930 23271 gene locus_tag LOCUS_19510 23930 23271 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813377.1 protein_id gnl|my_center|LOCUS_19510 24155 26818 gene locus_tag LOCUS_19520 gene gyrA 24155 26818 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189243.1 protein_id gnl|my_center|LOCUS_19520 26940 28049 gene locus_tag LOCUS_19530 gene serC 26940 28049 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_19530 28103 29203 gene locus_tag LOCUS_19540 gene pheA 28103 29203 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_19540 29246 30133 gene locus_tag LOCUS_19550 29246 30133 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930098.1 protein_id gnl|my_center|LOCUS_19550 30133 32160 gene locus_tag LOCUS_19560 30133 32160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19560 >Feature sequence041 2902 1628 gene locus_tag LOCUS_19570 gene ubiM 2902 1628 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088887969.1 protein_id gnl|my_center|LOCUS_19570 3163 3399 gene locus_tag LOCUS_19580 3163 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3501 5618 gene locus_tag LOCUS_19590 3501 5618 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087443.1 protein_id gnl|my_center|LOCUS_19590 5697 11180 gene locus_tag LOCUS_19600 5697 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 11229 11975 gene locus_tag LOCUS_19610 11229 11975 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507867.1 protein_id gnl|my_center|LOCUS_19610 12283 13026 gene locus_tag LOCUS_19620 gene minC 12283 13026 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 protein_id gnl|my_center|LOCUS_19620 13110 13925 gene locus_tag LOCUS_19630 gene minD 13110 13925 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 protein_id gnl|my_center|LOCUS_19630 13929 14198 gene locus_tag LOCUS_19640 gene minE 13929 14198 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 protein_id gnl|my_center|LOCUS_19640 14843 14280 gene locus_tag LOCUS_19650 14843 14280 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 protein_id gnl|my_center|LOCUS_19650 15071 15856 gene locus_tag LOCUS_19660 15071 15856 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088824.1 protein_id gnl|my_center|LOCUS_19660 15856 17046 gene locus_tag LOCUS_19670 15856 17046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 17208 18812 gene locus_tag LOCUS_19680 17208 18812 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530132.1 protein_id gnl|my_center|LOCUS_19680 20206 18872 gene locus_tag LOCUS_19690 20206 18872 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_19690 20296 21216 gene locus_tag LOCUS_19700 20296 21216 CDS product HTH-type transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523490.1 protein_id gnl|my_center|LOCUS_19700 21327 21944 gene locus_tag LOCUS_19710 21327 21944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 22393 21971 gene locus_tag LOCUS_19720 22393 21971 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 protein_id gnl|my_center|LOCUS_19720 23396 22515 gene locus_tag LOCUS_19730 23396 22515 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_19730 24379 23393 gene locus_tag LOCUS_19740 24379 23393 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088245.1 protein_id gnl|my_center|LOCUS_19740 24509 24949 gene locus_tag LOCUS_19750 24509 24949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 25732 25151 gene locus_tag LOCUS_19760 25732 25151 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529797.1 protein_id gnl|my_center|LOCUS_19760 26555 25713 gene locus_tag LOCUS_19770 26555 25713 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205373.1 protein_id gnl|my_center|LOCUS_19770 27649 26564 gene locus_tag LOCUS_19780 27649 26564 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202259.1 protein_id gnl|my_center|LOCUS_19780 28730 27702 gene locus_tag LOCUS_19790 28730 27702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529795.1 protein_id gnl|my_center|LOCUS_19790 29494 28727 gene locus_tag LOCUS_19800 29494 28727 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523480.1 protein_id gnl|my_center|LOCUS_19800 29723 30631 gene locus_tag LOCUS_19810 29723 30631 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188603.1 protein_id gnl|my_center|LOCUS_19810 <32497 30810 gene locus_tag LOCUS_19820 <32497 30810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003817018.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence042 120 584 gene locus_tag LOCUS_19830 120 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_19830 1298 990 gene locus_tag LOCUS_19840 1298 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1535 1924 gene locus_tag LOCUS_19850 1535 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1976 3298 gene locus_tag LOCUS_19860 1976 3298 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_19860 3295 4596 gene locus_tag LOCUS_19870 3295 4596 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763543.1 protein_id gnl|my_center|LOCUS_19870 4609 7779 gene locus_tag LOCUS_19880 4609 7779 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_19880 7776 8471 gene locus_tag LOCUS_19890 7776 8471 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_19890 8468 9877 gene locus_tag LOCUS_19900 8468 9877 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764043.1 protein_id gnl|my_center|LOCUS_19900 9931 10569 gene locus_tag LOCUS_19910 9931 10569 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706079.1 protein_id gnl|my_center|LOCUS_19910 10772 12289 gene locus_tag LOCUS_19920 10772 12289 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438863.1 protein_id gnl|my_center|LOCUS_19920 13201 12314 gene locus_tag LOCUS_19930 13201 12314 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_19930 14279 13275 gene locus_tag LOCUS_19940 14279 13275 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339199.1 protein_id gnl|my_center|LOCUS_19940 15104 14283 gene locus_tag LOCUS_19950 15104 14283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 15283 17472 gene locus_tag LOCUS_19960 15283 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 17641 19029 gene locus_tag LOCUS_19970 17641 19029 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_19970 19226 19942 gene locus_tag LOCUS_19980 19226 19942 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_19980 19943 21169 gene locus_tag LOCUS_19990 19943 21169 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401398.1 protein_id gnl|my_center|LOCUS_19990 22468 21188 gene locus_tag LOCUS_20000 22468 21188 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970397.1 protein_id gnl|my_center|LOCUS_20000 22545 23414 gene locus_tag LOCUS_20010 22545 23414 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809176.1 protein_id gnl|my_center|LOCUS_20010 23470 24564 gene locus_tag LOCUS_20020 23470 24564 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551047.1 protein_id gnl|my_center|LOCUS_20020 25640 24618 gene locus_tag LOCUS_20030 25640 24618 CDS product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196337679.1 protein_id gnl|my_center|LOCUS_20030 26686 25637 gene locus_tag LOCUS_20040 26686 25637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 27825 26683 gene locus_tag LOCUS_20050 27825 26683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 29157 27853 gene locus_tag LOCUS_20060 29157 27853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 29328 30281 gene locus_tag LOCUS_20070 29328 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 30531 30325 gene locus_tag LOCUS_20080 30531 30325 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_20080 31475 30537 gene locus_tag LOCUS_20090 31475 30537 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_20090 31965 31519 gene locus_tag LOCUS_20100 31965 31519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence043 350 456 gene locus_tag LOCUS_r00010 350 456 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 735 1472 gene locus_tag LOCUS_20110 735 1472 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_20110 1714 2619 gene locus_tag LOCUS_20120 1714 2619 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788737.1 protein_id gnl|my_center|LOCUS_20120 2777 3487 gene locus_tag LOCUS_20130 2777 3487 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448285.1 protein_id gnl|my_center|LOCUS_20130 3530 4516 gene locus_tag LOCUS_20140 3530 4516 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815411.1 protein_id gnl|my_center|LOCUS_20140 4551 5465 gene locus_tag LOCUS_20150 4551 5465 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533957.1 protein_id gnl|my_center|LOCUS_20150 5462 6283 gene locus_tag LOCUS_20160 5462 6283 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_20160 6444 7859 gene locus_tag LOCUS_20170 gene glnA 6444 7859 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_20170 8097 8615 gene locus_tag LOCUS_20180 8097 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 8756 9766 gene locus_tag LOCUS_20190 gene glnL 8756 9766 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192981.1 protein_id gnl|my_center|LOCUS_20190 9828 11480 gene locus_tag LOCUS_20200 gene ntrC 9828 11480 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 protein_id gnl|my_center|LOCUS_20200 11676 12644 gene locus_tag LOCUS_20210 11676 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 13560 12784 gene locus_tag LOCUS_20220 gene xth 13560 12784 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_20220 14097 13603 gene locus_tag LOCUS_20230 14097 13603 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776902.1 protein_id gnl|my_center|LOCUS_20230 14725 14132 gene locus_tag LOCUS_20240 14725 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 15624 14785 gene locus_tag LOCUS_20250 15624 14785 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225956.1 protein_id gnl|my_center|LOCUS_20250 15747 16304 gene locus_tag LOCUS_20260 15747 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 17774 16326 gene locus_tag LOCUS_20270 17774 16326 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191226.1 protein_id gnl|my_center|LOCUS_20270 18287 17880 gene locus_tag LOCUS_20280 18287 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 18420 19700 gene locus_tag LOCUS_20290 18420 19700 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812701.1 protein_id gnl|my_center|LOCUS_20290 21068 19743 gene locus_tag LOCUS_20300 gene hpnE 21068 19743 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_20300 21910 21071 gene locus_tag LOCUS_20310 gene hpnD 21910 21071 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_20310 22028 22921 gene locus_tag LOCUS_20320 22028 22921 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813679.1 protein_id gnl|my_center|LOCUS_20320 22914 24116 gene locus_tag LOCUS_20330 22914 24116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 25023 24139 gene locus_tag LOCUS_20340 gene hpnC 25023 24139 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_20340 25193 26341 gene locus_tag LOCUS_20350 25193 26341 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392398.1 protein_id gnl|my_center|LOCUS_20350 26351 29608 gene locus_tag LOCUS_20360 gene mexK 26351 29608 CDS product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_20360 29700 29786 gene locus_tag LOCUS_t00160 29700 29786 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29849 31159 gene locus_tag LOCUS_20370 gene tig 29849 31159 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_20370 31281 31889 gene locus_tag LOCUS_20380 gene clpP 31281 31889 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193408.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence044 <1 655 gene locus_tag LOCUS_20390 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185240.1:30S ribosomal protein S3 658 1074 gene locus_tag LOCUS_20400 gene rplP 658 1074 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_20400 1089 1286 gene locus_tag LOCUS_20410 gene rpmC 1089 1286 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_20410 1296 1565 gene locus_tag LOCUS_20420 gene rpsQ 1296 1565 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690077.1 protein_id gnl|my_center|LOCUS_20420 1821 2327 gene locus_tag LOCUS_20430 1821 2327 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 protein_id gnl|my_center|LOCUS_20430 3107 2613 gene locus_tag LOCUS_20440 3107 2613 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 protein_id gnl|my_center|LOCUS_20440 3170 3249 gene locus_tag LOCUS_t00170 3170 3249 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3708 3205 gene locus_tag LOCUS_20450 3708 3205 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198028.1 protein_id gnl|my_center|LOCUS_20450 3932 4540 gene locus_tag LOCUS_20460 3932 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 4634 5089 gene locus_tag LOCUS_20470 4634 5089 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_20470 5058 5327 gene locus_tag LOCUS_20480 5058 5327 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_20480 5407 7170 gene locus_tag LOCUS_20490 gene ptsP 5407 7170 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_20490 7440 8585 gene locus_tag LOCUS_20500 7440 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 8604 9176 gene locus_tag LOCUS_20510 8604 9176 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 protein_id gnl|my_center|LOCUS_20510 9209 9598 gene locus_tag LOCUS_20520 9209 9598 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_20520 9598 10356 gene locus_tag LOCUS_20530 9598 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 10353 12623 gene locus_tag LOCUS_20540 10353 12623 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_20540 13652 12663 gene locus_tag LOCUS_20550 gene lipA 13652 12663 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_20550 14366 13668 gene locus_tag LOCUS_20560 gene lipB 14366 13668 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064724.1 protein_id gnl|my_center|LOCUS_20560 14728 14399 gene locus_tag LOCUS_20570 14728 14399 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_20570 15042 15515 gene locus_tag LOCUS_20580 15042 15515 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524510.1 protein_id gnl|my_center|LOCUS_20580 15531 16409 gene locus_tag LOCUS_20590 gene atpB 15531 16409 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 protein_id gnl|my_center|LOCUS_20590 16468 16716 gene locus_tag LOCUS_20600 16468 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 16751 17221 gene locus_tag LOCUS_20610 16751 17221 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185283.1 protein_id gnl|my_center|LOCUS_20610 17235 17783 gene locus_tag LOCUS_20620 17235 17783 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195829.1 protein_id gnl|my_center|LOCUS_20620 17827 19380 gene locus_tag LOCUS_20630 gene atpA 17827 19380 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_20630 19399 20268 gene locus_tag LOCUS_20640 gene atpG 19399 20268 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_20640 20303 21712 gene locus_tag LOCUS_20650 gene atpD 20303 21712 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_20650 21863 22282 gene locus_tag LOCUS_20660 21863 22282 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_20660 23093 22428 gene locus_tag LOCUS_20670 23093 22428 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204255.1 protein_id gnl|my_center|LOCUS_20670 24052 23123 gene locus_tag LOCUS_20680 24052 23123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 24694 24092 gene locus_tag LOCUS_20690 24694 24092 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190125.1 protein_id gnl|my_center|LOCUS_20690 24895 25359 gene locus_tag LOCUS_20700 24895 25359 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_20700 25447 26496 gene locus_tag LOCUS_20710 25447 26496 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_20710 26489 27025 gene locus_tag LOCUS_20720 26489 27025 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142820828.1 protein_id gnl|my_center|LOCUS_20720 27678 27097 gene locus_tag LOCUS_20730 27678 27097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 29282 27792 gene locus_tag LOCUS_20740 gene oprB 29282 27792 CDS product efflux RND transporter outer membrane subunit OprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189997.1 protein_id gnl|my_center|LOCUS_20740 <31392 29288 gene locus_tag LOCUS_20750 <31392 29288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067600.1:efflux RND transporter permease subunit >Feature sequence045 1493 2713 gene locus_tag LOCUS_20760 gene coaBC 1493 2713 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 protein_id gnl|my_center|LOCUS_20760 2828 3277 gene locus_tag LOCUS_20770 gene dut 2828 3277 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_20770 3465 3974 gene locus_tag LOCUS_20780 3465 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4594 4070 gene locus_tag LOCUS_20790 4594 4070 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_20790 6179 4743 gene locus_tag LOCUS_20800 6179 4743 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089157.1 protein_id gnl|my_center|LOCUS_20800 6333 7457 gene locus_tag LOCUS_20810 6333 7457 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064174.1 protein_id gnl|my_center|LOCUS_20810 7529 8059 gene locus_tag LOCUS_20820 7529 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 8304 8564 gene locus_tag LOCUS_20830 8304 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 9498 8704 gene locus_tag LOCUS_20840 9498 8704 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_20840 10598 9510 gene locus_tag LOCUS_20850 gene bamC 10598 9510 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 protein_id gnl|my_center|LOCUS_20850 11566 10670 gene locus_tag LOCUS_20860 gene dapA 11566 10670 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_20860 12172 11597 gene locus_tag LOCUS_20870 12172 11597 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_20870 12430 12272 gene locus_tag LOCUS_20880 12430 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 13650 12445 gene locus_tag LOCUS_20890 13650 12445 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_20890 13777 15774 gene locus_tag LOCUS_20900 gene parE 13777 15774 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185934.1 protein_id gnl|my_center|LOCUS_20900 15919 18282 gene locus_tag LOCUS_20910 gene parC 15919 18282 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522490.1 protein_id gnl|my_center|LOCUS_20910 18529 20310 gene locus_tag LOCUS_20920 18529 20310 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063733.1 protein_id gnl|my_center|LOCUS_20920 20575 22188 gene locus_tag LOCUS_20930 20575 22188 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201704.1 protein_id gnl|my_center|LOCUS_20930 23090 22197 gene locus_tag LOCUS_20940 gene pdxY 23090 22197 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_20940 23608 23150 gene locus_tag LOCUS_20950 23608 23150 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 protein_id gnl|my_center|LOCUS_20950 23740 26325 gene locus_tag LOCUS_20960 23740 26325 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_20960 26471 28015 gene locus_tag LOCUS_20970 26471 28015 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_20970 28157 29125 gene locus_tag LOCUS_20980 28157 29125 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_20980 29507 29142 gene locus_tag LOCUS_20990 29507 29142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 30066 29695 gene locus_tag LOCUS_21000 30066 29695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence046 122 1894 gene locus_tag LOCUS_21010 122 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1929 2891 gene locus_tag LOCUS_21020 1929 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2891 4255 gene locus_tag LOCUS_21030 2891 4255 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129220445.1 protein_id gnl|my_center|LOCUS_21030 3222 3301 gene locus_tag LOCUS_t00180 3222 3301 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4252 4683 gene locus_tag LOCUS_21040 4252 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4694 5677 gene locus_tag LOCUS_21050 4694 5677 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_21050 6671 5700 gene locus_tag LOCUS_21060 6671 5700 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806881.1 protein_id gnl|my_center|LOCUS_21060 7012 6716 gene locus_tag LOCUS_21070 7012 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 7591 7034 gene locus_tag LOCUS_21080 7591 7034 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920046.1 protein_id gnl|my_center|LOCUS_21080 8428 7631 gene locus_tag LOCUS_21090 8428 7631 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_21090 9227 8535 gene locus_tag LOCUS_21100 gene rsmG 9227 8535 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806878.1 protein_id gnl|my_center|LOCUS_21100 11227 9224 gene locus_tag LOCUS_21110 gene mnmG 11227 9224 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 protein_id gnl|my_center|LOCUS_21110 11609 12025 gene locus_tag LOCUS_21120 11609 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 12466 13074 gene locus_tag LOCUS_21130 gene gstA 12466 13074 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_21130 13991 13104 gene locus_tag LOCUS_21140 13991 13104 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061777.1 protein_id gnl|my_center|LOCUS_21140 14823 13984 gene locus_tag LOCUS_21150 14823 13984 CDS product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061776.1 protein_id gnl|my_center|LOCUS_21150 15871 14813 gene locus_tag LOCUS_21160 gene tauA 15871 14813 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 protein_id gnl|my_center|LOCUS_21160 16195 17328 gene locus_tag LOCUS_21170 16195 17328 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810063.1 protein_id gnl|my_center|LOCUS_21170 19056 17524 gene locus_tag LOCUS_21180 19056 17524 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_21180 19709 19053 gene locus_tag LOCUS_21190 19709 19053 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812947.1 protein_id gnl|my_center|LOCUS_21190 19892 21292 gene locus_tag LOCUS_21200 19892 21292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 21376 22590 gene locus_tag LOCUS_21210 21376 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 22587 25691 gene locus_tag LOCUS_21220 22587 25691 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_21220 27485 25830 gene locus_tag LOCUS_21230 27485 25830 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816617.1 protein_id gnl|my_center|LOCUS_21230 30014 27726 gene locus_tag LOCUS_21240 gene copA1 30014 27726 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_21240 30148 30345 gene locus_tag LOCUS_21250 30148 30345 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092153.1 protein_id gnl|my_center|LOCUS_21250 30342 30821 gene locus_tag LOCUS_21260 gene cueR 30342 30821 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095248.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence047 <1 556 gene locus_tag LOCUS_21270 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037458.1:methyl-accepting chemotaxis protein 578 1126 gene locus_tag LOCUS_21280 578 1126 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 protein_id gnl|my_center|LOCUS_21280 1200 2435 gene locus_tag LOCUS_21290 1200 2435 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_21290 2578 3387 gene locus_tag LOCUS_21300 2578 3387 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508387.1 protein_id gnl|my_center|LOCUS_21300 3454 3942 gene locus_tag LOCUS_21310 gene cheD 3454 3942 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704960.1 protein_id gnl|my_center|LOCUS_21310 4002 5078 gene locus_tag LOCUS_21320 4002 5078 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437834.1 protein_id gnl|my_center|LOCUS_21320 5693 7990 gene locus_tag LOCUS_21330 5693 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 8015 8512 gene locus_tag LOCUS_21340 8015 8512 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704963.1 protein_id gnl|my_center|LOCUS_21340 8635 9180 gene locus_tag LOCUS_21350 8635 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 9947 9264 gene locus_tag LOCUS_21360 gene rpe 9947 9264 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186923.1 protein_id gnl|my_center|LOCUS_21360 10045 10452 gene locus_tag LOCUS_21370 gene apaG 10045 10452 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 protein_id gnl|my_center|LOCUS_21370 10449 12488 gene locus_tag LOCUS_21380 10449 12488 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533594.1 protein_id gnl|my_center|LOCUS_21380 12681 13958 gene locus_tag LOCUS_21390 12681 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 13948 15072 gene locus_tag LOCUS_21400 13948 15072 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 protein_id gnl|my_center|LOCUS_21400 15472 15029 gene locus_tag LOCUS_21410 15472 15029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 15777 16991 gene locus_tag LOCUS_21420 15777 16991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 17022 17543 gene locus_tag LOCUS_21430 17022 17543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 19710 17524 gene locus_tag LOCUS_21440 19710 17524 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031789.1 protein_id gnl|my_center|LOCUS_21440 19916 20893 gene locus_tag LOCUS_21450 gene thiL 19916 20893 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_21450 20950 21948 gene locus_tag LOCUS_21460 20950 21948 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_21460 21945 22808 gene locus_tag LOCUS_21470 21945 22808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_21470 22812 23615 gene locus_tag LOCUS_21480 22812 23615 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_21480 25754 23628 gene locus_tag LOCUS_21490 25754 23628 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 protein_id gnl|my_center|LOCUS_21490 25870 26412 gene locus_tag LOCUS_21500 25870 26412 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194201.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21500 26412 26948 gene locus_tag LOCUS_21510 26412 26948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 27836 26988 gene locus_tag LOCUS_21520 gene proC 27836 26988 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811267.1 protein_id gnl|my_center|LOCUS_21520 29405 27912 gene locus_tag LOCUS_21530 gene glpK 29405 27912 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_21530 29600 29418 gene locus_tag LOCUS_21540 29600 29418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 30372 29575 gene locus_tag LOCUS_21550 30372 29575 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931049.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence048 179 538 gene locus_tag LOCUS_21560 179 538 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189725.1 protein_id gnl|my_center|LOCUS_21560 673 3648 gene locus_tag LOCUS_21570 673 3648 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268309.1 protein_id gnl|my_center|LOCUS_21570 3648 4013 gene locus_tag LOCUS_21580 3648 4013 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810969.1 protein_id gnl|my_center|LOCUS_21580 4010 5749 gene locus_tag LOCUS_21590 4010 5749 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771172.1 protein_id gnl|my_center|LOCUS_21590 5746 6243 gene locus_tag LOCUS_21600 5746 6243 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771170.1 protein_id gnl|my_center|LOCUS_21600 6240 6521 gene locus_tag LOCUS_21610 6240 6521 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810975.1 protein_id gnl|my_center|LOCUS_21610 6518 6889 gene locus_tag LOCUS_21620 6518 6889 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771168.1 protein_id gnl|my_center|LOCUS_21620 6983 8830 gene locus_tag LOCUS_21630 6983 8830 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927251.1 protein_id gnl|my_center|LOCUS_21630 8858 9256 gene locus_tag LOCUS_21640 gene crcB 8858 9256 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_21640 9356 10219 gene locus_tag LOCUS_21650 9356 10219 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974284.1 protein_id gnl|my_center|LOCUS_21650 10236 10625 gene locus_tag LOCUS_21660 10236 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 11828 10635 gene locus_tag LOCUS_21670 11828 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 13557 11830 gene locus_tag LOCUS_21680 gene rmuC 13557 11830 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_21680 14622 13636 gene locus_tag LOCUS_21690 14622 13636 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203830.1 protein_id gnl|my_center|LOCUS_21690 15965 14745 gene locus_tag LOCUS_21700 gene pncB 15965 14745 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192078.1 protein_id gnl|my_center|LOCUS_21700 16527 16078 gene locus_tag LOCUS_21710 16527 16078 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_21710 16807 17367 gene locus_tag LOCUS_21720 16807 17367 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_21720 17700 18749 gene locus_tag LOCUS_21730 17700 18749 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_21730 18881 19639 gene locus_tag LOCUS_21740 18881 19639 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812901.1 protein_id gnl|my_center|LOCUS_21740 19968 19892 gene locus_tag LOCUS_t00190 19968 19892 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 20097 20022 gene locus_tag LOCUS_t00200 20097 20022 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20210 20135 gene locus_tag LOCUS_t00210 20210 20135 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21682 20285 gene locus_tag LOCUS_21750 gene gltX 21682 20285 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197094.1 protein_id gnl|my_center|LOCUS_21750 22893 21679 gene locus_tag LOCUS_21760 22893 21679 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_21760 24401 22893 gene locus_tag LOCUS_21770 gene purF 24401 22893 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811814.1 protein_id gnl|my_center|LOCUS_21770 24999 24478 gene locus_tag LOCUS_21780 24999 24478 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188369.1 protein_id gnl|my_center|LOCUS_21780 25927 25004 gene locus_tag LOCUS_21790 25927 25004 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525194.1 protein_id gnl|my_center|LOCUS_21790 27264 25942 gene locus_tag LOCUS_21800 gene folC 27264 25942 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 protein_id gnl|my_center|LOCUS_21800 27300 27698 gene locus_tag LOCUS_21810 27300 27698 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258243.1 protein_id gnl|my_center|LOCUS_21810 27853 28473 gene locus_tag LOCUS_21820 27853 28473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 28573 28932 gene locus_tag LOCUS_21830 28573 28932 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence049 1988 1035 gene locus_tag LOCUS_21840 1988 1035 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816017.1 protein_id gnl|my_center|LOCUS_21840 3167 2151 gene locus_tag LOCUS_21850 3167 2151 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552793.1 protein_id gnl|my_center|LOCUS_21850 3351 3869 gene locus_tag LOCUS_21860 3351 3869 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184509.1 protein_id gnl|my_center|LOCUS_21860 5890 3917 gene locus_tag LOCUS_21870 5890 3917 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 protein_id gnl|my_center|LOCUS_21870 6260 6784 gene locus_tag LOCUS_21880 6260 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 7637 6858 gene locus_tag LOCUS_21890 7637 6858 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223448.1 protein_id gnl|my_center|LOCUS_21890 7871 8908 gene locus_tag LOCUS_21900 7871 8908 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 protein_id gnl|my_center|LOCUS_21900 8958 10421 gene locus_tag LOCUS_21910 8958 10421 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243944.1 protein_id gnl|my_center|LOCUS_21910 10472 11662 gene locus_tag LOCUS_21920 10472 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 12102 13421 gene locus_tag LOCUS_21930 12102 13421 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_21930 14735 13452 gene locus_tag LOCUS_21940 14735 13452 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_21940 15724 14837 gene locus_tag LOCUS_21950 15724 14837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 16006 16560 gene locus_tag LOCUS_21960 16006 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 17402 16659 gene locus_tag LOCUS_21970 17402 16659 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086938.1 protein_id gnl|my_center|LOCUS_21970 17626 19875 gene locus_tag LOCUS_21980 17626 19875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_21980 21241 19976 gene locus_tag LOCUS_21990 21241 19976 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208816.1 protein_id gnl|my_center|LOCUS_21990 22096 21329 gene locus_tag LOCUS_22000 22096 21329 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051633.1 protein_id gnl|my_center|LOCUS_22000 23210 22137 gene locus_tag LOCUS_22010 23210 22137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 23982 23194 gene locus_tag LOCUS_22020 23982 23194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038928.1 protein_id gnl|my_center|LOCUS_22020 24773 23979 gene locus_tag LOCUS_22030 24773 23979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728488.1 protein_id gnl|my_center|LOCUS_22030 26271 24775 gene locus_tag LOCUS_22040 26271 24775 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012416341.1 protein_id gnl|my_center|LOCUS_22040 27392 26268 gene locus_tag LOCUS_22050 27392 26268 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_22050 27752 28183 gene locus_tag LOCUS_22060 27752 28183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 28336 28163 gene locus_tag LOCUS_22070 28336 28163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence050 633 1688 gene locus_tag LOCUS_22080 633 1688 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192249737.1 protein_id gnl|my_center|LOCUS_22080 1788 2234 gene locus_tag LOCUS_22090 gene aroQ 1788 2234 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_22090 2955 2248 gene locus_tag LOCUS_22100 gene queC 2955 2248 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929689.1 protein_id gnl|my_center|LOCUS_22100 3236 3084 gene locus_tag LOCUS_22110 3236 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4919 3318 gene locus_tag LOCUS_22120 4919 3318 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039214.1 protein_id gnl|my_center|LOCUS_22120 6261 5062 gene locus_tag LOCUS_22130 6261 5062 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813999.1 protein_id gnl|my_center|LOCUS_22130 6859 6371 gene locus_tag LOCUS_22140 6859 6371 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 protein_id gnl|my_center|LOCUS_22140 7036 10602 gene locus_tag LOCUS_22150 7036 10602 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_22150 10783 11205 gene locus_tag LOCUS_22160 10783 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 11347 13239 gene locus_tag LOCUS_22170 gene secD 11347 13239 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809414.1 protein_id gnl|my_center|LOCUS_22170 13252 14205 gene locus_tag LOCUS_22180 gene secF 13252 14205 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_22180 14412 16733 gene locus_tag LOCUS_22190 14412 16733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 17741 16761 gene locus_tag LOCUS_22200 17741 16761 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085864.1 protein_id gnl|my_center|LOCUS_22200 18387 17890 gene locus_tag LOCUS_22210 gene recX 18387 17890 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098485.1 protein_id gnl|my_center|LOCUS_22210 19606 18509 gene locus_tag LOCUS_22220 gene recA 19606 18509 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 protein_id gnl|my_center|LOCUS_22220 19722 20267 gene locus_tag LOCUS_22230 19722 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 20350 21045 gene locus_tag LOCUS_22240 20350 21045 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_22240 21143 22585 gene locus_tag LOCUS_22250 21143 22585 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_22250 23092 22700 gene locus_tag LOCUS_22260 23092 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 23834 23481 gene locus_tag LOCUS_22270 23834 23481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 25671 23977 gene locus_tag LOCUS_22280 25671 23977 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089991.1 protein_id gnl|my_center|LOCUS_22280 25764 26480 gene locus_tag LOCUS_22290 25764 26480 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531516.1 protein_id gnl|my_center|LOCUS_22290 27830 26511 gene locus_tag LOCUS_22300 27830 26511 CDS product MFS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268789.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence051 311 1642 gene locus_tag LOCUS_22310 311 1642 CDS product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895623.1 protein_id gnl|my_center|LOCUS_22310 2301 1651 gene locus_tag LOCUS_22320 2301 1651 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390875.1 protein_id gnl|my_center|LOCUS_22320 2371 2490 gene locus_tag LOCUS_22330 2371 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2512 3162 gene locus_tag LOCUS_22340 2512 3162 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194698.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22340 3955 3155 gene locus_tag LOCUS_22350 gene pheC 3955 3155 CDS product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092003.1 protein_id gnl|my_center|LOCUS_22350 6630 4015 gene locus_tag LOCUS_22360 6630 4015 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188327.1 protein_id gnl|my_center|LOCUS_22360 7696 6977 gene locus_tag LOCUS_22370 7696 6977 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 protein_id gnl|my_center|LOCUS_22370 9269 7713 gene locus_tag LOCUS_22380 9269 7713 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036476.1 protein_id gnl|my_center|LOCUS_22380 10594 9266 gene locus_tag LOCUS_22390 10594 9266 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_22390 13006 10808 gene locus_tag LOCUS_22400 gene ligA 13006 10808 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813875.1 protein_id gnl|my_center|LOCUS_22400 14279 13164 gene locus_tag LOCUS_22410 14279 13164 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535807.1 protein_id gnl|my_center|LOCUS_22410 17923 14312 gene locus_tag LOCUS_22420 gene smc 17923 14312 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114484320.1 protein_id gnl|my_center|LOCUS_22420 18374 18051 gene locus_tag LOCUS_22430 18374 18051 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 protein_id gnl|my_center|LOCUS_22430 21499 18395 gene locus_tag LOCUS_22440 21499 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 22045 21707 gene locus_tag LOCUS_22450 22045 21707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 23720 22038 gene locus_tag LOCUS_22460 23720 22038 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065178.1 protein_id gnl|my_center|LOCUS_22460 24038 23742 gene locus_tag LOCUS_22470 24038 23742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 24194 24667 gene locus_tag LOCUS_22480 24194 24667 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809250.1 protein_id gnl|my_center|LOCUS_22480 24758 25429 gene locus_tag LOCUS_22490 24758 25429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 25544 27394 gene locus_tag LOCUS_22500 25544 27394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208115026.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence052 1824 1135 gene locus_tag LOCUS_22510 1824 1135 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244022.1 protein_id gnl|my_center|LOCUS_22510 3689 1857 gene locus_tag LOCUS_22520 3689 1857 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525719.1 protein_id gnl|my_center|LOCUS_22520 5865 3943 gene locus_tag LOCUS_22530 5865 3943 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388610.1 protein_id gnl|my_center|LOCUS_22530 6056 5901 gene locus_tag LOCUS_22540 6056 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 6724 6161 gene locus_tag LOCUS_22550 6724 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 7311 6724 gene locus_tag LOCUS_22560 7311 6724 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070582.1 protein_id gnl|my_center|LOCUS_22560 7886 7335 gene locus_tag LOCUS_22570 7886 7335 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_22570 8451 7912 gene locus_tag LOCUS_22580 8451 7912 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389209.1 protein_id gnl|my_center|LOCUS_22580 9026 9307 gene locus_tag LOCUS_22590 9026 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 9348 10256 gene locus_tag LOCUS_22600 9348 10256 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388576.1 protein_id gnl|my_center|LOCUS_22600 10256 11083 gene locus_tag LOCUS_22610 10256 11083 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390775.1 protein_id gnl|my_center|LOCUS_22610 12556 11279 gene locus_tag LOCUS_22620 12556 11279 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392212.1 protein_id gnl|my_center|LOCUS_22620 14689 12836 gene locus_tag LOCUS_22630 gene ggt 14689 12836 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_22630 15027 14842 gene locus_tag LOCUS_22640 15027 14842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 16162 15008 gene locus_tag LOCUS_22650 gene cydB 16162 15008 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 protein_id gnl|my_center|LOCUS_22650 17784 16159 gene locus_tag LOCUS_22660 17784 16159 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973556.1 protein_id gnl|my_center|LOCUS_22660 19555 17840 gene locus_tag LOCUS_22670 19555 17840 CDS product amino acid ABC transporter ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973555.1 protein_id gnl|my_center|LOCUS_22670 21285 19552 gene locus_tag LOCUS_22680 gene cydD 21285 19552 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651734.1 protein_id gnl|my_center|LOCUS_22680 21455 22015 gene locus_tag LOCUS_22690 21455 22015 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_22690 22369 23337 gene locus_tag LOCUS_22700 22369 23337 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814720.1 protein_id gnl|my_center|LOCUS_22700 23337 24953 gene locus_tag LOCUS_22710 23337 24953 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064950.1 protein_id gnl|my_center|LOCUS_22710 26300 25065 gene locus_tag LOCUS_22720 26300 25065 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_22720 <27506 26297 gene locus_tag LOCUS_22730 <27506 26297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038951.1:Zn-dependent hydrolase >Feature sequence053 1203 313 gene locus_tag LOCUS_22740 gene ubiA 1203 313 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_22740 1808 1290 gene locus_tag LOCUS_22750 1808 1290 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_22750 2955 1990 gene locus_tag LOCUS_22760 2955 1990 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_22760 5340 3169 gene locus_tag LOCUS_22770 gene recG 5340 3169 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_22770 5458 6753 gene locus_tag LOCUS_22780 5458 6753 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_22780 6873 8027 gene locus_tag LOCUS_22790 gene queA 6873 8027 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200515.1 protein_id gnl|my_center|LOCUS_22790 8024 8947 gene locus_tag LOCUS_22800 8024 8947 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_22800 10666 9011 gene locus_tag LOCUS_22810 10666 9011 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237772.1 protein_id gnl|my_center|LOCUS_22810 11637 10663 gene locus_tag LOCUS_22820 11637 10663 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039342.1 protein_id gnl|my_center|LOCUS_22820 11890 12801 gene locus_tag LOCUS_22830 11890 12801 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762877.1 protein_id gnl|my_center|LOCUS_22830 13620 12886 gene locus_tag LOCUS_22840 13620 12886 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038721.1 protein_id gnl|my_center|LOCUS_22840 14512 13712 gene locus_tag LOCUS_22850 gene trpC 14512 13712 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_22850 15685 14633 gene locus_tag LOCUS_22860 gene trpD 15685 14633 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_22860 16333 15701 gene locus_tag LOCUS_22870 16333 15701 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 protein_id gnl|my_center|LOCUS_22870 16980 16372 gene locus_tag LOCUS_22880 16980 16372 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_22880 17330 16977 gene locus_tag LOCUS_22890 17330 16977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 18826 17327 gene locus_tag LOCUS_22900 gene trpE 18826 17327 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 protein_id gnl|my_center|LOCUS_22900 19174 19776 gene locus_tag LOCUS_22910 19174 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 20509 19808 gene locus_tag LOCUS_22920 20509 19808 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531889.1 protein_id gnl|my_center|LOCUS_22920 21745 20570 gene locus_tag LOCUS_22930 21745 20570 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550696.1 protein_id gnl|my_center|LOCUS_22930 21925 23127 gene locus_tag LOCUS_22940 21925 23127 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704968.1 protein_id gnl|my_center|LOCUS_22940 23166 23534 gene locus_tag LOCUS_22950 23166 23534 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553206.1 protein_id gnl|my_center|LOCUS_22950 23531 23857 gene locus_tag LOCUS_22960 23531 23857 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704966.1 protein_id gnl|my_center|LOCUS_22960 23854 26091 gene locus_tag LOCUS_22970 23854 26091 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence054 1471 1061 gene locus_tag LOCUS_22980 1471 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4237 2297 gene locus_tag LOCUS_22990 4237 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 4307 4990 gene locus_tag LOCUS_23000 4307 4990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140383.1 protein_id gnl|my_center|LOCUS_23000 6007 5060 gene locus_tag LOCUS_23010 6007 5060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_23010 6130 7194 gene locus_tag LOCUS_23020 6130 7194 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_23020 7465 7965 gene locus_tag LOCUS_23030 gene ybaK 7465 7965 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_23030 8047 8676 gene locus_tag LOCUS_23040 gene plsY 8047 8676 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_23040 10187 8721 gene locus_tag LOCUS_23050 10187 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 12541 10406 gene locus_tag LOCUS_23060 12541 10406 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 protein_id gnl|my_center|LOCUS_23060 12763 13095 gene locus_tag LOCUS_23070 12763 13095 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720718.1 protein_id gnl|my_center|LOCUS_23070 13258 14646 gene locus_tag LOCUS_23080 13258 14646 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 protein_id gnl|my_center|LOCUS_23080 15979 14657 gene locus_tag LOCUS_23090 15979 14657 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970614.1 protein_id gnl|my_center|LOCUS_23090 16324 16007 gene locus_tag LOCUS_23100 16324 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 17344 16385 gene locus_tag LOCUS_23110 17344 16385 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539252.1 protein_id gnl|my_center|LOCUS_23110 17462 18832 gene locus_tag LOCUS_23120 17462 18832 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524797.1 protein_id gnl|my_center|LOCUS_23120 18906 19898 gene locus_tag LOCUS_23130 18906 19898 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088130.1 protein_id gnl|my_center|LOCUS_23130 19959 21515 gene locus_tag LOCUS_23140 19959 21515 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762891.1 protein_id gnl|my_center|LOCUS_23140 22123 21593 gene locus_tag LOCUS_23150 22123 21593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 22397 22188 gene locus_tag LOCUS_23160 22397 22188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 23952 22510 gene locus_tag LOCUS_23170 23952 22510 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 protein_id gnl|my_center|LOCUS_23170 24674 24081 gene locus_tag LOCUS_23180 24674 24081 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 protein_id gnl|my_center|LOCUS_23180 24791 25324 gene locus_tag LOCUS_23190 gene azu 24791 25324 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813974.1 protein_id gnl|my_center|LOCUS_23190 25504 25704 gene locus_tag LOCUS_23200 25504 25704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence055 546 1832 gene locus_tag LOCUS_23210 546 1832 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_23210 3275 1851 gene locus_tag LOCUS_23220 3275 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 3860 5971 gene locus_tag LOCUS_23230 3860 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 7202 6075 gene locus_tag LOCUS_23240 gene mltB 7202 6075 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901052.1 protein_id gnl|my_center|LOCUS_23240 9287 7239 gene locus_tag LOCUS_23250 9287 7239 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 protein_id gnl|my_center|LOCUS_23250 10398 9385 gene locus_tag LOCUS_23260 10398 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23260 11329 10409 gene locus_tag LOCUS_23270 11329 10409 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_23270 11366 12325 gene locus_tag LOCUS_23280 11366 12325 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_23280 12385 13191 gene locus_tag LOCUS_23290 12385 13191 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_23290 13173 14465 gene locus_tag LOCUS_23300 13173 14465 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 protein_id gnl|my_center|LOCUS_23300 14628 15377 gene locus_tag LOCUS_23310 14628 15377 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 protein_id gnl|my_center|LOCUS_23310 15406 16338 gene locus_tag LOCUS_23320 15406 16338 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 protein_id gnl|my_center|LOCUS_23320 16413 18203 gene locus_tag LOCUS_23330 16413 18203 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_23330 18426 19382 gene locus_tag LOCUS_23340 18426 19382 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_23340 19908 19489 gene locus_tag LOCUS_23350 gene rnk 19908 19489 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706600.1 protein_id gnl|my_center|LOCUS_23350 20114 21229 gene locus_tag LOCUS_23360 20114 21229 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938358.1 protein_id gnl|my_center|LOCUS_23360 21423 22634 gene locus_tag LOCUS_23370 21423 22634 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 protein_id gnl|my_center|LOCUS_23370 23425 22781 gene locus_tag LOCUS_23380 23425 22781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 24120 23623 gene locus_tag LOCUS_23390 24120 23623 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 protein_id gnl|my_center|LOCUS_23390 25599 24190 gene locus_tag LOCUS_23400 25599 24190 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012170558.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence056 3 224 gene locus_tag LOCUS_23410 3 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 211 2820 gene locus_tag LOCUS_23420 gene alaS 211 2820 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191158.1 protein_id gnl|my_center|LOCUS_23420 3956 2928 gene locus_tag LOCUS_23430 3956 2928 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_23430 4765 3989 gene locus_tag LOCUS_23440 gene trmB 4765 3989 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185899.1 protein_id gnl|my_center|LOCUS_23440 5817 4762 gene locus_tag LOCUS_23450 gene gluQRS 5817 4762 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186469.1 protein_id gnl|my_center|LOCUS_23450 7031 5904 gene locus_tag LOCUS_23460 7031 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23460 8149 7211 gene locus_tag LOCUS_23470 8149 7211 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 protein_id gnl|my_center|LOCUS_23470 8180 8902 gene locus_tag LOCUS_23480 8180 8902 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179442.1 protein_id gnl|my_center|LOCUS_23480 8916 9827 gene locus_tag LOCUS_23490 8916 9827 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522639.1 protein_id gnl|my_center|LOCUS_23490 10637 9879 gene locus_tag LOCUS_23500 10637 9879 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039013.1 protein_id gnl|my_center|LOCUS_23500 11648 10800 gene locus_tag LOCUS_23510 11648 10800 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_23510 12360 11659 gene locus_tag LOCUS_23520 12360 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 14191 12506 gene locus_tag LOCUS_23530 gene sulP 14191 12506 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_23530 14348 14815 gene locus_tag LOCUS_23540 14348 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 14879 16141 gene locus_tag LOCUS_23550 14879 16141 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191808.1 protein_id gnl|my_center|LOCUS_23550 16213 16407 gene locus_tag LOCUS_23560 16213 16407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 17242 16565 gene locus_tag LOCUS_23570 17242 16565 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_23570 17261 17974 gene locus_tag LOCUS_23580 17261 17974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_23580 18090 18839 gene locus_tag LOCUS_23590 gene rlmB 18090 18839 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191786.1 protein_id gnl|my_center|LOCUS_23590 19902 18880 gene locus_tag LOCUS_23600 19902 18880 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 protein_id gnl|my_center|LOCUS_23600 20628 20032 gene locus_tag LOCUS_23610 20628 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 21275 20625 gene locus_tag LOCUS_23620 21275 20625 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206517.1 protein_id gnl|my_center|LOCUS_23620 22384 21476 gene locus_tag LOCUS_23630 gene mmsB 22384 21476 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811743.1 protein_id gnl|my_center|LOCUS_23630 22957 22499 gene locus_tag LOCUS_23640 22957 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 24197 23031 gene locus_tag LOCUS_23650 24197 23031 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811748.1 protein_id gnl|my_center|LOCUS_23650 24666 24250 gene locus_tag LOCUS_23660 24666 24250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence057 <1 882 gene locus_tag LOCUS_23670 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186490.1:serine hydroxymethyltransferase 944 1393 gene locus_tag LOCUS_23680 gene nrdR 944 1393 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_23680 2662 1565 gene locus_tag LOCUS_23690 gene aroC 2662 1565 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534774.1 protein_id gnl|my_center|LOCUS_23690 3344 2892 gene locus_tag LOCUS_23700 3344 2892 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_23700 3455 4765 gene locus_tag LOCUS_23710 3455 4765 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_23710 4770 5579 gene locus_tag LOCUS_23720 4770 5579 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_23720 6352 5651 gene locus_tag LOCUS_23730 6352 5651 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_23730 6402 7439 gene locus_tag LOCUS_23740 gene hemH 6402 7439 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853055.1 protein_id gnl|my_center|LOCUS_23740 8016 7609 gene locus_tag LOCUS_23750 8016 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 8356 10554 gene locus_tag LOCUS_23760 8356 10554 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930695.1 protein_id gnl|my_center|LOCUS_23760 12091 10643 gene locus_tag LOCUS_23770 12091 10643 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529613.1 protein_id gnl|my_center|LOCUS_23770 12732 12163 gene locus_tag LOCUS_23780 12732 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 13804 12845 gene locus_tag LOCUS_23790 13804 12845 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312075.1 protein_id gnl|my_center|LOCUS_23790 13973 14656 gene locus_tag LOCUS_23800 gene tctD 13973 14656 CDS product transcriptional regulator TctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706151.1 protein_id gnl|my_center|LOCUS_23800 14668 16086 gene locus_tag LOCUS_23810 14668 16086 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114178.1 protein_id gnl|my_center|LOCUS_23810 16119 16556 gene locus_tag LOCUS_23820 16119 16556 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811999.1 protein_id gnl|my_center|LOCUS_23820 16889 16581 gene locus_tag LOCUS_23830 16889 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 17371 18507 gene locus_tag LOCUS_23840 17371 18507 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972120.1 protein_id gnl|my_center|LOCUS_23840 19990 18566 gene locus_tag LOCUS_23850 gene pmbA 19990 18566 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_23850 20087 20752 gene locus_tag LOCUS_23860 gene yjgA 20087 20752 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189393.1 protein_id gnl|my_center|LOCUS_23860 20745 21383 gene locus_tag LOCUS_23870 gene mog 20745 21383 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522377.1 protein_id gnl|my_center|LOCUS_23870 22658 21453 gene locus_tag LOCUS_23880 22658 21453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 23835 23053 gene locus_tag LOCUS_23890 gene cysE 23835 23053 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_23890 24697 23891 gene locus_tag LOCUS_23900 24697 23891 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193115.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence058 575 1507 gene locus_tag LOCUS_23910 gene argC 575 1507 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 protein_id gnl|my_center|LOCUS_23910 2759 1530 gene locus_tag LOCUS_23920 gene dprA 2759 1530 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_23920 4029 2812 gene locus_tag LOCUS_23930 4029 2812 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_23930 4274 4783 gene locus_tag LOCUS_23940 gene def 4274 4783 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 protein_id gnl|my_center|LOCUS_23940 4780 5343 gene locus_tag LOCUS_23950 4780 5343 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203512.1 protein_id gnl|my_center|LOCUS_23950 5410 6489 gene locus_tag LOCUS_23960 gene fmt 5410 6489 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_23960 6486 7310 gene locus_tag LOCUS_23970 6486 7310 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522683.1 protein_id gnl|my_center|LOCUS_23970 7307 7672 gene locus_tag LOCUS_23980 7307 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 7751 8974 gene locus_tag LOCUS_23990 7751 8974 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189839.1 protein_id gnl|my_center|LOCUS_23990 9688 9116 gene locus_tag LOCUS_24000 9688 9116 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_24000 9975 10799 gene locus_tag LOCUS_24010 gene pyrF 9975 10799 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_24010 10817 11713 gene locus_tag LOCUS_24020 10817 11713 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448320.1 protein_id gnl|my_center|LOCUS_24020 11848 12837 gene locus_tag LOCUS_24030 11848 12837 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815277.1 protein_id gnl|my_center|LOCUS_24030 12834 13853 gene locus_tag LOCUS_24040 12834 13853 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815276.1 protein_id gnl|my_center|LOCUS_24040 14924 13983 gene locus_tag LOCUS_24050 14924 13983 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033113420.1 protein_id gnl|my_center|LOCUS_24050 15275 17245 gene locus_tag LOCUS_24060 15275 17245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 17444 19312 gene locus_tag LOCUS_24070 17444 19312 CDS product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920273.1 protein_id gnl|my_center|LOCUS_24070 19346 20803 gene locus_tag LOCUS_24080 19346 20803 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_24080 21731 20793 gene locus_tag LOCUS_24090 21731 20793 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089050.1 protein_id gnl|my_center|LOCUS_24090 21901 22866 gene locus_tag LOCUS_24100 21901 22866 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812334.1 protein_id gnl|my_center|LOCUS_24100 22868 23926 gene locus_tag LOCUS_24110 22868 23926 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113700.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence059 2505 862 gene locus_tag LOCUS_24120 2505 862 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_24120 2692 4197 gene locus_tag LOCUS_24130 2692 4197 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199502.1 protein_id gnl|my_center|LOCUS_24130 4194 4607 gene locus_tag LOCUS_24140 gene msrB 4194 4607 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268546.1 protein_id gnl|my_center|LOCUS_24140 4682 5257 gene locus_tag LOCUS_24150 4682 5257 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_24150 5254 5541 gene locus_tag LOCUS_24160 5254 5541 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970118.1 protein_id gnl|my_center|LOCUS_24160 5604 6389 gene locus_tag LOCUS_24170 5604 6389 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_24170 7752 6625 gene locus_tag LOCUS_24180 7752 6625 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_24180 8359 7889 gene locus_tag LOCUS_24190 8359 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 8796 8362 gene locus_tag LOCUS_24200 8796 8362 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_24200 10433 8835 gene locus_tag LOCUS_24210 10433 8835 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 protein_id gnl|my_center|LOCUS_24210 10457 11551 gene locus_tag LOCUS_24220 gene lptF 10457 11551 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_24220 11548 12672 gene locus_tag LOCUS_24230 gene lptG 11548 12672 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_24230 12669 13082 gene locus_tag LOCUS_24240 12669 13082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 13153 14094 gene locus_tag LOCUS_24250 13153 14094 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 protein_id gnl|my_center|LOCUS_24250 14144 15319 gene locus_tag LOCUS_24260 14144 15319 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_24260 16678 15335 gene locus_tag LOCUS_24270 gene rng 16678 15335 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_24270 16822 16697 gene locus_tag LOCUS_24280 16822 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24280 17473 16856 gene locus_tag LOCUS_24290 17473 16856 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_24290 18064 17597 gene locus_tag LOCUS_24300 gene rlmH 18064 17597 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_24300 18980 18150 gene locus_tag LOCUS_24310 18980 18150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 20143 19136 gene locus_tag LOCUS_24320 gene hemF 20143 19136 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 protein_id gnl|my_center|LOCUS_24320 21381 20143 gene locus_tag LOCUS_24330 gene purD 21381 20143 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_24330 22139 21420 gene locus_tag LOCUS_24340 22139 21420 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185607.1 protein_id gnl|my_center|LOCUS_24340 22211 23716 gene locus_tag LOCUS_24350 22211 23716 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence060 1476 250 gene locus_tag LOCUS_24360 gene gltS 1476 250 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_24360 1737 2357 gene locus_tag LOCUS_24370 1737 2357 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_24370 2738 3178 gene locus_tag LOCUS_24380 2738 3178 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087368.1 protein_id gnl|my_center|LOCUS_24380 3298 4557 gene locus_tag LOCUS_24390 3298 4557 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770220.1 protein_id gnl|my_center|LOCUS_24390 4781 6397 gene locus_tag LOCUS_24400 4781 6397 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193473.1 protein_id gnl|my_center|LOCUS_24400 6604 8289 gene locus_tag LOCUS_24410 6604 8289 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_24410 8334 9605 gene locus_tag LOCUS_24420 8334 9605 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039013.1 protein_id gnl|my_center|LOCUS_24420 10641 9670 gene locus_tag LOCUS_24430 10641 9670 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_24430 10780 11376 gene locus_tag LOCUS_24440 10780 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 11658 13052 gene locus_tag LOCUS_24450 11658 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 14532 13198 gene locus_tag LOCUS_24460 gene glmM 14532 13198 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550648.1 protein_id gnl|my_center|LOCUS_24460 15454 14597 gene locus_tag LOCUS_24470 gene folP 15454 14597 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_24470 17518 15599 gene locus_tag LOCUS_24480 gene ftsH 17518 15599 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_24480 18342 17686 gene locus_tag LOCUS_24490 18342 17686 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193119.1 protein_id gnl|my_center|LOCUS_24490 18421 18894 gene locus_tag LOCUS_24500 18421 18894 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193985.1 protein_id gnl|my_center|LOCUS_24500 18894 19637 gene locus_tag LOCUS_24510 18894 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_24510 20174 19767 gene locus_tag LOCUS_24520 20174 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 20671 20195 gene locus_tag LOCUS_24530 gene greA 20671 20195 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_24530 <23610 20899 gene locus_tag LOCUS_24540 <23610 20899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809588.1:carbamoyl-phosphate synthase large subunit >Feature sequence061 1926 1297 gene locus_tag LOCUS_24550 gene uvrY 1926 1297 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611328.1 protein_id gnl|my_center|LOCUS_24550 3296 1923 gene locus_tag LOCUS_24560 3296 1923 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088433.1 protein_id gnl|my_center|LOCUS_24560 4312 3293 gene locus_tag LOCUS_24570 gene pip 4312 3293 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925856.1 protein_id gnl|my_center|LOCUS_24570 4659 5579 gene locus_tag LOCUS_24580 gene pqqB 4659 5579 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763801.1 protein_id gnl|my_center|LOCUS_24580 5608 6348 gene locus_tag LOCUS_24590 gene pqqC 5608 6348 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 protein_id gnl|my_center|LOCUS_24590 6345 6638 gene locus_tag LOCUS_24600 gene pqqD 6345 6638 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_24600 6641 7819 gene locus_tag LOCUS_24610 gene pqqE 6641 7819 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 protein_id gnl|my_center|LOCUS_24610 7894 9522 gene locus_tag LOCUS_24620 7894 9522 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815895.1 protein_id gnl|my_center|LOCUS_24620 9532 11352 gene locus_tag LOCUS_24630 9532 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 11349 12311 gene locus_tag LOCUS_24640 11349 12311 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_24640 12308 12721 gene locus_tag LOCUS_24650 12308 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 12747 13562 gene locus_tag LOCUS_24660 12747 13562 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_24660 13609 13890 gene locus_tag LOCUS_24670 13609 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 14992 14024 gene locus_tag LOCUS_24680 14992 14024 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064416.1 protein_id gnl|my_center|LOCUS_24680 15420 16658 gene locus_tag LOCUS_24690 15420 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 17299 16751 gene locus_tag LOCUS_24700 17299 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 18047 17310 gene locus_tag LOCUS_24710 18047 17310 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 protein_id gnl|my_center|LOCUS_24710 18810 18142 gene locus_tag LOCUS_24720 18810 18142 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 protein_id gnl|my_center|LOCUS_24720 19543 18812 gene locus_tag LOCUS_24730 19543 18812 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194293.1 protein_id gnl|my_center|LOCUS_24730 20578 19676 gene locus_tag LOCUS_24740 20578 19676 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 protein_id gnl|my_center|LOCUS_24740 21960 21004 gene locus_tag LOCUS_24750 21960 21004 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_24750 22241 22837 gene locus_tag LOCUS_24760 22241 22837 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812400.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence062 402 70 gene locus_tag LOCUS_24770 402 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 911 531 gene locus_tag LOCUS_24780 911 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2078 1020 gene locus_tag LOCUS_24790 2078 1020 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807415.1 protein_id gnl|my_center|LOCUS_24790 3162 2221 gene locus_tag LOCUS_24800 gene rpoH 3162 2221 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195278.1 protein_id gnl|my_center|LOCUS_24800 4906 3287 gene locus_tag LOCUS_24810 4906 3287 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205290.1 protein_id gnl|my_center|LOCUS_24810 6689 5187 gene locus_tag LOCUS_24820 6689 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 6719 8182 gene locus_tag LOCUS_24830 6719 8182 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895504.1 protein_id gnl|my_center|LOCUS_24830 8201 9634 gene locus_tag LOCUS_24840 8201 9634 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_24840 9631 10314 gene locus_tag LOCUS_24850 gene rsmD 9631 10314 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_24850 10452 10946 gene locus_tag LOCUS_24860 gene coaD 10452 10946 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_24860 11068 14559 gene locus_tag LOCUS_24870 11068 14559 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 protein_id gnl|my_center|LOCUS_24870 14556 17378 gene locus_tag LOCUS_24880 14556 17378 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187774.1 protein_id gnl|my_center|LOCUS_24880 17421 18449 gene locus_tag LOCUS_24890 17421 18449 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553207.1 protein_id gnl|my_center|LOCUS_24890 19851 18565 gene locus_tag LOCUS_24900 19851 18565 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309834.1 protein_id gnl|my_center|LOCUS_24900 20412 20098 gene locus_tag LOCUS_24910 20412 20098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 21084 20533 gene locus_tag LOCUS_24920 21084 20533 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036245.1 protein_id gnl|my_center|LOCUS_24920 21560 21159 gene locus_tag LOCUS_24930 21560 21159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 21782 21621 gene locus_tag LOCUS_24940 21782 21621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 <23090 22013 gene locus_tag LOCUS_24950 <23090 22013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528391.1:PAS domain S-box protein >Feature sequence063 1503 175 gene locus_tag LOCUS_24960 1503 175 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_24960 2759 1563 gene locus_tag LOCUS_24970 2759 1563 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002055095.1 protein_id gnl|my_center|LOCUS_24970 2919 3851 gene locus_tag LOCUS_24980 2919 3851 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254613.1 protein_id gnl|my_center|LOCUS_24980 4013 4240 gene locus_tag LOCUS_24990 4013 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 6536 4932 gene locus_tag LOCUS_25000 6536 4932 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037563.1 protein_id gnl|my_center|LOCUS_25000 7029 7502 gene locus_tag LOCUS_25010 7029 7502 CDS product DUF4126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275228.1 protein_id gnl|my_center|LOCUS_25010 7806 7722 gene locus_tag LOCUS_t00220 7806 7722 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7850 8755 gene locus_tag LOCUS_25020 gene cysM 7850 8755 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550116.1 protein_id gnl|my_center|LOCUS_25020 8888 9445 gene locus_tag LOCUS_25030 8888 9445 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_25030 9537 9764 gene locus_tag LOCUS_25040 9537 9764 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_25040 10777 9896 gene locus_tag LOCUS_25050 gene galU 10777 9896 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_25050 13814 10941 gene locus_tag LOCUS_25060 13814 10941 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_25060 14645 14016 gene locus_tag LOCUS_25070 14645 14016 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_25070 14886 16634 gene locus_tag LOCUS_25080 14886 16634 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094971.1 protein_id gnl|my_center|LOCUS_25080 17978 16701 gene locus_tag LOCUS_25090 17978 16701 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_25090 19094 17997 gene locus_tag LOCUS_25100 19094 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 19920 19084 gene locus_tag LOCUS_25110 19920 19084 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446517.1 protein_id gnl|my_center|LOCUS_25110 20885 19929 gene locus_tag LOCUS_25120 gene hemC 20885 19929 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence064 1193 2575 gene locus_tag LOCUS_25130 1193 2575 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930606.1 protein_id gnl|my_center|LOCUS_25130 3773 2604 gene locus_tag LOCUS_25140 gene rodA 3773 2604 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_25140 3863 4453 gene locus_tag LOCUS_25150 3863 4453 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814956.1 protein_id gnl|my_center|LOCUS_25150 6005 4473 gene locus_tag LOCUS_25160 6005 4473 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820743.1 protein_id gnl|my_center|LOCUS_25160 6429 6007 gene locus_tag LOCUS_25170 6429 6007 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384291.1 protein_id gnl|my_center|LOCUS_25170 6632 7321 gene locus_tag LOCUS_25180 6632 7321 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 protein_id gnl|my_center|LOCUS_25180 7305 8831 gene locus_tag LOCUS_25190 7305 8831 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812764.1 protein_id gnl|my_center|LOCUS_25190 10395 8824 gene locus_tag LOCUS_25200 10395 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 10515 12584 gene locus_tag LOCUS_25210 10515 12584 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 protein_id gnl|my_center|LOCUS_25210 12617 13501 gene locus_tag LOCUS_25220 12617 13501 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567783.1 protein_id gnl|my_center|LOCUS_25220 13516 14382 gene locus_tag LOCUS_25230 gene aroE 13516 14382 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184294754.1 protein_id gnl|my_center|LOCUS_25230 14425 15162 gene locus_tag LOCUS_25240 gene mtgA 14425 15162 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522050.1 protein_id gnl|my_center|LOCUS_25240 15966 15187 gene locus_tag LOCUS_25250 gene xynR 15966 15187 CDS product DNA-binding transcriptional repressor XynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121657.1 protein_id gnl|my_center|LOCUS_25250 16619 17431 gene locus_tag LOCUS_25260 16619 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 17445 18449 gene locus_tag LOCUS_25270 17445 18449 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532378.1 protein_id gnl|my_center|LOCUS_25270 18508 19059 gene locus_tag LOCUS_25280 gene ruvC 18508 19059 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_25280 19582 19109 gene locus_tag LOCUS_25290 19582 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 21437 19815 gene locus_tag LOCUS_25300 21437 19815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence065 1506 877 gene locus_tag LOCUS_25310 gene upp 1506 877 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729095.1 protein_id gnl|my_center|LOCUS_25310 2741 1710 gene locus_tag LOCUS_25320 2741 1710 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186291.1 protein_id gnl|my_center|LOCUS_25320 4902 2836 gene locus_tag LOCUS_25330 4902 2836 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_25330 6740 4899 gene locus_tag LOCUS_25340 6740 4899 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930907.1 protein_id gnl|my_center|LOCUS_25340 8215 6737 gene locus_tag LOCUS_25350 8215 6737 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 protein_id gnl|my_center|LOCUS_25350 8685 8260 gene locus_tag LOCUS_25360 8685 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 9120 8701 gene locus_tag LOCUS_25370 9120 8701 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_25370 9998 9123 gene locus_tag LOCUS_25380 9998 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 10795 10073 gene locus_tag LOCUS_25390 10795 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 12017 10857 gene locus_tag LOCUS_25400 12017 10857 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035824.1 protein_id gnl|my_center|LOCUS_25400 14824 12017 gene locus_tag LOCUS_25410 14824 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 15158 14826 gene locus_tag LOCUS_25420 gene trxA 15158 14826 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_25420 16993 15224 gene locus_tag LOCUS_25430 16993 15224 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527892.1 protein_id gnl|my_center|LOCUS_25430 19469 17085 gene locus_tag LOCUS_25440 19469 17085 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928490.1 protein_id gnl|my_center|LOCUS_25440 19927 21405 gene locus_tag LOCUS_25450 19927 21405 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185957.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence066 156 1730 gene locus_tag LOCUS_25460 156 1730 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 protein_id gnl|my_center|LOCUS_25460 3459 2125 gene locus_tag LOCUS_25470 3459 2125 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064382.1 protein_id gnl|my_center|LOCUS_25470 7067 3624 gene locus_tag LOCUS_25480 gene addA 7067 3624 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528327.1 protein_id gnl|my_center|LOCUS_25480 9625 7064 gene locus_tag LOCUS_25490 9625 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 9735 10067 gene locus_tag LOCUS_25500 gene trxA 9735 10067 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380053.1 protein_id gnl|my_center|LOCUS_25500 10332 11594 gene locus_tag LOCUS_25510 gene rho 10332 11594 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810577.1 protein_id gnl|my_center|LOCUS_25510 11715 11975 gene locus_tag LOCUS_25520 11715 11975 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193070.1 protein_id gnl|my_center|LOCUS_25520 12096 13880 gene locus_tag LOCUS_25530 12096 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191882.1 protein_id gnl|my_center|LOCUS_25530 13896 15245 gene locus_tag LOCUS_25540 13896 15245 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192757.1 protein_id gnl|my_center|LOCUS_25540 16781 15411 gene locus_tag LOCUS_25550 gene phoR 16781 15411 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_25550 17634 16927 gene locus_tag LOCUS_25560 gene phoB 17634 16927 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192125.1 protein_id gnl|my_center|LOCUS_25560 18352 17651 gene locus_tag LOCUS_25570 gene phoU 18352 17651 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193271.1 protein_id gnl|my_center|LOCUS_25570 19217 18435 gene locus_tag LOCUS_25580 gene pstB 19217 18435 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193614.1 protein_id gnl|my_center|LOCUS_25580 20129 19245 gene locus_tag LOCUS_25590 gene pstA 20129 19245 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521821.1 protein_id gnl|my_center|LOCUS_25590 <20830 20132 gene locus_tag LOCUS_25600 <20830 20132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193912.1:phosphate ABC transporter permease PstC >Feature sequence067 493 1209 gene locus_tag LOCUS_25610 493 1209 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_25610 1206 2636 gene locus_tag LOCUS_25620 1206 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2662 3381 gene locus_tag LOCUS_25630 2662 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3388 6222 gene locus_tag LOCUS_25640 3388 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 6243 7412 gene locus_tag LOCUS_25650 6243 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 8082 9236 gene locus_tag LOCUS_25660 8082 9236 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101151.1 protein_id gnl|my_center|LOCUS_25660 9384 10160 gene locus_tag LOCUS_25670 9384 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 11756 10254 gene locus_tag LOCUS_25680 11756 10254 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812393.1 protein_id gnl|my_center|LOCUS_25680 12885 11845 gene locus_tag LOCUS_25690 gene eutR 12885 11845 CDS product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753715.1 protein_id gnl|my_center|LOCUS_25690 13102 14511 gene locus_tag LOCUS_25700 gene eat 13102 14511 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551092.1 protein_id gnl|my_center|LOCUS_25700 14537 15925 gene locus_tag LOCUS_25710 14537 15925 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_25710 15940 16818 gene locus_tag LOCUS_25720 gene eutC 15940 16818 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524484.1 protein_id gnl|my_center|LOCUS_25720 18014 16836 gene locus_tag LOCUS_25730 18014 16836 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965436.1 protein_id gnl|my_center|LOCUS_25730 20214 18205 gene locus_tag LOCUS_25740 20214 18205 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537232.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence068 139 2784 gene locus_tag LOCUS_25750 139 2784 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694559.1 protein_id gnl|my_center|LOCUS_25750 3190 2864 gene locus_tag LOCUS_25760 3190 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776245.1 protein_id gnl|my_center|LOCUS_25760 4074 3307 gene locus_tag LOCUS_25770 4074 3307 CDS product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247126.1 protein_id gnl|my_center|LOCUS_25770 5584 4118 gene locus_tag LOCUS_25780 5584 4118 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764523.1 protein_id gnl|my_center|LOCUS_25780 5880 7712 gene locus_tag LOCUS_25790 5880 7712 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267928.1 protein_id gnl|my_center|LOCUS_25790 7876 8691 gene locus_tag LOCUS_25800 7876 8691 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 protein_id gnl|my_center|LOCUS_25800 8691 10826 gene locus_tag LOCUS_25810 8691 10826 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_25810 10823 11758 gene locus_tag LOCUS_25820 10823 11758 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971611.1 protein_id gnl|my_center|LOCUS_25820 11772 12242 gene locus_tag LOCUS_25830 11772 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 12427 12927 gene locus_tag LOCUS_25840 12427 12927 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036047.1 protein_id gnl|my_center|LOCUS_25840 13798 13013 gene locus_tag LOCUS_25850 13798 13013 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_25850 14656 13835 gene locus_tag LOCUS_25860 14656 13835 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 protein_id gnl|my_center|LOCUS_25860 16277 14718 gene locus_tag LOCUS_25870 16277 14718 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 protein_id gnl|my_center|LOCUS_25870 17704 16457 gene locus_tag LOCUS_25880 17704 16457 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104287.1 protein_id gnl|my_center|LOCUS_25880 18690 17986 gene locus_tag LOCUS_25890 18690 17986 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704843.1 protein_id gnl|my_center|LOCUS_25890 19455 18796 gene locus_tag LOCUS_25900 19455 18796 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521496.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence069 1575 2180 gene locus_tag LOCUS_25910 1575 2180 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930554.1 protein_id gnl|my_center|LOCUS_25910 2884 4176 gene locus_tag LOCUS_25920 gene proV 2884 4176 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 protein_id gnl|my_center|LOCUS_25920 4173 5423 gene locus_tag LOCUS_25930 gene proW 4173 5423 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098424.1 protein_id gnl|my_center|LOCUS_25930 5482 6567 gene locus_tag LOCUS_25940 gene proX 5482 6567 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390230.1 protein_id gnl|my_center|LOCUS_25940 6904 7056 gene locus_tag LOCUS_25950 6904 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 7124 8707 gene locus_tag LOCUS_25960 gene baeS 7124 8707 CDS product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706068.1 protein_id gnl|my_center|LOCUS_25960 8704 9474 gene locus_tag LOCUS_25970 gene baeR 8704 9474 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815798.1 protein_id gnl|my_center|LOCUS_25970 9611 10783 gene locus_tag LOCUS_25980 9611 10783 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113726.1 protein_id gnl|my_center|LOCUS_25980 12193 10808 gene locus_tag LOCUS_25990 gene fumC 12193 10808 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707066.1 protein_id gnl|my_center|LOCUS_25990 12417 14597 gene locus_tag LOCUS_26000 12417 14597 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810405.1 protein_id gnl|my_center|LOCUS_26000 14721 16280 gene locus_tag LOCUS_26010 14721 16280 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064992.1 protein_id gnl|my_center|LOCUS_26010 16446 17315 gene locus_tag LOCUS_26020 gene murI 16446 17315 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552506.1 protein_id gnl|my_center|LOCUS_26020 17911 17384 gene locus_tag LOCUS_26030 17911 17384 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 protein_id gnl|my_center|LOCUS_26030 18726 18088 gene locus_tag LOCUS_26040 18726 18088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 18831 18740 gene locus_tag LOCUS_t00230 18831 18740 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19048 18973 gene locus_tag LOCUS_t00240 19048 18973 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19236 19163 gene locus_tag LOCUS_t00250 19236 19163 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 19367 19292 gene locus_tag LOCUS_t00260 19367 19292 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence070 9 758 gene locus_tag LOCUS_26050 9 758 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479931.1 protein_id gnl|my_center|LOCUS_26050 823 1605 gene locus_tag LOCUS_26060 823 1605 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479930.1 protein_id gnl|my_center|LOCUS_26060 1602 2369 gene locus_tag LOCUS_26070 1602 2369 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888285.1 protein_id gnl|my_center|LOCUS_26070 2408 3301 gene locus_tag LOCUS_26080 2408 3301 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227640.1 protein_id gnl|my_center|LOCUS_26080 5269 3323 gene locus_tag LOCUS_26090 gene mrdA 5269 3323 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_26090 5825 5307 gene locus_tag LOCUS_26100 gene mreD 5825 5307 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_26100 6742 5822 gene locus_tag LOCUS_26110 gene mreC 6742 5822 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_26110 7926 6883 gene locus_tag LOCUS_26120 7926 6883 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_26120 8132 8431 gene locus_tag LOCUS_26130 gene gatC 8132 8431 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189769.1 protein_id gnl|my_center|LOCUS_26130 8462 9961 gene locus_tag LOCUS_26140 gene gatA 8462 9961 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_26140 9963 11423 gene locus_tag LOCUS_26150 gene gatB 9963 11423 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929770.1 protein_id gnl|my_center|LOCUS_26150 12177 11479 gene locus_tag LOCUS_26160 12177 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 12878 12174 gene locus_tag LOCUS_26170 gene pyrE 12878 12174 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459018.1 protein_id gnl|my_center|LOCUS_26170 12889 13692 gene locus_tag LOCUS_26180 12889 13692 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_26180 14579 13689 gene locus_tag LOCUS_26190 14579 13689 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197329.1 protein_id gnl|my_center|LOCUS_26190 14649 15065 gene locus_tag LOCUS_26200 14649 15065 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205349.1 protein_id gnl|my_center|LOCUS_26200 16249 15089 gene locus_tag LOCUS_26210 16249 15089 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114439.1 protein_id gnl|my_center|LOCUS_26210 16375 17316 gene locus_tag LOCUS_26220 16375 17316 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114438.1 protein_id gnl|my_center|LOCUS_26220 18286 17363 gene locus_tag LOCUS_26230 18286 17363 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_26230 18370 18777 gene locus_tag LOCUS_26240 18370 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 18774 19226 gene locus_tag LOCUS_26250 18774 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064705.1 protein_id gnl|my_center|LOCUS_26250 19230 19424 gene locus_tag LOCUS_26260 19230 19424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence071 1290 2453 gene locus_tag LOCUS_26270 1290 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2426 3127 gene locus_tag LOCUS_26280 2426 3127 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082973.1 protein_id gnl|my_center|LOCUS_26280 4949 3069 gene locus_tag LOCUS_26290 gene pabB 4949 3069 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777109.1 protein_id gnl|my_center|LOCUS_26290 6111 4984 gene locus_tag LOCUS_26300 gene nadA 6111 4984 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 protein_id gnl|my_center|LOCUS_26300 7048 6182 gene locus_tag LOCUS_26310 gene nadC 7048 6182 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 protein_id gnl|my_center|LOCUS_26310 7277 9058 gene locus_tag LOCUS_26320 7277 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 9142 10032 gene locus_tag LOCUS_26330 gene panB 9142 10032 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_26330 10057 10920 gene locus_tag LOCUS_26340 gene panC 10057 10920 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_26340 12163 11186 gene locus_tag LOCUS_26350 12163 11186 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_26350 12728 12267 gene locus_tag LOCUS_26360 gene secB 12728 12267 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198004.1 protein_id gnl|my_center|LOCUS_26360 13161 12901 gene locus_tag LOCUS_26370 gene grxC 13161 12901 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_26370 13713 13228 gene locus_tag LOCUS_26380 13713 13228 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929909.1 protein_id gnl|my_center|LOCUS_26380 13708 14451 gene locus_tag LOCUS_26390 gene gpmA 13708 14451 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198007.1 protein_id gnl|my_center|LOCUS_26390 14574 16010 gene locus_tag LOCUS_26400 14574 16010 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543824.1 protein_id gnl|my_center|LOCUS_26400 16131 16901 gene locus_tag LOCUS_26410 gene moeB 16131 16901 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_26410 17028 17429 gene locus_tag LOCUS_26420 17028 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 18229 17597 gene locus_tag LOCUS_26430 gene rqpR 18229 17597 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence072 2 685 gene locus_tag LOCUS_26440 2 685 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_26440 766 1779 gene locus_tag LOCUS_26450 766 1779 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_26450 1795 2829 gene locus_tag LOCUS_26460 1795 2829 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_26460 2911 3852 gene locus_tag LOCUS_26470 2911 3852 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_26470 3905 4381 gene locus_tag LOCUS_26480 3905 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 4386 5261 gene locus_tag LOCUS_26490 4386 5261 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_26490 5351 6316 gene locus_tag LOCUS_26500 5351 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 6553 7158 gene locus_tag LOCUS_26510 6553 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 7276 8844 gene locus_tag LOCUS_26520 7276 8844 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_26520 8909 9259 gene locus_tag LOCUS_26530 8909 9259 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101146.1 protein_id gnl|my_center|LOCUS_26530 9311 9706 gene locus_tag LOCUS_26540 9311 9706 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 protein_id gnl|my_center|LOCUS_26540 9706 10101 gene locus_tag LOCUS_26550 9706 10101 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929235.1 protein_id gnl|my_center|LOCUS_26550 10174 11175 gene locus_tag LOCUS_26560 10174 11175 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_26560 12198 11302 gene locus_tag LOCUS_26570 gene pcaU 12198 11302 CDS product IclR family transcriptional regulator PcaU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120879.1 protein_id gnl|my_center|LOCUS_26570 12451 13674 gene locus_tag LOCUS_26580 gene pobA 12451 13674 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114537.1 protein_id gnl|my_center|LOCUS_26580 13812 14465 gene locus_tag LOCUS_26590 13812 14465 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406312.1 protein_id gnl|my_center|LOCUS_26590 14600 14818 gene locus_tag LOCUS_26600 14600 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 14841 15227 gene locus_tag LOCUS_26610 14841 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 15547 15113 gene locus_tag LOCUS_26620 15547 15113 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191582.1 protein_id gnl|my_center|LOCUS_26620 15687 16598 gene locus_tag LOCUS_26630 15687 16598 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065026.1 protein_id gnl|my_center|LOCUS_26630 16669 17655 gene locus_tag LOCUS_26640 16669 17655 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047167.1 protein_id gnl|my_center|LOCUS_26640 18058 17663 gene locus_tag LOCUS_26650 18058 17663 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014431504.1 protein_id gnl|my_center|LOCUS_26650 <18608 18055 gene locus_tag LOCUS_26660 <18608 18055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000715695.1:precorrin-3B C(17)-methyltransferase >Feature sequence073 1728 775 gene locus_tag LOCUS_26670 gene puuE 1728 775 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521217.1 protein_id gnl|my_center|LOCUS_26670 2423 1746 gene locus_tag LOCUS_26680 2423 1746 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083340.1 protein_id gnl|my_center|LOCUS_26680 2512 2862 gene locus_tag LOCUS_26690 gene uraH 2512 2862 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 protein_id gnl|my_center|LOCUS_26690 3475 2930 gene locus_tag LOCUS_26700 3475 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 3596 4456 gene locus_tag LOCUS_26710 gene xdhC 3596 4456 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 protein_id gnl|my_center|LOCUS_26710 4687 5928 gene locus_tag LOCUS_26720 4687 5928 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 protein_id gnl|my_center|LOCUS_26720 6020 6679 gene locus_tag LOCUS_26730 6020 6679 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171830.1 protein_id gnl|my_center|LOCUS_26730 6992 6768 gene locus_tag LOCUS_26740 6992 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 8739 7231 gene locus_tag LOCUS_26750 8739 7231 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200776.1 protein_id gnl|my_center|LOCUS_26750 9188 8736 gene locus_tag LOCUS_26760 9188 8736 CDS product bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929706.1 protein_id gnl|my_center|LOCUS_26760 9375 10361 gene locus_tag LOCUS_26770 gene queG 9375 10361 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 protein_id gnl|my_center|LOCUS_26770 10520 11467 gene locus_tag LOCUS_26780 10520 11467 CDS product IS481-like element IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015810.1 protein_id gnl|my_center|LOCUS_26780 12369 11464 gene locus_tag LOCUS_26790 12369 11464 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814325.1 protein_id gnl|my_center|LOCUS_26790 12600 13562 gene locus_tag LOCUS_26800 12600 13562 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 protein_id gnl|my_center|LOCUS_26800 13650 14549 gene locus_tag LOCUS_26810 gene xerD 13650 14549 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535956.1 protein_id gnl|my_center|LOCUS_26810 14593 15582 gene locus_tag LOCUS_26820 14593 15582 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817045.1 protein_id gnl|my_center|LOCUS_26820 16920 15622 gene locus_tag LOCUS_26830 16920 15622 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_26830 18220 17015 gene locus_tag LOCUS_26840 18220 17015 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence074 <1 700 gene locus_tag LOCUS_26850 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267831.1:efflux RND transporter permease subunit 831 2105 gene locus_tag LOCUS_26860 831 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2295 2927 gene locus_tag LOCUS_26870 2295 2927 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704610.1 protein_id gnl|my_center|LOCUS_26870 3927 3310 gene locus_tag LOCUS_26880 3927 3310 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931185.1 protein_id gnl|my_center|LOCUS_26880 4036 5415 gene locus_tag LOCUS_26890 gene purB 4036 5415 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522085.1 protein_id gnl|my_center|LOCUS_26890 5498 6058 gene locus_tag LOCUS_26900 5498 6058 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_26900 6475 6170 gene locus_tag LOCUS_26910 6475 6170 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040743.1 protein_id gnl|my_center|LOCUS_26910 6981 6523 gene locus_tag LOCUS_26920 6981 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 7557 8306 gene locus_tag LOCUS_26930 7557 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 8451 8933 gene locus_tag LOCUS_26940 8451 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 9133 9483 gene locus_tag LOCUS_26950 9133 9483 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931277.1 protein_id gnl|my_center|LOCUS_26950 11106 9451 gene locus_tag LOCUS_26960 11106 9451 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_26960 11523 12047 gene locus_tag LOCUS_26970 gene moaC 11523 12047 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_26970 12844 12089 gene locus_tag LOCUS_26980 12844 12089 CDS product fimb protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688173.1 protein_id gnl|my_center|LOCUS_26980 13515 12946 gene locus_tag LOCUS_26990 gene pilA 13515 12946 CDS product type IV pilus assembly protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526211.1 protein_id gnl|my_center|LOCUS_26990 14441 13743 gene locus_tag LOCUS_27000 14441 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 15470 14607 gene locus_tag LOCUS_27010 15470 14607 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701707.1 protein_id gnl|my_center|LOCUS_27010 16466 15774 gene locus_tag LOCUS_27020 16466 15774 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930987.1 protein_id gnl|my_center|LOCUS_27020 17506 16610 gene locus_tag LOCUS_27030 gene sucD 17506 16610 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_27030 <18227 17522 gene locus_tag LOCUS_27040 <18227 17522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812749.1:ADP-forming succinate--CoA ligase subunit beta >Feature sequence075 823 35 gene locus_tag LOCUS_27050 823 35 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 protein_id gnl|my_center|LOCUS_27050 1724 1011 gene locus_tag LOCUS_27060 gene serB 1724 1011 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_27060 2555 1884 gene locus_tag LOCUS_27070 2555 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 6215 2724 gene locus_tag LOCUS_27080 gene mfd 6215 2724 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_27080 6382 7236 gene locus_tag LOCUS_27090 gene ispD 6382 7236 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051360364.1 protein_id gnl|my_center|LOCUS_27090 7296 7796 gene locus_tag LOCUS_27100 gene ispF 7296 7796 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_27100 9368 7863 gene locus_tag LOCUS_27110 9368 7863 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531418.1 protein_id gnl|my_center|LOCUS_27110 10337 9606 gene locus_tag LOCUS_27120 gene ompR 10337 9606 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_27120 10637 11263 gene locus_tag LOCUS_27130 10637 11263 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039083.1 protein_id gnl|my_center|LOCUS_27130 11506 12465 gene locus_tag LOCUS_27140 11506 12465 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039713.1 protein_id gnl|my_center|LOCUS_27140 12462 14720 gene locus_tag LOCUS_27150 12462 14720 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 protein_id gnl|my_center|LOCUS_27150 14788 14864 gene locus_tag LOCUS_t00270 14788 14864 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15204 15512 gene locus_tag LOCUS_27160 15204 15512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 15907 16197 gene locus_tag LOCUS_27170 15907 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 17327 16269 gene locus_tag LOCUS_27180 17327 16269 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_27180 >Feature sequence076 405 172 gene locus_tag LOCUS_27190 405 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 587 1978 gene locus_tag LOCUS_27200 587 1978 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400962.1 protein_id gnl|my_center|LOCUS_27200 2241 3629 gene locus_tag LOCUS_27210 2241 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 4179 3658 gene locus_tag LOCUS_27220 4179 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 5172 4243 gene locus_tag LOCUS_27230 5172 4243 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930233.1 protein_id gnl|my_center|LOCUS_27230 5348 6265 gene locus_tag LOCUS_27240 5348 6265 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 protein_id gnl|my_center|LOCUS_27240 6268 7683 gene locus_tag LOCUS_27250 6268 7683 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_27250 9051 7708 gene locus_tag LOCUS_27260 9051 7708 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035275.1 protein_id gnl|my_center|LOCUS_27260 9800 9252 gene locus_tag LOCUS_27270 9800 9252 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527748.1 protein_id gnl|my_center|LOCUS_27270 10534 9797 gene locus_tag LOCUS_27280 10534 9797 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432251.1 protein_id gnl|my_center|LOCUS_27280 11174 10521 gene locus_tag LOCUS_27290 11174 10521 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464032.1 protein_id gnl|my_center|LOCUS_27290 11890 11171 gene locus_tag LOCUS_27300 11890 11171 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403260.1 protein_id gnl|my_center|LOCUS_27300 12767 11952 gene locus_tag LOCUS_27310 12767 11952 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244023.1 protein_id gnl|my_center|LOCUS_27310 13243 12764 gene locus_tag LOCUS_27320 13243 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 13546 13253 gene locus_tag LOCUS_27330 13546 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27330 13890 14666 gene locus_tag LOCUS_27340 13890 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091293.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence077 1195 176 gene locus_tag LOCUS_27350 1195 176 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811487.1 protein_id gnl|my_center|LOCUS_27350 2113 1265 gene locus_tag LOCUS_27360 2113 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 2185 3096 gene locus_tag LOCUS_27370 2185 3096 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813900.1 protein_id gnl|my_center|LOCUS_27370 3156 4046 gene locus_tag LOCUS_27380 3156 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 4751 4143 gene locus_tag LOCUS_27390 4751 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 4962 6374 gene locus_tag LOCUS_27400 4962 6374 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186512.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27400 7793 6417 gene locus_tag LOCUS_27410 7793 6417 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 protein_id gnl|my_center|LOCUS_27410 7946 11056 gene locus_tag LOCUS_27420 gene uvrA 7946 11056 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357763.1 protein_id gnl|my_center|LOCUS_27420 12077 11097 gene locus_tag LOCUS_27430 12077 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 14022 12454 gene locus_tag LOCUS_27440 14022 12454 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539579.1 protein_id gnl|my_center|LOCUS_27440 15117 14119 gene locus_tag LOCUS_27450 15117 14119 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_27450 16113 15157 gene locus_tag LOCUS_27460 16113 15157 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 protein_id gnl|my_center|LOCUS_27460 17045 16110 gene locus_tag LOCUS_27470 17045 16110 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence078 <1 1159 gene locus_tag LOCUS_27480 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037005.1:ferrous iron transporter B 1165 1410 gene locus_tag LOCUS_27490 1165 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 2067 1510 gene locus_tag LOCUS_27500 2067 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098290.1 protein_id gnl|my_center|LOCUS_27500 3058 2129 gene locus_tag LOCUS_27510 gene argF 3058 2129 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 protein_id gnl|my_center|LOCUS_27510 4254 3055 gene locus_tag LOCUS_27520 4254 3055 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064106.1 protein_id gnl|my_center|LOCUS_27520 4776 5123 gene locus_tag LOCUS_27530 4776 5123 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 protein_id gnl|my_center|LOCUS_27530 5384 6409 gene locus_tag LOCUS_27540 5384 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 6612 7976 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaacccacacgcccacacggggcgtgac 8827 8189 gene locus_tag LOCUS_27550 gene nth 8827 8189 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405450.1 protein_id gnl|my_center|LOCUS_27550 9020 9418 gene locus_tag LOCUS_27560 9020 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 9778 10974 gene locus_tag LOCUS_27570 gene lysN 9778 10974 CDS product 2-aminoadipate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227918.1 protein_id gnl|my_center|LOCUS_27570 11050 11274 gene locus_tag LOCUS_27580 11050 11274 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809188.1 protein_id gnl|my_center|LOCUS_27580 11392 11781 gene locus_tag LOCUS_27590 11392 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 13226 11844 gene locus_tag LOCUS_27600 13226 11844 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035678.1 protein_id gnl|my_center|LOCUS_27600 13418 13783 gene locus_tag LOCUS_27610 13418 13783 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 protein_id gnl|my_center|LOCUS_27610 13792 14025 gene locus_tag LOCUS_27620 13792 14025 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341842.1 protein_id gnl|my_center|LOCUS_27620 14505 14059 gene locus_tag LOCUS_27630 14505 14059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 15410 14502 gene locus_tag LOCUS_27640 15410 14502 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971259.1 protein_id gnl|my_center|LOCUS_27640 15454 16131 gene locus_tag LOCUS_27650 gene lysE 15454 16131 CDS product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409989.1 protein_id gnl|my_center|LOCUS_27650 16222 16557 gene locus_tag LOCUS_27660 16222 16557 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425060.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence079 3388 3600 gene locus_tag LOCUS_27670 gene rpsU 3388 3600 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_27670 3842 4288 gene locus_tag LOCUS_27680 3842 4288 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_27680 5057 4374 gene locus_tag LOCUS_27690 5057 4374 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 protein_id gnl|my_center|LOCUS_27690 5797 5105 gene locus_tag LOCUS_27700 5797 5105 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529578.1 protein_id gnl|my_center|LOCUS_27700 6747 5830 gene locus_tag LOCUS_27710 6747 5830 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815222.1 protein_id gnl|my_center|LOCUS_27710 6899 7993 gene locus_tag LOCUS_27720 6899 7993 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815224.1 protein_id gnl|my_center|LOCUS_27720 8097 9146 gene locus_tag LOCUS_27730 8097 9146 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_27730 9782 9159 gene locus_tag LOCUS_27740 9782 9159 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812310.1 protein_id gnl|my_center|LOCUS_27740 9876 11348 gene locus_tag LOCUS_27750 9876 11348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267581.1 protein_id gnl|my_center|LOCUS_27750 12334 11402 gene locus_tag LOCUS_27760 12334 11402 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089777.1 protein_id gnl|my_center|LOCUS_27760 12452 13450 gene locus_tag LOCUS_27770 12452 13450 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083775.1 protein_id gnl|my_center|LOCUS_27770 13463 15004 gene locus_tag LOCUS_27780 13463 15004 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence080 1449 994 gene locus_tag LOCUS_27790 1449 994 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_27790 1771 3591 gene locus_tag LOCUS_27800 1771 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 4446 3865 gene locus_tag LOCUS_27810 gene sodB 4446 3865 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_27810 6013 4664 gene locus_tag LOCUS_27820 gene xseA 6013 4664 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522628.1 protein_id gnl|my_center|LOCUS_27820 6432 7016 gene locus_tag LOCUS_27830 6432 7016 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_27830 7058 7489 gene locus_tag LOCUS_27840 7058 7489 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 protein_id gnl|my_center|LOCUS_27840 7535 8545 gene locus_tag LOCUS_27850 gene lpxK 7535 8545 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039579.1 protein_id gnl|my_center|LOCUS_27850 8647 8832 gene locus_tag LOCUS_27860 8647 8832 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528775.1 protein_id gnl|my_center|LOCUS_27860 8829 9614 gene locus_tag LOCUS_27870 gene kdsB 8829 9614 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_27870 9790 10446 gene locus_tag LOCUS_27880 gene adk 9790 10446 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_27880 11499 10555 gene locus_tag LOCUS_27890 11499 10555 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191991.1 protein_id gnl|my_center|LOCUS_27890 11613 12287 gene locus_tag LOCUS_27900 gene lexA 11613 12287 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191638.1 protein_id gnl|my_center|LOCUS_27900 12615 13277 gene locus_tag LOCUS_27910 12615 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 <16544 13752 gene locus_tag LOCUS_27920 <16544 13752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202033.1:ATP-dependent RNA helicase HrpA note possible pseudo, internal stop codon >Feature sequence081 483 1460 gene locus_tag LOCUS_27930 483 1460 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815222.1 protein_id gnl|my_center|LOCUS_27930 2005 1559 gene locus_tag LOCUS_27940 2005 1559 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_27940 2412 2200 gene locus_tag LOCUS_27950 gene rpsU 2412 2200 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_27950 2759 5986 gene locus_tag LOCUS_27960 2759 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 7308 6046 gene locus_tag LOCUS_27970 7308 6046 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249381.1 protein_id gnl|my_center|LOCUS_27970 7413 7916 gene locus_tag LOCUS_27980 7413 7916 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 protein_id gnl|my_center|LOCUS_27980 8625 7945 gene locus_tag LOCUS_27990 8625 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 9578 8730 gene locus_tag LOCUS_28000 gene cobA 9578 8730 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087845.1 protein_id gnl|my_center|LOCUS_28000 10498 9575 gene locus_tag LOCUS_28010 gene ybiB 10498 9575 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522867.1 protein_id gnl|my_center|LOCUS_28010 13518 10657 gene locus_tag LOCUS_28020 13518 10657 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936224.1 protein_id gnl|my_center|LOCUS_28020 14894 13587 gene locus_tag LOCUS_28030 14894 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 15691 15314 gene locus_tag LOCUS_28040 15691 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence082 1042 416 gene locus_tag LOCUS_28050 1042 416 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530934.1 protein_id gnl|my_center|LOCUS_28050 2206 1118 gene locus_tag LOCUS_28060 2206 1118 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_28060 2118 3179 gene locus_tag LOCUS_28070 2118 3179 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930577.1 protein_id gnl|my_center|LOCUS_28070 3608 3258 gene locus_tag LOCUS_28080 3608 3258 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531104.1 protein_id gnl|my_center|LOCUS_28080 3861 4832 gene locus_tag LOCUS_28090 3861 4832 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931671.1 protein_id gnl|my_center|LOCUS_28090 5438 4953 gene locus_tag LOCUS_28100 5438 4953 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 protein_id gnl|my_center|LOCUS_28100 7126 5489 gene locus_tag LOCUS_28110 gene pcnB 7126 5489 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194112.1 protein_id gnl|my_center|LOCUS_28110 7821 7123 gene locus_tag LOCUS_28120 7821 7123 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_28120 8567 7869 gene locus_tag LOCUS_28130 gene hda 8567 7869 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_28130 8451 8963 gene locus_tag LOCUS_28140 8451 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 8960 10003 gene locus_tag LOCUS_28150 gene purM 8960 10003 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065013.1 protein_id gnl|my_center|LOCUS_28150 10018 11100 gene locus_tag LOCUS_28160 10018 11100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202932.1 protein_id gnl|my_center|LOCUS_28160 11245 11793 gene locus_tag LOCUS_28170 11245 11793 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970775.1 protein_id gnl|my_center|LOCUS_28170 11790 12434 gene locus_tag LOCUS_28180 11790 12434 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010430079.1 protein_id gnl|my_center|LOCUS_28180 12395 13405 gene locus_tag LOCUS_28190 12395 13405 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 protein_id gnl|my_center|LOCUS_28190 14310 13432 gene locus_tag LOCUS_28200 gene ppk2 14310 13432 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 protein_id gnl|my_center|LOCUS_28200 14503 15552 gene locus_tag LOCUS_28210 14503 15552 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202565.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence083 <1 533 gene locus_tag LOCUS_28220 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185551.1:acyl-CoA dehydrogenase family protein 672 1787 gene locus_tag LOCUS_28230 672 1787 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929935.1 protein_id gnl|my_center|LOCUS_28230 3464 1866 gene locus_tag LOCUS_28240 3464 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 5010 3727 gene locus_tag LOCUS_28250 5010 3727 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538085.1 protein_id gnl|my_center|LOCUS_28250 5562 5047 gene locus_tag LOCUS_28260 5562 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 6661 5663 gene locus_tag LOCUS_28270 6661 5663 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_28270 7453 6911 gene locus_tag LOCUS_28280 7453 6911 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_28280 7675 8715 gene locus_tag LOCUS_28290 7675 8715 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_28290 8831 11710 gene locus_tag LOCUS_28300 gene ileS 8831 11710 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541624.1 protein_id gnl|my_center|LOCUS_28300 11711 12223 gene locus_tag LOCUS_28310 gene lspA 11711 12223 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_28310 12387 13394 gene locus_tag LOCUS_28320 12387 13394 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815913.1 protein_id gnl|my_center|LOCUS_28320 13496 14497 gene locus_tag LOCUS_28330 13496 14497 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815914.1 protein_id gnl|my_center|LOCUS_28330 14494 15318 gene locus_tag LOCUS_28340 14494 15318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191802.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence084 562 1368 gene locus_tag LOCUS_28350 562 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2051 1413 gene locus_tag LOCUS_28360 2051 1413 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534111.1 protein_id gnl|my_center|LOCUS_28360 2133 5222 gene locus_tag LOCUS_28370 2133 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 7221 5236 gene locus_tag LOCUS_28380 7221 5236 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522854.1 protein_id gnl|my_center|LOCUS_28380 7357 8358 gene locus_tag LOCUS_28390 7357 8358 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_28390 8358 8945 gene locus_tag LOCUS_28400 8358 8945 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_28400 8942 9577 gene locus_tag LOCUS_28410 gene lptC 8942 9577 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815173.1 protein_id gnl|my_center|LOCUS_28410 9612 10412 gene locus_tag LOCUS_28420 9612 10412 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 protein_id gnl|my_center|LOCUS_28420 11017 10508 gene locus_tag LOCUS_28430 11017 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 11709 11311 gene locus_tag LOCUS_28440 11709 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 12207 12785 gene locus_tag LOCUS_28450 12207 12785 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 protein_id gnl|my_center|LOCUS_28450 12888 14066 gene locus_tag LOCUS_28460 12888 14066 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_28460 14063 14647 gene locus_tag LOCUS_28470 gene metW 14063 14647 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence085 541 1815 gene locus_tag LOCUS_28480 541 1815 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390598.1 protein_id gnl|my_center|LOCUS_28480 2614 1895 gene locus_tag LOCUS_28490 2614 1895 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 protein_id gnl|my_center|LOCUS_28490 3082 4602 gene locus_tag LOCUS_28500 3082 4602 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556617.1 protein_id gnl|my_center|LOCUS_28500 4838 5869 gene locus_tag LOCUS_28510 gene adhP 4838 5869 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_28510 5997 6425 gene locus_tag LOCUS_28520 5997 6425 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_28520 7411 6548 gene locus_tag LOCUS_28530 7411 6548 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035561.1 protein_id gnl|my_center|LOCUS_28530 8859 7420 gene locus_tag LOCUS_28540 gene sbcB 8859 7420 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 protein_id gnl|my_center|LOCUS_28540 8998 10290 gene locus_tag LOCUS_28550 8998 10290 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 protein_id gnl|my_center|LOCUS_28550 12773 10425 gene locus_tag LOCUS_28560 gene clpA 12773 10425 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_28560 13190 12831 gene locus_tag LOCUS_28570 gene clpS 13190 12831 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_28570 <14541 13265 gene locus_tag LOCUS_28580 <14541 13265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522462.1:DNA polymerase III subunit alpha >Feature sequence086 939 2303 gene locus_tag LOCUS_28590 939 2303 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814879.1 protein_id gnl|my_center|LOCUS_28590 2529 3614 gene locus_tag LOCUS_28600 2529 3614 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 protein_id gnl|my_center|LOCUS_28600 5098 3644 gene locus_tag LOCUS_28610 gene mdtD 5098 3644 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037970.1 protein_id gnl|my_center|LOCUS_28610 5532 5167 gene locus_tag LOCUS_28620 gene erpA 5532 5167 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_28620 5994 5593 gene locus_tag LOCUS_28630 5994 5593 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882826.1 protein_id gnl|my_center|LOCUS_28630 6748 6038 gene locus_tag LOCUS_28640 6748 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 7290 6898 gene locus_tag LOCUS_28650 gene rpsI 7290 6898 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549989.1 protein_id gnl|my_center|LOCUS_28650 7624 7301 gene locus_tag LOCUS_28660 gene rplM 7624 7301 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_28660 9836 7941 gene locus_tag LOCUS_28670 9836 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 9991 10875 gene locus_tag LOCUS_28680 gene rlmJ 9991 10875 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063881.1 protein_id gnl|my_center|LOCUS_28680 11652 10921 gene locus_tag LOCUS_28690 11652 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 12711 11839 gene locus_tag LOCUS_28700 gene metF 12711 11839 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_28700 13709 12708 gene locus_tag LOCUS_28710 13709 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence087 1243 1584 gene locus_tag LOCUS_28720 1243 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1677 2297 gene locus_tag LOCUS_28730 1677 2297 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706154.1 protein_id gnl|my_center|LOCUS_28730 3945 2347 gene locus_tag LOCUS_28740 3945 2347 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065033.1 protein_id gnl|my_center|LOCUS_28740 5255 4158 gene locus_tag LOCUS_28750 gene alr 5255 4158 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208091.1 protein_id gnl|my_center|LOCUS_28750 5398 6678 gene locus_tag LOCUS_28760 gene lplT 5398 6678 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_28760 6736 7656 gene locus_tag LOCUS_28770 6736 7656 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_28770 8626 7697 gene locus_tag LOCUS_28780 8626 7697 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931188.1 protein_id gnl|my_center|LOCUS_28780 9556 8648 gene locus_tag LOCUS_28790 9556 8648 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813030.1 protein_id gnl|my_center|LOCUS_28790 9744 10673 gene locus_tag LOCUS_28800 9744 10673 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039548.1 protein_id gnl|my_center|LOCUS_28800 10677 12851 gene locus_tag LOCUS_28810 10677 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence088 2737 2147 gene locus_tag LOCUS_28820 gene kdpC 2737 2147 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_28820 4889 2754 gene locus_tag LOCUS_28830 gene kdpB 4889 2754 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_28830 6726 4918 gene locus_tag LOCUS_28840 gene kdpA 6726 4918 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_28840 6850 6728 gene locus_tag LOCUS_28850 6850 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 6954 6820 gene locus_tag LOCUS_28860 6954 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 7344 8312 gene locus_tag LOCUS_28870 7344 8312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088986.1 protein_id gnl|my_center|LOCUS_28870 8366 9202 gene locus_tag LOCUS_28880 8366 9202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088987.1 protein_id gnl|my_center|LOCUS_28880 9379 10158 gene locus_tag LOCUS_28890 9379 10158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531158.1 protein_id gnl|my_center|LOCUS_28890 10155 10997 gene locus_tag LOCUS_28900 gene hutC 10155 10997 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161420743.1 protein_id gnl|my_center|LOCUS_28900 11124 12662 gene locus_tag LOCUS_28910 gene hutH 11124 12662 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527399.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence089 1027 2022 gene locus_tag LOCUS_28920 1027 2022 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_28920 2067 3320 gene locus_tag LOCUS_28930 2067 3320 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_28930 3408 3770 gene locus_tag LOCUS_28940 3408 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 3778 5064 gene locus_tag LOCUS_28950 3778 5064 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817012.1 protein_id gnl|my_center|LOCUS_28950 5061 5540 gene locus_tag LOCUS_28960 gene arsC 5061 5540 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459395.1 protein_id gnl|my_center|LOCUS_28960 5751 7418 gene locus_tag LOCUS_28970 5751 7418 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975714.1 protein_id gnl|my_center|LOCUS_28970 8821 7493 gene locus_tag LOCUS_28980 8821 7493 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_28980 8836 9723 gene locus_tag LOCUS_28990 8836 9723 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192042.1 protein_id gnl|my_center|LOCUS_28990 10722 9805 gene locus_tag LOCUS_29000 10722 9805 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384663.1 protein_id gnl|my_center|LOCUS_29000 11114 11776 gene locus_tag LOCUS_29010 11114 11776 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218867.1 protein_id gnl|my_center|LOCUS_29010 11846 12874 gene locus_tag LOCUS_29020 11846 12874 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence090 2577 1930 gene locus_tag LOCUS_29030 2577 1930 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 protein_id gnl|my_center|LOCUS_29030 4030 2588 gene locus_tag LOCUS_29040 4030 2588 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523251.1 protein_id gnl|my_center|LOCUS_29040 4344 4117 gene locus_tag LOCUS_29050 4344 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 4268 5215 gene locus_tag LOCUS_29060 gene ttcA 4268 5215 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_29060 5295 6026 gene locus_tag LOCUS_29070 5295 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 6036 6686 gene locus_tag LOCUS_29080 6036 6686 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_29080 7823 6759 gene locus_tag LOCUS_29090 gene ruvB 7823 6759 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931466.1 protein_id gnl|my_center|LOCUS_29090 9396 7843 gene locus_tag LOCUS_29100 9396 7843 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327973.1 protein_id gnl|my_center|LOCUS_29100 10091 9519 gene locus_tag LOCUS_29110 gene ruvA 10091 9519 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_29110 10142 11086 gene locus_tag LOCUS_29120 10142 11086 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809398.1 protein_id gnl|my_center|LOCUS_29120 11295 11753 gene locus_tag LOCUS_29130 11295 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 11818 12564 gene locus_tag LOCUS_29140 11818 12564 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071993.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence091 376 1242 gene locus_tag LOCUS_29150 376 1242 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268115.1 protein_id gnl|my_center|LOCUS_29150 1306 1965 gene locus_tag LOCUS_29160 1306 1965 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400760.1 protein_id gnl|my_center|LOCUS_29160 2105 3052 gene locus_tag LOCUS_29170 2105 3052 CDS product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275299.1 protein_id gnl|my_center|LOCUS_29170 3116 3424 gene locus_tag LOCUS_29180 3116 3424 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_29180 3950 3483 gene locus_tag LOCUS_29190 3950 3483 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 protein_id gnl|my_center|LOCUS_29190 4055 6745 gene locus_tag LOCUS_29200 gene mdeB 4055 6745 CDS product alpha-ketoglutarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040186.1 protein_id gnl|my_center|LOCUS_29200 7710 6847 gene locus_tag LOCUS_29210 7710 6847 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_29210 8515 7715 gene locus_tag LOCUS_29220 8515 7715 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064171.1 protein_id gnl|my_center|LOCUS_29220 9181 8675 gene locus_tag LOCUS_29230 9181 8675 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_29230 9884 9303 gene locus_tag LOCUS_29240 9884 9303 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792177.1 protein_id gnl|my_center|LOCUS_29240 11242 9881 gene locus_tag LOCUS_29250 11242 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 <12152 11270 gene locus_tag LOCUS_29260 <12152 11270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195907.1:tetratricopeptide repeat protein >Feature sequence092 <1 1697 gene locus_tag LOCUS_29270 <1 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189629.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein 1717 2232 gene locus_tag LOCUS_29280 1717 2232 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122604.1 protein_id gnl|my_center|LOCUS_29280 2310 3509 gene locus_tag LOCUS_29290 2310 3509 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537877.1 protein_id gnl|my_center|LOCUS_29290 3711 4541 gene locus_tag LOCUS_29300 3711 4541 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892000.1 protein_id gnl|my_center|LOCUS_29300 4588 5397 gene locus_tag LOCUS_29310 4588 5397 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_29310 5675 6259 gene locus_tag LOCUS_29320 5675 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 6873 6397 gene locus_tag LOCUS_29330 6873 6397 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 protein_id gnl|my_center|LOCUS_29330 6906 8756 gene locus_tag LOCUS_29340 6906 8756 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_29340 8841 9161 gene locus_tag LOCUS_29350 8841 9161 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_29350 10261 9221 gene locus_tag LOCUS_29360 10261 9221 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 protein_id gnl|my_center|LOCUS_29360 <10947 10298 gene locus_tag LOCUS_29370 <10947 10298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812401.1:TRAP transporter large permease >Feature sequence093 407 565 gene locus_tag LOCUS_29380 407 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 816 1703 gene locus_tag LOCUS_29390 816 1703 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_29390 1717 2091 gene locus_tag LOCUS_29400 1717 2091 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_29400 2078 2485 gene locus_tag LOCUS_29410 2078 2485 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 protein_id gnl|my_center|LOCUS_29410 2476 3489 gene locus_tag LOCUS_29420 2476 3489 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 protein_id gnl|my_center|LOCUS_29420 3486 4487 gene locus_tag LOCUS_29430 3486 4487 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036372.1 protein_id gnl|my_center|LOCUS_29430 4487 6463 gene locus_tag LOCUS_29440 4487 6463 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 protein_id gnl|my_center|LOCUS_29440 8011 6608 gene locus_tag LOCUS_29450 gene cycA 8011 6608 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038625.1 protein_id gnl|my_center|LOCUS_29450 9295 8396 gene locus_tag LOCUS_29460 9295 8396 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065109.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence094 362 1696 gene locus_tag LOCUS_29470 362 1696 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728821.1 protein_id gnl|my_center|LOCUS_29470 1700 2650 gene locus_tag LOCUS_29480 1700 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 2637 3515 gene locus_tag LOCUS_29490 2637 3515 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 protein_id gnl|my_center|LOCUS_29490 3536 4624 gene locus_tag LOCUS_29500 gene ugpC 3536 4624 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396370.1 protein_id gnl|my_center|LOCUS_29500 5789 4683 gene locus_tag LOCUS_29510 5789 4683 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_29510 5889 6770 gene locus_tag LOCUS_29520 5889 6770 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139980.1 protein_id gnl|my_center|LOCUS_29520 6767 7177 gene locus_tag LOCUS_29530 6767 7177 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 protein_id gnl|my_center|LOCUS_29530 7174 7545 gene locus_tag LOCUS_29540 7174 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 8621 7614 gene locus_tag LOCUS_29550 8621 7614 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094782.1 protein_id gnl|my_center|LOCUS_29550 8726 9694 gene locus_tag LOCUS_29560 8726 9694 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094781.1 protein_id gnl|my_center|LOCUS_29560 10066 9815 gene locus_tag LOCUS_29570 10066 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence095 1494 2801 gene locus_tag LOCUS_29580 1494 2801 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_29580 3262 2822 gene locus_tag LOCUS_29590 3262 2822 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367081.1 protein_id gnl|my_center|LOCUS_29590 3391 3999 gene locus_tag LOCUS_29600 3391 3999 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113789.1 protein_id gnl|my_center|LOCUS_29600 4708 4130 gene locus_tag LOCUS_29610 4708 4130 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217107.1 protein_id gnl|my_center|LOCUS_29610 5360 4782 gene locus_tag LOCUS_29620 5360 4782 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 protein_id gnl|my_center|LOCUS_29620 5983 5426 gene locus_tag LOCUS_29630 5983 5426 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_29630 6331 6834 gene locus_tag LOCUS_29640 6331 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420254.1 protein_id gnl|my_center|LOCUS_29640 8629 6893 gene locus_tag LOCUS_29650 8629 6893 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105457.1 protein_id gnl|my_center|LOCUS_29650 10227 8635 gene locus_tag LOCUS_29660 10227 8635 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266442.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence096 1679 288 gene locus_tag LOCUS_29670 1679 288 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816312.1 protein_id gnl|my_center|LOCUS_29670 2274 1786 gene locus_tag LOCUS_29680 2274 1786 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261711.1 protein_id gnl|my_center|LOCUS_29680 4312 2390 gene locus_tag LOCUS_29690 4312 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29690 4758 4549 gene locus_tag LOCUS_29700 4758 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 4945 5199 gene locus_tag LOCUS_29710 4945 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 5747 5400 gene locus_tag LOCUS_29720 5747 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 6792 5791 gene locus_tag LOCUS_29730 6792 5791 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195540.1 protein_id gnl|my_center|LOCUS_29730 6953 8329 gene locus_tag LOCUS_29740 6953 8329 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557408.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence097 2274 703 gene locus_tag LOCUS_29750 gene adeC 2274 703 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153304094.1 protein_id gnl|my_center|LOCUS_29750 5465 2271 gene locus_tag LOCUS_29760 5465 2271 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268045.1 protein_id gnl|my_center|LOCUS_29760 6837 5482 gene locus_tag LOCUS_29770 6837 5482 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_29770 7026 8495 gene locus_tag LOCUS_29780 gene baeS 7026 8495 CDS product sensor histidine kinase efflux regulator BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400907.1 protein_id gnl|my_center|LOCUS_29780 8492 9220 gene locus_tag LOCUS_29790 gene baeR 8492 9220 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137877.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence098 <1 760 gene locus_tag LOCUS_29800 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205379.1:PAS domain-containing methyl-accepting chemotaxis protein 2505 904 gene locus_tag LOCUS_29810 2505 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3145 2849 gene locus_tag LOCUS_29820 3145 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 4777 3212 gene locus_tag LOCUS_29830 4777 3212 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813155.1 protein_id gnl|my_center|LOCUS_29830 6025 4796 gene locus_tag LOCUS_29840 6025 4796 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930844.1 protein_id gnl|my_center|LOCUS_29840 7708 6119 gene locus_tag LOCUS_29850 7708 6119 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388615.1 protein_id gnl|my_center|LOCUS_29850 8267 7755 gene locus_tag LOCUS_29860 8267 7755 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813149.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence099 214 1128 gene locus_tag LOCUS_29870 214 1128 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110400.1 protein_id gnl|my_center|LOCUS_29870 1302 1715 gene locus_tag LOCUS_29880 1302 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1935 4454 gene locus_tag LOCUS_29890 1935 4454 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114236.1 protein_id gnl|my_center|LOCUS_29890 6830 4392 gene locus_tag LOCUS_29900 6830 4392 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence100 784 1869 gene locus_tag LOCUS_29910 gene mnmA 784 1869 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 protein_id gnl|my_center|LOCUS_29910 2216 3877 gene locus_tag LOCUS_29920 2216 3877 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_29920 4795 3899 gene locus_tag LOCUS_29930 4795 3899 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930623.1 protein_id gnl|my_center|LOCUS_29930 4899 5939 gene locus_tag LOCUS_29940 4899 5939 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence101 375 172 gene locus_tag LOCUS_29950 375 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 349 555 gene locus_tag LOCUS_29960 349 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 1094 621 gene locus_tag LOCUS_29970 1094 621 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 protein_id gnl|my_center|LOCUS_29970 1200 3980 gene locus_tag LOCUS_29980 gene mdeB 1200 3980 CDS product alpha-ketoglutarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187349.1 protein_id gnl|my_center|LOCUS_29980 4911 4000 gene locus_tag LOCUS_29990 4911 4000 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089777.1 protein_id gnl|my_center|LOCUS_29990 5071 6066 gene locus_tag LOCUS_30000 5071 6066 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039786.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence102 1252 308 gene locus_tag LOCUS_30010 1252 308 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_30010 1348 2295 gene locus_tag LOCUS_30020 1348 2295 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816572.1 protein_id gnl|my_center|LOCUS_30020 2668 2321 gene locus_tag LOCUS_30030 2668 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3186 4427 gene locus_tag LOCUS_30040 3186 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040