>Feature sequence01 <1 698 gene locus_tag LOCUS_00010 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206932.1:3-oxoadipyl-CoA thiolase 784 1563 gene locus_tag LOCUS_00020 gene pcaD 784 1563 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206900.1 protein_id gnl|my_center|LOCUS_00020 3510 1828 gene locus_tag LOCUS_00030 3510 1828 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_00030 3927 4217 gene locus_tag LOCUS_00040 3927 4217 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206219.1 protein_id gnl|my_center|LOCUS_00040 4236 5237 gene locus_tag LOCUS_00050 4236 5237 CDS product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 protein_id gnl|my_center|LOCUS_00050 5250 5519 gene locus_tag LOCUS_00060 5250 5519 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_00060 5589 7115 gene locus_tag LOCUS_00070 5589 7115 CDS product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_00070 7211 7573 gene locus_tag LOCUS_00080 7211 7573 CDS product phenol hydroxylase subunit P4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 protein_id gnl|my_center|LOCUS_00080 7585 8646 gene locus_tag LOCUS_00090 7585 8646 CDS product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 protein_id gnl|my_center|LOCUS_00090 8750 9670 gene locus_tag LOCUS_00100 gene catA 8750 9670 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113693.1 protein_id gnl|my_center|LOCUS_00100 9767 10648 gene locus_tag LOCUS_00110 9767 10648 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206215.1 protein_id gnl|my_center|LOCUS_00110 10848 11261 gene locus_tag LOCUS_00120 10848 11261 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206884.1 protein_id gnl|my_center|LOCUS_00120 11351 12157 gene locus_tag LOCUS_00130 11351 12157 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114389.1 protein_id gnl|my_center|LOCUS_00130 13363 12296 gene locus_tag LOCUS_00140 13363 12296 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_00140 14606 13365 gene locus_tag LOCUS_00150 14606 13365 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206886.1 protein_id gnl|my_center|LOCUS_00150 14924 17161 gene locus_tag LOCUS_00160 gene fpvA 14924 17161 CDS product ferripyoverdine/pyocin S3 receptor FpvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349900.1 protein_id gnl|my_center|LOCUS_00160 18496 17270 gene locus_tag LOCUS_00170 gene zigA 18496 17270 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_00170 18909 18505 gene locus_tag LOCUS_00180 18909 18505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19478 18912 gene locus_tag LOCUS_00190 19478 18912 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207984.1 protein_id gnl|my_center|LOCUS_00190 20404 20961 gene locus_tag LOCUS_00200 gene fimA 20404 20961 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095930.1 protein_id gnl|my_center|LOCUS_00200 21016 21495 gene locus_tag LOCUS_00210 21016 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21515 22216 gene locus_tag LOCUS_00220 gene fimC 21515 22216 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764009.1 protein_id gnl|my_center|LOCUS_00220 22221 24827 gene locus_tag LOCUS_00230 22221 24827 CDS product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095933.1 protein_id gnl|my_center|LOCUS_00230 24841 25851 gene locus_tag LOCUS_00240 gene fimH 24841 25851 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708646.1 protein_id gnl|my_center|LOCUS_00240 26131 27045 gene locus_tag LOCUS_00250 gene fimH 26131 27045 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095934.1 protein_id gnl|my_center|LOCUS_00250 27055 27597 gene locus_tag LOCUS_00260 gene sfmF 27055 27597 CDS product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095935.1 protein_id gnl|my_center|LOCUS_00260 27876 28898 gene locus_tag LOCUS_00270 27876 28898 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_00270 29421 29624 gene locus_tag LOCUS_00280 29421 29624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30173 30724 gene locus_tag LOCUS_00290 gene fimA 30173 30724 CDS product type 1 fimbrial protein subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681037.1 protein_id gnl|my_center|LOCUS_00290 30795 31274 gene locus_tag LOCUS_00300 30795 31274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31294 31995 gene locus_tag LOCUS_00310 gene fimC 31294 31995 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095932.1 protein_id gnl|my_center|LOCUS_00310 32001 34619 gene locus_tag LOCUS_00320 32001 34619 CDS product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095933.1 protein_id gnl|my_center|LOCUS_00320 34631 35641 gene locus_tag LOCUS_00330 gene fimH 34631 35641 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708646.1 protein_id gnl|my_center|LOCUS_00330 35657 36205 gene locus_tag LOCUS_00340 gene sfmF 35657 36205 CDS product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095935.1 protein_id gnl|my_center|LOCUS_00340 36451 37482 gene locus_tag LOCUS_00350 36451 37482 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 protein_id gnl|my_center|LOCUS_00350 37509 37835 gene locus_tag LOCUS_00360 37509 37835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38875 37919 gene locus_tag LOCUS_00370 38875 37919 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205962.1 protein_id gnl|my_center|LOCUS_00370 40432 38981 gene locus_tag LOCUS_00380 40432 38981 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205961.1 protein_id gnl|my_center|LOCUS_00380 41611 40496 gene locus_tag LOCUS_00390 41611 40496 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120432.1 protein_id gnl|my_center|LOCUS_00390 42631 41678 gene locus_tag LOCUS_00400 42631 41678 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205960.1 protein_id gnl|my_center|LOCUS_00400 44277 42628 gene locus_tag LOCUS_00410 44277 42628 CDS product BCCT family carnitine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120258.1 protein_id gnl|my_center|LOCUS_00410 45433 44321 gene locus_tag LOCUS_00420 45433 44321 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205959.1 protein_id gnl|my_center|LOCUS_00420 45534 46514 gene locus_tag LOCUS_00430 45534 46514 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205958.1 protein_id gnl|my_center|LOCUS_00430 46593 47426 gene locus_tag LOCUS_00440 46593 47426 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 protein_id gnl|my_center|LOCUS_00440 48732 47548 gene locus_tag LOCUS_00450 48732 47548 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205957.1 protein_id gnl|my_center|LOCUS_00450 49667 49125 gene locus_tag LOCUS_00460 49667 49125 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617693.1 protein_id gnl|my_center|LOCUS_00460 51213 50155 gene locus_tag LOCUS_00470 51213 50155 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206671.1 protein_id gnl|my_center|LOCUS_00470 52121 51336 gene locus_tag LOCUS_00480 52121 51336 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206670.1 protein_id gnl|my_center|LOCUS_00480 53533 52133 gene locus_tag LOCUS_00490 gene lpdA 53533 52133 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206669.1 protein_id gnl|my_center|LOCUS_00490 55109 53544 gene locus_tag LOCUS_00500 55109 53544 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206668.1 protein_id gnl|my_center|LOCUS_00500 56130 55111 gene locus_tag LOCUS_00510 56130 55111 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792520.1 protein_id gnl|my_center|LOCUS_00510 57108 56146 gene locus_tag LOCUS_00520 57108 56146 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 protein_id gnl|my_center|LOCUS_00520 57470 58462 gene locus_tag LOCUS_00530 gene lipA 57470 58462 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206667.1 protein_id gnl|my_center|LOCUS_00530 58712 59809 gene locus_tag LOCUS_00540 58712 59809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069347.1 protein_id gnl|my_center|LOCUS_00540 61304 59826 gene locus_tag LOCUS_00550 61304 59826 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206378.1 protein_id gnl|my_center|LOCUS_00550 61468 62658 gene locus_tag LOCUS_00560 61468 62658 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388899.1 protein_id gnl|my_center|LOCUS_00560 62893 63348 gene locus_tag LOCUS_00570 62893 63348 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206377.1 protein_id gnl|my_center|LOCUS_00570 64975 63905 gene locus_tag LOCUS_00580 gene adeS 64975 63905 CDS product two-component sensor histidine kinase AdeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206730.1 protein_id gnl|my_center|LOCUS_00580 65122 65385 gene locus_tag LOCUS_00590 65122 65385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 66147 65401 gene locus_tag LOCUS_00600 gene adeR 66147 65401 CDS product efflux system response regulator transcription factor AdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113657.1 protein_id gnl|my_center|LOCUS_00600 66294 67481 gene locus_tag LOCUS_00610 66294 67481 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206729.1 protein_id gnl|my_center|LOCUS_00610 67481 70603 gene locus_tag LOCUS_00620 67481 70603 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206728.1 protein_id gnl|my_center|LOCUS_00620 70632 72095 gene locus_tag LOCUS_00630 gene adeK 70632 72095 CDS product multidrug efflux RND transporter outer membrane channel subunit AdeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_00630 72412 73563 gene locus_tag LOCUS_00640 72412 73563 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208088.1 protein_id gnl|my_center|LOCUS_00640 74617 73673 gene locus_tag LOCUS_00650 74617 73673 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206473.1 protein_id gnl|my_center|LOCUS_00650 74707 75348 gene locus_tag LOCUS_00660 74707 75348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816571.1 protein_id gnl|my_center|LOCUS_00660 76252 75656 gene locus_tag LOCUS_00670 76252 75656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 77880 76573 gene locus_tag LOCUS_00680 gene ptsJ 77880 76573 CDS product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703133.1 protein_id gnl|my_center|LOCUS_00680 78598 77900 gene locus_tag LOCUS_00690 78598 77900 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207090.1 protein_id gnl|my_center|LOCUS_00690 79785 78604 gene locus_tag LOCUS_00700 79785 78604 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104111.1 protein_id gnl|my_center|LOCUS_00700 80042 79782 gene locus_tag LOCUS_00710 80042 79782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 80786 80049 gene locus_tag LOCUS_00720 80786 80049 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_00720 81953 80973 gene locus_tag LOCUS_00730 81953 80973 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208028.1 protein_id gnl|my_center|LOCUS_00730 83590 82073 gene locus_tag LOCUS_00740 83590 82073 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_00740 84816 84208 gene locus_tag LOCUS_00750 84816 84208 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060343.1 protein_id gnl|my_center|LOCUS_00750 85489 84851 gene locus_tag LOCUS_00760 85489 84851 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206488.1 protein_id gnl|my_center|LOCUS_00760 85621 87123 gene locus_tag LOCUS_00770 85621 87123 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206487.1 protein_id gnl|my_center|LOCUS_00770 87634 87248 gene locus_tag LOCUS_00780 87634 87248 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_00780 89088 87631 gene locus_tag LOCUS_00790 89088 87631 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206416.1 protein_id gnl|my_center|LOCUS_00790 90403 89231 gene locus_tag LOCUS_00800 90403 89231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206415.1 protein_id gnl|my_center|LOCUS_00800 91830 90436 gene locus_tag LOCUS_00810 91830 90436 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076659.1 protein_id gnl|my_center|LOCUS_00810 93668 92199 gene locus_tag LOCUS_00820 93668 92199 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206413.1 protein_id gnl|my_center|LOCUS_00820 94717 93680 gene locus_tag LOCUS_00830 94717 93680 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212559.1 protein_id gnl|my_center|LOCUS_00830 95652 94720 gene locus_tag LOCUS_00840 95652 94720 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206412.1 protein_id gnl|my_center|LOCUS_00840 96468 95677 gene locus_tag LOCUS_00850 96468 95677 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206411.1 protein_id gnl|my_center|LOCUS_00850 97039 96437 gene locus_tag LOCUS_00860 97039 96437 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420415.1 protein_id gnl|my_center|LOCUS_00860 97188 97850 gene locus_tag LOCUS_00870 97188 97850 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049494.1 protein_id gnl|my_center|LOCUS_00870 97898 98185 gene locus_tag LOCUS_00880 97898 98185 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206410.1 protein_id gnl|my_center|LOCUS_00880 100543 98315 gene locus_tag LOCUS_00890 100543 98315 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207286.1 protein_id gnl|my_center|LOCUS_00890 101670 100684 gene locus_tag LOCUS_00900 gene bauB 101670 100684 CDS product siderophore-binding periplasmic lipoprotein BauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207287.1 protein_id gnl|my_center|LOCUS_00900 102445 101675 gene locus_tag LOCUS_00910 gene bauE 102445 101675 CDS product ferric acinetobactin ABC transporter ATP-binding protein BauE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582117.1 protein_id gnl|my_center|LOCUS_00910 103389 102442 gene locus_tag LOCUS_00920 gene bauC 103389 102442 CDS product ferric acinetobactin ABC transporter permease subunit BauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207288.1 protein_id gnl|my_center|LOCUS_00920 104330 103389 gene locus_tag LOCUS_00930 gene bauD 104330 103389 CDS product ferric acinetobactin ABC transporter permease subunit BauD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207289.1 protein_id gnl|my_center|LOCUS_00930 106099 104321 gene locus_tag LOCUS_00940 106099 104321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031834.1 protein_id gnl|my_center|LOCUS_00940 107898 106093 gene locus_tag LOCUS_00950 107898 106093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485997.1 protein_id gnl|my_center|LOCUS_00950 108168 108713 gene locus_tag LOCUS_00960 108168 108713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 109702 108857 gene locus_tag LOCUS_00970 109702 108857 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207292.1 protein_id gnl|my_center|LOCUS_00970 110362 109895 gene locus_tag LOCUS_00980 gene soxR 110362 109895 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206380.1 protein_id gnl|my_center|LOCUS_00980 110685 111113 gene locus_tag LOCUS_00990 gene mexG 110685 111113 CDS product multidrug efflux RND transporter inhibitory subunit MexG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093607.1 protein_id gnl|my_center|LOCUS_00990 111110 112210 gene locus_tag LOCUS_01000 gene mexH 111110 112210 CDS product multidrug efflux RND transporter periplasmic adaptor MexH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104731.1 protein_id gnl|my_center|LOCUS_01000 112223 115303 gene locus_tag LOCUS_01010 gene mexI 112223 115303 CDS product multidrug efflux RND transporter permease MexI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114727.1 protein_id gnl|my_center|LOCUS_01010 116307 115666 gene locus_tag LOCUS_01020 116307 115666 CDS product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112485.1 protein_id gnl|my_center|LOCUS_01020 116289 116531 gene locus_tag LOCUS_01030 116289 116531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 117397 116528 gene locus_tag LOCUS_01040 gene hchA 117397 116528 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207522.1 protein_id gnl|my_center|LOCUS_01040 117729 118124 gene locus_tag LOCUS_01050 117729 118124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01050 118072 118542 gene locus_tag LOCUS_01060 118072 118542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01060 119576 118716 gene locus_tag LOCUS_01070 119576 118716 CDS product Vmh family MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705499.1 protein_id gnl|my_center|LOCUS_01070 120258 119581 gene locus_tag LOCUS_01080 120258 119581 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816993.1 protein_id gnl|my_center|LOCUS_01080 120462 120734 gene locus_tag LOCUS_01090 120462 120734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 122235 121021 gene locus_tag LOCUS_01100 gene pobA 122235 121021 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114537.1 protein_id gnl|my_center|LOCUS_01100 122369 123178 gene locus_tag LOCUS_01110 gene pobR 122369 123178 CDS product IclR family transcriptional regulator PobR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206420.1 protein_id gnl|my_center|LOCUS_01110 123469 125679 gene locus_tag LOCUS_01120 gene tdfF 123469 125679 CDS product TonB-dependent iron piracy receptor TdfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225792.1 protein_id gnl|my_center|LOCUS_01120 125890 126906 gene locus_tag LOCUS_01130 125890 126906 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_01130 127761 129446 gene locus_tag LOCUS_01140 gene aspT 127761 129446 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068377.1 protein_id gnl|my_center|LOCUS_01140 129501 131102 gene locus_tag LOCUS_01150 129501 131102 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073522.1 protein_id gnl|my_center|LOCUS_01150 131698 131237 gene locus_tag LOCUS_01160 131698 131237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 134012 131952 gene locus_tag LOCUS_01170 134012 131952 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070759.1 protein_id gnl|my_center|LOCUS_01170 135852 135148 gene locus_tag LOCUS_01180 gene arsH 135852 135148 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087170.1 protein_id gnl|my_center|LOCUS_01180 136901 135858 gene locus_tag LOCUS_01190 gene arsB 136901 135858 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206515.1 protein_id gnl|my_center|LOCUS_01190 137382 136909 gene locus_tag LOCUS_01200 137382 136909 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112098.1 protein_id gnl|my_center|LOCUS_01200 137709 137389 gene locus_tag LOCUS_01210 137709 137389 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206514.1 protein_id gnl|my_center|LOCUS_01210 138202 137768 gene locus_tag LOCUS_01220 gene arsC 138202 137768 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706113.1 protein_id gnl|my_center|LOCUS_01220 138654 139217 gene locus_tag LOCUS_01230 138654 139217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 139518 139333 gene locus_tag LOCUS_01240 139518 139333 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206318.1 protein_id gnl|my_center|LOCUS_01240 140132 139512 gene locus_tag LOCUS_01250 140132 139512 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_01250 140887 140129 gene locus_tag LOCUS_01260 140887 140129 CDS product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206316.1 protein_id gnl|my_center|LOCUS_01260 141701 140838 gene locus_tag LOCUS_01270 141701 140838 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206315.1 protein_id gnl|my_center|LOCUS_01270 142080 141772 gene locus_tag LOCUS_01280 142080 141772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122109.1 protein_id gnl|my_center|LOCUS_01280 142356 142844 gene locus_tag LOCUS_01290 142356 142844 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206314.1 protein_id gnl|my_center|LOCUS_01290 143586 144425 gene locus_tag LOCUS_01300 143586 144425 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_01300 145792 144695 gene locus_tag LOCUS_01310 145792 144695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193049.1 protein_id gnl|my_center|LOCUS_01310 146415 145966 gene locus_tag LOCUS_01320 146415 145966 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081832.1 protein_id gnl|my_center|LOCUS_01320 147289 146435 gene locus_tag LOCUS_01330 147289 146435 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_01330 147485 148153 gene locus_tag LOCUS_01340 147485 148153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 148537 150627 gene locus_tag LOCUS_01350 148537 150627 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208087.1 protein_id gnl|my_center|LOCUS_01350 150827 152167 gene locus_tag LOCUS_01360 150827 152167 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206829.1 protein_id gnl|my_center|LOCUS_01360 152462 152208 gene locus_tag LOCUS_01370 152462 152208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 154807 152702 gene locus_tag LOCUS_01380 154807 152702 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208087.1 protein_id gnl|my_center|LOCUS_01380 157126 154847 gene locus_tag LOCUS_01390 157126 154847 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114901.1 protein_id gnl|my_center|LOCUS_01390 157609 157199 gene locus_tag LOCUS_01400 157609 157199 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114087.1 protein_id gnl|my_center|LOCUS_01400 158547 157855 gene locus_tag LOCUS_01410 158547 157855 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763967.1 protein_id gnl|my_center|LOCUS_01410 162153 158551 gene locus_tag LOCUS_01420 gene uca 162153 158551 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 protein_id gnl|my_center|LOCUS_01420 164000 162168 gene locus_tag LOCUS_01430 gene atzF 164000 162168 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_01430 164898 168086 gene locus_tag LOCUS_01440 164898 168086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 168368 168138 gene locus_tag LOCUS_01450 168368 168138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 169385 168450 gene locus_tag LOCUS_01460 169385 168450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 protein_id gnl|my_center|LOCUS_01460 170558 169497 gene locus_tag LOCUS_01470 170558 169497 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_01470 170806 170618 gene locus_tag LOCUS_01480 170806 170618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 171771 170740 gene locus_tag LOCUS_01490 171771 170740 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_01490 172650 171928 gene locus_tag LOCUS_01500 172650 171928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 172649 172864 gene locus_tag LOCUS_01510 172649 172864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 173836 174090 gene locus_tag LOCUS_01520 173836 174090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 174222 174446 gene locus_tag LOCUS_01530 174222 174446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 174480 174926 gene locus_tag LOCUS_01540 174480 174926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 175206 175799 gene locus_tag LOCUS_01550 175206 175799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 177270 176401 gene locus_tag LOCUS_01560 177270 176401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 177856 178788 gene locus_tag LOCUS_01570 177856 178788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 180102 178960 gene locus_tag LOCUS_01580 180102 178960 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703417.1 protein_id gnl|my_center|LOCUS_01580 180644 180286 gene locus_tag LOCUS_tm00010 180644 180286 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 180775 182256 gene locus_tag LOCUS_01590 gene glpK 180775 182256 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_01590 182799 182320 gene locus_tag LOCUS_01600 gene def 182799 182320 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206042.1 protein_id gnl|my_center|LOCUS_01600 183004 183207 gene locus_tag LOCUS_01610 183004 183207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 183368 184642 gene locus_tag LOCUS_01620 183368 184642 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206041.1 protein_id gnl|my_center|LOCUS_01620 185751 184639 gene locus_tag LOCUS_01630 185751 184639 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207939.1 protein_id gnl|my_center|LOCUS_01630 186894 186613 gene locus_tag LOCUS_01640 186894 186613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206029.1 protein_id gnl|my_center|LOCUS_01640 187496 186912 gene locus_tag LOCUS_01650 gene pnuC 187496 186912 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206028.1 protein_id gnl|my_center|LOCUS_01650 188600 189160 gene locus_tag LOCUS_01660 188600 189160 CDS product YqiJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071585.1 protein_id gnl|my_center|LOCUS_01660 189191 190897 gene locus_tag LOCUS_01670 189191 190897 CDS product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 protein_id gnl|my_center|LOCUS_01670 191117 191848 gene locus_tag LOCUS_01680 191117 191848 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930779.1 protein_id gnl|my_center|LOCUS_01680 193740 192136 gene locus_tag LOCUS_01690 193740 192136 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206021.1 protein_id gnl|my_center|LOCUS_01690 193998 194621 gene locus_tag LOCUS_01700 gene betI 193998 194621 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206020.1 protein_id gnl|my_center|LOCUS_01700 194614 196086 gene locus_tag LOCUS_01710 gene betB 194614 196086 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206019.1 protein_id gnl|my_center|LOCUS_01710 196177 197874 gene locus_tag LOCUS_01720 gene betA 196177 197874 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206018.1 protein_id gnl|my_center|LOCUS_01720 197936 198730 gene locus_tag LOCUS_01730 197936 198730 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206895.1 protein_id gnl|my_center|LOCUS_01730 199244 200035 gene locus_tag LOCUS_01740 199244 200035 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070982.1 protein_id gnl|my_center|LOCUS_01740 200032 200622 gene locus_tag LOCUS_01750 gene scpB 200032 200622 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120355.1 protein_id gnl|my_center|LOCUS_01750 200664 201866 gene locus_tag LOCUS_01760 200664 201866 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120431.1 protein_id gnl|my_center|LOCUS_01760 203668 201938 gene locus_tag LOCUS_01770 203668 201938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_01770 204819 203680 gene locus_tag LOCUS_01780 204819 203680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206615.1 protein_id gnl|my_center|LOCUS_01780 205763 204825 gene locus_tag LOCUS_01790 205763 204825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_01790 207787 205778 gene locus_tag LOCUS_01800 207787 205778 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_01800 209661 207856 gene locus_tag LOCUS_01810 209661 207856 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_01810 211467 209683 gene locus_tag LOCUS_01820 211467 209683 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 protein_id gnl|my_center|LOCUS_01820 212230 214905 gene locus_tag LOCUS_01830 212230 214905 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_01830 215050 215754 gene locus_tag LOCUS_01840 215050 215754 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206609.1 protein_id gnl|my_center|LOCUS_01840 215776 216636 gene locus_tag LOCUS_01850 215776 216636 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206608.1 protein_id gnl|my_center|LOCUS_01850 216664 217089 gene locus_tag LOCUS_01860 216664 217089 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_01860 217110 217523 gene locus_tag LOCUS_01870 217110 217523 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206607.1 protein_id gnl|my_center|LOCUS_01870 218073 217615 gene locus_tag LOCUS_01880 218073 217615 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330815.1 protein_id gnl|my_center|LOCUS_01880 218474 218130 gene locus_tag LOCUS_01890 218474 218130 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 protein_id gnl|my_center|LOCUS_01890 218928 218569 gene locus_tag LOCUS_01900 218928 218569 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207564.1 protein_id gnl|my_center|LOCUS_01900 219402 218956 gene locus_tag LOCUS_01910 219402 218956 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_01910 219923 219543 gene locus_tag LOCUS_01920 219923 219543 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079563.1 protein_id gnl|my_center|LOCUS_01920 220140 220886 gene locus_tag LOCUS_01930 220140 220886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 223083 220957 gene locus_tag LOCUS_01940 223083 220957 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_01940 224352 223087 gene locus_tag LOCUS_01950 224352 223087 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696697.1 protein_id gnl|my_center|LOCUS_01950 225509 224361 gene locus_tag LOCUS_01960 225509 224361 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225636.1 protein_id gnl|my_center|LOCUS_01960 226012 225797 gene locus_tag LOCUS_01970 226012 225797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 226266 226051 gene locus_tag LOCUS_01980 226266 226051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 226823 226452 gene locus_tag LOCUS_01990 226823 226452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 227165 226989 gene locus_tag LOCUS_02000 227165 226989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 227437 227222 gene locus_tag LOCUS_02010 227437 227222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 229567 228557 gene locus_tag LOCUS_02020 229567 228557 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 protein_id gnl|my_center|LOCUS_02020 229664 231292 gene locus_tag LOCUS_02030 229664 231292 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117884.1 protein_id gnl|my_center|LOCUS_02030 232350 231535 gene locus_tag LOCUS_02040 232350 231535 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065232.1 protein_id gnl|my_center|LOCUS_02040 232681 234012 gene locus_tag LOCUS_02050 gene hflX 232681 234012 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207696.1 protein_id gnl|my_center|LOCUS_02050 234056 234427 gene locus_tag LOCUS_02060 234056 234427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117849.1 protein_id gnl|my_center|LOCUS_02060 234437 235105 gene locus_tag LOCUS_02070 234437 235105 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804924.1 protein_id gnl|my_center|LOCUS_02070 235198 235641 gene locus_tag LOCUS_02080 235198 235641 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 protein_id gnl|my_center|LOCUS_02080 235719 236141 gene locus_tag LOCUS_02090 235719 236141 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 protein_id gnl|my_center|LOCUS_02090 236599 237369 gene locus_tag LOCUS_02100 236599 237369 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419670.1 protein_id gnl|my_center|LOCUS_02100 238386 237538 gene locus_tag LOCUS_02110 238386 237538 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207697.1 protein_id gnl|my_center|LOCUS_02110 239201 238389 gene locus_tag LOCUS_02120 gene rsmA 239201 238389 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349619.1 protein_id gnl|my_center|LOCUS_02120 240211 239240 gene locus_tag LOCUS_02130 gene pdxA 240211 239240 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207700.1 protein_id gnl|my_center|LOCUS_02130 241094 240786 gene locus_tag LOCUS_02140 241094 240786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 241444 241872 gene locus_tag LOCUS_02150 gene rplM 241444 241872 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117832.1 protein_id gnl|my_center|LOCUS_02150 241885 242271 gene locus_tag LOCUS_02160 gene rpsI 241885 242271 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048725.1 protein_id gnl|my_center|LOCUS_02160 242816 242343 gene locus_tag LOCUS_02170 242816 242343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 242938 243591 gene locus_tag LOCUS_02180 242938 243591 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065247.1 protein_id gnl|my_center|LOCUS_02180 243618 244058 gene locus_tag LOCUS_02190 243618 244058 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 protein_id gnl|my_center|LOCUS_02190 244074 244733 gene locus_tag LOCUS_02200 244074 244733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065252.1 protein_id gnl|my_center|LOCUS_02200 245190 246158 gene locus_tag LOCUS_02210 245190 246158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207702.1 protein_id gnl|my_center|LOCUS_02210 246173 246706 gene locus_tag LOCUS_02220 246173 246706 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_02220 246724 247137 gene locus_tag LOCUS_02230 246724 247137 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207704.1 protein_id gnl|my_center|LOCUS_02230 248030 247182 gene locus_tag LOCUS_02240 248030 247182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 249344 248643 gene locus_tag LOCUS_02250 249344 248643 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_02250 250396 249959 gene locus_tag LOCUS_02260 250396 249959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 251106 250657 gene locus_tag LOCUS_02270 251106 250657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 251688 251476 gene locus_tag LOCUS_02280 251688 251476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 252460 251879 gene locus_tag LOCUS_02290 252460 251879 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_02290 253040 252894 gene locus_tag LOCUS_02300 253040 252894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 255816 253210 gene locus_tag LOCUS_02310 gene acnD 255816 253210 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208069.1 protein_id gnl|my_center|LOCUS_02310 256055 256777 gene locus_tag LOCUS_02320 256055 256777 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207574.1 protein_id gnl|my_center|LOCUS_02320 257295 256810 gene locus_tag LOCUS_02330 257295 256810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010567719.1 protein_id gnl|my_center|LOCUS_02330 258679 257288 gene locus_tag LOCUS_02340 258679 257288 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_02340 259963 258779 gene locus_tag LOCUS_02350 259963 258779 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_02350 260152 261423 gene locus_tag LOCUS_02360 260152 261423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 261697 261452 gene locus_tag LOCUS_02370 261697 261452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 261873 262130 gene locus_tag LOCUS_02380 261873 262130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 262127 262447 gene locus_tag LOCUS_02390 262127 262447 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_02390 262719 264308 gene locus_tag LOCUS_02400 262719 264308 CDS product DKNYY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021069248.1 protein_id gnl|my_center|LOCUS_02400 264413 265120 gene locus_tag LOCUS_02410 264413 265120 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207575.1 protein_id gnl|my_center|LOCUS_02410 265347 266159 gene locus_tag LOCUS_02420 265347 266159 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207576.1 protein_id gnl|my_center|LOCUS_02420 267121 266198 gene locus_tag LOCUS_02430 267121 266198 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 protein_id gnl|my_center|LOCUS_02430 268350 267232 gene locus_tag LOCUS_02440 268350 267232 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116511.1 protein_id gnl|my_center|LOCUS_02440 270511 268370 gene locus_tag LOCUS_02450 270511 268370 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207578.1 protein_id gnl|my_center|LOCUS_02450 271843 270545 gene locus_tag LOCUS_02460 gene oprB 271843 270545 CDS product carbohydrate porin OprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116413.1 protein_id gnl|my_center|LOCUS_02460 272233 273084 gene locus_tag LOCUS_02470 gene mutM 272233 273084 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207580.1 protein_id gnl|my_center|LOCUS_02470 273081 273365 gene locus_tag LOCUS_02480 273081 273365 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207581.1 protein_id gnl|my_center|LOCUS_02480 273817 273362 gene locus_tag LOCUS_02490 273817 273362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 274150 273998 gene locus_tag LOCUS_02500 274150 273998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 274933 274292 gene locus_tag LOCUS_02510 274933 274292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 275497 275066 gene locus_tag LOCUS_02520 gene mscL 275497 275066 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207584.1 protein_id gnl|my_center|LOCUS_02520 277526 275691 gene locus_tag LOCUS_02530 gene typA 277526 275691 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 protein_id gnl|my_center|LOCUS_02530 277701 279074 gene locus_tag LOCUS_02540 277701 279074 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207585.1 protein_id gnl|my_center|LOCUS_02540 279145 280176 gene locus_tag LOCUS_02550 279145 280176 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207586.1 protein_id gnl|my_center|LOCUS_02550 280179 281642 gene locus_tag LOCUS_02560 280179 281642 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207587.1 protein_id gnl|my_center|LOCUS_02560 282037 283242 gene locus_tag LOCUS_02570 282037 283242 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 protein_id gnl|my_center|LOCUS_02570 283841 283311 gene locus_tag LOCUS_02580 283841 283311 CDS product cysteine peptidase family C39 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207252.1 protein_id gnl|my_center|LOCUS_02580 284443 283919 gene locus_tag LOCUS_02590 284443 283919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 285522 284491 gene locus_tag LOCUS_02600 285522 284491 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207589.1 protein_id gnl|my_center|LOCUS_02600 286007 286429 gene locus_tag LOCUS_02610 286007 286429 CDS product GspH/FimT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207590.1 protein_id gnl|my_center|LOCUS_02610 286546 287721 gene locus_tag LOCUS_02620 286546 287721 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_02620 288466 288146 gene locus_tag LOCUS_02630 288466 288146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 291567 288808 gene locus_tag LOCUS_02640 291567 288808 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208412.1 protein_id gnl|my_center|LOCUS_02640 291685 294447 gene locus_tag LOCUS_02650 gene polA 291685 294447 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208411.1 protein_id gnl|my_center|LOCUS_02650 <297592 294844 gene locus_tag LOCUS_02660 <297592 294844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040403.1:retention module-containing protein >Feature sequence02 1618 1361 gene locus_tag LOCUS_02670 gene tusA 1618 1361 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053527.1 protein_id gnl|my_center|LOCUS_02670 1810 2649 gene locus_tag LOCUS_02680 1810 2649 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208254.1 protein_id gnl|my_center|LOCUS_02680 2646 4205 gene locus_tag LOCUS_02690 gene lnt 2646 4205 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208253.1 protein_id gnl|my_center|LOCUS_02690 4623 4285 gene locus_tag LOCUS_02700 4623 4285 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114937.1 protein_id gnl|my_center|LOCUS_02700 5320 5583 gene locus_tag LOCUS_02710 5320 5583 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 protein_id gnl|my_center|LOCUS_02710 6004 5669 gene locus_tag LOCUS_02720 6004 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804170.1 protein_id gnl|my_center|LOCUS_02720 6723 6286 gene locus_tag LOCUS_02730 6723 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 7964 6759 gene locus_tag LOCUS_02740 gene gspF 7964 6759 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_02740 8133 10358 gene locus_tag LOCUS_02750 8133 10358 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208251.1 protein_id gnl|my_center|LOCUS_02750 10835 12730 gene locus_tag LOCUS_02760 10835 12730 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065938.1 protein_id gnl|my_center|LOCUS_02760 12814 13689 gene locus_tag LOCUS_02770 12814 13689 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208250.1 protein_id gnl|my_center|LOCUS_02770 13815 14264 gene locus_tag LOCUS_02780 13815 14264 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 protein_id gnl|my_center|LOCUS_02780 14555 15523 gene locus_tag LOCUS_02790 14555 15523 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208249.1 protein_id gnl|my_center|LOCUS_02790 15564 15902 gene locus_tag LOCUS_02800 15564 15902 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114963.1 protein_id gnl|my_center|LOCUS_02800 16022 16291 gene locus_tag LOCUS_02810 16022 16291 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688536.1 protein_id gnl|my_center|LOCUS_02810 17522 16299 gene locus_tag LOCUS_02820 17522 16299 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 protein_id gnl|my_center|LOCUS_02820 19763 17670 gene locus_tag LOCUS_02830 gene pnp 19763 17670 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208247.1 protein_id gnl|my_center|LOCUS_02830 20282 20013 gene locus_tag LOCUS_02840 gene rpsO 20282 20013 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114951.1 protein_id gnl|my_center|LOCUS_02840 20565 21863 gene locus_tag LOCUS_02850 20565 21863 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_02850 22074 21865 gene locus_tag LOCUS_02860 22074 21865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 24324 22531 gene locus_tag LOCUS_02870 gene recD 24324 22531 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208245.1 protein_id gnl|my_center|LOCUS_02870 28158 24364 gene locus_tag LOCUS_02880 28158 24364 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208244.1 protein_id gnl|my_center|LOCUS_02880 31883 28158 gene locus_tag LOCUS_02890 31883 28158 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208242.1 protein_id gnl|my_center|LOCUS_02890 32068 32580 gene locus_tag LOCUS_02900 32068 32580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208241.1 protein_id gnl|my_center|LOCUS_02900 33291 32947 gene locus_tag LOCUS_02910 33291 32947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 34732 33314 gene locus_tag LOCUS_02920 34732 33314 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065911.1 protein_id gnl|my_center|LOCUS_02920 34934 35641 gene locus_tag LOCUS_02930 34934 35641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208240.1 protein_id gnl|my_center|LOCUS_02930 35794 36738 gene locus_tag LOCUS_02940 gene ubiE 35794 36738 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114829.1 protein_id gnl|my_center|LOCUS_02940 36770 37441 gene locus_tag LOCUS_02950 36770 37441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208239.1 protein_id gnl|my_center|LOCUS_02950 37445 39064 gene locus_tag LOCUS_02960 37445 39064 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208238.1 protein_id gnl|my_center|LOCUS_02960 39196 40278 gene locus_tag LOCUS_02970 39196 40278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_02970 40771 42060 gene locus_tag LOCUS_02980 40771 42060 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208237.1 protein_id gnl|my_center|LOCUS_02980 42419 42021 gene locus_tag LOCUS_02990 42419 42021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 42531 43316 gene locus_tag LOCUS_03000 gene hisIE 42531 43316 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208235.1 protein_id gnl|my_center|LOCUS_03000 45450 43462 gene locus_tag LOCUS_03010 45450 43462 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208316.1 protein_id gnl|my_center|LOCUS_03010 45733 47226 gene locus_tag LOCUS_03020 45733 47226 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114901.1 protein_id gnl|my_center|LOCUS_03020 47319 48692 gene locus_tag LOCUS_03030 47319 48692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 49142 51979 gene locus_tag LOCUS_03040 49142 51979 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208232.1 protein_id gnl|my_center|LOCUS_03040 51983 52348 gene locus_tag LOCUS_03050 51983 52348 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115033.1 protein_id gnl|my_center|LOCUS_03050 52348 54147 gene locus_tag LOCUS_03060 52348 54147 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208231.1 protein_id gnl|my_center|LOCUS_03060 54148 54669 gene locus_tag LOCUS_03070 54148 54669 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208230.1 protein_id gnl|my_center|LOCUS_03070 54666 54941 gene locus_tag LOCUS_03080 54666 54941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 54953 55345 gene locus_tag LOCUS_03090 54953 55345 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208229.1 protein_id gnl|my_center|LOCUS_03090 55591 56217 gene locus_tag LOCUS_03100 55591 56217 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_03100 57153 56263 gene locus_tag LOCUS_03110 57153 56263 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207824.1 protein_id gnl|my_center|LOCUS_03110 58875 57454 gene locus_tag LOCUS_03120 58875 57454 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_03120 63446 58965 gene locus_tag LOCUS_03130 gene gltB 63446 58965 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207826.1 protein_id gnl|my_center|LOCUS_03130 64733 63864 gene locus_tag LOCUS_03140 64733 63864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207827.1 protein_id gnl|my_center|LOCUS_03140 65831 64752 gene locus_tag LOCUS_03150 gene aroB 65831 64752 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207828.1 protein_id gnl|my_center|LOCUS_03150 66410 65868 gene locus_tag LOCUS_03160 gene aroK 66410 65868 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116987.1 protein_id gnl|my_center|LOCUS_03160 68618 66447 gene locus_tag LOCUS_03170 68618 66447 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_03170 69169 68639 gene locus_tag LOCUS_03180 69169 68639 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_03180 69918 69166 gene locus_tag LOCUS_03190 gene pilO 69918 69166 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207831.1 protein_id gnl|my_center|LOCUS_03190 70556 69915 gene locus_tag LOCUS_03200 70556 69915 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207832.1 protein_id gnl|my_center|LOCUS_03200 71614 70556 gene locus_tag LOCUS_03210 71614 70556 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804529.1 protein_id gnl|my_center|LOCUS_03210 71778 74318 gene locus_tag LOCUS_03220 gene ponA 71778 74318 CDS product penicillin-binding protein PBP1a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207833.1 protein_id gnl|my_center|LOCUS_03220 75179 74376 gene locus_tag LOCUS_03230 75179 74376 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_03230 76371 75253 gene locus_tag LOCUS_03240 gene mraY 76371 75253 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116751.1 protein_id gnl|my_center|LOCUS_03240 77780 76371 gene locus_tag LOCUS_03250 77780 76371 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207836.1 protein_id gnl|my_center|LOCUS_03250 79298 77790 gene locus_tag LOCUS_03260 79298 77790 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207837.1 protein_id gnl|my_center|LOCUS_03260 81141 79306 gene locus_tag LOCUS_03270 gene ftsI 81141 79306 CDS product penicillin-binding protein PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 protein_id gnl|my_center|LOCUS_03270 81483 81151 gene locus_tag LOCUS_03280 gene ftsL 81483 81151 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116847.1 protein_id gnl|my_center|LOCUS_03280 82406 81483 gene locus_tag LOCUS_03290 gene rsmH 82406 81483 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207838.1 protein_id gnl|my_center|LOCUS_03290 83014 82577 gene locus_tag LOCUS_03300 83014 82577 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389455.1 protein_id gnl|my_center|LOCUS_03300 84128 83112 gene locus_tag LOCUS_03310 84128 83112 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207839.1 protein_id gnl|my_center|LOCUS_03310 85488 84496 gene locus_tag LOCUS_03320 85488 84496 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207839.1 protein_id gnl|my_center|LOCUS_03320 85865 86176 gene locus_tag LOCUS_03330 85865 86176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116889.1 protein_id gnl|my_center|LOCUS_03330 86315 87823 gene locus_tag LOCUS_03340 gene gltX 86315 87823 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207840.1 protein_id gnl|my_center|LOCUS_03340 87882 87957 gene locus_tag LOCUS_t00010 87882 87957 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 87984 88059 gene locus_tag LOCUS_t00020 87984 88059 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 88213 88554 gene locus_tag LOCUS_03350 88213 88554 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078496.1 protein_id gnl|my_center|LOCUS_03350 89547 88594 gene locus_tag LOCUS_03360 89547 88594 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207843.1 protein_id gnl|my_center|LOCUS_03360 89697 90497 gene locus_tag LOCUS_03370 89697 90497 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207105.1 protein_id gnl|my_center|LOCUS_03370 93754 90572 gene locus_tag LOCUS_03380 93754 90572 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207844.1 protein_id gnl|my_center|LOCUS_03380 95021 93744 gene locus_tag LOCUS_03390 95021 93744 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207845.1 protein_id gnl|my_center|LOCUS_03390 96315 95023 gene locus_tag LOCUS_03400 96315 95023 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207846.1 protein_id gnl|my_center|LOCUS_03400 96873 96445 gene locus_tag LOCUS_03410 96873 96445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207847.1 protein_id gnl|my_center|LOCUS_03410 97181 97534 gene locus_tag LOCUS_03420 97181 97534 CDS product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207851.1 protein_id gnl|my_center|LOCUS_03420 97894 98781 gene locus_tag LOCUS_03430 97894 98781 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207854.1 protein_id gnl|my_center|LOCUS_03430 99680 98784 gene locus_tag LOCUS_03440 99680 98784 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208272.1 protein_id gnl|my_center|LOCUS_03440 99786 100541 gene locus_tag LOCUS_03450 99786 100541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208271.1 protein_id gnl|my_center|LOCUS_03450 101682 100588 gene locus_tag LOCUS_03460 101682 100588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 101778 102155 gene locus_tag LOCUS_03470 gene cueR 101778 102155 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_03470 104575 102203 gene locus_tag LOCUS_03480 104575 102203 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116875.1 protein_id gnl|my_center|LOCUS_03480 105130 104684 gene locus_tag LOCUS_03490 105130 104684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 105287 106051 gene locus_tag LOCUS_03500 gene ompR 105287 106051 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_03500 106751 108211 gene locus_tag LOCUS_03510 106751 108211 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_03510 108417 109937 gene locus_tag LOCUS_03520 108417 109937 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116671.1 protein_id gnl|my_center|LOCUS_03520 111723 110089 gene locus_tag LOCUS_03530 111723 110089 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966127.1 protein_id gnl|my_center|LOCUS_03530 111937 112356 gene locus_tag LOCUS_03540 111937 112356 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_03540 113750 112491 gene locus_tag LOCUS_03550 113750 112491 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919955.1 protein_id gnl|my_center|LOCUS_03550 114598 113837 gene locus_tag LOCUS_03560 114598 113837 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114678736.1 protein_id gnl|my_center|LOCUS_03560 114876 114801 gene locus_tag LOCUS_t00030 114876 114801 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 115085 115010 gene locus_tag LOCUS_t00040 115085 115010 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 115782 115405 gene locus_tag LOCUS_03570 115782 115405 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116928.1 protein_id gnl|my_center|LOCUS_03570 115885 116478 gene locus_tag LOCUS_03580 gene hisB 115885 116478 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116767.1 protein_id gnl|my_center|LOCUS_03580 116478 117095 gene locus_tag LOCUS_03590 gene hisH 116478 117095 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 protein_id gnl|my_center|LOCUS_03590 117245 117778 gene locus_tag LOCUS_03600 117245 117778 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067011.1 protein_id gnl|my_center|LOCUS_03600 118176 117775 gene locus_tag LOCUS_03610 118176 117775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 118344 119006 gene locus_tag LOCUS_03620 118344 119006 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 protein_id gnl|my_center|LOCUS_03620 119082 119813 gene locus_tag LOCUS_03630 gene hisA 119082 119813 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207860.1 protein_id gnl|my_center|LOCUS_03630 120174 119881 gene locus_tag LOCUS_03640 120174 119881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 120400 121251 gene locus_tag LOCUS_03650 120400 121251 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207863.1 protein_id gnl|my_center|LOCUS_03650 121711 121319 gene locus_tag LOCUS_03660 121711 121319 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 protein_id gnl|my_center|LOCUS_03660 122381 121746 gene locus_tag LOCUS_03670 122381 121746 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207865.1 protein_id gnl|my_center|LOCUS_03670 123351 122401 gene locus_tag LOCUS_03680 123351 122401 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207866.1 protein_id gnl|my_center|LOCUS_03680 123466 124224 gene locus_tag LOCUS_03690 gene hisF 123466 124224 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001007.1 protein_id gnl|my_center|LOCUS_03690 124792 125151 gene locus_tag LOCUS_03700 124792 125151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 126855 125194 gene locus_tag LOCUS_03710 gene ettA 126855 125194 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207852.1 protein_id gnl|my_center|LOCUS_03710 129022 127445 gene locus_tag LOCUS_03720 129022 127445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 129259 130536 gene locus_tag LOCUS_03730 129259 130536 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 protein_id gnl|my_center|LOCUS_03730 131352 130630 gene locus_tag LOCUS_03740 gene phoU 131352 130630 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948570.1 protein_id gnl|my_center|LOCUS_03740 131806 132819 gene locus_tag LOCUS_03750 131806 132819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208183.1 protein_id gnl|my_center|LOCUS_03750 132886 133941 gene locus_tag LOCUS_03760 132886 133941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208183.1 protein_id gnl|my_center|LOCUS_03760 134265 136160 gene locus_tag LOCUS_03770 gene thiC 134265 136160 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121180.1 protein_id gnl|my_center|LOCUS_03770 136235 136855 gene locus_tag LOCUS_03780 136235 136855 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208182.1 protein_id gnl|my_center|LOCUS_03780 136865 137674 gene locus_tag LOCUS_03790 136865 137674 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208181.1 protein_id gnl|my_center|LOCUS_03790 137883 138410 gene locus_tag LOCUS_03800 gene dksA 137883 138410 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121205.1 protein_id gnl|my_center|LOCUS_03800 138416 139333 gene locus_tag LOCUS_03810 gene gluQRS 138416 139333 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208180.1 protein_id gnl|my_center|LOCUS_03810 140637 139441 gene locus_tag LOCUS_03820 gene ftsW 140637 139441 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079447.1 protein_id gnl|my_center|LOCUS_03820 142007 140661 gene locus_tag LOCUS_03830 gene murD 142007 140661 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208179.1 protein_id gnl|my_center|LOCUS_03830 142802 142257 gene locus_tag LOCUS_03840 142802 142257 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_03840 143572 142913 gene locus_tag LOCUS_03850 143572 142913 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_03850 144971 143667 gene locus_tag LOCUS_03860 144971 143667 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_03860 146080 144968 gene locus_tag LOCUS_03870 gene ribD 146080 144968 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208167.1 protein_id gnl|my_center|LOCUS_03870 146577 146113 gene locus_tag LOCUS_03880 gene nrdR 146577 146113 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543541.1 protein_id gnl|my_center|LOCUS_03880 148141 146738 gene locus_tag LOCUS_03890 148141 146738 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208166.1 protein_id gnl|my_center|LOCUS_03890 148547 148209 gene locus_tag LOCUS_03900 gene glnK 148547 148209 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_03900 148839 149066 gene locus_tag LOCUS_03910 148839 149066 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121136.1 protein_id gnl|my_center|LOCUS_03910 149138 150625 gene locus_tag LOCUS_03920 149138 150625 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208165.1 protein_id gnl|my_center|LOCUS_03920 151885 150704 gene locus_tag LOCUS_03930 151885 150704 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207582.1 protein_id gnl|my_center|LOCUS_03930 153212 152160 gene locus_tag LOCUS_03940 153212 152160 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529706.1 protein_id gnl|my_center|LOCUS_03940 153562 155148 gene locus_tag LOCUS_03950 153562 155148 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067378.1 protein_id gnl|my_center|LOCUS_03950 155145 155930 gene locus_tag LOCUS_03960 155145 155930 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970558.1 protein_id gnl|my_center|LOCUS_03960 155932 157446 gene locus_tag LOCUS_03970 155932 157446 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398620.1 protein_id gnl|my_center|LOCUS_03970 157498 158283 gene locus_tag LOCUS_03980 157498 158283 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529695.1 protein_id gnl|my_center|LOCUS_03980 158292 159932 gene locus_tag LOCUS_03990 158292 159932 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529694.1 protein_id gnl|my_center|LOCUS_03990 159904 161079 gene locus_tag LOCUS_04000 159904 161079 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398651.1 protein_id gnl|my_center|LOCUS_04000 161139 162374 gene locus_tag LOCUS_04010 gene fucP 161139 162374 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_04010 162403 165093 gene locus_tag LOCUS_04020 gene ppc 162403 165093 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208009.1 protein_id gnl|my_center|LOCUS_04020 165175 166317 gene locus_tag LOCUS_04030 165175 166317 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207425.1 protein_id gnl|my_center|LOCUS_04030 167254 166382 gene locus_tag LOCUS_04040 167254 166382 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_04040 167378 168658 gene locus_tag LOCUS_04050 gene fucP 167378 168658 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_04050 168661 169668 gene locus_tag LOCUS_04060 168661 169668 CDS product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067379.1 protein_id gnl|my_center|LOCUS_04060 169659 171170 gene locus_tag LOCUS_04070 169659 171170 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445683.1 protein_id gnl|my_center|LOCUS_04070 171324 171833 gene locus_tag LOCUS_04080 171324 171833 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207057.1 protein_id gnl|my_center|LOCUS_04080 172667 171897 gene locus_tag LOCUS_04090 172667 171897 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 protein_id gnl|my_center|LOCUS_04090 173936 173166 gene locus_tag LOCUS_04100 173936 173166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 174246 175547 gene locus_tag LOCUS_04110 174246 175547 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208158.1 protein_id gnl|my_center|LOCUS_04110 176174 175650 gene locus_tag LOCUS_04120 gene ppa 176174 175650 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121243.1 protein_id gnl|my_center|LOCUS_04120 176694 176296 gene locus_tag LOCUS_04130 176694 176296 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 protein_id gnl|my_center|LOCUS_04130 176801 177190 gene locus_tag LOCUS_04140 176801 177190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208156.1 protein_id gnl|my_center|LOCUS_04140 178941 177268 gene locus_tag LOCUS_04150 178941 177268 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 protein_id gnl|my_center|LOCUS_04150 181310 179091 gene locus_tag LOCUS_04160 gene parC 181310 179091 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208155.1 protein_id gnl|my_center|LOCUS_04160 181857 181558 gene locus_tag LOCUS_04170 181857 181558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 183360 182041 gene locus_tag LOCUS_04180 183360 182041 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121171.1 protein_id gnl|my_center|LOCUS_04180 184359 183715 gene locus_tag LOCUS_04190 184359 183715 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121256.1 protein_id gnl|my_center|LOCUS_04190 184888 184421 gene locus_tag LOCUS_04200 184888 184421 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208154.1 protein_id gnl|my_center|LOCUS_04200 186860 185280 gene locus_tag LOCUS_04210 186860 185280 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208153.1 protein_id gnl|my_center|LOCUS_04210 187009 186857 gene locus_tag LOCUS_04220 187009 186857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 187298 187933 gene locus_tag LOCUS_04230 187298 187933 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208152.1 protein_id gnl|my_center|LOCUS_04230 188432 188091 gene locus_tag LOCUS_04240 188432 188091 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789991.1 protein_id gnl|my_center|LOCUS_04240 189309 188542 gene locus_tag LOCUS_04250 189309 188542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 189763 192594 gene locus_tag LOCUS_04260 gene uvrA 189763 192594 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207906.1 protein_id gnl|my_center|LOCUS_04260 192894 193469 gene locus_tag LOCUS_04270 192894 193469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207215.1 protein_id gnl|my_center|LOCUS_04270 195146 193485 gene locus_tag LOCUS_04280 195146 193485 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207907.1 protein_id gnl|my_center|LOCUS_04280 196297 195479 gene locus_tag LOCUS_04290 gene blaOXA 196297 195479 CDS product OXA-213 family carbapenem-hydrolyzing class D beta-lactamase OXA-642 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206564.1 protein_id gnl|my_center|LOCUS_04290 197202 198086 gene locus_tag LOCUS_04300 gene omp33-36 197202 198086 CDS product porin Omp33-36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207908.1 protein_id gnl|my_center|LOCUS_04300 200123 198156 gene locus_tag LOCUS_04310 gene betT 200123 198156 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207909.1 protein_id gnl|my_center|LOCUS_04310 200931 200293 gene locus_tag LOCUS_04320 200931 200293 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 protein_id gnl|my_center|LOCUS_04320 202959 201244 gene locus_tag LOCUS_04330 202959 201244 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121878.1 protein_id gnl|my_center|LOCUS_04330 203293 202961 gene locus_tag LOCUS_04340 203293 202961 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207911.1 protein_id gnl|my_center|LOCUS_04340 203588 206971 gene locus_tag LOCUS_04350 203588 206971 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207912.1 protein_id gnl|my_center|LOCUS_04350 207389 208156 gene locus_tag LOCUS_04360 207389 208156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207913.1 protein_id gnl|my_center|LOCUS_04360 209499 208255 gene locus_tag LOCUS_04370 209499 208255 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208142.1 protein_id gnl|my_center|LOCUS_04370 210785 209622 gene locus_tag LOCUS_04380 210785 209622 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207995.1 protein_id gnl|my_center|LOCUS_04380 212053 211235 gene locus_tag LOCUS_04390 212053 211235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence03 437 2758 gene locus_tag LOCUS_04400 437 2758 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038162489.1 protein_id gnl|my_center|LOCUS_04400 2758 4128 gene locus_tag LOCUS_04410 2758 4128 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_04410 4245 7505 gene locus_tag LOCUS_04420 4245 7505 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 protein_id gnl|my_center|LOCUS_04420 7644 9176 gene locus_tag LOCUS_04430 7644 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 9169 9864 gene locus_tag LOCUS_04440 9169 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 10070 12259 gene locus_tag LOCUS_04450 10070 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 12272 13576 gene locus_tag LOCUS_04460 12272 13576 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103653.1 protein_id gnl|my_center|LOCUS_04460 14871 13654 gene locus_tag LOCUS_04470 14871 13654 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_04470 15122 15047 gene locus_tag LOCUS_t00050 15122 15047 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16565 15195 gene locus_tag LOCUS_04480 16565 15195 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207521.1 protein_id gnl|my_center|LOCUS_04480 16885 18072 gene locus_tag LOCUS_04490 gene prpF 16885 18072 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_04490 18329 19291 gene locus_tag LOCUS_04500 18329 19291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 19446 20357 gene locus_tag LOCUS_04510 19446 20357 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207519.1 protein_id gnl|my_center|LOCUS_04510 21905 20460 gene locus_tag LOCUS_04520 gene putP 21905 20460 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206579.1 protein_id gnl|my_center|LOCUS_04520 22993 22139 gene locus_tag LOCUS_04530 22993 22139 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_04530 23481 23017 gene locus_tag LOCUS_04540 23481 23017 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_04540 24535 23618 gene locus_tag LOCUS_04550 24535 23618 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_04550 25221 24595 gene locus_tag LOCUS_04560 25221 24595 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207515.1 protein_id gnl|my_center|LOCUS_04560 25408 26658 gene locus_tag LOCUS_04570 25408 26658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_04570 27124 28785 gene locus_tag LOCUS_04580 27124 28785 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207511.1 protein_id gnl|my_center|LOCUS_04580 28803 29495 gene locus_tag LOCUS_04590 28803 29495 CDS product DNA-binding response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207510.1 protein_id gnl|my_center|LOCUS_04590 29497 30834 gene locus_tag LOCUS_04600 29497 30834 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207509.1 protein_id gnl|my_center|LOCUS_04600 31677 30868 gene locus_tag LOCUS_04610 31677 30868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688791.1 protein_id gnl|my_center|LOCUS_04610 32936 32256 gene locus_tag LOCUS_04620 32936 32256 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207508.1 protein_id gnl|my_center|LOCUS_04620 34439 33252 gene locus_tag LOCUS_04630 34439 33252 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_04630 35238 34753 gene locus_tag LOCUS_04640 35238 34753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 35737 36084 gene locus_tag LOCUS_04650 35737 36084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 36710 36087 gene locus_tag LOCUS_04660 36710 36087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 36860 37702 gene locus_tag LOCUS_04670 36860 37702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 protein_id gnl|my_center|LOCUS_04670 37932 38897 gene locus_tag LOCUS_04680 37932 38897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 39357 38929 gene locus_tag LOCUS_04690 39357 38929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 42323 39429 gene locus_tag LOCUS_04700 42323 39429 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207500.1 protein_id gnl|my_center|LOCUS_04700 42660 43355 gene locus_tag LOCUS_04710 42660 43355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 43435 44232 gene locus_tag LOCUS_04720 43435 44232 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_04720 44319 45083 gene locus_tag LOCUS_04730 44319 45083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 46118 45129 gene locus_tag LOCUS_04740 46118 45129 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435528.1 protein_id gnl|my_center|LOCUS_04740 46762 46331 gene locus_tag LOCUS_04750 46762 46331 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_04750 47122 46772 gene locus_tag LOCUS_04760 47122 46772 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_04760 48691 47234 gene locus_tag LOCUS_04770 gene adeK 48691 47234 CDS product multidrug efflux RND transporter outer membrane channel subunit AdeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_04770 51867 48688 gene locus_tag LOCUS_04780 51867 48688 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 protein_id gnl|my_center|LOCUS_04780 53145 51880 gene locus_tag LOCUS_04790 gene adeI 53145 51880 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AdeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116482.1 protein_id gnl|my_center|LOCUS_04790 53783 53145 gene locus_tag LOCUS_04800 53783 53145 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064516.1 protein_id gnl|my_center|LOCUS_04800 55963 53942 gene locus_tag LOCUS_04810 55963 53942 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_04810 56995 56012 gene locus_tag LOCUS_04820 56995 56012 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116233.1 protein_id gnl|my_center|LOCUS_04820 57415 57726 gene locus_tag LOCUS_04830 gene rplU 57415 57726 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271409.1 protein_id gnl|my_center|LOCUS_04830 57746 58000 gene locus_tag LOCUS_04840 gene rpmA 57746 58000 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551972.1 protein_id gnl|my_center|LOCUS_04840 58231 58926 gene locus_tag LOCUS_04850 gene lolA 58231 58926 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207490.1 protein_id gnl|my_center|LOCUS_04850 59177 59986 gene locus_tag LOCUS_04860 59177 59986 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207489.1 protein_id gnl|my_center|LOCUS_04860 60096 61367 gene locus_tag LOCUS_04870 gene serS 60096 61367 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072887.1 protein_id gnl|my_center|LOCUS_04870 61449 62822 gene locus_tag LOCUS_04880 gene cysG 61449 62822 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207488.1 protein_id gnl|my_center|LOCUS_04880 62905 63384 gene locus_tag LOCUS_04890 62905 63384 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072891.1 protein_id gnl|my_center|LOCUS_04890 63831 63412 gene locus_tag LOCUS_04900 63831 63412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 64360 63983 gene locus_tag LOCUS_04910 64360 63983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 64880 64488 gene locus_tag LOCUS_04920 64880 64488 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116344.1 protein_id gnl|my_center|LOCUS_04920 65035 65751 gene locus_tag LOCUS_04930 65035 65751 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 protein_id gnl|my_center|LOCUS_04930 65791 66345 gene locus_tag LOCUS_04940 65791 66345 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207483.1 protein_id gnl|my_center|LOCUS_04940 67854 66442 gene locus_tag LOCUS_04950 67854 66442 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207482.1 protein_id gnl|my_center|LOCUS_04950 68094 67879 gene locus_tag LOCUS_04960 68094 67879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 69307 68123 gene locus_tag LOCUS_04970 69307 68123 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_04970 69844 69311 gene locus_tag LOCUS_04980 69844 69311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072911.1 protein_id gnl|my_center|LOCUS_04980 70617 69922 gene locus_tag LOCUS_04990 gene lipB 70617 69922 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207480.1 protein_id gnl|my_center|LOCUS_04990 71069 70782 gene locus_tag LOCUS_05000 71069 70782 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116017.1 protein_id gnl|my_center|LOCUS_05000 73087 71195 gene locus_tag LOCUS_05010 gene rpoD 73087 71195 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207479.1 protein_id gnl|my_center|LOCUS_05010 73470 73676 gene locus_tag LOCUS_05020 73470 73676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 73743 74267 gene locus_tag LOCUS_05030 73743 74267 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116105.1 protein_id gnl|my_center|LOCUS_05030 74682 74413 gene locus_tag LOCUS_05040 74682 74413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 75665 75057 gene locus_tag LOCUS_05050 75665 75057 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208463.1 protein_id gnl|my_center|LOCUS_05050 76736 76128 gene locus_tag LOCUS_05060 76736 76128 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_05060 77887 76955 gene locus_tag LOCUS_05070 77887 76955 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064553.1 protein_id gnl|my_center|LOCUS_05070 78120 78602 gene locus_tag LOCUS_05080 78120 78602 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064555.1 protein_id gnl|my_center|LOCUS_05080 78548 78775 gene locus_tag LOCUS_05090 78548 78775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 79378 78719 gene locus_tag LOCUS_05100 gene ribB 79378 78719 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205945.1 protein_id gnl|my_center|LOCUS_05100 79819 81648 gene locus_tag LOCUS_05110 79819 81648 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205946.1 protein_id gnl|my_center|LOCUS_05110 81645 82259 gene locus_tag LOCUS_05120 81645 82259 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903319.1 protein_id gnl|my_center|LOCUS_05120 82699 82319 gene locus_tag LOCUS_05130 82699 82319 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120296.1 protein_id gnl|my_center|LOCUS_05130 83433 82855 gene locus_tag LOCUS_05140 gene pth 83433 82855 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120328.1 protein_id gnl|my_center|LOCUS_05140 83750 83454 gene locus_tag LOCUS_05150 gene rplY 83750 83454 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120443.1 protein_id gnl|my_center|LOCUS_05150 84801 83848 gene locus_tag LOCUS_05160 84801 83848 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120445.1 protein_id gnl|my_center|LOCUS_05160 84912 84838 gene locus_tag LOCUS_t00060 84912 84838 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 85077 85003 gene locus_tag LOCUS_t00070 85077 85003 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 85171 85097 gene locus_tag LOCUS_t00080 85171 85097 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 85276 85202 gene locus_tag LOCUS_t00090 85276 85202 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 86108 85281 gene locus_tag LOCUS_05170 gene ispE 86108 85281 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205949.1 protein_id gnl|my_center|LOCUS_05170 86733 86134 gene locus_tag LOCUS_05180 gene lolB 86733 86134 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070955.1 protein_id gnl|my_center|LOCUS_05180 88424 86742 gene locus_tag LOCUS_05190 88424 86742 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205950.1 protein_id gnl|my_center|LOCUS_05190 88532 89818 gene locus_tag LOCUS_05200 gene hemA 88532 89818 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205951.1 protein_id gnl|my_center|LOCUS_05200 89908 90342 gene locus_tag LOCUS_05210 89908 90342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 92252 90339 gene locus_tag LOCUS_05220 92252 90339 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205953.1 protein_id gnl|my_center|LOCUS_05220 93422 92400 gene locus_tag LOCUS_05230 93422 92400 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205954.1 protein_id gnl|my_center|LOCUS_05230 93494 94546 gene locus_tag LOCUS_05240 gene rluD 93494 94546 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075271.1 protein_id gnl|my_center|LOCUS_05240 94583 95326 gene locus_tag LOCUS_05250 gene pgeF 94583 95326 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205955.1 protein_id gnl|my_center|LOCUS_05250 95450 96001 gene locus_tag LOCUS_05260 95450 96001 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075275.1 protein_id gnl|my_center|LOCUS_05260 96233 97729 gene locus_tag LOCUS_05270 96233 97729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_05270 98097 99413 gene locus_tag LOCUS_05280 98097 99413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_05280 99931 99455 gene locus_tag LOCUS_05290 gene smpB 99931 99455 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120348.1 protein_id gnl|my_center|LOCUS_05290 100092 100583 gene locus_tag LOCUS_05300 gene coaD 100092 100583 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120252.1 protein_id gnl|my_center|LOCUS_05300 100660 100854 gene locus_tag LOCUS_05310 100660 100854 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205956.1 protein_id gnl|my_center|LOCUS_05310 101317 101393 gene locus_tag LOCUS_t00100 101317 101393 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 102429 101473 gene locus_tag LOCUS_05320 102429 101473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 102722 102637 gene locus_tag LOCUS_t00110 102722 102637 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 102940 104706 gene locus_tag LOCUS_05330 102940 104706 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_05330 105499 104768 gene locus_tag LOCUS_05340 105499 104768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 105709 105624 gene locus_tag LOCUS_t00120 105709 105624 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 105793 105720 gene locus_tag LOCUS_t00130 105793 105720 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 105946 106794 gene locus_tag LOCUS_05350 gene folD 105946 106794 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 protein_id gnl|my_center|LOCUS_05350 107018 107686 gene locus_tag LOCUS_05360 107018 107686 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_05360 108152 107727 gene locus_tag LOCUS_05370 108152 107727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115580.1 protein_id gnl|my_center|LOCUS_05370 109617 108298 gene locus_tag LOCUS_05380 109617 108298 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803945.1 protein_id gnl|my_center|LOCUS_05380 110073 110828 gene locus_tag LOCUS_05390 110073 110828 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011169330.1 protein_id gnl|my_center|LOCUS_05390 110969 112498 gene locus_tag LOCUS_05400 gene glpD 110969 112498 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207451.1 protein_id gnl|my_center|LOCUS_05400 113962 112649 gene locus_tag LOCUS_05410 113962 112649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764944.1 protein_id gnl|my_center|LOCUS_05410 115360 114482 gene locus_tag LOCUS_05420 115360 114482 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419670.1 protein_id gnl|my_center|LOCUS_05420 117503 115671 gene locus_tag LOCUS_05430 117503 115671 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115528.1 protein_id gnl|my_center|LOCUS_05430 117911 118852 gene locus_tag LOCUS_05440 117911 118852 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115559.1 protein_id gnl|my_center|LOCUS_05440 118833 119588 gene locus_tag LOCUS_05450 118833 119588 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207450.1 protein_id gnl|my_center|LOCUS_05450 119796 120086 gene locus_tag LOCUS_05460 119796 120086 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650103.1 protein_id gnl|my_center|LOCUS_05460 120189 121823 gene locus_tag LOCUS_05470 gene groL 120189 121823 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120607.1 protein_id gnl|my_center|LOCUS_05470 122427 122053 gene locus_tag LOCUS_05480 122427 122053 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_05480 123714 122569 gene locus_tag LOCUS_05490 123714 122569 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207445.1 protein_id gnl|my_center|LOCUS_05490 123987 127088 gene locus_tag LOCUS_05500 123987 127088 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207444.1 protein_id gnl|my_center|LOCUS_05500 127333 128670 gene locus_tag LOCUS_05510 gene mgtE 127333 128670 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 protein_id gnl|my_center|LOCUS_05510 129131 128682 gene locus_tag LOCUS_05520 129131 128682 CDS product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068176.1 protein_id gnl|my_center|LOCUS_05520 129270 129195 gene locus_tag LOCUS_t00140 129270 129195 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 130938 130087 gene locus_tag LOCUS_05530 gene asd 130938 130087 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207963.1 protein_id gnl|my_center|LOCUS_05530 131816 130935 gene locus_tag LOCUS_05540 131816 130935 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207964.1 protein_id gnl|my_center|LOCUS_05540 133102 131891 gene locus_tag LOCUS_05550 gene pncB 133102 131891 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358295.1 protein_id gnl|my_center|LOCUS_05550 133375 133815 gene locus_tag LOCUS_05560 gene dtd 133375 133815 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207966.1 protein_id gnl|my_center|LOCUS_05560 134372 133893 gene locus_tag LOCUS_05570 134372 133893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119134.1 protein_id gnl|my_center|LOCUS_05570 134901 134587 gene locus_tag LOCUS_05580 134901 134587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119105.1 protein_id gnl|my_center|LOCUS_05580 136547 135327 gene locus_tag LOCUS_05590 gene serB 136547 135327 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207967.1 protein_id gnl|my_center|LOCUS_05590 136625 137911 gene locus_tag LOCUS_05600 136625 137911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207968.1 protein_id gnl|my_center|LOCUS_05600 138203 139324 gene locus_tag LOCUS_05610 gene ribBA 138203 139324 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_05610 139426 139896 gene locus_tag LOCUS_05620 gene ribE 139426 139896 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119264.1 protein_id gnl|my_center|LOCUS_05620 139900 140349 gene locus_tag LOCUS_05630 gene nusB 139900 140349 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119137.1 protein_id gnl|my_center|LOCUS_05630 140361 141278 gene locus_tag LOCUS_05640 gene thiL 140361 141278 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207969.1 protein_id gnl|my_center|LOCUS_05640 141271 141777 gene locus_tag LOCUS_05650 141271 141777 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207970.1 protein_id gnl|my_center|LOCUS_05650 141799 143163 gene locus_tag LOCUS_05660 gene glmU 141799 143163 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207971.1 protein_id gnl|my_center|LOCUS_05660 143176 145014 gene locus_tag LOCUS_05670 gene glmS 143176 145014 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207972.1 protein_id gnl|my_center|LOCUS_05670 145270 146235 gene locus_tag LOCUS_05680 145270 146235 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 protein_id gnl|my_center|LOCUS_05680 146962 146642 gene locus_tag LOCUS_05690 146962 146642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 147360 147082 gene locus_tag LOCUS_05700 147360 147082 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531766.1 protein_id gnl|my_center|LOCUS_05700 147454 147972 gene locus_tag LOCUS_05710 147454 147972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 147969 148442 gene locus_tag LOCUS_05720 147969 148442 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207987.1 protein_id gnl|my_center|LOCUS_05720 149456 148503 gene locus_tag LOCUS_05730 149456 148503 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 protein_id gnl|my_center|LOCUS_05730 150195 149554 gene locus_tag LOCUS_05740 gene pncA 150195 149554 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207990.1 protein_id gnl|my_center|LOCUS_05740 150823 151719 gene locus_tag LOCUS_05750 gene dapA 150823 151719 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300412.1 protein_id gnl|my_center|LOCUS_05750 151735 152343 gene locus_tag LOCUS_05760 151735 152343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207991.1 protein_id gnl|my_center|LOCUS_05760 152381 153100 gene locus_tag LOCUS_05770 152381 153100 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119240.1 protein_id gnl|my_center|LOCUS_05770 153724 153170 gene locus_tag LOCUS_05780 153724 153170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 154282 154872 gene locus_tag LOCUS_05790 154282 154872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 154986 155324 gene locus_tag LOCUS_05800 gene fdx 154986 155324 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_05800 155408 155596 gene locus_tag LOCUS_05810 gene golB 155408 155596 CDS product gold resistance metallochaperone GolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159469.1 protein_id gnl|my_center|LOCUS_05810 155854 158256 gene locus_tag LOCUS_05820 155854 158256 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407998.1 protein_id gnl|my_center|LOCUS_05820 158441 158956 gene locus_tag LOCUS_05830 158441 158956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 161327 158976 gene locus_tag LOCUS_05840 161327 158976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 162732 161458 gene locus_tag LOCUS_05850 162732 161458 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207994.1 protein_id gnl|my_center|LOCUS_05850 163732 162803 gene locus_tag LOCUS_05860 163732 162803 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274373.1 protein_id gnl|my_center|LOCUS_05860 164285 163815 gene locus_tag LOCUS_05870 164285 163815 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119281.1 protein_id gnl|my_center|LOCUS_05870 164458 164616 gene locus_tag LOCUS_05880 164458 164616 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053759.1 protein_id gnl|my_center|LOCUS_05880 164815 165552 gene locus_tag LOCUS_05890 164815 165552 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119163.1 protein_id gnl|my_center|LOCUS_05890 165599 165967 gene locus_tag LOCUS_05900 165599 165967 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207996.1 protein_id gnl|my_center|LOCUS_05900 166170 167204 gene locus_tag LOCUS_05910 gene mutY 166170 167204 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207997.1 protein_id gnl|my_center|LOCUS_05910 167301 167849 gene locus_tag LOCUS_05920 167301 167849 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207998.1 protein_id gnl|my_center|LOCUS_05920 167879 168124 gene locus_tag LOCUS_05930 167879 168124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066589.1 protein_id gnl|my_center|LOCUS_05930 168152 168706 gene locus_tag LOCUS_05940 168152 168706 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066585.1 protein_id gnl|my_center|LOCUS_05940 168736 169758 gene locus_tag LOCUS_05950 168736 169758 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_05950 171450 170014 gene locus_tag LOCUS_05960 171450 170014 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208000.1 protein_id gnl|my_center|LOCUS_05960 171561 171968 gene locus_tag LOCUS_05970 171561 171968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208001.1 protein_id gnl|my_center|LOCUS_05970 172818 171928 gene locus_tag LOCUS_05980 172818 171928 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208002.1 protein_id gnl|my_center|LOCUS_05980 172942 173754 gene locus_tag LOCUS_05990 gene dkgB 172942 173754 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811193.1 protein_id gnl|my_center|LOCUS_05990 174290 175456 gene locus_tag LOCUS_06000 174290 175456 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066574.1 protein_id gnl|my_center|LOCUS_06000 176218 175568 gene locus_tag LOCUS_06010 176218 175568 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066572.1 protein_id gnl|my_center|LOCUS_06010 177090 176269 gene locus_tag LOCUS_06020 gene dapB 177090 176269 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119175.1 protein_id gnl|my_center|LOCUS_06020 177380 177571 gene locus_tag LOCUS_06030 177380 177571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 177969 178175 gene locus_tag LOCUS_06040 177969 178175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 179347 178235 gene locus_tag LOCUS_06050 gene dnaJ 179347 178235 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208006.1 protein_id gnl|my_center|LOCUS_06050 179818 179441 gene locus_tag LOCUS_06060 179818 179441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119294.1 protein_id gnl|my_center|LOCUS_06060 183101 179955 gene locus_tag LOCUS_06070 183101 179955 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208007.1 protein_id gnl|my_center|LOCUS_06070 184204 183104 gene locus_tag LOCUS_06080 184204 183104 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208008.1 protein_id gnl|my_center|LOCUS_06080 184541 185158 gene locus_tag LOCUS_06090 184541 185158 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119184.1 protein_id gnl|my_center|LOCUS_06090 185682 188372 gene locus_tag LOCUS_06100 gene ppc 185682 188372 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208009.1 protein_id gnl|my_center|LOCUS_06100 188675 190012 gene locus_tag LOCUS_06110 188675 190012 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119102.1 protein_id gnl|my_center|LOCUS_06110 190773 190060 gene locus_tag LOCUS_06120 190773 190060 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112421.1 protein_id gnl|my_center|LOCUS_06120 192085 190949 gene locus_tag LOCUS_06130 192085 190949 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208024.1 protein_id gnl|my_center|LOCUS_06130 192293 193294 gene locus_tag LOCUS_06140 gene ribF 192293 193294 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208023.1 protein_id gnl|my_center|LOCUS_06140 193357 196197 gene locus_tag LOCUS_06150 gene ileS 193357 196197 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208022.1 protein_id gnl|my_center|LOCUS_06150 196190 196729 gene locus_tag LOCUS_06160 gene lspA 196190 196729 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_06160 196722 197207 gene locus_tag LOCUS_06170 196722 197207 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208021.1 protein_id gnl|my_center|LOCUS_06170 197992 197297 gene locus_tag LOCUS_06180 197992 197297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 198913 198002 gene locus_tag LOCUS_06190 198913 198002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 199238 198915 gene locus_tag LOCUS_06200 199238 198915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 200235 199546 gene locus_tag LOCUS_06210 200235 199546 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207167.1 protein_id gnl|my_center|LOCUS_06210 200351 201280 gene locus_tag LOCUS_06220 200351 201280 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208010.1 protein_id gnl|my_center|LOCUS_06220 202077 201334 gene locus_tag LOCUS_06230 202077 201334 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208011.1 protein_id gnl|my_center|LOCUS_06230 202284 203663 gene locus_tag LOCUS_06240 202284 203663 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207113.1 protein_id gnl|my_center|LOCUS_06240 204178 203801 gene locus_tag LOCUS_06250 204178 203801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 204525 204235 gene locus_tag LOCUS_06260 204525 204235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 205858 204503 gene locus_tag LOCUS_06270 205858 204503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208012.1 protein_id gnl|my_center|LOCUS_06270 207957 206113 gene locus_tag LOCUS_06280 gene ilvD 207957 206113 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208013.1 protein_id gnl|my_center|LOCUS_06280 209332 208538 gene locus_tag LOCUS_06290 gene bamE 209332 208538 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 protein_id gnl|my_center|LOCUS_06290 <212202 209397 gene locus_tag LOCUS_06300 <212202 209397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052728129.1:YadA-like family protein >Feature sequence04 407 517 gene locus_tag LOCUS_r00010 407 517 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1651 674 gene locus_tag LOCUS_06310 1651 674 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207446.1 protein_id gnl|my_center|LOCUS_06310 2273 1788 gene locus_tag LOCUS_06320 2273 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4418 2361 gene locus_tag LOCUS_06330 gene metG 4418 2361 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205915.1 protein_id gnl|my_center|LOCUS_06330 4598 5398 gene locus_tag LOCUS_06340 4598 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5501 5962 gene locus_tag LOCUS_06350 5501 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 6093 5872 gene locus_tag LOCUS_06360 6093 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6156 6452 gene locus_tag LOCUS_06370 6156 6452 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388148.1 protein_id gnl|my_center|LOCUS_06370 6684 6469 gene locus_tag LOCUS_06380 6684 6469 CDS product DUF6500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029304506.1 protein_id gnl|my_center|LOCUS_06380 6880 7077 gene locus_tag LOCUS_06390 6880 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 7421 7122 gene locus_tag LOCUS_06400 7421 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 7728 8981 gene locus_tag LOCUS_06410 gene apbC 7728 8981 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205916.1 protein_id gnl|my_center|LOCUS_06410 9052 9240 gene locus_tag LOCUS_06420 9052 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 9577 10401 gene locus_tag LOCUS_06430 9577 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 10908 10426 gene locus_tag LOCUS_06440 10908 10426 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205919.1 protein_id gnl|my_center|LOCUS_06440 11427 12020 gene locus_tag LOCUS_06450 11427 12020 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071033.1 protein_id gnl|my_center|LOCUS_06450 12155 12724 gene locus_tag LOCUS_06460 gene dcd 12155 12724 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003653416.1 protein_id gnl|my_center|LOCUS_06460 13075 14421 gene locus_tag LOCUS_06470 13075 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_06470 14999 16462 gene locus_tag LOCUS_06480 14999 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_06480 17033 18487 gene locus_tag LOCUS_06490 17033 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_06490 19411 20787 gene locus_tag LOCUS_06500 19411 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_06500 21040 22596 gene locus_tag LOCUS_06510 21040 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205921.1 protein_id gnl|my_center|LOCUS_06510 22613 23365 gene locus_tag LOCUS_06520 22613 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205922.1 protein_id gnl|my_center|LOCUS_06520 23391 25853 gene locus_tag LOCUS_06530 23391 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205923.1 protein_id gnl|my_center|LOCUS_06530 25949 26908 gene locus_tag LOCUS_06540 25949 26908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205924.1 protein_id gnl|my_center|LOCUS_06540 29066 27336 gene locus_tag LOCUS_06550 29066 27336 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207562.1 protein_id gnl|my_center|LOCUS_06550 29887 29315 gene locus_tag LOCUS_06560 29887 29315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207559.1 protein_id gnl|my_center|LOCUS_06560 30241 30624 gene locus_tag LOCUS_06570 gene pilG 30241 30624 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 protein_id gnl|my_center|LOCUS_06570 30645 31013 gene locus_tag LOCUS_06580 30645 31013 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_06580 31017 31553 gene locus_tag LOCUS_06590 31017 31553 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 protein_id gnl|my_center|LOCUS_06590 31596 33665 gene locus_tag LOCUS_06600 31596 33665 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072794.1 protein_id gnl|my_center|LOCUS_06600 33810 38306 gene locus_tag LOCUS_06610 33810 38306 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207558.1 protein_id gnl|my_center|LOCUS_06610 38315 38782 gene locus_tag LOCUS_06620 38315 38782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207557.1 protein_id gnl|my_center|LOCUS_06620 41308 39506 gene locus_tag LOCUS_06630 41308 39506 CDS product SAV1866 family putative multidrug efflux ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 protein_id gnl|my_center|LOCUS_06630 41430 42065 gene locus_tag LOCUS_06640 41430 42065 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_06640 42809 42111 gene locus_tag LOCUS_06650 42809 42111 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207528.1 protein_id gnl|my_center|LOCUS_06650 43931 43128 gene locus_tag LOCUS_06660 43931 43128 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114686.1 protein_id gnl|my_center|LOCUS_06660 44427 46511 gene locus_tag LOCUS_06670 44427 46511 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208221.1 protein_id gnl|my_center|LOCUS_06670 46514 46720 gene locus_tag LOCUS_06680 46514 46720 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115096.1 protein_id gnl|my_center|LOCUS_06680 46789 47799 gene locus_tag LOCUS_06690 46789 47799 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114928.1 protein_id gnl|my_center|LOCUS_06690 48566 47853 gene locus_tag LOCUS_06700 48566 47853 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142136.1 protein_id gnl|my_center|LOCUS_06700 49024 48581 gene locus_tag LOCUS_06710 gene ruvX 49024 48581 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115066.1 protein_id gnl|my_center|LOCUS_06710 49571 49017 gene locus_tag LOCUS_06720 49571 49017 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114753.1 protein_id gnl|my_center|LOCUS_06720 51489 49828 gene locus_tag LOCUS_06730 gene recN 51489 49828 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208222.1 protein_id gnl|my_center|LOCUS_06730 52018 52341 gene locus_tag LOCUS_06740 52018 52341 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_06740 52485 53237 gene locus_tag LOCUS_06750 gene rlmB 52485 53237 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079348.1 protein_id gnl|my_center|LOCUS_06750 53278 53442 gene locus_tag LOCUS_06760 53278 53442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06760 53497 54198 gene locus_tag LOCUS_06770 53497 54198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06770 54844 54245 gene locus_tag LOCUS_06780 gene coaE 54844 54245 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115011.1 protein_id gnl|my_center|LOCUS_06780 55751 54870 gene locus_tag LOCUS_06790 55751 54870 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208225.1 protein_id gnl|my_center|LOCUS_06790 56983 55754 gene locus_tag LOCUS_06800 56983 55754 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_06800 58720 57011 gene locus_tag LOCUS_06810 gene pilB 58720 57011 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 protein_id gnl|my_center|LOCUS_06810 59005 59799 gene locus_tag LOCUS_06820 gene tpiA 59005 59799 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208228.1 protein_id gnl|my_center|LOCUS_06820 59809 60150 gene locus_tag LOCUS_06830 gene secG 59809 60150 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 protein_id gnl|my_center|LOCUS_06830 60204 60288 gene locus_tag LOCUS_t00150 60204 60288 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60333 60409 gene locus_tag LOCUS_t00160 60333 60409 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 60485 60561 gene locus_tag LOCUS_t00170 60485 60561 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 60665 60741 gene locus_tag LOCUS_t00180 60665 60741 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 60943 61467 gene locus_tag LOCUS_06840 gene rimP 60943 61467 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114922.1 protein_id gnl|my_center|LOCUS_06840 61502 62986 gene locus_tag LOCUS_06850 gene nusA 61502 62986 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115134.1 protein_id gnl|my_center|LOCUS_06850 62997 65705 gene locus_tag LOCUS_06860 gene infB 62997 65705 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114697.1 protein_id gnl|my_center|LOCUS_06860 65705 66100 gene locus_tag LOCUS_06870 65705 66100 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114836.1 protein_id gnl|my_center|LOCUS_06870 66356 66946 gene locus_tag LOCUS_06880 66356 66946 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117090.1 protein_id gnl|my_center|LOCUS_06880 67024 68145 gene locus_tag LOCUS_06890 67024 68145 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207823.1 protein_id gnl|my_center|LOCUS_06890 68139 68699 gene locus_tag LOCUS_06900 68139 68699 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207822.1 protein_id gnl|my_center|LOCUS_06900 68922 69371 gene locus_tag LOCUS_06910 gene pilA 68922 69371 CDS product type 4a pilus biogenesis protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112842.1 protein_id gnl|my_center|LOCUS_06910 69418 70758 gene locus_tag LOCUS_06920 69418 70758 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229683.1 protein_id gnl|my_center|LOCUS_06920 70755 71945 gene locus_tag LOCUS_06930 70755 71945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 71935 73131 gene locus_tag LOCUS_06940 71935 73131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 73268 73705 gene locus_tag LOCUS_06950 73268 73705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 73754 74491 gene locus_tag LOCUS_06960 73754 74491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 74552 76201 gene locus_tag LOCUS_06970 74552 76201 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207819.1 protein_id gnl|my_center|LOCUS_06970 77319 76855 gene locus_tag LOCUS_06980 gene bfr 77319 76855 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207818.1 protein_id gnl|my_center|LOCUS_06980 77826 77632 gene locus_tag LOCUS_06990 77826 77632 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000629.1 protein_id gnl|my_center|LOCUS_06990 78418 78035 gene locus_tag LOCUS_07000 78418 78035 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_07000 80622 78511 gene locus_tag LOCUS_07010 80622 78511 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116807.1 protein_id gnl|my_center|LOCUS_07010 81114 80833 gene locus_tag LOCUS_07020 gene rpoZ 81114 80833 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116990.1 protein_id gnl|my_center|LOCUS_07020 81847 81227 gene locus_tag LOCUS_07030 gene gmk 81847 81227 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116973.1 protein_id gnl|my_center|LOCUS_07030 81982 82932 gene locus_tag LOCUS_07040 gene ispH 81982 82932 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116992.1 protein_id gnl|my_center|LOCUS_07040 83074 83574 gene locus_tag LOCUS_07050 83074 83574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 83611 84123 gene locus_tag LOCUS_07060 gene pilV 83611 84123 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207814.1 protein_id gnl|my_center|LOCUS_07060 84123 85115 gene locus_tag LOCUS_07070 84123 85115 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207813.1 protein_id gnl|my_center|LOCUS_07070 85112 85942 gene locus_tag LOCUS_07080 85112 85942 CDS product type IV fimbrial biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207812.1 protein_id gnl|my_center|LOCUS_07080 85958 89797 gene locus_tag LOCUS_07090 85958 89797 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207811.1 protein_id gnl|my_center|LOCUS_07090 89785 90384 gene locus_tag LOCUS_07100 89785 90384 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207810.1 protein_id gnl|my_center|LOCUS_07100 90384 90869 gene locus_tag LOCUS_07110 90384 90869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 91015 91272 gene locus_tag LOCUS_07120 gene rpsP 91015 91272 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260334.1 protein_id gnl|my_center|LOCUS_07120 91295 91843 gene locus_tag LOCUS_07130 gene rimM 91295 91843 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116736.1 protein_id gnl|my_center|LOCUS_07130 91884 92633 gene locus_tag LOCUS_07140 gene trmD 91884 92633 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116964.1 protein_id gnl|my_center|LOCUS_07140 92838 93209 gene locus_tag LOCUS_07150 gene rplS 92838 93209 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116654.1 protein_id gnl|my_center|LOCUS_07150 94607 93645 gene locus_tag LOCUS_07160 94607 93645 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207808.1 protein_id gnl|my_center|LOCUS_07160 96003 95038 gene locus_tag LOCUS_07170 96003 95038 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207808.1 protein_id gnl|my_center|LOCUS_07170 97239 96268 gene locus_tag LOCUS_07180 97239 96268 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207808.1 protein_id gnl|my_center|LOCUS_07180 98291 97308 gene locus_tag LOCUS_07190 98291 97308 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207808.1 protein_id gnl|my_center|LOCUS_07190 99357 98323 gene locus_tag LOCUS_07200 99357 98323 CDS product lipase secretion chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207807.1 protein_id gnl|my_center|LOCUS_07200 99493 100398 gene locus_tag LOCUS_07210 gene truB 99493 100398 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207806.1 protein_id gnl|my_center|LOCUS_07210 100481 101248 gene locus_tag LOCUS_07220 100481 101248 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525218.1 protein_id gnl|my_center|LOCUS_07220 101472 101885 gene locus_tag LOCUS_07230 101472 101885 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019905.1 protein_id gnl|my_center|LOCUS_07230 102882 102004 gene locus_tag LOCUS_07240 102882 102004 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207805.1 protein_id gnl|my_center|LOCUS_07240 103052 104488 gene locus_tag LOCUS_07250 103052 104488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 104504 105223 gene locus_tag LOCUS_07260 104504 105223 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028854.1 protein_id gnl|my_center|LOCUS_07260 105469 107472 gene locus_tag LOCUS_07270 105469 107472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 108385 107516 gene locus_tag LOCUS_07280 108385 107516 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207804.1 protein_id gnl|my_center|LOCUS_07280 109769 108537 gene locus_tag LOCUS_07290 gene serA 109769 108537 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 protein_id gnl|my_center|LOCUS_07290 110141 111550 gene locus_tag LOCUS_07300 110141 111550 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_07300 111688 112506 gene locus_tag LOCUS_07310 111688 112506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 112585 112956 gene locus_tag LOCUS_07320 112585 112956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207801.1 protein_id gnl|my_center|LOCUS_07320 113012 114109 gene locus_tag LOCUS_07330 gene ddlA 113012 114109 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121973253.1 protein_id gnl|my_center|LOCUS_07330 114272 114424 gene locus_tag LOCUS_07340 114272 114424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 114378 115142 gene locus_tag LOCUS_07350 114378 115142 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 protein_id gnl|my_center|LOCUS_07350 115173 116054 gene locus_tag LOCUS_07360 115173 116054 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089646.1 protein_id gnl|my_center|LOCUS_07360 116480 116088 gene locus_tag LOCUS_07370 116480 116088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 116824 118065 gene locus_tag LOCUS_07380 116824 118065 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207797.1 protein_id gnl|my_center|LOCUS_07380 118414 118127 gene locus_tag LOCUS_07390 118414 118127 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_07390 119217 118663 gene locus_tag LOCUS_07400 119217 118663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 121328 119247 gene locus_tag LOCUS_07410 gene yccS 121328 119247 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207796.1 protein_id gnl|my_center|LOCUS_07410 121580 122803 gene locus_tag LOCUS_07420 121580 122803 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104245.1 protein_id gnl|my_center|LOCUS_07420 123920 122952 gene locus_tag LOCUS_07430 gene ompT 123920 122952 CDS product omptin family outer membrane protease OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201840.1 protein_id gnl|my_center|LOCUS_07430 125454 124936 gene locus_tag LOCUS_07440 125454 124936 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207795.1 protein_id gnl|my_center|LOCUS_07440 126812 125691 gene locus_tag LOCUS_07450 126812 125691 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_07450 127558 126914 gene locus_tag LOCUS_07460 127558 126914 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804567.1 protein_id gnl|my_center|LOCUS_07460 127687 128154 gene locus_tag LOCUS_07470 127687 128154 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116954.1 protein_id gnl|my_center|LOCUS_07470 128774 128151 gene locus_tag LOCUS_07480 128774 128151 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209604823.1 protein_id gnl|my_center|LOCUS_07480 128953 129543 gene locus_tag LOCUS_07490 128953 129543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207794.1 protein_id gnl|my_center|LOCUS_07490 129624 130028 gene locus_tag LOCUS_07500 129624 130028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 130818 130264 gene locus_tag LOCUS_07510 130818 130264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067173.1 protein_id gnl|my_center|LOCUS_07510 131624 130848 gene locus_tag LOCUS_07520 131624 130848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207793.1 protein_id gnl|my_center|LOCUS_07520 131726 133003 gene locus_tag LOCUS_07530 131726 133003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207792.1 protein_id gnl|my_center|LOCUS_07530 133616 133185 gene locus_tag LOCUS_07540 133616 133185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 134845 133742 gene locus_tag LOCUS_07550 134845 133742 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521899.1 protein_id gnl|my_center|LOCUS_07550 134965 135630 gene locus_tag LOCUS_07560 134965 135630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 135777 136733 gene locus_tag LOCUS_07570 135777 136733 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_07570 137529 136858 gene locus_tag LOCUS_07580 137529 136858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 138462 137743 gene locus_tag LOCUS_07590 138462 137743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 139593 139210 gene locus_tag LOCUS_07600 139593 139210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207782.1 protein_id gnl|my_center|LOCUS_07600 141914 139845 gene locus_tag LOCUS_07610 gene glyS 141914 139845 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207776.1 protein_id gnl|my_center|LOCUS_07610 142891 141914 gene locus_tag LOCUS_07620 gene glyQ 142891 141914 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002044989.1 protein_id gnl|my_center|LOCUS_07620 143393 142998 gene locus_tag LOCUS_07630 143393 142998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 143432 143929 gene locus_tag LOCUS_07640 143432 143929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 144336 143902 gene locus_tag LOCUS_07650 144336 143902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 144364 144777 gene locus_tag LOCUS_07660 144364 144777 CDS product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207774.1 protein_id gnl|my_center|LOCUS_07660 144899 145999 gene locus_tag LOCUS_07670 144899 145999 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117107.1 protein_id gnl|my_center|LOCUS_07670 146342 146082 gene locus_tag LOCUS_07680 146342 146082 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207771.1 protein_id gnl|my_center|LOCUS_07680 146688 147350 gene locus_tag LOCUS_07690 146688 147350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207770.1 protein_id gnl|my_center|LOCUS_07690 147448 147373 gene locus_tag LOCUS_t00190 147448 147373 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 147685 147610 gene locus_tag LOCUS_t00200 147685 147610 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 147851 147776 gene locus_tag LOCUS_t00210 147851 147776 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 148015 147940 gene locus_tag LOCUS_t00220 148015 147940 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 149987 148146 gene locus_tag LOCUS_07700 149987 148146 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 protein_id gnl|my_center|LOCUS_07700 153726 150319 gene locus_tag LOCUS_07710 153726 150319 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208274.1 protein_id gnl|my_center|LOCUS_07710 154494 155432 gene locus_tag LOCUS_07720 154494 155432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 155633 156301 gene locus_tag LOCUS_07730 155633 156301 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208277.1 protein_id gnl|my_center|LOCUS_07730 156375 157085 gene locus_tag LOCUS_07740 156375 157085 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114898.1 protein_id gnl|my_center|LOCUS_07740 157125 157739 gene locus_tag LOCUS_07750 157125 157739 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208278.1 protein_id gnl|my_center|LOCUS_07750 158573 157896 gene locus_tag LOCUS_07760 158573 157896 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_07760 159769 158864 gene locus_tag LOCUS_07770 gene hcaR 159769 158864 CDS product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066014.1 protein_id gnl|my_center|LOCUS_07770 160511 160062 gene locus_tag LOCUS_07780 160511 160062 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766046.1 protein_id gnl|my_center|LOCUS_07780 160640 161578 gene locus_tag LOCUS_07790 160640 161578 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036504.1 protein_id gnl|my_center|LOCUS_07790 161581 162711 gene locus_tag LOCUS_07800 161581 162711 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208279.1 protein_id gnl|my_center|LOCUS_07800 162736 163254 gene locus_tag LOCUS_07810 162736 163254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 163322 163972 gene locus_tag LOCUS_07820 163322 163972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 164373 163975 gene locus_tag LOCUS_07830 164373 163975 CDS product DoxX-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926952.1 protein_id gnl|my_center|LOCUS_07830 164806 164351 gene locus_tag LOCUS_07840 164806 164351 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105006.1 protein_id gnl|my_center|LOCUS_07840 166418 164898 gene locus_tag LOCUS_07850 gene katA 166418 164898 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951343.1 protein_id gnl|my_center|LOCUS_07850 167583 166933 gene locus_tag LOCUS_07860 167583 166933 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195845.1 protein_id gnl|my_center|LOCUS_07860 167665 169323 gene locus_tag LOCUS_07870 167665 169323 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195844.1 protein_id gnl|my_center|LOCUS_07870 169730 169536 gene locus_tag LOCUS_07880 169730 169536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 171140 170115 gene locus_tag LOCUS_07890 171140 170115 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_07890 171468 171656 gene locus_tag LOCUS_07900 171468 171656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 173969 171675 gene locus_tag LOCUS_07910 gene ptsP 173969 171675 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208281.1 protein_id gnl|my_center|LOCUS_07910 174551 174051 gene locus_tag LOCUS_07920 174551 174051 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567255.1 protein_id gnl|my_center|LOCUS_07920 174736 175386 gene locus_tag LOCUS_07930 174736 175386 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115098.1 protein_id gnl|my_center|LOCUS_07930 175740 175982 gene locus_tag LOCUS_07940 175740 175982 CDS product DUF2789 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 protein_id gnl|my_center|LOCUS_07940 176920 176048 gene locus_tag LOCUS_07950 176920 176048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066023.1 protein_id gnl|my_center|LOCUS_07950 177114 177983 gene locus_tag LOCUS_07960 177114 177983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 178252 178010 gene locus_tag LOCUS_07970 178252 178010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 178785 180218 gene locus_tag LOCUS_07980 gene leuC 178785 180218 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208284.1 protein_id gnl|my_center|LOCUS_07980 180239 180889 gene locus_tag LOCUS_07990 gene leuD 180239 180889 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114814.1 protein_id gnl|my_center|LOCUS_07990 180996 181565 gene locus_tag LOCUS_08000 180996 181565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066026.1 protein_id gnl|my_center|LOCUS_08000 181595 182686 gene locus_tag LOCUS_08010 gene leuB 181595 182686 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208285.1 protein_id gnl|my_center|LOCUS_08010 183165 182758 gene locus_tag LOCUS_08020 183165 182758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208286.1 protein_id gnl|my_center|LOCUS_08020 183759 183538 gene locus_tag LOCUS_08030 gene infA 183759 183538 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_08030 183988 184998 gene locus_tag LOCUS_08040 183988 184998 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_08040 185889 185092 gene locus_tag LOCUS_08050 gene truA 185889 185092 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208287.1 protein_id gnl|my_center|LOCUS_08050 186872 185898 gene locus_tag LOCUS_08060 186872 185898 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208288.1 protein_id gnl|my_center|LOCUS_08060 188276 186966 gene locus_tag LOCUS_08070 188276 186966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208289.1 protein_id gnl|my_center|LOCUS_08070 189815 188325 gene locus_tag LOCUS_08080 189815 188325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208290.1 protein_id gnl|my_center|LOCUS_08080 191075 189957 gene locus_tag LOCUS_08090 gene asd 191075 189957 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208291.1 protein_id gnl|my_center|LOCUS_08090 191261 192400 gene locus_tag LOCUS_08100 191261 192400 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_08100 192714 193031 gene locus_tag LOCUS_08110 192714 193031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 193109 193558 gene locus_tag LOCUS_08120 193109 193558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 194498 193656 gene locus_tag LOCUS_08130 gene lpxL 194498 193656 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208295.1 protein_id gnl|my_center|LOCUS_08130 194707 195258 gene locus_tag LOCUS_08140 194707 195258 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 protein_id gnl|my_center|LOCUS_08140 195367 196269 gene locus_tag LOCUS_08150 195367 196269 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989636.1 protein_id gnl|my_center|LOCUS_08150 196705 196394 gene locus_tag LOCUS_08160 196705 196394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 197001 197531 gene locus_tag LOCUS_08170 197001 197531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 197543 198556 gene locus_tag LOCUS_08180 197543 198556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence05 436 209 gene locus_tag LOCUS_08190 436 209 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071638.1 protein_id gnl|my_center|LOCUS_08190 1461 532 gene locus_tag LOCUS_08200 1461 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 protein_id gnl|my_center|LOCUS_08200 2633 1578 gene locus_tag LOCUS_08210 2633 1578 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_08210 3802 2756 gene locus_tag LOCUS_08220 3802 2756 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_08220 4684 4061 gene locus_tag LOCUS_08230 4684 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5038 4727 gene locus_tag LOCUS_08240 5038 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5327 5043 gene locus_tag LOCUS_08250 5327 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7800 6070 gene locus_tag LOCUS_08260 7800 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 10371 7807 gene locus_tag LOCUS_08270 10371 7807 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479527.1 protein_id gnl|my_center|LOCUS_08270 11916 10951 gene locus_tag LOCUS_08280 11916 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 14508 12181 gene locus_tag LOCUS_08290 14508 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 15006 16109 gene locus_tag LOCUS_08300 15006 16109 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212639319.1 protein_id gnl|my_center|LOCUS_08300 16633 17751 gene locus_tag LOCUS_08310 16633 17751 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212639319.1 protein_id gnl|my_center|LOCUS_08310 18272 19627 gene locus_tag LOCUS_08320 18272 19627 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206872.1 protein_id gnl|my_center|LOCUS_08320 20309 19695 gene locus_tag LOCUS_08330 20309 19695 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_08330 20633 21682 gene locus_tag LOCUS_08340 20633 21682 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 protein_id gnl|my_center|LOCUS_08340 21679 22689 gene locus_tag LOCUS_08350 21679 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206061.1 protein_id gnl|my_center|LOCUS_08350 24817 22730 gene locus_tag LOCUS_08360 gene yuiR 24817 22730 CDS product colicin FY TonB-dependent receptor YuiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171330.1 protein_id gnl|my_center|LOCUS_08360 25740 25102 gene locus_tag LOCUS_08370 gene nfuA 25740 25102 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117617.1 protein_id gnl|my_center|LOCUS_08370 26164 27714 gene locus_tag LOCUS_08380 26164 27714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_08380 27989 28777 gene locus_tag LOCUS_08390 27989 28777 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086719.1 protein_id gnl|my_center|LOCUS_08390 28822 29742 gene locus_tag LOCUS_08400 28822 29742 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086717.1 protein_id gnl|my_center|LOCUS_08400 29783 30337 gene locus_tag LOCUS_08410 29783 30337 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 protein_id gnl|my_center|LOCUS_08410 30384 30761 gene locus_tag LOCUS_08420 30384 30761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 31336 30755 gene locus_tag LOCUS_08430 31336 30755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 32087 31497 gene locus_tag LOCUS_08440 32087 31497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 33186 32269 gene locus_tag LOCUS_08450 33186 32269 CDS product HARLDQ motif MBL-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083230.1 protein_id gnl|my_center|LOCUS_08450 34452 33310 gene locus_tag LOCUS_08460 34452 33310 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529021.1 protein_id gnl|my_center|LOCUS_08460 34924 34511 gene locus_tag LOCUS_08470 gene pgaD 34924 34511 CDS product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206026.1 protein_id gnl|my_center|LOCUS_08470 36157 34970 gene locus_tag LOCUS_08480 gene pgaC 36157 34970 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206025.1 protein_id gnl|my_center|LOCUS_08480 38202 36244 gene locus_tag LOCUS_08490 gene pgaB 38202 36244 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206024.1 protein_id gnl|my_center|LOCUS_08490 39096 38758 gene locus_tag LOCUS_08500 39096 38758 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117532.1 protein_id gnl|my_center|LOCUS_08500 40362 39124 gene locus_tag LOCUS_08510 40362 39124 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_08510 41086 40463 gene locus_tag LOCUS_08520 41086 40463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 41727 41197 gene locus_tag LOCUS_08530 41727 41197 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075397.1 protein_id gnl|my_center|LOCUS_08530 42796 41783 gene locus_tag LOCUS_08540 42796 41783 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206022.1 protein_id gnl|my_center|LOCUS_08540 43243 43470 gene locus_tag LOCUS_08550 43243 43470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 43910 43749 gene locus_tag LOCUS_08560 43910 43749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08560 44151 44014 gene locus_tag LOCUS_08570 44151 44014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 44457 44152 gene locus_tag LOCUS_08580 44457 44152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 44851 45192 gene locus_tag LOCUS_08590 44851 45192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 45817 45296 gene locus_tag LOCUS_08600 45817 45296 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_08600 47190 46204 gene locus_tag LOCUS_08610 47190 46204 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207543.1 protein_id gnl|my_center|LOCUS_08610 47332 48540 gene locus_tag LOCUS_08620 gene chrA 47332 48540 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_08620 49824 48589 gene locus_tag LOCUS_08630 gene gltS 49824 48589 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207191.1 protein_id gnl|my_center|LOCUS_08630 51597 50347 gene locus_tag LOCUS_08640 51597 50347 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207512.1 protein_id gnl|my_center|LOCUS_08640 52666 53559 gene locus_tag LOCUS_08650 52666 53559 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206822.1 protein_id gnl|my_center|LOCUS_08650 53606 55102 gene locus_tag LOCUS_08660 53606 55102 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206821.1 protein_id gnl|my_center|LOCUS_08660 55806 55153 gene locus_tag LOCUS_08670 55806 55153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 56376 55855 gene locus_tag LOCUS_08680 56376 55855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 56510 57256 gene locus_tag LOCUS_08690 56510 57256 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 protein_id gnl|my_center|LOCUS_08690 57253 57819 gene locus_tag LOCUS_08700 57253 57819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 58473 57841 gene locus_tag LOCUS_08710 58473 57841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 58581 58958 gene locus_tag LOCUS_08720 58581 58958 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205987.1 protein_id gnl|my_center|LOCUS_08720 59257 60510 gene locus_tag LOCUS_08730 59257 60510 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205985.1 protein_id gnl|my_center|LOCUS_08730 60520 64116 gene locus_tag LOCUS_08740 60520 64116 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205984.1 protein_id gnl|my_center|LOCUS_08740 64559 64161 gene locus_tag LOCUS_08750 64559 64161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 65406 64651 gene locus_tag LOCUS_08760 65406 64651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113151.1 protein_id gnl|my_center|LOCUS_08760 66422 65637 gene locus_tag LOCUS_08770 66422 65637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113151.1 protein_id gnl|my_center|LOCUS_08770 67432 66599 gene locus_tag LOCUS_08780 67432 66599 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_08780 68249 67557 gene locus_tag LOCUS_08790 68249 67557 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 protein_id gnl|my_center|LOCUS_08790 68688 69725 gene locus_tag LOCUS_08800 68688 69725 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_08800 69753 70871 gene locus_tag LOCUS_08810 69753 70871 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070855.1 protein_id gnl|my_center|LOCUS_08810 71383 70946 gene locus_tag LOCUS_08820 gene fur 71383 70946 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_08820 71496 71894 gene locus_tag LOCUS_08830 71496 71894 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121740.1 protein_id gnl|my_center|LOCUS_08830 72308 71976 gene locus_tag LOCUS_08840 72308 71976 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205982.1 protein_id gnl|my_center|LOCUS_08840 73384 72317 gene locus_tag LOCUS_08850 73384 72317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113997598.1 protein_id gnl|my_center|LOCUS_08850 74055 73600 gene locus_tag LOCUS_08860 74055 73600 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121698.1 protein_id gnl|my_center|LOCUS_08860 75170 74340 gene locus_tag LOCUS_08870 75170 74340 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 protein_id gnl|my_center|LOCUS_08870 76183 75398 gene locus_tag LOCUS_08880 76183 75398 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121744.1 protein_id gnl|my_center|LOCUS_08880 77259 76351 gene locus_tag LOCUS_08890 gene argB 77259 76351 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121716.1 protein_id gnl|my_center|LOCUS_08890 78757 77318 gene locus_tag LOCUS_08900 78757 77318 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205979.1 protein_id gnl|my_center|LOCUS_08900 79441 78989 gene locus_tag LOCUS_08910 gene dut 79441 78989 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121799.1 protein_id gnl|my_center|LOCUS_08910 81589 79550 gene locus_tag LOCUS_08920 81589 79550 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070868.1 protein_id gnl|my_center|LOCUS_08920 82677 82027 gene locus_tag LOCUS_08930 82677 82027 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070886.1 protein_id gnl|my_center|LOCUS_08930 82919 83836 gene locus_tag LOCUS_08940 82919 83836 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205978.1 protein_id gnl|my_center|LOCUS_08940 83874 84923 gene locus_tag LOCUS_08950 83874 84923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205977.1 protein_id gnl|my_center|LOCUS_08950 85065 85784 gene locus_tag LOCUS_08960 gene minC 85065 85784 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205976.1 protein_id gnl|my_center|LOCUS_08960 85851 86663 gene locus_tag LOCUS_08970 gene minD 85851 86663 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121719.1 protein_id gnl|my_center|LOCUS_08970 86666 86938 gene locus_tag LOCUS_08980 gene minE 86666 86938 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896934.1 protein_id gnl|my_center|LOCUS_08980 87160 87447 gene locus_tag LOCUS_08990 87160 87447 CDS product PA4642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121755.1 protein_id gnl|my_center|LOCUS_08990 89420 87816 gene locus_tag LOCUS_09000 89420 87816 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_09000 90056 91045 gene locus_tag LOCUS_09010 90056 91045 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_09010 91189 92517 gene locus_tag LOCUS_09020 91189 92517 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117726.1 protein_id gnl|my_center|LOCUS_09020 92906 94246 gene locus_tag LOCUS_09030 92906 94246 CDS product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117607.1 protein_id gnl|my_center|LOCUS_09030 96237 94453 gene locus_tag LOCUS_09040 96237 94453 CDS product cholesterol oxidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204858.1 protein_id gnl|my_center|LOCUS_09040 97454 96702 gene locus_tag LOCUS_09050 gene tatC 97454 96702 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114673.1 protein_id gnl|my_center|LOCUS_09050 97844 97470 gene locus_tag LOCUS_09060 97844 97470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 98029 97865 gene locus_tag LOCUS_09070 98029 97865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 98693 98193 gene locus_tag LOCUS_09080 98693 98193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206079.1 protein_id gnl|my_center|LOCUS_09080 99654 100664 gene locus_tag LOCUS_09090 99654 100664 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208299.1 protein_id gnl|my_center|LOCUS_09090 101777 100785 gene locus_tag LOCUS_09100 101777 100785 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207523.1 protein_id gnl|my_center|LOCUS_09100 102050 103552 gene locus_tag LOCUS_09110 102050 103552 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207529.1 protein_id gnl|my_center|LOCUS_09110 103726 104274 gene locus_tag LOCUS_09120 103726 104274 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206078.1 protein_id gnl|my_center|LOCUS_09120 104565 104383 gene locus_tag LOCUS_09130 104565 104383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 106645 105032 gene locus_tag LOCUS_09140 gene cysN 106645 105032 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206077.1 protein_id gnl|my_center|LOCUS_09140 107688 106774 gene locus_tag LOCUS_09150 gene cysD 107688 106774 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_09150 107831 108277 gene locus_tag LOCUS_09160 107831 108277 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064706.1 protein_id gnl|my_center|LOCUS_09160 109811 108354 gene locus_tag LOCUS_09170 109811 108354 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206075.1 protein_id gnl|my_center|LOCUS_09170 111538 110006 gene locus_tag LOCUS_09180 111538 110006 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206054.1 protein_id gnl|my_center|LOCUS_09180 118242 112132 gene locus_tag LOCUS_09190 118242 112132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 118801 122490 gene locus_tag LOCUS_09200 gene metH 118801 122490 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_09200 123009 122641 gene locus_tag LOCUS_09210 123009 122641 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_09210 123391 123098 gene locus_tag LOCUS_09220 123391 123098 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205904.1 protein_id gnl|my_center|LOCUS_09220 125062 123536 gene locus_tag LOCUS_09230 125062 123536 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205993.1 protein_id gnl|my_center|LOCUS_09230 126226 125069 gene locus_tag LOCUS_09240 126226 125069 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_09240 127088 126555 gene locus_tag LOCUS_09250 127088 126555 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205992.1 protein_id gnl|my_center|LOCUS_09250 127188 128201 gene locus_tag LOCUS_09260 gene hemB 127188 128201 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075335.1 protein_id gnl|my_center|LOCUS_09260 128497 129624 gene locus_tag LOCUS_09270 128497 129624 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205991.1 protein_id gnl|my_center|LOCUS_09270 130457 129696 gene locus_tag LOCUS_09280 130457 129696 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120057.1 protein_id gnl|my_center|LOCUS_09280 130540 131421 gene locus_tag LOCUS_09290 gene gigC 130540 131421 CDS product LysR family transcriptional regulator GigC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120024.1 protein_id gnl|my_center|LOCUS_09290 132204 131467 gene locus_tag LOCUS_09300 132204 131467 CDS product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071042.1 protein_id gnl|my_center|LOCUS_09300 133376 132261 gene locus_tag LOCUS_09310 133376 132261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 134076 133441 gene locus_tag LOCUS_09320 gene upp 134076 133441 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120045.1 protein_id gnl|my_center|LOCUS_09320 135753 134197 gene locus_tag LOCUS_09330 gene nuoN 135753 134197 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205903.1 protein_id gnl|my_center|LOCUS_09330 137372 135756 gene locus_tag LOCUS_09340 gene nuoM 137372 135756 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120006.1 protein_id gnl|my_center|LOCUS_09340 139263 137374 gene locus_tag LOCUS_09350 gene nuoL 139263 137374 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120008.1 protein_id gnl|my_center|LOCUS_09350 139568 139260 gene locus_tag LOCUS_09360 gene nuoK 139568 139260 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529822.1 protein_id gnl|my_center|LOCUS_09360 140089 139568 gene locus_tag LOCUS_09370 gene nuoJ 140089 139568 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205902.1 protein_id gnl|my_center|LOCUS_09370 140628 140086 gene locus_tag LOCUS_09380 gene nuoI 140628 140086 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172747.1 protein_id gnl|my_center|LOCUS_09380 141660 140647 gene locus_tag LOCUS_09390 gene nuoH 141660 140647 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004703499.1 protein_id gnl|my_center|LOCUS_09390 144347 141663 gene locus_tag LOCUS_09400 gene nuoG 144347 141663 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205900.1 protein_id gnl|my_center|LOCUS_09400 145690 144359 gene locus_tag LOCUS_09410 gene nuoF 145690 144359 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120030.1 protein_id gnl|my_center|LOCUS_09410 146196 145687 gene locus_tag LOCUS_09420 gene nuoE 146196 145687 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_09420 147998 146211 gene locus_tag LOCUS_09430 gene nuoC 147998 146211 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120052.1 protein_id gnl|my_center|LOCUS_09430 148762 148085 gene locus_tag LOCUS_09440 148762 148085 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120034.1 protein_id gnl|my_center|LOCUS_09440 149318 148770 gene locus_tag LOCUS_09450 gene ndhC 149318 148770 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205899.1 protein_id gnl|my_center|LOCUS_09450 150345 150695 gene locus_tag LOCUS_09460 150345 150695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205897.1 protein_id gnl|my_center|LOCUS_09460 152438 150810 gene locus_tag LOCUS_09470 gene bfmS 152438 150810 CDS product sensor histidine kinase BfmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205896.1 protein_id gnl|my_center|LOCUS_09470 153216 152503 gene locus_tag LOCUS_09480 gene bfmR 153216 152503 CDS product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_09480 153819 156644 gene locus_tag LOCUS_09490 153819 156644 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071099.1 protein_id gnl|my_center|LOCUS_09490 156776 156907 gene locus_tag LOCUS_09500 156776 156907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 157048 158331 gene locus_tag LOCUS_09510 157048 158331 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005007934.1 protein_id gnl|my_center|LOCUS_09510 159378 158449 gene locus_tag LOCUS_09520 159378 158449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 159493 163434 gene locus_tag LOCUS_09530 159493 163434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 164185 163496 gene locus_tag LOCUS_09540 164185 163496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 165708 164632 gene locus_tag LOCUS_09550 165708 164632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 166805 165681 gene locus_tag LOCUS_09560 166805 165681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 <168307 166822 gene locus_tag LOCUS_09570 <168307 166822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206344.1:type VI secretion system Vgr family protein >Feature sequence06 223 1038 gene locus_tag LOCUS_09580 223 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2861 1164 gene locus_tag LOCUS_09590 gene dld 2861 1164 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208066.1 protein_id gnl|my_center|LOCUS_09590 4301 3147 gene locus_tag LOCUS_09600 gene lldD 4301 3147 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208065.1 protein_id gnl|my_center|LOCUS_09600 5047 4304 gene locus_tag LOCUS_09610 gene lldR 5047 4304 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208064.1 protein_id gnl|my_center|LOCUS_09610 6753 5089 gene locus_tag LOCUS_09620 gene lldP 6753 5089 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208063.1 protein_id gnl|my_center|LOCUS_09620 8198 7281 gene locus_tag LOCUS_09630 8198 7281 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399570.1 protein_id gnl|my_center|LOCUS_09630 8349 9200 gene locus_tag LOCUS_09640 8349 9200 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926327.1 protein_id gnl|my_center|LOCUS_09640 9590 9264 gene locus_tag LOCUS_09650 9590 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9849 11192 gene locus_tag LOCUS_09660 gene argG 9849 11192 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206117.1 protein_id gnl|my_center|LOCUS_09660 11500 11261 gene locus_tag LOCUS_09670 11500 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 12058 11702 gene locus_tag LOCUS_09680 12058 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 12713 12231 gene locus_tag LOCUS_09690 12713 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 14521 13265 gene locus_tag LOCUS_09700 gene icd 14521 13265 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207335.1 protein_id gnl|my_center|LOCUS_09700 15103 15891 gene locus_tag LOCUS_09710 15103 15891 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067912.1 protein_id gnl|my_center|LOCUS_09710 17180 15939 gene locus_tag LOCUS_09720 17180 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 19527 17296 gene locus_tag LOCUS_09730 19527 17296 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400583.1 protein_id gnl|my_center|LOCUS_09730 20120 22582 gene locus_tag LOCUS_09740 20120 22582 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 protein_id gnl|my_center|LOCUS_09740 22731 23123 gene locus_tag LOCUS_09750 22731 23123 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_09750 23441 23187 gene locus_tag LOCUS_09760 23441 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 23737 24090 gene locus_tag LOCUS_09770 23737 24090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 24092 25828 gene locus_tag LOCUS_09780 24092 25828 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064860.1 protein_id gnl|my_center|LOCUS_09780 25825 26163 gene locus_tag LOCUS_09790 25825 26163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 26252 26776 gene locus_tag LOCUS_09800 26252 26776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 26979 26686 gene locus_tag LOCUS_09810 26979 26686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 28461 27043 gene locus_tag LOCUS_09820 28461 27043 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804132.1 protein_id gnl|my_center|LOCUS_09820 28633 28451 gene locus_tag LOCUS_09830 28633 28451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 29849 29289 gene locus_tag LOCUS_09840 29849 29289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 30695 29853 gene locus_tag LOCUS_09850 30695 29853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 30982 32364 gene locus_tag LOCUS_09860 gene ahcY 30982 32364 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073425.1 protein_id gnl|my_center|LOCUS_09860 32489 33325 gene locus_tag LOCUS_09870 gene metF 32489 33325 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207253.1 protein_id gnl|my_center|LOCUS_09870 33364 34077 gene locus_tag LOCUS_09880 33364 34077 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207254.1 protein_id gnl|my_center|LOCUS_09880 34635 37079 gene locus_tag LOCUS_09890 34635 37079 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207255.1 protein_id gnl|my_center|LOCUS_09890 37217 39487 gene locus_tag LOCUS_09900 37217 39487 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118176.1 protein_id gnl|my_center|LOCUS_09900 39596 40834 gene locus_tag LOCUS_09910 39596 40834 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207256.1 protein_id gnl|my_center|LOCUS_09910 40905 41339 gene locus_tag LOCUS_09920 40905 41339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 42722 41415 gene locus_tag LOCUS_09930 42722 41415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 43785 42811 gene locus_tag LOCUS_09940 gene epmA 43785 42811 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207420.1 protein_id gnl|my_center|LOCUS_09940 44849 43782 gene locus_tag LOCUS_09950 44849 43782 CDS product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207421.1 protein_id gnl|my_center|LOCUS_09950 45420 46115 gene locus_tag LOCUS_09960 45420 46115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206308.1 protein_id gnl|my_center|LOCUS_09960 46222 48978 gene locus_tag LOCUS_09970 gene mgtA 46222 48978 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817269.1 protein_id gnl|my_center|LOCUS_09970 50500 49085 gene locus_tag LOCUS_09980 gene sthA 50500 49085 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118117.1 protein_id gnl|my_center|LOCUS_09980 50701 51714 gene locus_tag LOCUS_09990 gene lipA 50701 51714 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207249.1 protein_id gnl|my_center|LOCUS_09990 52197 51778 gene locus_tag LOCUS_10000 52197 51778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 52930 52427 gene locus_tag LOCUS_10010 52930 52427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 53402 53803 gene locus_tag LOCUS_10020 gene uraH 53402 53803 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167347.1 protein_id gnl|my_center|LOCUS_10020 55586 53883 gene locus_tag LOCUS_10030 55586 53883 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207339.1 protein_id gnl|my_center|LOCUS_10030 55765 57033 gene locus_tag LOCUS_10040 55765 57033 CDS product D-alanyl-D-alanine carboxypeptidase PBP6B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207340.1 protein_id gnl|my_center|LOCUS_10040 57159 58445 gene locus_tag LOCUS_10050 57159 58445 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207341.1 protein_id gnl|my_center|LOCUS_10050 58589 59071 gene locus_tag LOCUS_10060 58589 59071 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_10060 59182 60612 gene locus_tag LOCUS_10070 59182 60612 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207343.1 protein_id gnl|my_center|LOCUS_10070 61128 60646 gene locus_tag LOCUS_10080 61128 60646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207361.1 protein_id gnl|my_center|LOCUS_10080 61375 61450 gene locus_tag LOCUS_t00230 61375 61450 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 61555 61882 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctacctatgcggtagtgaac 63186 62353 gene locus_tag LOCUS_10090 63186 62353 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 protein_id gnl|my_center|LOCUS_10090 63432 63875 gene locus_tag LOCUS_10100 63432 63875 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143490.1 protein_id gnl|my_center|LOCUS_10100 63886 64527 gene locus_tag LOCUS_10110 63886 64527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 64524 65513 gene locus_tag LOCUS_10120 64524 65513 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388814.1 protein_id gnl|my_center|LOCUS_10120 66240 65593 gene locus_tag LOCUS_10130 66240 65593 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_10130 67009 66284 gene locus_tag LOCUS_10140 gene pdxJ 67009 66284 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207365.1 protein_id gnl|my_center|LOCUS_10140 67760 67041 gene locus_tag LOCUS_10150 67760 67041 CDS product DNA repair protein RecO C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207366.1 protein_id gnl|my_center|LOCUS_10150 67963 67772 gene locus_tag LOCUS_10160 67963 67772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 69013 67985 gene locus_tag LOCUS_10170 gene era 69013 67985 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207367.1 protein_id gnl|my_center|LOCUS_10170 69711 69019 gene locus_tag LOCUS_10180 gene rnc 69711 69019 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067830.1 protein_id gnl|my_center|LOCUS_10180 70057 69683 gene locus_tag LOCUS_10190 70057 69683 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207369.1 protein_id gnl|my_center|LOCUS_10190 71231 70377 gene locus_tag LOCUS_10200 gene lepB 71231 70377 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207370.1 protein_id gnl|my_center|LOCUS_10200 73070 71253 gene locus_tag LOCUS_10210 gene lepA 73070 71253 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118606.1 protein_id gnl|my_center|LOCUS_10210 74180 73242 gene locus_tag LOCUS_10220 74180 73242 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974859.1 protein_id gnl|my_center|LOCUS_10220 74363 75394 gene locus_tag LOCUS_10230 74363 75394 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327747.1 protein_id gnl|my_center|LOCUS_10230 75391 77016 gene locus_tag LOCUS_10240 75391 77016 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_10240 77016 77867 gene locus_tag LOCUS_10250 77016 77867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 78458 78006 gene locus_tag LOCUS_10260 78458 78006 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_10260 79941 78556 gene locus_tag LOCUS_10270 79941 78556 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207372.1 protein_id gnl|my_center|LOCUS_10270 80188 81825 gene locus_tag LOCUS_10280 gene nadB 80188 81825 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367525.1 protein_id gnl|my_center|LOCUS_10280 82684 81908 gene locus_tag LOCUS_10290 82684 81908 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836266.1 protein_id gnl|my_center|LOCUS_10290 83079 82684 gene locus_tag LOCUS_10300 83079 82684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 84069 83194 gene locus_tag LOCUS_10310 84069 83194 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_10310 85063 84074 gene locus_tag LOCUS_10320 85063 84074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 85658 85239 gene locus_tag LOCUS_10330 85658 85239 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842533.1 protein_id gnl|my_center|LOCUS_10330 86338 85739 gene locus_tag LOCUS_10340 gene tmk 86338 85739 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207373.1 protein_id gnl|my_center|LOCUS_10340 87408 86341 gene locus_tag LOCUS_10350 gene mltG 87408 86341 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207374.1 protein_id gnl|my_center|LOCUS_10350 88222 87401 gene locus_tag LOCUS_10360 gene pabC 88222 87401 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207375.1 protein_id gnl|my_center|LOCUS_10360 88385 89395 gene locus_tag LOCUS_10370 88385 89395 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207376.1 protein_id gnl|my_center|LOCUS_10370 89437 90042 gene locus_tag LOCUS_10380 89437 90042 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118423.1 protein_id gnl|my_center|LOCUS_10380 90124 90957 gene locus_tag LOCUS_10390 gene cysT 90124 90957 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207377.1 protein_id gnl|my_center|LOCUS_10390 90954 91850 gene locus_tag LOCUS_10400 gene cysW 90954 91850 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118746.1 protein_id gnl|my_center|LOCUS_10400 91861 92922 gene locus_tag LOCUS_10410 91861 92922 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207378.1 protein_id gnl|my_center|LOCUS_10410 92980 93909 gene locus_tag LOCUS_10420 92980 93909 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 protein_id gnl|my_center|LOCUS_10420 93959 94123 gene locus_tag LOCUS_10430 93959 94123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 94120 95337 gene locus_tag LOCUS_10440 94120 95337 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207529.1 protein_id gnl|my_center|LOCUS_10440 96155 95412 gene locus_tag LOCUS_10450 gene carO 96155 95412 CDS product ornithine uptake porin CarO type 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207379.1 protein_id gnl|my_center|LOCUS_10450 96460 97281 gene locus_tag LOCUS_10460 gene dapD 96460 97281 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118664.1 protein_id gnl|my_center|LOCUS_10460 97414 98124 gene locus_tag LOCUS_10470 gene queE 97414 98124 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118723.1 protein_id gnl|my_center|LOCUS_10470 98160 98831 gene locus_tag LOCUS_10480 gene queC 98160 98831 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803840.1 protein_id gnl|my_center|LOCUS_10480 98845 99255 gene locus_tag LOCUS_10490 98845 99255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073124.1 protein_id gnl|my_center|LOCUS_10490 99319 100020 gene locus_tag LOCUS_10500 99319 100020 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207380.1 protein_id gnl|my_center|LOCUS_10500 100024 100485 gene locus_tag LOCUS_10510 100024 100485 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207381.1 protein_id gnl|my_center|LOCUS_10510 101234 100635 gene locus_tag LOCUS_10520 101234 100635 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_10520 101412 102302 gene locus_tag LOCUS_10530 101412 102302 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206103.1 protein_id gnl|my_center|LOCUS_10530 103193 102606 gene locus_tag LOCUS_10540 103193 102606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 104186 103581 gene locus_tag LOCUS_10550 gene gstA 104186 103581 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 protein_id gnl|my_center|LOCUS_10550 104284 105201 gene locus_tag LOCUS_10560 104284 105201 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973716.1 protein_id gnl|my_center|LOCUS_10560 105818 105252 gene locus_tag LOCUS_10570 105818 105252 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456641.1 protein_id gnl|my_center|LOCUS_10570 106456 105890 gene locus_tag LOCUS_10580 106456 105890 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119001.1 protein_id gnl|my_center|LOCUS_10580 106558 107358 gene locus_tag LOCUS_10590 106558 107358 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207384.1 protein_id gnl|my_center|LOCUS_10590 107458 108219 gene locus_tag LOCUS_10600 107458 108219 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_10600 108585 108268 gene locus_tag LOCUS_10610 108585 108268 CDS product NIF3 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207385.1 protein_id gnl|my_center|LOCUS_10610 109941 108637 gene locus_tag LOCUS_10620 109941 108637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 110508 110002 gene locus_tag LOCUS_10630 110508 110002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 113593 110591 gene locus_tag LOCUS_10640 gene gyrA 113593 110591 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207410.1 protein_id gnl|my_center|LOCUS_10640 114245 114003 gene locus_tag LOCUS_10650 114245 114003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 115223 114369 gene locus_tag LOCUS_10660 115223 114369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 116023 115247 gene locus_tag LOCUS_10670 116023 115247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 117668 116736 gene locus_tag LOCUS_10680 117668 116736 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267475.1 protein_id gnl|my_center|LOCUS_10680 118435 117686 gene locus_tag LOCUS_10690 118435 117686 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 protein_id gnl|my_center|LOCUS_10690 119524 118916 gene locus_tag LOCUS_10700 119524 118916 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_10700 119639 120133 gene locus_tag LOCUS_10710 119639 120133 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530158.1 protein_id gnl|my_center|LOCUS_10710 120199 120753 gene locus_tag LOCUS_10720 120199 120753 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_10720 120817 121362 gene locus_tag LOCUS_10730 120817 121362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 protein_id gnl|my_center|LOCUS_10730 121740 121369 gene locus_tag LOCUS_10740 121740 121369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 122807 122472 gene locus_tag LOCUS_10750 122807 122472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 123141 122809 gene locus_tag LOCUS_10760 123141 122809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 123897 123142 gene locus_tag LOCUS_10770 123897 123142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 124325 123891 gene locus_tag LOCUS_10780 124325 123891 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206865.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10780 125521 124595 gene locus_tag LOCUS_10790 125521 124595 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207413.1 protein_id gnl|my_center|LOCUS_10790 126450 125572 gene locus_tag LOCUS_10800 126450 125572 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_10800 126669 127151 gene locus_tag LOCUS_10810 gene rlmH 126669 127151 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206094.1 protein_id gnl|my_center|LOCUS_10810 127322 128098 gene locus_tag LOCUS_10820 127322 128098 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075524.1 protein_id gnl|my_center|LOCUS_10820 128265 129035 gene locus_tag LOCUS_10830 128265 129035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 129278 129697 gene locus_tag LOCUS_10840 129278 129697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 131137 129794 gene locus_tag LOCUS_10850 gene gdhA 131137 129794 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206092.1 protein_id gnl|my_center|LOCUS_10850 131485 132285 gene locus_tag LOCUS_10860 131485 132285 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206091.1 protein_id gnl|my_center|LOCUS_10860 132282 132959 gene locus_tag LOCUS_10870 gene nth 132282 132959 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802915.1 protein_id gnl|my_center|LOCUS_10870 133656 133306 gene locus_tag LOCUS_10880 133656 133306 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875287.1 protein_id gnl|my_center|LOCUS_10880 133981 133829 gene locus_tag LOCUS_10890 133981 133829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 134789 134136 gene locus_tag LOCUS_10900 gene adk 134789 134136 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802919.1 protein_id gnl|my_center|LOCUS_10900 136189 134873 gene locus_tag LOCUS_10910 136189 134873 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 protein_id gnl|my_center|LOCUS_10910 136789 136250 gene locus_tag LOCUS_10920 136789 136250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117557.1 protein_id gnl|my_center|LOCUS_10920 137067 139133 gene locus_tag LOCUS_10930 gene mrdA 137067 139133 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 protein_id gnl|my_center|LOCUS_10930 139126 139686 gene locus_tag LOCUS_10940 gene rsmD 139126 139686 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206088.1 protein_id gnl|my_center|LOCUS_10940 140086 139883 gene locus_tag LOCUS_10950 140086 139883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 140705 140226 gene locus_tag LOCUS_10960 140705 140226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 <150473 140982 gene locus_tag LOCUS_10970 <150473 140982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_155030721.1:Ig-like domain-containing protein >Feature sequence07 1643 291 gene locus_tag LOCUS_10980 1643 291 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206953.1 protein_id gnl|my_center|LOCUS_10980 2302 1652 gene locus_tag LOCUS_10990 2302 1652 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206952.1 protein_id gnl|my_center|LOCUS_10990 2648 3082 gene locus_tag LOCUS_11000 2648 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3134 3607 gene locus_tag LOCUS_11010 3134 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3802 3620 gene locus_tag LOCUS_11020 3802 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5417 3879 gene locus_tag LOCUS_11030 gene ilvA 5417 3879 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206951.1 protein_id gnl|my_center|LOCUS_11030 5533 6204 gene locus_tag LOCUS_11040 gene rpiA 5533 6204 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206950.1 protein_id gnl|my_center|LOCUS_11040 6290 6964 gene locus_tag LOCUS_11050 6290 6964 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206949.1 protein_id gnl|my_center|LOCUS_11050 7017 7373 gene locus_tag LOCUS_11060 7017 7373 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140136.1 protein_id gnl|my_center|LOCUS_11060 7405 7818 gene locus_tag LOCUS_11070 7405 7818 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887982.1 protein_id gnl|my_center|LOCUS_11070 7849 8295 gene locus_tag LOCUS_11080 7849 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9106 8285 gene locus_tag LOCUS_11090 9106 8285 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_11090 9863 9111 gene locus_tag LOCUS_11100 9863 9111 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206302.1 protein_id gnl|my_center|LOCUS_11100 10312 11394 gene locus_tag LOCUS_11110 10312 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 11535 12584 gene locus_tag LOCUS_11120 gene argC 11535 12584 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206947.1 protein_id gnl|my_center|LOCUS_11120 12665 13408 gene locus_tag LOCUS_11130 12665 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206946.1 protein_id gnl|my_center|LOCUS_11130 13451 13846 gene locus_tag LOCUS_11140 gene clpS 13451 13846 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121129.1 protein_id gnl|my_center|LOCUS_11140 13856 16132 gene locus_tag LOCUS_11150 gene clpA 13856 16132 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073979.1 protein_id gnl|my_center|LOCUS_11150 17111 16188 gene locus_tag LOCUS_11160 17111 16188 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195023.1 protein_id gnl|my_center|LOCUS_11160 17329 17682 gene locus_tag LOCUS_11170 17329 17682 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069026.1 protein_id gnl|my_center|LOCUS_11170 18677 17724 gene locus_tag LOCUS_11180 18677 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 19143 18913 gene locus_tag LOCUS_11190 19143 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011679.1 protein_id gnl|my_center|LOCUS_11190 20469 19387 gene locus_tag LOCUS_11200 gene trmA 20469 19387 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206575.1 protein_id gnl|my_center|LOCUS_11200 21522 20623 gene locus_tag LOCUS_11210 21522 20623 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120927.1 protein_id gnl|my_center|LOCUS_11210 22038 21610 gene locus_tag LOCUS_11220 22038 21610 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_11220 22174 22509 gene locus_tag LOCUS_11230 22174 22509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121003.1 protein_id gnl|my_center|LOCUS_11230 23504 22551 gene locus_tag LOCUS_11240 23504 22551 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254613.1 protein_id gnl|my_center|LOCUS_11240 23809 25032 gene locus_tag LOCUS_11250 23809 25032 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002055095.1 protein_id gnl|my_center|LOCUS_11250 25285 26601 gene locus_tag LOCUS_11260 25285 26601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208446.1 protein_id gnl|my_center|LOCUS_11260 26723 27952 gene locus_tag LOCUS_11270 26723 27952 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208447.1 protein_id gnl|my_center|LOCUS_11270 30204 28099 gene locus_tag LOCUS_11280 gene ppk1 30204 28099 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206067.1 protein_id gnl|my_center|LOCUS_11280 30876 30406 gene locus_tag LOCUS_11290 30876 30406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 32075 30981 gene locus_tag LOCUS_11300 32075 30981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 33213 32293 gene locus_tag LOCUS_11310 gene argF 33213 32293 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_11310 33991 33338 gene locus_tag LOCUS_11320 33991 33338 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068893.1 protein_id gnl|my_center|LOCUS_11320 34228 35112 gene locus_tag LOCUS_11330 gene prpB 34228 35112 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_11330 35117 36253 gene locus_tag LOCUS_11340 gene prpC 35117 36253 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070709.1 protein_id gnl|my_center|LOCUS_11340 36949 36314 gene locus_tag LOCUS_11350 36949 36314 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978560.1 protein_id gnl|my_center|LOCUS_11350 37145 37285 gene locus_tag LOCUS_11360 37145 37285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 37915 37328 gene locus_tag LOCUS_11370 37915 37328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 38627 37923 gene locus_tag LOCUS_11380 38627 37923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206270.1 protein_id gnl|my_center|LOCUS_11380 38988 40289 gene locus_tag LOCUS_11390 38988 40289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 41994 40324 gene locus_tag LOCUS_11400 41994 40324 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151815123.1 protein_id gnl|my_center|LOCUS_11400 42181 42396 gene locus_tag LOCUS_11410 42181 42396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 42497 42952 gene locus_tag LOCUS_11420 42497 42952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 44408 43245 gene locus_tag LOCUS_11430 44408 43245 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206583.1 protein_id gnl|my_center|LOCUS_11430 45431 44838 gene locus_tag LOCUS_11440 45431 44838 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121436.1 protein_id gnl|my_center|LOCUS_11440 45836 45453 gene locus_tag LOCUS_11450 45836 45453 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 protein_id gnl|my_center|LOCUS_11450 45976 47163 gene locus_tag LOCUS_11460 45976 47163 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206584.1 protein_id gnl|my_center|LOCUS_11460 47311 47589 gene locus_tag LOCUS_11470 47311 47589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 47718 48755 gene locus_tag LOCUS_11480 gene fba 47718 48755 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 protein_id gnl|my_center|LOCUS_11480 48890 49741 gene locus_tag LOCUS_11490 48890 49741 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207096.1 protein_id gnl|my_center|LOCUS_11490 49937 50536 gene locus_tag LOCUS_11500 49937 50536 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 protein_id gnl|my_center|LOCUS_11500 51135 50593 gene locus_tag LOCUS_11510 gene cbrC 51135 50593 CDS product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193070.1 protein_id gnl|my_center|LOCUS_11510 52214 51174 gene locus_tag LOCUS_11520 52214 51174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 53052 52414 gene locus_tag LOCUS_11530 53052 52414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 53777 53094 gene locus_tag LOCUS_11540 53777 53094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 54455 53805 gene locus_tag LOCUS_11550 54455 53805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206996.1 protein_id gnl|my_center|LOCUS_11550 54558 55052 gene locus_tag LOCUS_11560 gene ispF 54558 55052 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115651.1 protein_id gnl|my_center|LOCUS_11560 55645 55379 gene locus_tag LOCUS_11570 gene rpsT 55645 55379 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 protein_id gnl|my_center|LOCUS_11570 55859 56521 gene locus_tag LOCUS_11580 55859 56521 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206619.1 protein_id gnl|my_center|LOCUS_11580 56537 57049 gene locus_tag LOCUS_11590 gene rraA 56537 57049 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117938.1 protein_id gnl|my_center|LOCUS_11590 57093 57887 gene locus_tag LOCUS_11600 57093 57887 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_11600 57930 58412 gene locus_tag LOCUS_11610 57930 58412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 58614 59555 gene locus_tag LOCUS_11620 58614 59555 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206621.1 protein_id gnl|my_center|LOCUS_11620 59667 60023 gene locus_tag LOCUS_11630 59667 60023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206622.1 protein_id gnl|my_center|LOCUS_11630 60157 60684 gene locus_tag LOCUS_11640 60157 60684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 60727 64212 gene locus_tag LOCUS_11650 gene mfd 60727 64212 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206623.1 protein_id gnl|my_center|LOCUS_11650 64442 64876 gene locus_tag LOCUS_11660 64442 64876 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_11660 64934 66370 gene locus_tag LOCUS_11670 64934 66370 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206624.1 protein_id gnl|my_center|LOCUS_11670 66845 66507 gene locus_tag LOCUS_11680 gene fdx 66845 66507 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_11680 68722 66863 gene locus_tag LOCUS_11690 gene hscA 68722 66863 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206625.1 protein_id gnl|my_center|LOCUS_11690 69303 68788 gene locus_tag LOCUS_11700 gene hscB 69303 68788 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206626.1 protein_id gnl|my_center|LOCUS_11700 69724 69404 gene locus_tag LOCUS_11710 gene iscA 69724 69404 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117986.1 protein_id gnl|my_center|LOCUS_11710 70157 69771 gene locus_tag LOCUS_11720 gene iscU 70157 69771 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117907.1 protein_id gnl|my_center|LOCUS_11720 71483 70266 gene locus_tag LOCUS_11730 71483 70266 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206627.1 protein_id gnl|my_center|LOCUS_11730 71958 71485 gene locus_tag LOCUS_11740 71958 71485 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 protein_id gnl|my_center|LOCUS_11740 72753 72100 gene locus_tag LOCUS_11750 72753 72100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206628.1 protein_id gnl|my_center|LOCUS_11750 73036 73503 gene locus_tag LOCUS_11760 73036 73503 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069443.1 protein_id gnl|my_center|LOCUS_11760 73669 73941 gene locus_tag LOCUS_11770 73669 73941 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_11770 74123 75946 gene locus_tag LOCUS_11780 74123 75946 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206629.1 protein_id gnl|my_center|LOCUS_11780 76944 76024 gene locus_tag LOCUS_11790 76944 76024 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076206.1 protein_id gnl|my_center|LOCUS_11790 77136 78353 gene locus_tag LOCUS_11800 77136 78353 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206630.1 protein_id gnl|my_center|LOCUS_11800 78669 79148 gene locus_tag LOCUS_11810 78669 79148 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068860.1 protein_id gnl|my_center|LOCUS_11810 79582 80916 gene locus_tag LOCUS_11820 79582 80916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 81306 80995 gene locus_tag LOCUS_11830 81306 80995 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115694.1 protein_id gnl|my_center|LOCUS_11830 81668 81384 gene locus_tag LOCUS_11840 81668 81384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207003.1 protein_id gnl|my_center|LOCUS_11840 82039 81689 gene locus_tag LOCUS_11850 82039 81689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115699.1 protein_id gnl|my_center|LOCUS_11850 82451 82083 gene locus_tag LOCUS_11860 gene tusD 82451 82083 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115623.1 protein_id gnl|my_center|LOCUS_11860 82730 83749 gene locus_tag LOCUS_11870 82730 83749 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689040.1 protein_id gnl|my_center|LOCUS_11870 84033 83746 gene locus_tag LOCUS_11880 84033 83746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 84714 84112 gene locus_tag LOCUS_11890 84714 84112 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956900.1 protein_id gnl|my_center|LOCUS_11890 84957 84718 gene locus_tag LOCUS_11900 84957 84718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 86276 84957 gene locus_tag LOCUS_11910 86276 84957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 87071 86289 gene locus_tag LOCUS_11920 87071 86289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 87376 87074 gene locus_tag LOCUS_11930 87376 87074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 87843 87376 gene locus_tag LOCUS_11940 87843 87376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 88057 87851 gene locus_tag LOCUS_11950 88057 87851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 88716 88390 gene locus_tag LOCUS_11960 88716 88390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 89733 88798 gene locus_tag LOCUS_11970 89733 88798 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324795.1 protein_id gnl|my_center|LOCUS_11970 90082 89780 gene locus_tag LOCUS_11980 90082 89780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 90775 90113 gene locus_tag LOCUS_11990 90775 90113 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262505.1 protein_id gnl|my_center|LOCUS_11990 90886 91086 gene locus_tag LOCUS_12000 90886 91086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 91157 91654 gene locus_tag LOCUS_12010 91157 91654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 91703 91948 gene locus_tag LOCUS_12020 91703 91948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 91945 92241 gene locus_tag LOCUS_12030 91945 92241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 92238 93158 gene locus_tag LOCUS_12040 92238 93158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 93159 93572 gene locus_tag LOCUS_12050 93159 93572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 93575 94075 gene locus_tag LOCUS_12060 93575 94075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 94199 95509 gene locus_tag LOCUS_12070 94199 95509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 95755 95561 gene locus_tag LOCUS_12080 95755 95561 CDS product exodeoxyribonuclease VII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206229.1 protein_id gnl|my_center|LOCUS_12080 97010 95748 gene locus_tag LOCUS_12090 gene xseA 97010 95748 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206230.1 protein_id gnl|my_center|LOCUS_12090 97394 97606 gene locus_tag LOCUS_12100 97394 97606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 97637 97846 gene locus_tag LOCUS_12110 97637 97846 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070223.1 protein_id gnl|my_center|LOCUS_12110 98193 98531 gene locus_tag LOCUS_12120 98193 98531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 98700 98918 gene locus_tag LOCUS_12130 98700 98918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 99033 99248 gene locus_tag LOCUS_12140 99033 99248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 99573 99803 gene locus_tag LOCUS_12150 99573 99803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 100646 100203 gene locus_tag LOCUS_12160 100646 100203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 101052 101312 gene locus_tag LOCUS_12170 101052 101312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 101384 101542 gene locus_tag LOCUS_12180 101384 101542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 101603 102307 gene locus_tag LOCUS_12190 101603 102307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 102376 102765 gene locus_tag LOCUS_12200 102376 102765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 102928 103569 gene locus_tag LOCUS_12210 102928 103569 CDS product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095975.1 protein_id gnl|my_center|LOCUS_12210 103628 104092 gene locus_tag LOCUS_12220 103628 104092 CDS product DUF2280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267982.1 protein_id gnl|my_center|LOCUS_12220 104082 105485 gene locus_tag LOCUS_12230 gene terL 104082 105485 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 protein_id gnl|my_center|LOCUS_12230 105403 106944 gene locus_tag LOCUS_12240 105403 106944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 106952 108154 gene locus_tag LOCUS_12250 106952 108154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 108381 109340 gene locus_tag LOCUS_12260 108381 109340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 109343 109720 gene locus_tag LOCUS_12270 109343 109720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 109733 110809 gene locus_tag LOCUS_12280 109733 110809 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907461.1 protein_id gnl|my_center|LOCUS_12280 110820 111188 gene locus_tag LOCUS_12290 110820 111188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 111197 111631 gene locus_tag LOCUS_12300 111197 111631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 111638 112135 gene locus_tag LOCUS_12310 111638 112135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 112110 112532 gene locus_tag LOCUS_12320 112110 112532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 112541 112708 gene locus_tag LOCUS_12330 112541 112708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 112701 113435 gene locus_tag LOCUS_12340 112701 113435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 113500 114060 gene locus_tag LOCUS_12350 113500 114060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 114121 114402 gene locus_tag LOCUS_12360 114121 114402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 114405 114743 gene locus_tag LOCUS_12370 114405 114743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 114805 118668 gene locus_tag LOCUS_12380 114805 118668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 118671 119084 gene locus_tag LOCUS_12390 118671 119084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 119074 121035 gene locus_tag LOCUS_12400 119074 121035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 121046 122662 gene locus_tag LOCUS_12410 121046 122662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 122714 123943 gene locus_tag LOCUS_12420 122714 123943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 123936 124289 gene locus_tag LOCUS_12430 123936 124289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 124286 124687 gene locus_tag LOCUS_12440 124286 124687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 124704 126713 gene locus_tag LOCUS_12450 124704 126713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 126706 126936 gene locus_tag LOCUS_12460 126706 126936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 126998 127279 gene locus_tag LOCUS_12470 126998 127279 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155240.1 protein_id gnl|my_center|LOCUS_12470 127276 128067 gene locus_tag LOCUS_12480 127276 128067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 128677 128198 gene locus_tag LOCUS_12490 128677 128198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 130932 128956 gene locus_tag LOCUS_12500 130932 128956 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206337.1 protein_id gnl|my_center|LOCUS_12500 131740 131048 gene locus_tag LOCUS_12510 131740 131048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 133113 131818 gene locus_tag LOCUS_12520 133113 131818 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115586.1 protein_id gnl|my_center|LOCUS_12520 133727 133110 gene locus_tag LOCUS_12530 gene umuD 133727 133110 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069871.1 protein_id gnl|my_center|LOCUS_12530 134465 133821 gene locus_tag LOCUS_12540 134465 133821 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206972.1 protein_id gnl|my_center|LOCUS_12540 134941 135945 gene locus_tag LOCUS_12550 gene galE 134941 135945 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207002.1 protein_id gnl|my_center|LOCUS_12550 136108 137502 gene locus_tag LOCUS_12560 gene fumC 136108 137502 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207001.1 protein_id gnl|my_center|LOCUS_12560 137778 137626 gene locus_tag LOCUS_12570 137778 137626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 138008 138289 gene locus_tag LOCUS_12580 138008 138289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 138796 138353 gene locus_tag LOCUS_12590 138796 138353 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206997.1 protein_id gnl|my_center|LOCUS_12590 138829 139017 gene locus_tag LOCUS_12600 138829 139017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 139197 139661 gene locus_tag LOCUS_12610 139197 139661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 140265 139888 gene locus_tag LOCUS_12620 140265 139888 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225660.1 protein_id gnl|my_center|LOCUS_12620 140364 140900 gene locus_tag LOCUS_12630 140364 140900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12630 140833 141195 gene locus_tag LOCUS_12640 140833 141195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12640 141548 142039 gene locus_tag LOCUS_12650 141548 142039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115670.1 protein_id gnl|my_center|LOCUS_12650 142584 143186 gene locus_tag LOCUS_12660 142584 143186 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707008.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence08 197 751 gene locus_tag LOCUS_12670 gene frr 197 751 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115638.1 protein_id gnl|my_center|LOCUS_12670 760 1509 gene locus_tag LOCUS_12680 gene uppS 760 1509 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115643.1 protein_id gnl|my_center|LOCUS_12680 1512 2336 gene locus_tag LOCUS_12690 1512 2336 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206990.1 protein_id gnl|my_center|LOCUS_12690 2337 3533 gene locus_tag LOCUS_12700 gene ispC 2337 3533 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206989.1 protein_id gnl|my_center|LOCUS_12700 3536 4891 gene locus_tag LOCUS_12710 gene rseP 3536 4891 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_12710 4928 7456 gene locus_tag LOCUS_12720 gene bamA 4928 7456 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206986.1 protein_id gnl|my_center|LOCUS_12720 7499 7984 gene locus_tag LOCUS_12730 7499 7984 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206985.1 protein_id gnl|my_center|LOCUS_12730 7988 9058 gene locus_tag LOCUS_12740 gene lpxD 7988 9058 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206984.1 protein_id gnl|my_center|LOCUS_12740 9061 9546 gene locus_tag LOCUS_12750 gene fabZ 9061 9546 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115603.1 protein_id gnl|my_center|LOCUS_12750 9543 10331 gene locus_tag LOCUS_12760 gene lpxA 9543 10331 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206983.1 protein_id gnl|my_center|LOCUS_12760 11355 10411 gene locus_tag LOCUS_12770 11355 10411 CDS product YbgF trimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206981.1 protein_id gnl|my_center|LOCUS_12770 12327 13439 gene locus_tag LOCUS_12780 12327 13439 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207246.1 protein_id gnl|my_center|LOCUS_12780 14481 13891 gene locus_tag LOCUS_12790 14481 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 16013 14634 gene locus_tag LOCUS_12800 16013 14634 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272619.1 protein_id gnl|my_center|LOCUS_12800 16914 16066 gene locus_tag LOCUS_12810 16914 16066 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272620.1 protein_id gnl|my_center|LOCUS_12810 18105 17062 gene locus_tag LOCUS_12820 gene recA 18105 17062 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115680.1 protein_id gnl|my_center|LOCUS_12820 18711 18265 gene locus_tag LOCUS_12830 18711 18265 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068915.1 protein_id gnl|my_center|LOCUS_12830 19384 18689 gene locus_tag LOCUS_12840 19384 18689 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206980.1 protein_id gnl|my_center|LOCUS_12840 20189 20443 gene locus_tag LOCUS_12850 20189 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 20947 21798 gene locus_tag LOCUS_12860 20947 21798 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206618.1 protein_id gnl|my_center|LOCUS_12860 21903 22631 gene locus_tag LOCUS_12870 21903 22631 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_12870 22938 25976 gene locus_tag LOCUS_12880 22938 25976 CDS product M66 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776990.1 protein_id gnl|my_center|LOCUS_12880 26648 26091 gene locus_tag LOCUS_12890 26648 26091 CDS product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 protein_id gnl|my_center|LOCUS_12890 27781 26690 gene locus_tag LOCUS_12900 27781 26690 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206644.1 protein_id gnl|my_center|LOCUS_12900 28802 27924 gene locus_tag LOCUS_12910 28802 27924 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206645.1 protein_id gnl|my_center|LOCUS_12910 30613 29123 gene locus_tag LOCUS_12920 30613 29123 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_12920 32108 30636 gene locus_tag LOCUS_12930 32108 30636 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205898.1 protein_id gnl|my_center|LOCUS_12930 32362 32856 gene locus_tag LOCUS_12940 32362 32856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207023.1 protein_id gnl|my_center|LOCUS_12940 34358 32994 gene locus_tag LOCUS_12950 gene accC 34358 32994 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115704.1 protein_id gnl|my_center|LOCUS_12950 34794 34375 gene locus_tag LOCUS_12960 gene accB 34794 34375 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354611.1 protein_id gnl|my_center|LOCUS_12960 35267 34812 gene locus_tag LOCUS_12970 gene aroQ 35267 34812 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068810.1 protein_id gnl|my_center|LOCUS_12970 36819 35503 gene locus_tag LOCUS_12980 36819 35503 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115586.1 protein_id gnl|my_center|LOCUS_12980 38687 37485 gene locus_tag LOCUS_12990 38687 37485 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 protein_id gnl|my_center|LOCUS_12990 39310 38771 gene locus_tag LOCUS_13000 39310 38771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 39477 39815 gene locus_tag LOCUS_13010 39477 39815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 39832 40212 gene locus_tag LOCUS_13020 39832 40212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 40739 41170 gene locus_tag LOCUS_13030 gene hpaR 40739 41170 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093470.1 protein_id gnl|my_center|LOCUS_13030 42374 41616 gene locus_tag LOCUS_13040 gene dsbG 42374 41616 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039720.1 protein_id gnl|my_center|LOCUS_13040 43268 42432 gene locus_tag LOCUS_13050 43268 42432 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172934.1 protein_id gnl|my_center|LOCUS_13050 45283 43265 gene locus_tag LOCUS_13060 gene dsbD 45283 43265 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207940.1 protein_id gnl|my_center|LOCUS_13060 45799 45374 gene locus_tag LOCUS_13070 45799 45374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 46318 48927 gene locus_tag LOCUS_13080 gene pepN 46318 48927 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207081.1 protein_id gnl|my_center|LOCUS_13080 49291 49010 gene locus_tag LOCUS_13090 49291 49010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 49616 49831 gene locus_tag LOCUS_13100 49616 49831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 50085 50954 gene locus_tag LOCUS_13110 50085 50954 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030772.1 protein_id gnl|my_center|LOCUS_13110 51035 51259 gene locus_tag LOCUS_13120 51035 51259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115208.1 protein_id gnl|my_center|LOCUS_13120 52139 52483 gene locus_tag LOCUS_13130 52139 52483 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087001.1 protein_id gnl|my_center|LOCUS_13130 52505 53101 gene locus_tag LOCUS_13140 52505 53101 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972227.1 protein_id gnl|my_center|LOCUS_13140 57299 53547 gene locus_tag LOCUS_13150 gene putA 57299 53547 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206577.1 protein_id gnl|my_center|LOCUS_13150 57420 57923 gene locus_tag LOCUS_13160 57420 57923 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206578.1 protein_id gnl|my_center|LOCUS_13160 59469 57964 gene locus_tag LOCUS_13170 gene putP 59469 57964 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206579.1 protein_id gnl|my_center|LOCUS_13170 59849 61306 gene locus_tag LOCUS_13180 gene aspA 59849 61306 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460458.1 protein_id gnl|my_center|LOCUS_13180 61440 62438 gene locus_tag LOCUS_13190 61440 62438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 63196 62492 gene locus_tag LOCUS_13200 63196 62492 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206580.1 protein_id gnl|my_center|LOCUS_13200 63369 65354 gene locus_tag LOCUS_13210 63369 65354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 65351 67378 gene locus_tag LOCUS_13220 65351 67378 CDS product DUF4034 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434232.1 protein_id gnl|my_center|LOCUS_13220 68068 67733 gene locus_tag LOCUS_13230 68068 67733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 69465 68167 gene locus_tag LOCUS_13240 69465 68167 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206689.1 protein_id gnl|my_center|LOCUS_13240 70064 72907 gene locus_tag LOCUS_13250 70064 72907 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206344.1 protein_id gnl|my_center|LOCUS_13250 72910 74223 gene locus_tag LOCUS_13260 72910 74223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 74232 74711 gene locus_tag LOCUS_13270 74232 74711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 74984 75400 gene locus_tag LOCUS_13280 74984 75400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 76833 75607 gene locus_tag LOCUS_13290 gene benE 76833 75607 CDS product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_13290 77678 76893 gene locus_tag LOCUS_13300 77678 76893 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206211.1 protein_id gnl|my_center|LOCUS_13300 78721 77705 gene locus_tag LOCUS_13310 gene benC 78721 77705 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206212.1 protein_id gnl|my_center|LOCUS_13310 79326 78817 gene locus_tag LOCUS_13320 gene benB 79326 78817 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206213.1 protein_id gnl|my_center|LOCUS_13320 80723 79323 gene locus_tag LOCUS_13330 gene benA 80723 79323 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119889.1 protein_id gnl|my_center|LOCUS_13330 81720 80800 gene locus_tag LOCUS_13340 gene catA 81720 80800 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113693.1 protein_id gnl|my_center|LOCUS_13340 82001 82924 gene locus_tag LOCUS_13350 82001 82924 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206214.1 protein_id gnl|my_center|LOCUS_13350 83427 84791 gene locus_tag LOCUS_13360 83427 84791 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_13360 84869 86140 gene locus_tag LOCUS_13370 84869 86140 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206454.1 protein_id gnl|my_center|LOCUS_13370 87127 86216 gene locus_tag LOCUS_13380 87127 86216 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120883.1 protein_id gnl|my_center|LOCUS_13380 87687 87136 gene locus_tag LOCUS_13390 87687 87136 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206944.1 protein_id gnl|my_center|LOCUS_13390 87853 89877 gene locus_tag LOCUS_13400 87853 89877 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206943.1 protein_id gnl|my_center|LOCUS_13400 89966 90376 gene locus_tag LOCUS_13410 89966 90376 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206942.1 protein_id gnl|my_center|LOCUS_13410 90453 91538 gene locus_tag LOCUS_13420 90453 91538 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206940.1 protein_id gnl|my_center|LOCUS_13420 92511 92047 gene locus_tag LOCUS_13430 92511 92047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206938.1 protein_id gnl|my_center|LOCUS_13430 92741 94381 gene locus_tag LOCUS_13440 92741 94381 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121060.1 protein_id gnl|my_center|LOCUS_13440 94409 95266 gene locus_tag LOCUS_13450 gene kdsA 94409 95266 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121042.1 protein_id gnl|my_center|LOCUS_13450 95312 96601 gene locus_tag LOCUS_13460 gene eno 95312 96601 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121066.1 protein_id gnl|my_center|LOCUS_13460 96612 96998 gene locus_tag LOCUS_13470 gene ftsB 96612 96998 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121014.1 protein_id gnl|my_center|LOCUS_13470 96961 97686 gene locus_tag LOCUS_13480 gene ispD 96961 97686 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206935.1 protein_id gnl|my_center|LOCUS_13480 97788 98924 gene locus_tag LOCUS_13490 gene rodA 97788 98924 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068220.1 protein_id gnl|my_center|LOCUS_13490 99440 100708 gene locus_tag LOCUS_13500 gene dadA 99440 100708 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098274.1 protein_id gnl|my_center|LOCUS_13500 100729 101385 gene locus_tag LOCUS_13510 100729 101385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 101787 102275 gene locus_tag LOCUS_13520 101787 102275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 102609 103853 gene locus_tag LOCUS_13530 102609 103853 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115716.1 protein_id gnl|my_center|LOCUS_13530 104598 103945 gene locus_tag LOCUS_13540 gene nfsB 104598 103945 CDS product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207095.1 protein_id gnl|my_center|LOCUS_13540 104871 105080 gene locus_tag LOCUS_13550 104871 105080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 105793 105071 gene locus_tag LOCUS_13560 105793 105071 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207093.1 protein_id gnl|my_center|LOCUS_13560 106401 105892 gene locus_tag LOCUS_13570 106401 105892 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122280.1 protein_id gnl|my_center|LOCUS_13570 106569 108290 gene locus_tag LOCUS_13580 106569 108290 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207092.1 protein_id gnl|my_center|LOCUS_13580 108428 108748 gene locus_tag LOCUS_13590 108428 108748 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_13590 109851 108949 gene locus_tag LOCUS_13600 109851 108949 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037803.1 protein_id gnl|my_center|LOCUS_13600 109954 111006 gene locus_tag LOCUS_13610 109954 111006 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057648430.1 protein_id gnl|my_center|LOCUS_13610 111117 111563 gene locus_tag LOCUS_13620 111117 111563 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114199.1 protein_id gnl|my_center|LOCUS_13620 112199 111663 gene locus_tag LOCUS_13630 112199 111663 CDS product lecithin retinol acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206573.1 protein_id gnl|my_center|LOCUS_13630 112382 113137 gene locus_tag LOCUS_13640 112382 113137 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206574.1 protein_id gnl|my_center|LOCUS_13640 113456 113211 gene locus_tag LOCUS_13650 113456 113211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 114869 113628 gene locus_tag LOCUS_13660 114869 113628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 115565 116203 gene locus_tag LOCUS_13670 115565 116203 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206451.1 protein_id gnl|my_center|LOCUS_13670 116263 116952 gene locus_tag LOCUS_13680 116263 116952 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206453.1 protein_id gnl|my_center|LOCUS_13680 119279 117078 gene locus_tag LOCUS_13690 gene plsB 119279 117078 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207756.1 protein_id gnl|my_center|LOCUS_13690 119513 120511 gene locus_tag LOCUS_13700 gene cysK 119513 120511 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208137.1 protein_id gnl|my_center|LOCUS_13700 121249 120755 gene locus_tag LOCUS_13710 121249 120755 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208138.1 protein_id gnl|my_center|LOCUS_13710 121608 121940 gene locus_tag LOCUS_13720 121608 121940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence09 1662 169 gene locus_tag LOCUS_13730 gene trpE 1662 169 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804103.1 protein_id gnl|my_center|LOCUS_13730 2460 1792 gene locus_tag LOCUS_13740 2460 1792 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208197.1 protein_id gnl|my_center|LOCUS_13740 3347 2589 gene locus_tag LOCUS_13750 3347 2589 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208196.1 protein_id gnl|my_center|LOCUS_13750 5758 3521 gene locus_tag LOCUS_13760 gene gspD 5758 3521 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 protein_id gnl|my_center|LOCUS_13760 6651 5800 gene locus_tag LOCUS_13770 6651 5800 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079413.1 protein_id gnl|my_center|LOCUS_13770 7394 6651 gene locus_tag LOCUS_13780 gene gspN 7394 6651 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208194.1 protein_id gnl|my_center|LOCUS_13780 7881 7558 gene locus_tag LOCUS_13790 7881 7558 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 protein_id gnl|my_center|LOCUS_13790 8548 8111 gene locus_tag LOCUS_13800 8548 8111 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208193.1 protein_id gnl|my_center|LOCUS_13800 9751 8558 gene locus_tag LOCUS_13810 9751 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208192.1 protein_id gnl|my_center|LOCUS_13810 10586 9756 gene locus_tag LOCUS_13820 10586 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208191.1 protein_id gnl|my_center|LOCUS_13820 11365 10583 gene locus_tag LOCUS_13830 11365 10583 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208190.1 protein_id gnl|my_center|LOCUS_13830 12305 11376 gene locus_tag LOCUS_13840 gene hemC 12305 11376 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 protein_id gnl|my_center|LOCUS_13840 13136 12399 gene locus_tag LOCUS_13850 13136 12399 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 protein_id gnl|my_center|LOCUS_13850 14205 13189 gene locus_tag LOCUS_13860 14205 13189 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208187.1 protein_id gnl|my_center|LOCUS_13860 14340 15770 gene locus_tag LOCUS_13870 gene argH 14340 15770 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121138.1 protein_id gnl|my_center|LOCUS_13870 15782 16051 gene locus_tag LOCUS_13880 15782 16051 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089995.1 protein_id gnl|my_center|LOCUS_13880 17343 16705 gene locus_tag LOCUS_13890 17343 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_13890 17563 18564 gene locus_tag LOCUS_13900 17563 18564 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_13900 18848 19540 gene locus_tag LOCUS_13910 gene aqpZ 18848 19540 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207869.1 protein_id gnl|my_center|LOCUS_13910 19902 19657 gene locus_tag LOCUS_13920 19902 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207871.1 protein_id gnl|my_center|LOCUS_13920 21139 20093 gene locus_tag LOCUS_13930 21139 20093 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207873.1 protein_id gnl|my_center|LOCUS_13930 23752 21872 gene locus_tag LOCUS_13940 23752 21872 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207874.1 protein_id gnl|my_center|LOCUS_13940 23873 23963 gene locus_tag LOCUS_t00240 23873 23963 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24454 24131 gene locus_tag LOCUS_13950 24454 24131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 24424 24990 gene locus_tag LOCUS_13960 24424 24990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 25132 28077 gene locus_tag LOCUS_13970 25132 28077 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939035.1 protein_id gnl|my_center|LOCUS_13970 28080 29885 gene locus_tag LOCUS_13980 28080 29885 CDS product response regulator receiver domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530590.1 protein_id gnl|my_center|LOCUS_13980 30954 29890 gene locus_tag LOCUS_13990 30954 29890 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_13990 32028 31138 gene locus_tag LOCUS_14000 32028 31138 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_14000 32310 32146 gene locus_tag LOCUS_14010 32310 32146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 33044 33298 gene locus_tag LOCUS_14020 33044 33298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 33431 33655 gene locus_tag LOCUS_14030 33431 33655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 33704 34288 gene locus_tag LOCUS_14040 33704 34288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 34797 34426 gene locus_tag LOCUS_14050 34797 34426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 35053 35280 gene locus_tag LOCUS_14060 35053 35280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 35947 36022 gene locus_tag LOCUS_t00250 35947 36022 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36950 36135 gene locus_tag LOCUS_14070 36950 36135 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207892.1 protein_id gnl|my_center|LOCUS_14070 38303 37005 gene locus_tag LOCUS_14080 38303 37005 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207893.1 protein_id gnl|my_center|LOCUS_14080 39898 39023 gene locus_tag LOCUS_14090 39898 39023 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207894.1 protein_id gnl|my_center|LOCUS_14090 40175 40801 gene locus_tag LOCUS_14100 gene ycaC 40175 40801 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046156.1 protein_id gnl|my_center|LOCUS_14100 40919 41842 gene locus_tag LOCUS_14110 40919 41842 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207895.1 protein_id gnl|my_center|LOCUS_14110 42471 41908 gene locus_tag LOCUS_14120 gene ahpC 42471 41908 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206206.1 protein_id gnl|my_center|LOCUS_14120 42671 43006 gene locus_tag LOCUS_14130 42671 43006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206662.1 protein_id gnl|my_center|LOCUS_14130 44055 43180 gene locus_tag LOCUS_14140 44055 43180 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206678.1 protein_id gnl|my_center|LOCUS_14140 44238 45143 gene locus_tag LOCUS_14150 44238 45143 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206677.1 protein_id gnl|my_center|LOCUS_14150 45876 45292 gene locus_tag LOCUS_14160 45876 45292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 47289 45928 gene locus_tag LOCUS_14170 47289 45928 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207901.1 protein_id gnl|my_center|LOCUS_14170 48517 47432 gene locus_tag LOCUS_14180 48517 47432 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121988.1 protein_id gnl|my_center|LOCUS_14180 48752 49423 gene locus_tag LOCUS_14190 gene tenA 48752 49423 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066884.1 protein_id gnl|my_center|LOCUS_14190 49536 49832 gene locus_tag LOCUS_14200 49536 49832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 51976 50144 gene locus_tag LOCUS_14210 51976 50144 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258464.1 protein_id gnl|my_center|LOCUS_14210 52379 53692 gene locus_tag LOCUS_14220 gene mdtD 52379 53692 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208151.1 protein_id gnl|my_center|LOCUS_14220 53735 54703 gene locus_tag LOCUS_14230 53735 54703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122551.1 protein_id gnl|my_center|LOCUS_14230 54726 55460 gene locus_tag LOCUS_14240 54726 55460 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208150.1 protein_id gnl|my_center|LOCUS_14240 55602 56633 gene locus_tag LOCUS_14250 gene dinB 55602 56633 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208149.1 protein_id gnl|my_center|LOCUS_14250 57236 56622 gene locus_tag LOCUS_14260 57236 56622 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207415.1 protein_id gnl|my_center|LOCUS_14260 57906 57265 gene locus_tag LOCUS_14270 57906 57265 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208119.1 protein_id gnl|my_center|LOCUS_14270 58055 58501 gene locus_tag LOCUS_14280 58055 58501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 58988 58590 gene locus_tag LOCUS_14290 58988 58590 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208118.1 protein_id gnl|my_center|LOCUS_14290 60085 59138 gene locus_tag LOCUS_14300 60085 59138 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208117.1 protein_id gnl|my_center|LOCUS_14300 60631 60350 gene locus_tag LOCUS_14310 60631 60350 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 protein_id gnl|my_center|LOCUS_14310 60967 60788 gene locus_tag LOCUS_14320 60967 60788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14320 61381 60986 gene locus_tag LOCUS_14330 61381 60986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 61946 61404 gene locus_tag LOCUS_14340 61946 61404 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208116.1 protein_id gnl|my_center|LOCUS_14340 63970 62267 gene locus_tag LOCUS_14350 gene recJ 63970 62267 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207923.1 protein_id gnl|my_center|LOCUS_14350 64627 63971 gene locus_tag LOCUS_14360 gene pdxH 64627 63971 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207924.1 protein_id gnl|my_center|LOCUS_14360 65992 64661 gene locus_tag LOCUS_14370 gene glmM 65992 64661 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207925.1 protein_id gnl|my_center|LOCUS_14370 67576 66110 gene locus_tag LOCUS_14380 gene guaB 67576 66110 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121951.1 protein_id gnl|my_center|LOCUS_14380 68147 67878 gene locus_tag LOCUS_14390 68147 67878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 69131 68334 gene locus_tag LOCUS_14400 69131 68334 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207926.1 protein_id gnl|my_center|LOCUS_14400 69926 69348 gene locus_tag LOCUS_14410 69926 69348 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 protein_id gnl|my_center|LOCUS_14410 72300 70309 gene locus_tag LOCUS_14420 72300 70309 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207930.1 protein_id gnl|my_center|LOCUS_14420 75008 72300 gene locus_tag LOCUS_14430 gene aceE 75008 72300 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207931.1 protein_id gnl|my_center|LOCUS_14430 75968 75291 gene locus_tag LOCUS_14440 75968 75291 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121983.1 protein_id gnl|my_center|LOCUS_14440 76074 76523 gene locus_tag LOCUS_14450 76074 76523 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121887.1 protein_id gnl|my_center|LOCUS_14450 77524 76622 gene locus_tag LOCUS_14460 gene lpxC 77524 76622 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121967.1 protein_id gnl|my_center|LOCUS_14460 78843 77650 gene locus_tag LOCUS_14470 gene ftsZ 78843 77650 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121912.1 protein_id gnl|my_center|LOCUS_14470 80269 79007 gene locus_tag LOCUS_14480 gene ftsA 80269 79007 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207932.1 protein_id gnl|my_center|LOCUS_14480 81187 80333 gene locus_tag LOCUS_14490 81187 80333 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207933.1 protein_id gnl|my_center|LOCUS_14490 82120 81191 gene locus_tag LOCUS_14500 82120 81191 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066802.1 protein_id gnl|my_center|LOCUS_14500 83652 82204 gene locus_tag LOCUS_14510 gene murC 83652 82204 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122011.1 protein_id gnl|my_center|LOCUS_14510 84763 83666 gene locus_tag LOCUS_14520 gene murG 84763 83666 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078668.1 protein_id gnl|my_center|LOCUS_14520 86030 85086 gene locus_tag LOCUS_14530 gene gshB 86030 85086 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207934.1 protein_id gnl|my_center|LOCUS_14530 86141 86341 gene locus_tag LOCUS_14540 86141 86341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 86375 87070 gene locus_tag LOCUS_14550 86375 87070 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496768.1 protein_id gnl|my_center|LOCUS_14550 87095 87814 gene locus_tag LOCUS_14560 87095 87814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 88539 88006 gene locus_tag LOCUS_14570 88539 88006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 89265 88615 gene locus_tag LOCUS_14580 gene pyrE 89265 88615 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211305.1 protein_id gnl|my_center|LOCUS_14580 89306 90124 gene locus_tag LOCUS_14590 89306 90124 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122009.1 protein_id gnl|my_center|LOCUS_14590 90627 90983 gene locus_tag LOCUS_14600 90627 90983 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_14600 91486 91055 gene locus_tag LOCUS_14610 91486 91055 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121971.1 protein_id gnl|my_center|LOCUS_14610 91646 92554 gene locus_tag LOCUS_14620 91646 92554 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004790086.1 protein_id gnl|my_center|LOCUS_14620 93220 93825 gene locus_tag LOCUS_14630 93220 93825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 94000 95187 gene locus_tag LOCUS_14640 94000 95187 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207939.1 protein_id gnl|my_center|LOCUS_14640 95880 95197 gene locus_tag LOCUS_14650 95880 95197 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 protein_id gnl|my_center|LOCUS_14650 96777 96010 gene locus_tag LOCUS_14660 96777 96010 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207941.1 protein_id gnl|my_center|LOCUS_14660 97335 96793 gene locus_tag LOCUS_14670 97335 96793 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066773.1 protein_id gnl|my_center|LOCUS_14670 97865 97512 gene locus_tag LOCUS_14680 97865 97512 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985299.1 protein_id gnl|my_center|LOCUS_14680 98365 99087 gene locus_tag LOCUS_14690 98365 99087 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_14690 99199 99717 gene locus_tag LOCUS_14700 99199 99717 CDS product L-methionine sulfoximine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099390.1 protein_id gnl|my_center|LOCUS_14700 99880 100620 gene locus_tag LOCUS_14710 99880 100620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207885.1 protein_id gnl|my_center|LOCUS_14710 101382 100684 gene locus_tag LOCUS_14720 gene urtE 101382 100684 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816777.1 protein_id gnl|my_center|LOCUS_14720 102232 101396 gene locus_tag LOCUS_14730 gene urtD 102232 101396 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105136.1 protein_id gnl|my_center|LOCUS_14730 103302 102232 gene locus_tag LOCUS_14740 gene urtC 103302 102232 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112319.1 protein_id gnl|my_center|LOCUS_14740 104956 103307 gene locus_tag LOCUS_14750 gene urtB 104956 103307 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105141.1 protein_id gnl|my_center|LOCUS_14750 106344 105055 gene locus_tag LOCUS_14760 gene urtA 106344 105055 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_14760 108832 106952 gene locus_tag LOCUS_14770 gene parE 108832 106952 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122026.1 protein_id gnl|my_center|LOCUS_14770 109433 108849 gene locus_tag LOCUS_14780 109433 108849 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207947.1 protein_id gnl|my_center|LOCUS_14780 109677 111008 gene locus_tag LOCUS_14790 109677 111008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121854.1 protein_id gnl|my_center|LOCUS_14790 111574 111062 gene locus_tag LOCUS_14800 111574 111062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence10 439 1314 gene locus_tag LOCUS_14810 439 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2187 1384 gene locus_tag LOCUS_14820 2187 1384 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482660.1 protein_id gnl|my_center|LOCUS_14820 2807 2265 gene locus_tag LOCUS_14830 2807 2265 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330816.1 protein_id gnl|my_center|LOCUS_14830 4721 3480 gene locus_tag LOCUS_14840 4721 3480 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207962.1 protein_id gnl|my_center|LOCUS_14840 6278 4941 gene locus_tag LOCUS_14850 6278 4941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208101.1 protein_id gnl|my_center|LOCUS_14850 7452 6427 gene locus_tag LOCUS_14860 7452 6427 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208100.1 protein_id gnl|my_center|LOCUS_14860 8241 7468 gene locus_tag LOCUS_14870 8241 7468 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002069758.1 protein_id gnl|my_center|LOCUS_14870 9414 8287 gene locus_tag LOCUS_14880 9414 8287 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160774.1 protein_id gnl|my_center|LOCUS_14880 11139 9478 gene locus_tag LOCUS_14890 11139 9478 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_14890 12124 11234 gene locus_tag LOCUS_14900 gene mmsB 12124 11234 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208097.1 protein_id gnl|my_center|LOCUS_14900 13657 12140 gene locus_tag LOCUS_14910 13657 12140 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208096.1 protein_id gnl|my_center|LOCUS_14910 13823 14704 gene locus_tag LOCUS_14920 13823 14704 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208095.1 protein_id gnl|my_center|LOCUS_14920 16995 14791 gene locus_tag LOCUS_14930 16995 14791 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_14930 17620 18546 gene locus_tag LOCUS_14940 gene yddG 17620 18546 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206329.1 protein_id gnl|my_center|LOCUS_14940 19795 18740 gene locus_tag LOCUS_14950 19795 18740 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207677.1 protein_id gnl|my_center|LOCUS_14950 20085 21017 gene locus_tag LOCUS_14960 gene hpxR 20085 21017 CDS product LysR family hpxDE operon transcriptional regulator HpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705425.1 protein_id gnl|my_center|LOCUS_14960 22349 21192 gene locus_tag LOCUS_14970 gene hpxO 22349 21192 CDS product FAD-dependent urate hydroxylase HpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207945.1 protein_id gnl|my_center|LOCUS_14970 22562 23569 gene locus_tag LOCUS_14980 gene alc 22562 23569 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121874.1 protein_id gnl|my_center|LOCUS_14980 23562 24068 gene locus_tag LOCUS_14990 23562 24068 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207946.1 protein_id gnl|my_center|LOCUS_14990 24940 24218 gene locus_tag LOCUS_15000 24940 24218 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_15000 25406 25086 gene locus_tag LOCUS_15010 gene uraH 25406 25086 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626013.1 protein_id gnl|my_center|LOCUS_15010 25937 25431 gene locus_tag LOCUS_15020 gene uraD 25937 25431 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207943.1 protein_id gnl|my_center|LOCUS_15020 26987 26004 gene locus_tag LOCUS_15030 gene puuE 26987 26004 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207942.1 protein_id gnl|my_center|LOCUS_15030 28123 27068 gene locus_tag LOCUS_15040 28123 27068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 28722 28141 gene locus_tag LOCUS_15050 28722 28141 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769904.1 protein_id gnl|my_center|LOCUS_15050 29396 28803 gene locus_tag LOCUS_15060 29396 28803 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207064.1 protein_id gnl|my_center|LOCUS_15060 31241 29541 gene locus_tag LOCUS_15070 gene ureC 31241 29541 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206084.1 protein_id gnl|my_center|LOCUS_15070 31564 31241 gene locus_tag LOCUS_15080 31564 31241 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206082.1 protein_id gnl|my_center|LOCUS_15080 31896 31594 gene locus_tag LOCUS_15090 gene ureA 31896 31594 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117495.1 protein_id gnl|my_center|LOCUS_15090 32584 31949 gene locus_tag LOCUS_15100 32584 31949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 33579 32704 gene locus_tag LOCUS_15110 33579 32704 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206081.1 protein_id gnl|my_center|LOCUS_15110 34190 33624 gene locus_tag LOCUS_15120 34190 33624 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206087.1 protein_id gnl|my_center|LOCUS_15120 34856 34242 gene locus_tag LOCUS_15130 gene ureG 34856 34242 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117800.1 protein_id gnl|my_center|LOCUS_15130 35589 34924 gene locus_tag LOCUS_15140 35589 34924 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206086.1 protein_id gnl|my_center|LOCUS_15140 36058 35576 gene locus_tag LOCUS_15150 gene ureE 36058 35576 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206085.1 protein_id gnl|my_center|LOCUS_15150 36424 36885 gene locus_tag LOCUS_15160 36424 36885 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120966.1 protein_id gnl|my_center|LOCUS_15160 36919 37362 gene locus_tag LOCUS_15170 36919 37362 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073779.1 protein_id gnl|my_center|LOCUS_15170 37661 37428 gene locus_tag LOCUS_15180 37661 37428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 38049 38528 gene locus_tag LOCUS_15190 38049 38528 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206192.1 protein_id gnl|my_center|LOCUS_15190 38659 39132 gene locus_tag LOCUS_15200 38659 39132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 40369 39275 gene locus_tag LOCUS_15210 gene aroC 40369 39275 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206664.1 protein_id gnl|my_center|LOCUS_15210 41392 40382 gene locus_tag LOCUS_15220 gene prmB 41392 40382 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113580.1 protein_id gnl|my_center|LOCUS_15220 41890 41507 gene locus_tag LOCUS_15230 41890 41507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 42102 42407 gene locus_tag LOCUS_15240 42102 42407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206634.1 protein_id gnl|my_center|LOCUS_15240 42554 43927 gene locus_tag LOCUS_15250 42554 43927 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_15250 44166 45461 gene locus_tag LOCUS_15260 44166 45461 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206632.1 protein_id gnl|my_center|LOCUS_15260 45486 46685 gene locus_tag LOCUS_15270 45486 46685 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206631.1 protein_id gnl|my_center|LOCUS_15270 46802 47299 gene locus_tag LOCUS_15280 46802 47299 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815474.1 protein_id gnl|my_center|LOCUS_15280 47534 47983 gene locus_tag LOCUS_15290 47534 47983 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121358.1 protein_id gnl|my_center|LOCUS_15290 48077 49108 gene locus_tag LOCUS_15300 48077 49108 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 protein_id gnl|my_center|LOCUS_15300 49226 49600 gene locus_tag LOCUS_15310 gene gcvH 49226 49600 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069578.1 protein_id gnl|my_center|LOCUS_15310 49999 49673 gene locus_tag LOCUS_15320 49999 49673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 50098 50694 gene locus_tag LOCUS_15330 50098 50694 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_15330 51208 50684 gene locus_tag LOCUS_15340 51208 50684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 51650 51273 gene locus_tag LOCUS_15350 51650 51273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 52554 52156 gene locus_tag LOCUS_15360 52554 52156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 52806 52561 gene locus_tag LOCUS_15370 52806 52561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 54714 53650 gene locus_tag LOCUS_15380 54714 53650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 58012 54725 gene locus_tag LOCUS_15390 58012 54725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 59707 58079 gene locus_tag LOCUS_15400 59707 58079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 60087 59746 gene locus_tag LOCUS_15410 60087 59746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 60231 60533 gene locus_tag LOCUS_15420 60231 60533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 60551 60868 gene locus_tag LOCUS_15430 60551 60868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 60960 61268 gene locus_tag LOCUS_15440 60960 61268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 62482 61427 gene locus_tag LOCUS_15450 62482 61427 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206945.1 protein_id gnl|my_center|LOCUS_15450 65082 62941 gene locus_tag LOCUS_15460 65082 62941 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206970.1 protein_id gnl|my_center|LOCUS_15460 66278 65409 gene locus_tag LOCUS_15470 66278 65409 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_15470 66692 66282 gene locus_tag LOCUS_15480 66692 66282 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206922.1 protein_id gnl|my_center|LOCUS_15480 67114 66695 gene locus_tag LOCUS_15490 67114 66695 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069081.1 protein_id gnl|my_center|LOCUS_15490 68045 67314 gene locus_tag LOCUS_15500 68045 67314 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_15500 68331 68074 gene locus_tag LOCUS_15510 68331 68074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 68564 68875 gene locus_tag LOCUS_15520 68564 68875 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121379.1 protein_id gnl|my_center|LOCUS_15520 68994 70721 gene locus_tag LOCUS_15530 68994 70721 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_15530 70891 72087 gene locus_tag LOCUS_15540 gene sstT 70891 72087 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206582.1 protein_id gnl|my_center|LOCUS_15540 72119 72793 gene locus_tag LOCUS_15550 72119 72793 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121399.1 protein_id gnl|my_center|LOCUS_15550 72809 73342 gene locus_tag LOCUS_15560 72809 73342 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121466.1 protein_id gnl|my_center|LOCUS_15560 74346 73606 gene locus_tag LOCUS_15570 74346 73606 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206643.1 protein_id gnl|my_center|LOCUS_15570 74954 74343 gene locus_tag LOCUS_15580 74954 74343 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206641.1 protein_id gnl|my_center|LOCUS_15580 76031 74979 gene locus_tag LOCUS_15590 gene cobT 76031 74979 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206640.1 protein_id gnl|my_center|LOCUS_15590 76624 76103 gene locus_tag LOCUS_15600 gene cobU 76624 76103 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 protein_id gnl|my_center|LOCUS_15600 77280 76612 gene locus_tag LOCUS_15610 77280 76612 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206638.1 protein_id gnl|my_center|LOCUS_15610 78056 77382 gene locus_tag LOCUS_15620 78056 77382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 79717 78119 gene locus_tag LOCUS_15630 79717 78119 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206642.1 protein_id gnl|my_center|LOCUS_15630 81043 79793 gene locus_tag LOCUS_15640 81043 79793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 83425 81173 gene locus_tag LOCUS_15650 83425 81173 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206636.1 protein_id gnl|my_center|LOCUS_15650 84688 83429 gene locus_tag LOCUS_15660 84688 83429 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528114.1 protein_id gnl|my_center|LOCUS_15660 85056 84676 gene locus_tag LOCUS_15670 85056 84676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 85706 85053 gene locus_tag LOCUS_15680 85706 85053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 87602 85761 gene locus_tag LOCUS_15690 gene rhbF 87602 85761 CDS product rhizobactin siderophore biosynthesis protein RhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968206.1 protein_id gnl|my_center|LOCUS_15690 89068 87599 gene locus_tag LOCUS_15700 89068 87599 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904089.1 protein_id gnl|my_center|LOCUS_15700 90848 89061 gene locus_tag LOCUS_15710 gene rhbC 90848 89061 CDS product rhizobactin siderophore biosynthesis protein RhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968203.1 protein_id gnl|my_center|LOCUS_15710 91605 91183 gene locus_tag LOCUS_15720 91605 91183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 92131 91802 gene locus_tag LOCUS_15730 92131 91802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15730 93112 92645 gene locus_tag LOCUS_15740 gene ybaK 93112 92645 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206635.1 protein_id gnl|my_center|LOCUS_15740 93272 93907 gene locus_tag LOCUS_15750 93272 93907 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 protein_id gnl|my_center|LOCUS_15750 93937 95685 gene locus_tag LOCUS_15760 93937 95685 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 protein_id gnl|my_center|LOCUS_15760 95761 97116 gene locus_tag LOCUS_15770 95761 97116 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105551.1 protein_id gnl|my_center|LOCUS_15770 97113 97541 gene locus_tag LOCUS_15780 97113 97541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 97872 98612 gene locus_tag LOCUS_15790 97872 98612 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113327.1 protein_id gnl|my_center|LOCUS_15790 98609 99553 gene locus_tag LOCUS_15800 98609 99553 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089962.1 protein_id gnl|my_center|LOCUS_15800 100224 99721 gene locus_tag LOCUS_15810 100224 99721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 100735 100394 gene locus_tag LOCUS_15820 100735 100394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 101581 100760 gene locus_tag LOCUS_15830 101581 100760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 102405 101578 gene locus_tag LOCUS_15840 102405 101578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 103226 102402 gene locus_tag LOCUS_15850 103226 102402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 106100 103242 gene locus_tag LOCUS_15860 106100 103242 CDS product T6SS effector BTH_I2691 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206353.1 protein_id gnl|my_center|LOCUS_15860 107055 106111 gene locus_tag LOCUS_15870 107055 106111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206352.1 protein_id gnl|my_center|LOCUS_15870 <109183 107055 gene locus_tag LOCUS_15880 <109183 107055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206351.1:type VI secretion system Vgr family protein >Feature sequence11 1006 164 gene locus_tag LOCUS_15890 1006 164 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208333.1 protein_id gnl|my_center|LOCUS_15890 2266 1262 gene locus_tag LOCUS_15900 gene nagZ 2266 1262 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208334.1 protein_id gnl|my_center|LOCUS_15900 2478 4661 gene locus_tag LOCUS_15910 2478 4661 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208335.1 protein_id gnl|my_center|LOCUS_15910 6932 5793 gene locus_tag LOCUS_15920 gene dapE 6932 5793 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116563.1 protein_id gnl|my_center|LOCUS_15920 7228 7088 gene locus_tag LOCUS_15930 7228 7088 CDS product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207555.1 protein_id gnl|my_center|LOCUS_15930 8190 7345 gene locus_tag LOCUS_15940 8190 7345 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207554.1 protein_id gnl|my_center|LOCUS_15940 8405 8797 gene locus_tag LOCUS_15950 8405 8797 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207553.1 protein_id gnl|my_center|LOCUS_15950 9081 9156 gene locus_tag LOCUS_t00260 9081 9156 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9165 9241 gene locus_tag LOCUS_t00270 9165 9241 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9357 9432 gene locus_tag LOCUS_t00280 9357 9432 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9441 9517 gene locus_tag LOCUS_t00290 9441 9517 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9618 9693 gene locus_tag LOCUS_t00300 9618 9693 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9771 10238 gene locus_tag LOCUS_15960 9771 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 10831 10268 gene locus_tag LOCUS_15970 10831 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 13829 11187 gene locus_tag LOCUS_15980 13829 11187 CDS product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207550.1 protein_id gnl|my_center|LOCUS_15980 14556 13996 gene locus_tag LOCUS_15990 14556 13996 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207549.1 protein_id gnl|my_center|LOCUS_15990 16830 14656 gene locus_tag LOCUS_16000 gene yccS 16830 14656 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207548.1 protein_id gnl|my_center|LOCUS_16000 16977 18191 gene locus_tag LOCUS_16010 16977 18191 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207547.1 protein_id gnl|my_center|LOCUS_16010 18520 18975 gene locus_tag LOCUS_16020 18520 18975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 19422 19000 gene locus_tag LOCUS_16030 19422 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205905.1 protein_id gnl|my_center|LOCUS_16030 19974 21596 gene locus_tag LOCUS_16040 19974 21596 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071062.1 protein_id gnl|my_center|LOCUS_16040 21679 21843 gene locus_tag LOCUS_16050 21679 21843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205907.1 protein_id gnl|my_center|LOCUS_16050 21995 22147 gene locus_tag LOCUS_16060 21995 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 23372 22173 gene locus_tag LOCUS_16070 23372 22173 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205908.1 protein_id gnl|my_center|LOCUS_16070 24316 23447 gene locus_tag LOCUS_16080 24316 23447 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_16080 25559 24432 gene locus_tag LOCUS_16090 25559 24432 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205910.1 protein_id gnl|my_center|LOCUS_16090 27286 25634 gene locus_tag LOCUS_16100 27286 25634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205911.1 protein_id gnl|my_center|LOCUS_16100 27846 27298 gene locus_tag LOCUS_16110 27846 27298 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120318.1 protein_id gnl|my_center|LOCUS_16110 28100 28723 gene locus_tag LOCUS_16120 28100 28723 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207984.1 protein_id gnl|my_center|LOCUS_16120 28794 29432 gene locus_tag LOCUS_16130 28794 29432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 29532 30293 gene locus_tag LOCUS_16140 29532 30293 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206235.1 protein_id gnl|my_center|LOCUS_16140 30352 30912 gene locus_tag LOCUS_16150 30352 30912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 31016 31195 gene locus_tag LOCUS_16160 31016 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 32879 31260 gene locus_tag LOCUS_16170 32879 31260 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931645.1 protein_id gnl|my_center|LOCUS_16170 33279 33902 gene locus_tag LOCUS_16180 33279 33902 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205912.1 protein_id gnl|my_center|LOCUS_16180 34044 34715 gene locus_tag LOCUS_16190 34044 34715 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111706.1 protein_id gnl|my_center|LOCUS_16190 34730 35107 gene locus_tag LOCUS_16200 34730 35107 CDS product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083569.1 protein_id gnl|my_center|LOCUS_16200 35104 35778 gene locus_tag LOCUS_16210 35104 35778 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688570.1 protein_id gnl|my_center|LOCUS_16210 36926 36183 gene locus_tag LOCUS_16220 36926 36183 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114298.1 protein_id gnl|my_center|LOCUS_16220 37617 36940 gene locus_tag LOCUS_16230 37617 36940 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114551.1 protein_id gnl|my_center|LOCUS_16230 38462 37620 gene locus_tag LOCUS_16240 38462 37620 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114400.1 protein_id gnl|my_center|LOCUS_16240 39465 38554 gene locus_tag LOCUS_16250 39465 38554 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206541.1 protein_id gnl|my_center|LOCUS_16250 39976 41439 gene locus_tag LOCUS_16260 39976 41439 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208419.1 protein_id gnl|my_center|LOCUS_16260 41620 41961 gene locus_tag LOCUS_16270 gene raiA 41620 41961 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071251.1 protein_id gnl|my_center|LOCUS_16270 42110 42361 gene locus_tag LOCUS_16280 gene ibaG 42110 42361 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 protein_id gnl|my_center|LOCUS_16280 42368 43633 gene locus_tag LOCUS_16290 gene murA 42368 43633 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115380.1 protein_id gnl|my_center|LOCUS_16290 43633 44328 gene locus_tag LOCUS_16300 gene hisG 43633 44328 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071248.1 protein_id gnl|my_center|LOCUS_16300 44477 45139 gene locus_tag LOCUS_16310 44477 45139 CDS product DUF4272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917823.1 protein_id gnl|my_center|LOCUS_16310 45280 46569 gene locus_tag LOCUS_16320 gene hisD 45280 46569 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208420.1 protein_id gnl|my_center|LOCUS_16320 46762 47859 gene locus_tag LOCUS_16330 gene hisC 46762 47859 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208421.1 protein_id gnl|my_center|LOCUS_16330 49327 47987 gene locus_tag LOCUS_16340 49327 47987 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208422.1 protein_id gnl|my_center|LOCUS_16340 49670 50596 gene locus_tag LOCUS_16350 49670 50596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208423.1 protein_id gnl|my_center|LOCUS_16350 50804 51637 gene locus_tag LOCUS_16360 50804 51637 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208424.1 protein_id gnl|my_center|LOCUS_16360 51691 52881 gene locus_tag LOCUS_16370 51691 52881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208425.1 protein_id gnl|my_center|LOCUS_16370 52894 54558 gene locus_tag LOCUS_16380 52894 54558 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208426.1 protein_id gnl|my_center|LOCUS_16380 54558 55838 gene locus_tag LOCUS_16390 54558 55838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 55849 57792 gene locus_tag LOCUS_16400 55849 57792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208429.1 protein_id gnl|my_center|LOCUS_16400 58462 57881 gene locus_tag LOCUS_16410 58462 57881 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 protein_id gnl|my_center|LOCUS_16410 58554 59168 gene locus_tag LOCUS_16420 58554 59168 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208431.1 protein_id gnl|my_center|LOCUS_16420 59222 59755 gene locus_tag LOCUS_16430 59222 59755 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208432.1 protein_id gnl|my_center|LOCUS_16430 60157 60822 gene locus_tag LOCUS_16440 gene tsaB 60157 60822 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208433.1 protein_id gnl|my_center|LOCUS_16440 60870 61694 gene locus_tag LOCUS_16450 60870 61694 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_16450 61688 62506 gene locus_tag LOCUS_16460 61688 62506 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208434.1 protein_id gnl|my_center|LOCUS_16460 62628 64043 gene locus_tag LOCUS_16470 62628 64043 CDS product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_16470 64131 64967 gene locus_tag LOCUS_16480 gene fghA 64131 64967 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208436.1 protein_id gnl|my_center|LOCUS_16480 65139 66245 gene locus_tag LOCUS_16490 65139 66245 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206121.1 protein_id gnl|my_center|LOCUS_16490 66266 67399 gene locus_tag LOCUS_16500 66266 67399 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206120.1 protein_id gnl|my_center|LOCUS_16500 67668 68354 gene locus_tag LOCUS_16510 gene rpe 67668 68354 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043044.1 protein_id gnl|my_center|LOCUS_16510 68764 69189 gene locus_tag LOCUS_16520 68764 69189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 69246 71126 gene locus_tag LOCUS_16530 69246 71126 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208439.1 protein_id gnl|my_center|LOCUS_16530 71113 72045 gene locus_tag LOCUS_16540 71113 72045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 72587 72096 gene locus_tag LOCUS_16550 72587 72096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 72805 73122 gene locus_tag LOCUS_16560 72805 73122 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 protein_id gnl|my_center|LOCUS_16560 73213 73530 gene locus_tag LOCUS_16570 73213 73530 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 protein_id gnl|my_center|LOCUS_16570 73573 74052 gene locus_tag LOCUS_16580 73573 74052 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208442.1 protein_id gnl|my_center|LOCUS_16580 74812 74192 gene locus_tag LOCUS_16590 74812 74192 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971209.1 protein_id gnl|my_center|LOCUS_16590 75699 74893 gene locus_tag LOCUS_16600 75699 74893 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191977.1 protein_id gnl|my_center|LOCUS_16600 76407 75862 gene locus_tag LOCUS_16610 76407 75862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 77270 76503 gene locus_tag LOCUS_16620 77270 76503 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205943.1 protein_id gnl|my_center|LOCUS_16620 77376 78020 gene locus_tag LOCUS_16630 77376 78020 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205944.1 protein_id gnl|my_center|LOCUS_16630 78545 78081 gene locus_tag LOCUS_16640 78545 78081 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208089.1 protein_id gnl|my_center|LOCUS_16640 78684 79943 gene locus_tag LOCUS_16650 78684 79943 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208090.1 protein_id gnl|my_center|LOCUS_16650 80033 81148 gene locus_tag LOCUS_16660 gene alr 80033 81148 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208091.1 protein_id gnl|my_center|LOCUS_16660 81159 81530 gene locus_tag LOCUS_16670 81159 81530 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208092.1 protein_id gnl|my_center|LOCUS_16670 81712 83145 gene locus_tag LOCUS_16680 81712 83145 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208093.1 protein_id gnl|my_center|LOCUS_16680 83389 84492 gene locus_tag LOCUS_16690 83389 84492 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207982.1 protein_id gnl|my_center|LOCUS_16690 85427 84975 gene locus_tag LOCUS_16700 gene hemJ 85427 84975 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120291.1 protein_id gnl|my_center|LOCUS_16700 86742 85510 gene locus_tag LOCUS_16710 86742 85510 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205967.1 protein_id gnl|my_center|LOCUS_16710 90866 87027 gene locus_tag LOCUS_16720 90866 87027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 93137 90981 gene locus_tag LOCUS_16730 93137 90981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 94318 93134 gene locus_tag LOCUS_16740 94318 93134 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786824.1 protein_id gnl|my_center|LOCUS_16740 96921 94315 gene locus_tag LOCUS_16750 96921 94315 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084336.1 protein_id gnl|my_center|LOCUS_16750 98018 96921 gene locus_tag LOCUS_16760 98018 96921 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_16760 98361 99827 gene locus_tag LOCUS_16770 98361 99827 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205968.1 protein_id gnl|my_center|LOCUS_16770 99975 100349 gene locus_tag LOCUS_16780 gene rpsL 99975 100349 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050319.1 protein_id gnl|my_center|LOCUS_16780 100528 100998 gene locus_tag LOCUS_16790 gene rpsG 100528 100998 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138055.1 protein_id gnl|my_center|LOCUS_16790 101186 103321 gene locus_tag LOCUS_16800 gene fusA 101186 103321 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120436.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence12 183 938 gene locus_tag LOCUS_16810 183 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225626.1 protein_id gnl|my_center|LOCUS_16810 919 1185 gene locus_tag LOCUS_16820 919 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1496 1732 gene locus_tag LOCUS_16830 1496 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1784 1966 gene locus_tag LOCUS_16840 1784 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1984 2130 gene locus_tag LOCUS_16850 1984 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2181 2735 gene locus_tag LOCUS_16860 2181 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2859 3035 gene locus_tag LOCUS_16870 2859 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3839 3141 gene locus_tag LOCUS_16880 3839 3141 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_16880 4462 4184 gene locus_tag LOCUS_16890 4462 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16890 5673 4615 gene locus_tag LOCUS_16900 5673 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16900 7022 5880 gene locus_tag LOCUS_16910 gene argE 7022 5880 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266226.1 protein_id gnl|my_center|LOCUS_16910 8001 7015 gene locus_tag LOCUS_16920 8001 7015 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929941.1 protein_id gnl|my_center|LOCUS_16920 8708 8037 gene locus_tag LOCUS_16930 8708 8037 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 protein_id gnl|my_center|LOCUS_16930 9146 8733 gene locus_tag LOCUS_16940 9146 8733 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877160.1 protein_id gnl|my_center|LOCUS_16940 9575 10834 gene locus_tag LOCUS_16950 9575 10834 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114443.1 protein_id gnl|my_center|LOCUS_16950 10886 12289 gene locus_tag LOCUS_16960 10886 12289 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_16960 12318 13718 gene locus_tag LOCUS_16970 12318 13718 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 protein_id gnl|my_center|LOCUS_16970 14611 15147 gene locus_tag LOCUS_16980 14611 15147 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099340.1 protein_id gnl|my_center|LOCUS_16980 15210 15764 gene locus_tag LOCUS_16990 15210 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 15804 16280 gene locus_tag LOCUS_17000 15804 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 16285 17100 gene locus_tag LOCUS_17010 16285 17100 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778750.1 protein_id gnl|my_center|LOCUS_17010 17100 19610 gene locus_tag LOCUS_17020 17100 19610 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832203.1 protein_id gnl|my_center|LOCUS_17020 19607 20647 gene locus_tag LOCUS_17030 19607 20647 CDS product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478117.1 protein_id gnl|my_center|LOCUS_17030 20954 21538 gene locus_tag LOCUS_17040 20954 21538 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205894.1 protein_id gnl|my_center|LOCUS_17040 21540 21788 gene locus_tag LOCUS_17050 21540 21788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 22813 21980 gene locus_tag LOCUS_17060 22813 21980 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_17060 23500 22868 gene locus_tag LOCUS_17070 23500 22868 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122637.1 protein_id gnl|my_center|LOCUS_17070 25455 24007 gene locus_tag LOCUS_17080 gene gabP 25455 24007 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105441.1 protein_id gnl|my_center|LOCUS_17080 27328 25826 gene locus_tag LOCUS_17090 27328 25826 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 protein_id gnl|my_center|LOCUS_17090 27441 27731 gene locus_tag LOCUS_17100 27441 27731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 27860 29038 gene locus_tag LOCUS_17110 27860 29038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206415.1 protein_id gnl|my_center|LOCUS_17110 29404 30666 gene locus_tag LOCUS_17120 gene gabT 29404 30666 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207897.1 protein_id gnl|my_center|LOCUS_17120 30682 32130 gene locus_tag LOCUS_17130 30682 32130 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207896.1 protein_id gnl|my_center|LOCUS_17130 32757 34436 gene locus_tag LOCUS_17140 32757 34436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 35783 34488 gene locus_tag LOCUS_17150 35783 34488 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206129.1 protein_id gnl|my_center|LOCUS_17150 37050 36250 gene locus_tag LOCUS_17160 gene aph(3')-IIIa 37050 36250 CDS product aminoglycoside O-phosphotransferase APH(3')-IIIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096887.1 protein_id gnl|my_center|LOCUS_17160 38665 37748 gene locus_tag LOCUS_17170 38665 37748 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206888.1 protein_id gnl|my_center|LOCUS_17170 39085 39915 gene locus_tag LOCUS_17180 39085 39915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206887.1 protein_id gnl|my_center|LOCUS_17180 40549 41088 gene locus_tag LOCUS_17190 40549 41088 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113678.1 protein_id gnl|my_center|LOCUS_17190 41167 41898 gene locus_tag LOCUS_17200 41167 41898 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206740.1 protein_id gnl|my_center|LOCUS_17200 42037 44610 gene locus_tag LOCUS_17210 42037 44610 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206739.1 protein_id gnl|my_center|LOCUS_17210 44607 45617 gene locus_tag LOCUS_17220 44607 45617 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206738.1 protein_id gnl|my_center|LOCUS_17220 45734 46039 gene locus_tag LOCUS_17230 45734 46039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 47085 46165 gene locus_tag LOCUS_17240 47085 46165 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206846.1 protein_id gnl|my_center|LOCUS_17240 47188 48564 gene locus_tag LOCUS_17250 47188 48564 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206845.1 protein_id gnl|my_center|LOCUS_17250 48619 50181 gene locus_tag LOCUS_17260 48619 50181 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206844.1 protein_id gnl|my_center|LOCUS_17260 50346 51737 gene locus_tag LOCUS_17270 50346 51737 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206843.1 protein_id gnl|my_center|LOCUS_17270 52251 51910 gene locus_tag LOCUS_17280 52251 51910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 52809 52315 gene locus_tag LOCUS_17290 gene yetL 52809 52315 CDS product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 protein_id gnl|my_center|LOCUS_17290 53421 55523 gene locus_tag LOCUS_17300 53421 55523 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207927.1 protein_id gnl|my_center|LOCUS_17300 57172 55658 gene locus_tag LOCUS_17310 57172 55658 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 protein_id gnl|my_center|LOCUS_17310 57588 58343 gene locus_tag LOCUS_17320 57588 58343 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 protein_id gnl|my_center|LOCUS_17320 58678 59937 gene locus_tag LOCUS_17330 58678 59937 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186502.1 protein_id gnl|my_center|LOCUS_17330 60015 61415 gene locus_tag LOCUS_17340 60015 61415 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 protein_id gnl|my_center|LOCUS_17340 61605 63020 gene locus_tag LOCUS_17350 61605 63020 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 protein_id gnl|my_center|LOCUS_17350 63124 64452 gene locus_tag LOCUS_17360 63124 64452 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206131.1 protein_id gnl|my_center|LOCUS_17360 64534 65634 gene locus_tag LOCUS_17370 gene aguA 64534 65634 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209980.1 protein_id gnl|my_center|LOCUS_17370 66751 65735 gene locus_tag LOCUS_17380 66751 65735 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207015.1 protein_id gnl|my_center|LOCUS_17380 67342 66755 gene locus_tag LOCUS_17390 67342 66755 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115726.1 protein_id gnl|my_center|LOCUS_17390 67793 69172 gene locus_tag LOCUS_17400 67793 69172 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_17400 69219 71765 gene locus_tag LOCUS_17410 gene nirB 69219 71765 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_17410 71783 73408 gene locus_tag LOCUS_17420 gene nirD 71783 73408 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207013.1 protein_id gnl|my_center|LOCUS_17420 73607 76399 gene locus_tag LOCUS_17430 73607 76399 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207012.1 protein_id gnl|my_center|LOCUS_17430 76396 77034 gene locus_tag LOCUS_17440 76396 77034 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207011.1 protein_id gnl|my_center|LOCUS_17440 77223 78368 gene locus_tag LOCUS_17450 gene moaA 77223 78368 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207009.1 protein_id gnl|my_center|LOCUS_17450 78370 78678 gene locus_tag LOCUS_17460 78370 78678 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187654.1 protein_id gnl|my_center|LOCUS_17460 78680 79378 gene locus_tag LOCUS_17470 78680 79378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 79437 80360 gene locus_tag LOCUS_17480 gene moaCB 79437 80360 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_17480 80357 81607 gene locus_tag LOCUS_17490 80357 81607 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207006.1 protein_id gnl|my_center|LOCUS_17490 81619 82374 gene locus_tag LOCUS_17500 gene modA 81619 82374 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206718.1 protein_id gnl|my_center|LOCUS_17500 82386 83084 gene locus_tag LOCUS_17510 gene modB 82386 83084 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 protein_id gnl|my_center|LOCUS_17510 83071 83712 gene locus_tag LOCUS_17520 gene modC 83071 83712 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038308.1 protein_id gnl|my_center|LOCUS_17520 84032 85027 gene locus_tag LOCUS_17530 84032 85027 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227006.1 protein_id gnl|my_center|LOCUS_17530 85320 86591 gene locus_tag LOCUS_17540 85320 86591 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206819.1 protein_id gnl|my_center|LOCUS_17540 87170 86598 gene locus_tag LOCUS_17550 87170 86598 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206379.1 protein_id gnl|my_center|LOCUS_17550 87594 88508 gene locus_tag LOCUS_17560 87594 88508 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207104.1 protein_id gnl|my_center|LOCUS_17560 89176 89922 gene locus_tag LOCUS_17570 89176 89922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 91000 91755 gene locus_tag LOCUS_17580 91000 91755 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_17580 91769 92437 gene locus_tag LOCUS_17590 91769 92437 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206333.1 protein_id gnl|my_center|LOCUS_17590 92440 96045 gene locus_tag LOCUS_17600 gene uca 92440 96045 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206334.1 protein_id gnl|my_center|LOCUS_17600 96642 96106 gene locus_tag LOCUS_17610 96642 96106 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206335.1 protein_id gnl|my_center|LOCUS_17610 96737 97096 gene locus_tag LOCUS_17620 96737 97096 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_17620 97508 97942 gene locus_tag LOCUS_17630 97508 97942 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118705.1 protein_id gnl|my_center|LOCUS_17630 97958 99766 gene locus_tag LOCUS_17640 gene atzF 97958 99766 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_17640 99763 100785 gene locus_tag LOCUS_17650 99763 100785 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence13 1386 214 gene locus_tag LOCUS_17660 1386 214 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_17660 2651 1800 gene locus_tag LOCUS_17670 2651 1800 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_17670 3350 2658 gene locus_tag LOCUS_17680 3350 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3502 4521 gene locus_tag LOCUS_17690 3502 4521 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243759.1 protein_id gnl|my_center|LOCUS_17690 4946 4698 gene locus_tag LOCUS_17700 4946 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5148 5657 gene locus_tag LOCUS_17710 5148 5657 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531618.1 protein_id gnl|my_center|LOCUS_17710 6753 5710 gene locus_tag LOCUS_17720 6753 5710 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207349.1 protein_id gnl|my_center|LOCUS_17720 7583 6882 gene locus_tag LOCUS_17730 7583 6882 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118524.1 protein_id gnl|my_center|LOCUS_17730 8028 7684 gene locus_tag LOCUS_17740 8028 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121546.1 protein_id gnl|my_center|LOCUS_17740 8551 8988 gene locus_tag LOCUS_17750 8551 8988 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207704.1 protein_id gnl|my_center|LOCUS_17750 9352 9714 gene locus_tag LOCUS_17760 9352 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 protein_id gnl|my_center|LOCUS_17760 9811 10026 gene locus_tag LOCUS_17770 9811 10026 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206204.1 protein_id gnl|my_center|LOCUS_17770 10170 10763 gene locus_tag LOCUS_17780 10170 10763 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_17780 11032 10826 gene locus_tag LOCUS_17790 11032 10826 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070287.1 protein_id gnl|my_center|LOCUS_17790 11260 11757 gene locus_tag LOCUS_17800 11260 11757 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888793.1 protein_id gnl|my_center|LOCUS_17800 11854 12210 gene locus_tag LOCUS_17810 11854 12210 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254609.1 protein_id gnl|my_center|LOCUS_17810 12835 12272 gene locus_tag LOCUS_17820 gene ahpC 12835 12272 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206206.1 protein_id gnl|my_center|LOCUS_17820 13305 17201 gene locus_tag LOCUS_17830 gene hrpA 13305 17201 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206207.1 protein_id gnl|my_center|LOCUS_17830 17249 18364 gene locus_tag LOCUS_17840 17249 18364 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013198471.1 protein_id gnl|my_center|LOCUS_17840 18526 19329 gene locus_tag LOCUS_17850 18526 19329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 19339 19854 gene locus_tag LOCUS_17860 19339 19854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 19885 20283 gene locus_tag LOCUS_17870 19885 20283 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119862.1 protein_id gnl|my_center|LOCUS_17870 20508 22847 gene locus_tag LOCUS_17880 gene blp2 20508 22847 CDS product Ig-like repeat protein Blp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207312.1 protein_id gnl|my_center|LOCUS_17880 22956 28127 gene locus_tag LOCUS_17890 22956 28127 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267807.1 protein_id gnl|my_center|LOCUS_17890 28342 34581 gene locus_tag LOCUS_17900 28342 34581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 34585 36270 gene locus_tag LOCUS_17910 34585 36270 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_17910 36599 37351 gene locus_tag LOCUS_17920 gene hutC 36599 37351 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207981.1 protein_id gnl|my_center|LOCUS_17920 37348 37929 gene locus_tag LOCUS_17930 37348 37929 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207980.1 protein_id gnl|my_center|LOCUS_17930 38167 39843 gene locus_tag LOCUS_17940 gene hutU 38167 39843 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207979.1 protein_id gnl|my_center|LOCUS_17940 39933 41471 gene locus_tag LOCUS_17950 gene hutH 39933 41471 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421598.1 protein_id gnl|my_center|LOCUS_17950 41536 42948 gene locus_tag LOCUS_17960 41536 42948 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804358.1 protein_id gnl|my_center|LOCUS_17960 43000 44205 gene locus_tag LOCUS_17970 gene hutI 43000 44205 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207978.1 protein_id gnl|my_center|LOCUS_17970 44239 45159 gene locus_tag LOCUS_17980 gene hutG 44239 45159 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207977.1 protein_id gnl|my_center|LOCUS_17980 45196 46467 gene locus_tag LOCUS_17990 45196 46467 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207790.1 protein_id gnl|my_center|LOCUS_17990 46795 46986 gene locus_tag LOCUS_18000 46795 46986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 47372 47887 gene locus_tag LOCUS_18010 47372 47887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089049.1 protein_id gnl|my_center|LOCUS_18010 47877 48053 gene locus_tag LOCUS_18020 47877 48053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 48634 47999 gene locus_tag LOCUS_18030 48634 47999 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084765.1 protein_id gnl|my_center|LOCUS_18030 48744 50246 gene locus_tag LOCUS_18040 48744 50246 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 protein_id gnl|my_center|LOCUS_18040 50327 51163 gene locus_tag LOCUS_18050 50327 51163 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892195.1 protein_id gnl|my_center|LOCUS_18050 52156 51533 gene locus_tag LOCUS_18060 52156 51533 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208296.1 protein_id gnl|my_center|LOCUS_18060 52754 52179 gene locus_tag LOCUS_18070 52754 52179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 52867 54012 gene locus_tag LOCUS_18080 52867 54012 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_18080 54005 54700 gene locus_tag LOCUS_18090 gene lolD 54005 54700 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207403.1 protein_id gnl|my_center|LOCUS_18090 54851 57274 gene locus_tag LOCUS_18100 54851 57274 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207402.1 protein_id gnl|my_center|LOCUS_18100 58138 57245 gene locus_tag LOCUS_18110 58138 57245 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_18110 58400 59431 gene locus_tag LOCUS_18120 gene sppA 58400 59431 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207400.1 protein_id gnl|my_center|LOCUS_18120 59795 60610 gene locus_tag LOCUS_18130 59795 60610 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207399.1 protein_id gnl|my_center|LOCUS_18130 61397 60765 gene locus_tag LOCUS_18140 gene purN 61397 60765 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207398.1 protein_id gnl|my_center|LOCUS_18140 62476 61406 gene locus_tag LOCUS_18150 gene purM 62476 61406 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112583.1 protein_id gnl|my_center|LOCUS_18150 62612 63814 gene locus_tag LOCUS_18160 62612 63814 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_18160 63830 64537 gene locus_tag LOCUS_18170 gene hda 63830 64537 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118656.1 protein_id gnl|my_center|LOCUS_18170 64714 66522 gene locus_tag LOCUS_18180 gene rbtA 64714 66522 CDS product rhombotarget A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207395.1 protein_id gnl|my_center|LOCUS_18180 66533 68971 gene locus_tag LOCUS_18190 66533 68971 CDS product CSLREA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207394.1 protein_id gnl|my_center|LOCUS_18190 69140 69922 gene locus_tag LOCUS_18200 69140 69922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 69932 71086 gene locus_tag LOCUS_18210 69932 71086 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723133.1 protein_id gnl|my_center|LOCUS_18210 71135 72052 gene locus_tag LOCUS_18220 71135 72052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 72764 72144 gene locus_tag LOCUS_18230 72764 72144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 73171 74736 gene locus_tag LOCUS_18240 gene ahpF 73171 74736 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206518.1 protein_id gnl|my_center|LOCUS_18240 75548 74880 gene locus_tag LOCUS_18250 75548 74880 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206659.1 protein_id gnl|my_center|LOCUS_18250 75663 76547 gene locus_tag LOCUS_18260 75663 76547 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967095.1 protein_id gnl|my_center|LOCUS_18260 76984 76733 gene locus_tag LOCUS_18270 76984 76733 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334896.1 protein_id gnl|my_center|LOCUS_18270 78394 76994 gene locus_tag LOCUS_18280 gene yegQ 78394 76994 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207227.1 protein_id gnl|my_center|LOCUS_18280 78987 78559 gene locus_tag LOCUS_18290 gene arsC 78987 78559 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206513.1 protein_id gnl|my_center|LOCUS_18290 79090 79413 gene locus_tag LOCUS_18300 79090 79413 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206514.1 protein_id gnl|my_center|LOCUS_18300 79417 80475 gene locus_tag LOCUS_18310 gene arsB 79417 80475 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206515.1 protein_id gnl|my_center|LOCUS_18310 80930 80526 gene locus_tag LOCUS_18320 gene cadR 80930 80526 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 protein_id gnl|my_center|LOCUS_18320 81104 81745 gene locus_tag LOCUS_18330 81104 81745 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_18330 82949 82092 gene locus_tag LOCUS_18340 82949 82092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 83200 83769 gene locus_tag LOCUS_18350 83200 83769 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121343.1 protein_id gnl|my_center|LOCUS_18350 85285 84857 gene locus_tag LOCUS_18360 85285 84857 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728424.1 protein_id gnl|my_center|LOCUS_18360 85859 85287 gene locus_tag LOCUS_18370 85859 85287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 86843 86142 gene locus_tag LOCUS_18380 86843 86142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 87199 87795 gene locus_tag LOCUS_18390 87199 87795 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067937.1 protein_id gnl|my_center|LOCUS_18390 87935 90772 gene locus_tag LOCUS_18400 gene rapA 87935 90772 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207322.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence14 1671 499 gene locus_tag LOCUS_18410 1671 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206415.1 protein_id gnl|my_center|LOCUS_18410 3598 2192 gene locus_tag LOCUS_18420 3598 2192 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_18420 5169 3718 gene locus_tag LOCUS_18430 5169 3718 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 protein_id gnl|my_center|LOCUS_18430 6149 5157 gene locus_tag LOCUS_18440 6149 5157 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 protein_id gnl|my_center|LOCUS_18440 7572 6184 gene locus_tag LOCUS_18450 7572 6184 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809702.1 protein_id gnl|my_center|LOCUS_18450 8118 9170 gene locus_tag LOCUS_18460 8118 9170 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395757.1 protein_id gnl|my_center|LOCUS_18460 10696 9203 gene locus_tag LOCUS_18470 10696 9203 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163897449.1 protein_id gnl|my_center|LOCUS_18470 11126 10776 gene locus_tag LOCUS_18480 11126 10776 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854323.1 protein_id gnl|my_center|LOCUS_18480 11487 11137 gene locus_tag LOCUS_18490 11487 11137 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809646.1 protein_id gnl|my_center|LOCUS_18490 12872 11538 gene locus_tag LOCUS_18500 12872 11538 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101374.1 protein_id gnl|my_center|LOCUS_18500 14312 12993 gene locus_tag LOCUS_18510 14312 12993 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_18510 14826 15881 gene locus_tag LOCUS_18520 14826 15881 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395757.1 protein_id gnl|my_center|LOCUS_18520 16073 16993 gene locus_tag LOCUS_18530 gene yddG 16073 16993 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206329.1 protein_id gnl|my_center|LOCUS_18530 18445 17117 gene locus_tag LOCUS_18540 18445 17117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101374.1 protein_id gnl|my_center|LOCUS_18540 19452 18613 gene locus_tag LOCUS_18550 gene yddG 19452 18613 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705524.1 protein_id gnl|my_center|LOCUS_18550 20771 19575 gene locus_tag LOCUS_18560 20771 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206415.1 protein_id gnl|my_center|LOCUS_18560 22425 20929 gene locus_tag LOCUS_18570 22425 20929 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101377.1 protein_id gnl|my_center|LOCUS_18570 23330 22425 gene locus_tag LOCUS_18580 23330 22425 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973459.1 protein_id gnl|my_center|LOCUS_18580 24730 23402 gene locus_tag LOCUS_18590 24730 23402 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101374.1 protein_id gnl|my_center|LOCUS_18590 26247 24922 gene locus_tag LOCUS_18600 26247 24922 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_18600 27001 26324 gene locus_tag LOCUS_18610 27001 26324 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101372.1 protein_id gnl|my_center|LOCUS_18610 27645 29234 gene locus_tag LOCUS_18620 27645 29234 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936075.1 protein_id gnl|my_center|LOCUS_18620 29250 30779 gene locus_tag LOCUS_18630 29250 30779 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530986.1 protein_id gnl|my_center|LOCUS_18630 30849 31505 gene locus_tag LOCUS_18640 30849 31505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197753.1 protein_id gnl|my_center|LOCUS_18640 31957 31601 gene locus_tag LOCUS_18650 31957 31601 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_18650 32999 32022 gene locus_tag LOCUS_18660 32999 32022 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207904.1 protein_id gnl|my_center|LOCUS_18660 33612 33004 gene locus_tag LOCUS_18670 33612 33004 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207905.1 protein_id gnl|my_center|LOCUS_18670 34053 35534 gene locus_tag LOCUS_18680 gene proP 34053 35534 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095119.1 protein_id gnl|my_center|LOCUS_18680 36469 35690 gene locus_tag LOCUS_18690 36469 35690 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103062.1 protein_id gnl|my_center|LOCUS_18690 36559 37377 gene locus_tag LOCUS_18700 36559 37377 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085615.1 protein_id gnl|my_center|LOCUS_18700 37746 38963 gene locus_tag LOCUS_18710 37746 38963 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039416.1 protein_id gnl|my_center|LOCUS_18710 39550 38987 gene locus_tag LOCUS_18720 39550 38987 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002005730.1 protein_id gnl|my_center|LOCUS_18720 40476 40207 gene locus_tag LOCUS_18730 40476 40207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 40737 40579 gene locus_tag LOCUS_18740 40737 40579 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053759.1 protein_id gnl|my_center|LOCUS_18740 41206 40862 gene locus_tag LOCUS_18750 41206 40862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 41773 42222 gene locus_tag LOCUS_18760 41773 42222 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206997.1 protein_id gnl|my_center|LOCUS_18760 42262 42729 gene locus_tag LOCUS_18770 42262 42729 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073517.1 protein_id gnl|my_center|LOCUS_18770 43261 42773 gene locus_tag LOCUS_18780 43261 42773 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869958.1 protein_id gnl|my_center|LOCUS_18780 43637 43371 gene locus_tag LOCUS_18790 43637 43371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 44655 44116 gene locus_tag LOCUS_18800 44655 44116 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112987.1 protein_id gnl|my_center|LOCUS_18800 45589 45005 gene locus_tag LOCUS_18810 gene pdxH 45589 45005 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282321.1 protein_id gnl|my_center|LOCUS_18810 46203 45595 gene locus_tag LOCUS_18820 46203 45595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 46627 46241 gene locus_tag LOCUS_18830 46627 46241 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 protein_id gnl|my_center|LOCUS_18830 47868 47173 gene locus_tag LOCUS_18840 47868 47173 CDS product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207184.1 protein_id gnl|my_center|LOCUS_18840 49517 47865 gene locus_tag LOCUS_18850 49517 47865 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207185.1 protein_id gnl|my_center|LOCUS_18850 50341 49562 gene locus_tag LOCUS_18860 50341 49562 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207186.1 protein_id gnl|my_center|LOCUS_18860 50988 50338 gene locus_tag LOCUS_18870 50988 50338 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207187.1 protein_id gnl|my_center|LOCUS_18870 51835 51356 gene locus_tag LOCUS_18880 51835 51356 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019905.1 protein_id gnl|my_center|LOCUS_18880 52599 53477 gene locus_tag LOCUS_18890 52599 53477 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208464.1 protein_id gnl|my_center|LOCUS_18890 53718 54467 gene locus_tag LOCUS_18900 53718 54467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 54910 54782 gene locus_tag LOCUS_18910 54910 54782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 56027 54999 gene locus_tag LOCUS_18920 56027 54999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 56701 56138 gene locus_tag LOCUS_18930 gene sfmF 56701 56138 CDS product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603408.1 protein_id gnl|my_center|LOCUS_18930 57743 56712 gene locus_tag LOCUS_18940 gene fimH 57743 56712 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691080.1 protein_id gnl|my_center|LOCUS_18940 60288 57757 gene locus_tag LOCUS_18950 60288 57757 CDS product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095933.1 protein_id gnl|my_center|LOCUS_18950 61101 60397 gene locus_tag LOCUS_18960 gene fimC 61101 60397 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764009.1 protein_id gnl|my_center|LOCUS_18960 61592 61122 gene locus_tag LOCUS_18970 61592 61122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 62193 61645 gene locus_tag LOCUS_18980 gene fimA 62193 61645 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095930.1 protein_id gnl|my_center|LOCUS_18980 62500 62817 gene locus_tag LOCUS_18990 62500 62817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 66168 68387 gene locus_tag LOCUS_19000 66168 68387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 68895 69473 gene locus_tag LOCUS_19010 68895 69473 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207168.1 protein_id gnl|my_center|LOCUS_19010 69443 69946 gene locus_tag LOCUS_19020 69443 69946 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207169.1 protein_id gnl|my_center|LOCUS_19020 69965 70663 gene locus_tag LOCUS_19030 69965 70663 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207170.1 protein_id gnl|my_center|LOCUS_19030 71978 70656 gene locus_tag LOCUS_19040 71978 70656 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207171.1 protein_id gnl|my_center|LOCUS_19040 73075 72026 gene locus_tag LOCUS_19050 73075 72026 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207172.1 protein_id gnl|my_center|LOCUS_19050 73863 73084 gene locus_tag LOCUS_19060 73863 73084 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207173.1 protein_id gnl|my_center|LOCUS_19060 75098 73902 gene locus_tag LOCUS_19070 75098 73902 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207174.1 protein_id gnl|my_center|LOCUS_19070 75889 75095 gene locus_tag LOCUS_19080 75889 75095 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207175.1 protein_id gnl|my_center|LOCUS_19080 77172 75898 gene locus_tag LOCUS_19090 77172 75898 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_19090 78158 77169 gene locus_tag LOCUS_19100 78158 77169 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207178.1 protein_id gnl|my_center|LOCUS_19100 79981 78653 gene locus_tag LOCUS_19110 gene dctA 79981 78653 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206023.1 protein_id gnl|my_center|LOCUS_19110 80432 83086 gene locus_tag LOCUS_19120 gene mutS 80432 83086 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206264.1 protein_id gnl|my_center|LOCUS_19120 83307 83765 gene locus_tag LOCUS_19130 83307 83765 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206263.1 protein_id gnl|my_center|LOCUS_19130 84105 84428 gene locus_tag LOCUS_19140 84105 84428 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_19140 84569 85288 gene locus_tag LOCUS_19150 84569 85288 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115771.1 protein_id gnl|my_center|LOCUS_19150 87252 85720 gene locus_tag LOCUS_19160 87252 85720 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207318.1 protein_id gnl|my_center|LOCUS_19160 87885 87256 gene locus_tag LOCUS_19170 87885 87256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19170 88630 87887 gene locus_tag LOCUS_19180 88630 87887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19180 89133 89837 gene locus_tag LOCUS_19190 89133 89837 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence15 2940 355 gene locus_tag LOCUS_19200 gene plsB 2940 355 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207756.1 protein_id gnl|my_center|LOCUS_19200 3231 4106 gene locus_tag LOCUS_19210 3231 4106 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207755.1 protein_id gnl|my_center|LOCUS_19210 4257 5501 gene locus_tag LOCUS_19220 4257 5501 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_19220 6561 5614 gene locus_tag LOCUS_19230 6561 5614 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207753.1 protein_id gnl|my_center|LOCUS_19230 7557 6703 gene locus_tag LOCUS_19240 gene yihA 7557 6703 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116788.1 protein_id gnl|my_center|LOCUS_19240 8153 7713 gene locus_tag LOCUS_19250 8153 7713 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207752.1 protein_id gnl|my_center|LOCUS_19250 8574 8227 gene locus_tag LOCUS_19260 8574 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 9499 8738 gene locus_tag LOCUS_19270 9499 8738 CDS product globin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207751.1 protein_id gnl|my_center|LOCUS_19270 11348 9789 gene locus_tag LOCUS_19280 11348 9789 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_19280 12730 11540 gene locus_tag LOCUS_19290 12730 11540 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207748.1 protein_id gnl|my_center|LOCUS_19290 12911 13636 gene locus_tag LOCUS_19300 12911 13636 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116949.1 protein_id gnl|my_center|LOCUS_19300 13911 14222 gene locus_tag LOCUS_19310 gene rpsJ 13911 14222 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116694.1 protein_id gnl|my_center|LOCUS_19310 14282 14920 gene locus_tag LOCUS_19320 gene rplC 14282 14920 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207747.1 protein_id gnl|my_center|LOCUS_19320 14932 15534 gene locus_tag LOCUS_19330 gene rplD 14932 15534 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049755.1 protein_id gnl|my_center|LOCUS_19330 15531 15851 gene locus_tag LOCUS_19340 gene rplW 15531 15851 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049693.1 protein_id gnl|my_center|LOCUS_19340 15863 16687 gene locus_tag LOCUS_19350 gene rplB 15863 16687 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049686.1 protein_id gnl|my_center|LOCUS_19350 16707 16982 gene locus_tag LOCUS_19360 gene rpsS 16707 16982 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138119.1 protein_id gnl|my_center|LOCUS_19360 16994 17323 gene locus_tag LOCUS_19370 gene rplV 16994 17323 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982638.1 protein_id gnl|my_center|LOCUS_19370 17325 18077 gene locus_tag LOCUS_19380 gene rpsC 17325 18077 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207746.1 protein_id gnl|my_center|LOCUS_19380 18081 18494 gene locus_tag LOCUS_19390 gene rplP 18081 18494 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207745.1 protein_id gnl|my_center|LOCUS_19390 18494 18691 gene locus_tag LOCUS_19400 gene rpmC 18494 18691 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849928.1 protein_id gnl|my_center|LOCUS_19400 18688 18945 gene locus_tag LOCUS_19410 gene rpsQ 18688 18945 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207744.1 protein_id gnl|my_center|LOCUS_19410 19038 19406 gene locus_tag LOCUS_19420 gene rplN 19038 19406 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982634.1 protein_id gnl|my_center|LOCUS_19420 19418 19735 gene locus_tag LOCUS_19430 gene rplX 19418 19735 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116820.1 protein_id gnl|my_center|LOCUS_19430 19752 20288 gene locus_tag LOCUS_19440 gene rplE 19752 20288 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116961.1 protein_id gnl|my_center|LOCUS_19440 20298 20603 gene locus_tag LOCUS_19450 gene rpsN 20298 20603 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 protein_id gnl|my_center|LOCUS_19450 20617 21012 gene locus_tag LOCUS_19460 gene rpsH 20617 21012 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049732.1 protein_id gnl|my_center|LOCUS_19460 21026 21559 gene locus_tag LOCUS_19470 gene rplF 21026 21559 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116801.1 protein_id gnl|my_center|LOCUS_19470 21574 21924 gene locus_tag LOCUS_19480 gene rplR 21574 21924 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049741.1 protein_id gnl|my_center|LOCUS_19480 21927 22424 gene locus_tag LOCUS_19490 gene rpsE 21927 22424 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141025.1 protein_id gnl|my_center|LOCUS_19490 22431 22607 gene locus_tag LOCUS_19500 gene rpmD 22431 22607 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849088.1 protein_id gnl|my_center|LOCUS_19500 22611 23051 gene locus_tag LOCUS_19510 gene rplO 22611 23051 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116985.1 protein_id gnl|my_center|LOCUS_19510 23058 24416 gene locus_tag LOCUS_19520 gene secY 23058 24416 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207743.1 protein_id gnl|my_center|LOCUS_19520 24662 25018 gene locus_tag LOCUS_19530 gene rpsM 24662 25018 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090815.1 protein_id gnl|my_center|LOCUS_19530 25038 25424 gene locus_tag LOCUS_19540 gene rpsK 25038 25424 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040166.1 protein_id gnl|my_center|LOCUS_19540 25437 26060 gene locus_tag LOCUS_19550 gene rpsD 25437 26060 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135204.1 protein_id gnl|my_center|LOCUS_19550 26078 27085 gene locus_tag LOCUS_19560 gene rpoA 26078 27085 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116730.1 protein_id gnl|my_center|LOCUS_19560 27104 27469 gene locus_tag LOCUS_19570 gene rplQ 27104 27469 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049717.1 protein_id gnl|my_center|LOCUS_19570 27671 29164 gene locus_tag LOCUS_19580 27671 29164 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207742.1 protein_id gnl|my_center|LOCUS_19580 30453 29281 gene locus_tag LOCUS_19590 30453 29281 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207741.1 protein_id gnl|my_center|LOCUS_19590 30634 30891 gene locus_tag LOCUS_19600 30634 30891 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207740.1 protein_id gnl|my_center|LOCUS_19600 30955 31098 gene locus_tag LOCUS_19610 30955 31098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 31076 31282 gene locus_tag LOCUS_19620 31076 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 31485 31640 gene locus_tag LOCUS_19630 31485 31640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 31857 32945 gene locus_tag LOCUS_19640 31857 32945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_19640 33021 33599 gene locus_tag LOCUS_19650 gene rrtA 33021 33599 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207737.1 protein_id gnl|my_center|LOCUS_19650 33927 36125 gene locus_tag LOCUS_19660 33927 36125 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_19660 37394 36615 gene locus_tag LOCUS_19670 37394 36615 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098431.1 protein_id gnl|my_center|LOCUS_19670 37640 37431 gene locus_tag LOCUS_19680 37640 37431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 37557 38477 gene locus_tag LOCUS_19690 37557 38477 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209722.1 protein_id gnl|my_center|LOCUS_19690 38979 38545 gene locus_tag LOCUS_19700 38979 38545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207735.1 protein_id gnl|my_center|LOCUS_19700 39210 38995 gene locus_tag LOCUS_19710 39210 38995 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117042.1 protein_id gnl|my_center|LOCUS_19710 41286 39259 gene locus_tag LOCUS_19720 41286 39259 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207734.1 protein_id gnl|my_center|LOCUS_19720 42005 41379 gene locus_tag LOCUS_19730 42005 41379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 42065 42871 gene locus_tag LOCUS_19740 42065 42871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 45369 42928 gene locus_tag LOCUS_19750 gene rnr 45369 42928 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207733.1 protein_id gnl|my_center|LOCUS_19750 45637 45726 gene locus_tag LOCUS_t00310 45637 45726 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45742 45818 gene locus_tag LOCUS_t00320 45742 45818 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45866 45942 gene locus_tag LOCUS_t00330 45866 45942 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 46671 46003 gene locus_tag LOCUS_19760 46671 46003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 47683 46892 gene locus_tag LOCUS_19770 47683 46892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 47862 48059 gene locus_tag LOCUS_19780 47862 48059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 48382 48918 gene locus_tag LOCUS_19790 48382 48918 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206470.1 protein_id gnl|my_center|LOCUS_19790 48908 49579 gene locus_tag LOCUS_19800 48908 49579 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418066.1 protein_id gnl|my_center|LOCUS_19800 49576 50307 gene locus_tag LOCUS_19810 49576 50307 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130360.1 protein_id gnl|my_center|LOCUS_19810 50339 51244 gene locus_tag LOCUS_19820 50339 51244 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206471.1 protein_id gnl|my_center|LOCUS_19820 51305 52171 gene locus_tag LOCUS_19830 51305 52171 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206472.1 protein_id gnl|my_center|LOCUS_19830 52674 52237 gene locus_tag LOCUS_19840 52674 52237 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926470.1 protein_id gnl|my_center|LOCUS_19840 52779 54047 gene locus_tag LOCUS_19850 52779 54047 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206250.1 protein_id gnl|my_center|LOCUS_19850 54170 54246 gene locus_tag LOCUS_t00340 54170 54246 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54345 55130 gene locus_tag LOCUS_19860 54345 55130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 56443 55154 gene locus_tag LOCUS_19870 56443 55154 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121975069.1 protein_id gnl|my_center|LOCUS_19870 56632 57132 gene locus_tag LOCUS_19880 56632 57132 CDS product YcxB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804627.1 protein_id gnl|my_center|LOCUS_19880 57178 57816 gene locus_tag LOCUS_19890 57178 57816 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207728.1 protein_id gnl|my_center|LOCUS_19890 58793 58020 gene locus_tag LOCUS_19900 58793 58020 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943998.1 protein_id gnl|my_center|LOCUS_19900 58940 59881 gene locus_tag LOCUS_19910 58940 59881 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943999.1 protein_id gnl|my_center|LOCUS_19910 61217 59973 gene locus_tag LOCUS_19920 61217 59973 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112579.1 protein_id gnl|my_center|LOCUS_19920 61336 61929 gene locus_tag LOCUS_19930 gene wrbA 61336 61929 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207725.1 protein_id gnl|my_center|LOCUS_19930 63143 62205 gene locus_tag LOCUS_19940 63143 62205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 63662 63300 gene locus_tag LOCUS_19950 63662 63300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120526.1 protein_id gnl|my_center|LOCUS_19950 64758 63895 gene locus_tag LOCUS_19960 64758 63895 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207755.1 protein_id gnl|my_center|LOCUS_19960 65485 64910 gene locus_tag LOCUS_19970 65485 64910 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119547.1 protein_id gnl|my_center|LOCUS_19970 66296 65589 gene locus_tag LOCUS_19980 66296 65589 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_19980 67134 66448 gene locus_tag LOCUS_19990 67134 66448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207723.1 protein_id gnl|my_center|LOCUS_19990 67364 68245 gene locus_tag LOCUS_20000 67364 68245 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207722.1 protein_id gnl|my_center|LOCUS_20000 68804 68322 gene locus_tag LOCUS_20010 68804 68322 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964949.1 protein_id gnl|my_center|LOCUS_20010 69195 68911 gene locus_tag LOCUS_20020 69195 68911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 70205 69294 gene locus_tag LOCUS_20030 70205 69294 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064169.1 protein_id gnl|my_center|LOCUS_20030 70966 70244 gene locus_tag LOCUS_20040 gene radC 70966 70244 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207648.1 protein_id gnl|my_center|LOCUS_20040 71081 72346 gene locus_tag LOCUS_20050 gene coaBC 71081 72346 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207647.1 protein_id gnl|my_center|LOCUS_20050 72511 72885 gene locus_tag LOCUS_20060 72511 72885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 73266 74117 gene locus_tag LOCUS_20070 73266 74117 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_20070 74104 74841 gene locus_tag LOCUS_20080 74104 74841 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525296.1 protein_id gnl|my_center|LOCUS_20080 74845 75090 gene locus_tag LOCUS_20090 74845 75090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 75077 75694 gene locus_tag LOCUS_20100 75077 75694 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_20100 76179 75706 gene locus_tag LOCUS_20110 76179 75706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 76783 76325 gene locus_tag LOCUS_20120 gene secB 76783 76325 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115005.1 protein_id gnl|my_center|LOCUS_20120 77073 76816 gene locus_tag LOCUS_20130 gene grxC 77073 76816 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_20130 77500 77090 gene locus_tag LOCUS_20140 77500 77090 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_20140 78650 77592 gene locus_tag LOCUS_20150 gene rsgA 78650 77592 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208364.1 protein_id gnl|my_center|LOCUS_20150 78775 79332 gene locus_tag LOCUS_20160 gene orn 78775 79332 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099436.1 protein_id gnl|my_center|LOCUS_20160 80010 80744 gene locus_tag LOCUS_20170 80010 80744 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794670.1 protein_id gnl|my_center|LOCUS_20170 80903 81706 gene locus_tag LOCUS_20180 80903 81706 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208365.1 protein_id gnl|my_center|LOCUS_20180 81880 84510 gene locus_tag LOCUS_20190 81880 84510 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206351.1 protein_id gnl|my_center|LOCUS_20190 84510 85367 gene locus_tag LOCUS_20200 84510 85367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 85357 88353 gene locus_tag LOCUS_20210 85357 88353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence16 380 667 gene locus_tag LOCUS_20220 380 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1114 932 gene locus_tag LOCUS_20230 1114 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1562 2704 gene locus_tag LOCUS_20240 gene rodA 1562 2704 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068220.1 protein_id gnl|my_center|LOCUS_20240 2738 3739 gene locus_tag LOCUS_20250 gene mltB 2738 3739 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207240.1 protein_id gnl|my_center|LOCUS_20250 4025 4636 gene locus_tag LOCUS_20260 4025 4636 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207241.1 protein_id gnl|my_center|LOCUS_20260 4849 6012 gene locus_tag LOCUS_20270 4849 6012 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028914.1 protein_id gnl|my_center|LOCUS_20270 6205 7992 gene locus_tag LOCUS_20280 6205 7992 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074413.1 protein_id gnl|my_center|LOCUS_20280 8012 8785 gene locus_tag LOCUS_20290 8012 8785 CDS product DUF4850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207541.1 protein_id gnl|my_center|LOCUS_20290 8920 9366 gene locus_tag LOCUS_20300 8920 9366 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118194.1 protein_id gnl|my_center|LOCUS_20300 9732 9418 gene locus_tag LOCUS_20310 9732 9418 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088669.1 protein_id gnl|my_center|LOCUS_20310 10475 9729 gene locus_tag LOCUS_20320 10475 9729 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207242.1 protein_id gnl|my_center|LOCUS_20320 11421 10600 gene locus_tag LOCUS_20330 11421 10600 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207243.1 protein_id gnl|my_center|LOCUS_20330 12105 11557 gene locus_tag LOCUS_20340 12105 11557 CDS product DUF3465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207244.1 protein_id gnl|my_center|LOCUS_20340 13149 12274 gene locus_tag LOCUS_20350 gene tsf 13149 12274 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118238.1 protein_id gnl|my_center|LOCUS_20350 14041 13289 gene locus_tag LOCUS_20360 gene rpsB 14041 13289 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118204.1 protein_id gnl|my_center|LOCUS_20360 14261 15088 gene locus_tag LOCUS_20370 gene map 14261 15088 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207245.1 protein_id gnl|my_center|LOCUS_20370 15416 16465 gene locus_tag LOCUS_20380 15416 16465 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207246.1 protein_id gnl|my_center|LOCUS_20380 16638 17864 gene locus_tag LOCUS_20390 16638 17864 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207248.1 protein_id gnl|my_center|LOCUS_20390 19441 18197 gene locus_tag LOCUS_20400 19441 18197 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206115.1 protein_id gnl|my_center|LOCUS_20400 21173 19575 gene locus_tag LOCUS_20410 21173 19575 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206114.1 protein_id gnl|my_center|LOCUS_20410 22161 21145 gene locus_tag LOCUS_20420 22161 21145 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206113.1 protein_id gnl|my_center|LOCUS_20420 23231 22161 gene locus_tag LOCUS_20430 23231 22161 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206112.1 protein_id gnl|my_center|LOCUS_20430 25184 23346 gene locus_tag LOCUS_20440 25184 23346 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206111.1 protein_id gnl|my_center|LOCUS_20440 28549 25262 gene locus_tag LOCUS_20450 28549 25262 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206110.1 protein_id gnl|my_center|LOCUS_20450 28765 30180 gene locus_tag LOCUS_20460 gene dnaQ 28765 30180 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206109.1 protein_id gnl|my_center|LOCUS_20460 30309 31952 gene locus_tag LOCUS_20470 30309 31952 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206108.1 protein_id gnl|my_center|LOCUS_20470 31952 32710 gene locus_tag LOCUS_20480 gene nudC 31952 32710 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206107.1 protein_id gnl|my_center|LOCUS_20480 33649 32747 gene locus_tag LOCUS_20490 33649 32747 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206106.1 protein_id gnl|my_center|LOCUS_20490 34337 33633 gene locus_tag LOCUS_20500 34337 33633 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117601.1 protein_id gnl|my_center|LOCUS_20500 34861 34445 gene locus_tag LOCUS_20510 34861 34445 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206105.1 protein_id gnl|my_center|LOCUS_20510 35709 34873 gene locus_tag LOCUS_20520 35709 34873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 35834 36676 gene locus_tag LOCUS_20530 gene rsmI 35834 36676 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075551.1 protein_id gnl|my_center|LOCUS_20530 36871 37317 gene locus_tag LOCUS_20540 36871 37317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 37641 37390 gene locus_tag LOCUS_20550 37641 37390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117665.1 protein_id gnl|my_center|LOCUS_20550 39056 37815 gene locus_tag LOCUS_20560 39056 37815 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206101.1 protein_id gnl|my_center|LOCUS_20560 40264 39053 gene locus_tag LOCUS_20570 gene ubiH 40264 39053 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206100.1 protein_id gnl|my_center|LOCUS_20570 43427 40593 gene locus_tag LOCUS_20580 43427 40593 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920555.1 protein_id gnl|my_center|LOCUS_20580 44868 43699 gene locus_tag LOCUS_20590 44868 43699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 46361 45039 gene locus_tag LOCUS_20600 gene pepP 46361 45039 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206099.1 protein_id gnl|my_center|LOCUS_20600 47302 46670 gene locus_tag LOCUS_20610 47302 46670 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802891.1 protein_id gnl|my_center|LOCUS_20610 47367 47918 gene locus_tag LOCUS_20620 47367 47918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206098.1 protein_id gnl|my_center|LOCUS_20620 47921 48205 gene locus_tag LOCUS_20630 47921 48205 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117766.1 protein_id gnl|my_center|LOCUS_20630 49047 48757 gene locus_tag LOCUS_20640 49047 48757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 49473 49267 gene locus_tag LOCUS_20650 49473 49267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 49678 50100 gene locus_tag LOCUS_20660 49678 50100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 53342 50721 gene locus_tag LOCUS_20670 53342 50721 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815963.1 protein_id gnl|my_center|LOCUS_20670 54433 53450 gene locus_tag LOCUS_20680 54433 53450 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206008.1 protein_id gnl|my_center|LOCUS_20680 54971 54423 gene locus_tag LOCUS_20690 54971 54423 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206007.1 protein_id gnl|my_center|LOCUS_20690 55132 55506 gene locus_tag LOCUS_20700 55132 55506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 58089 55762 gene locus_tag LOCUS_20710 58089 55762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 60129 58639 gene locus_tag LOCUS_20720 60129 58639 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206010.1 protein_id gnl|my_center|LOCUS_20720 60952 60194 gene locus_tag LOCUS_20730 60952 60194 CDS product transferrin-binding protein-like solute binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041986.1 protein_id gnl|my_center|LOCUS_20730 64324 61154 gene locus_tag LOCUS_20740 64324 61154 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206009.1 protein_id gnl|my_center|LOCUS_20740 65722 64709 gene locus_tag LOCUS_20750 65722 64709 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206008.1 protein_id gnl|my_center|LOCUS_20750 66244 65723 gene locus_tag LOCUS_20760 66244 65723 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206007.1 protein_id gnl|my_center|LOCUS_20760 66964 66527 gene locus_tag LOCUS_20770 66964 66527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 67411 66986 gene locus_tag LOCUS_20780 67411 66986 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206012.1 protein_id gnl|my_center|LOCUS_20780 68038 67442 gene locus_tag LOCUS_20790 68038 67442 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002062720.1 protein_id gnl|my_center|LOCUS_20790 68877 68080 gene locus_tag LOCUS_20800 68877 68080 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206011.1 protein_id gnl|my_center|LOCUS_20800 70014 69304 gene locus_tag LOCUS_20810 70014 69304 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207114.1 protein_id gnl|my_center|LOCUS_20810 72699 70042 gene locus_tag LOCUS_20820 72699 70042 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207115.1 protein_id gnl|my_center|LOCUS_20820 73539 72937 gene locus_tag LOCUS_20830 gene kdpC 73539 72937 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207116.1 protein_id gnl|my_center|LOCUS_20830 75590 73560 gene locus_tag LOCUS_20840 gene kdpB 75590 73560 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207117.1 protein_id gnl|my_center|LOCUS_20840 77325 75601 gene locus_tag LOCUS_20850 gene kdpA 77325 75601 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207118.1 protein_id gnl|my_center|LOCUS_20850 77641 78441 gene locus_tag LOCUS_20860 77641 78441 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116515.1 protein_id gnl|my_center|LOCUS_20860 78975 78634 gene locus_tag LOCUS_20870 78975 78634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 79407 79129 gene locus_tag LOCUS_20880 79407 79129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 79562 80242 gene locus_tag LOCUS_20890 79562 80242 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_20890 80235 81611 gene locus_tag LOCUS_20900 gene pcoS 80235 81611 CDS product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 protein_id gnl|my_center|LOCUS_20900 83452 82235 gene locus_tag LOCUS_20910 83452 82235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20910 84605 83355 gene locus_tag LOCUS_20920 84605 83355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20920 <85427 84673 gene locus_tag LOCUS_20930 <85427 84673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040534536.1:IS5 family transposase >Feature sequence17 1588 317 gene locus_tag LOCUS_20940 1588 317 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207790.1 protein_id gnl|my_center|LOCUS_20940 1842 3119 gene locus_tag LOCUS_20950 1842 3119 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767839.1 protein_id gnl|my_center|LOCUS_20950 3134 4513 gene locus_tag LOCUS_20960 3134 4513 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694857.1 protein_id gnl|my_center|LOCUS_20960 4560 6053 gene locus_tag LOCUS_20970 4560 6053 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895535.1 protein_id gnl|my_center|LOCUS_20970 6191 7474 gene locus_tag LOCUS_20980 6191 7474 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112529.1 protein_id gnl|my_center|LOCUS_20980 7561 10494 gene locus_tag LOCUS_20990 7561 10494 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267753.1 protein_id gnl|my_center|LOCUS_20990 11820 10879 gene locus_tag LOCUS_21000 gene gcvA 11820 10879 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142898278.1 protein_id gnl|my_center|LOCUS_21000 11870 12571 gene locus_tag LOCUS_21010 11870 12571 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942960.1 protein_id gnl|my_center|LOCUS_21010 12636 12827 gene locus_tag LOCUS_21020 12636 12827 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064697.1 protein_id gnl|my_center|LOCUS_21020 12896 13474 gene locus_tag LOCUS_21030 12896 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 14393 13500 gene locus_tag LOCUS_21040 14393 13500 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095575.1 protein_id gnl|my_center|LOCUS_21040 15488 14616 gene locus_tag LOCUS_21050 15488 14616 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976244.1 protein_id gnl|my_center|LOCUS_21050 16984 15587 gene locus_tag LOCUS_21060 16984 15587 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206843.1 protein_id gnl|my_center|LOCUS_21060 17368 18534 gene locus_tag LOCUS_21070 17368 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206415.1 protein_id gnl|my_center|LOCUS_21070 19134 19048 gene locus_tag LOCUS_t00350 19134 19048 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19316 20374 gene locus_tag LOCUS_21080 gene queA 19316 20374 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207644.1 protein_id gnl|my_center|LOCUS_21080 20493 21509 gene locus_tag LOCUS_21090 20493 21509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 21611 22636 gene locus_tag LOCUS_21100 21611 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 22656 23225 gene locus_tag LOCUS_21110 22656 23225 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871101.1 protein_id gnl|my_center|LOCUS_21110 23516 23932 gene locus_tag LOCUS_21120 23516 23932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 24160 25290 gene locus_tag LOCUS_21130 gene tgt 24160 25290 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207645.1 protein_id gnl|my_center|LOCUS_21130 25425 25754 gene locus_tag LOCUS_21140 gene yajC 25425 25754 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116168.1 protein_id gnl|my_center|LOCUS_21140 25808 27709 gene locus_tag LOCUS_21150 gene secD 25808 27709 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116237.1 protein_id gnl|my_center|LOCUS_21150 27720 28688 gene locus_tag LOCUS_21160 gene secF 27720 28688 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207646.1 protein_id gnl|my_center|LOCUS_21160 29682 28975 gene locus_tag LOCUS_21170 29682 28975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 31262 29808 gene locus_tag LOCUS_21180 31262 29808 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079030.1 protein_id gnl|my_center|LOCUS_21180 31586 31266 gene locus_tag LOCUS_21190 31586 31266 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 protein_id gnl|my_center|LOCUS_21190 32725 31598 gene locus_tag LOCUS_21200 32725 31598 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208383.1 protein_id gnl|my_center|LOCUS_21200 33655 34581 gene locus_tag LOCUS_21210 33655 34581 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208382.1 protein_id gnl|my_center|LOCUS_21210 34606 35481 gene locus_tag LOCUS_21220 34606 35481 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100070.1 protein_id gnl|my_center|LOCUS_21220 36135 35545 gene locus_tag LOCUS_21230 36135 35545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 36208 36639 gene locus_tag LOCUS_21240 36208 36639 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208381.1 protein_id gnl|my_center|LOCUS_21240 36662 37852 gene locus_tag LOCUS_21250 36662 37852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208380.1 protein_id gnl|my_center|LOCUS_21250 38312 38160 gene locus_tag LOCUS_21260 38312 38160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 38347 38766 gene locus_tag LOCUS_21270 38347 38766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 38835 39254 gene locus_tag LOCUS_21280 38835 39254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 40250 39606 gene locus_tag LOCUS_21290 40250 39606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 40702 42048 gene locus_tag LOCUS_21300 40702 42048 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764779.1 protein_id gnl|my_center|LOCUS_21300 42104 42988 gene locus_tag LOCUS_21310 42104 42988 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 protein_id gnl|my_center|LOCUS_21310 43011 44390 gene locus_tag LOCUS_21320 43011 44390 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268749.1 protein_id gnl|my_center|LOCUS_21320 44401 45171 gene locus_tag LOCUS_21330 44401 45171 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764783.1 protein_id gnl|my_center|LOCUS_21330 45259 46008 gene locus_tag LOCUS_21340 45259 46008 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412971.1 protein_id gnl|my_center|LOCUS_21340 46028 46324 gene locus_tag LOCUS_21350 46028 46324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431302.1 protein_id gnl|my_center|LOCUS_21350 46327 47295 gene locus_tag LOCUS_21360 46327 47295 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764786.1 protein_id gnl|my_center|LOCUS_21360 47559 48788 gene locus_tag LOCUS_21370 47559 48788 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207595.1 protein_id gnl|my_center|LOCUS_21370 49017 50207 gene locus_tag LOCUS_21380 49017 50207 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268746.1 protein_id gnl|my_center|LOCUS_21380 51238 50234 gene locus_tag LOCUS_21390 51238 50234 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207837.1 protein_id gnl|my_center|LOCUS_21390 52835 51519 gene locus_tag LOCUS_21400 52835 51519 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207595.1 protein_id gnl|my_center|LOCUS_21400 54155 52926 gene locus_tag LOCUS_21410 gene fucP 54155 52926 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_21410 54516 54181 gene locus_tag LOCUS_21420 54516 54181 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369371.1 protein_id gnl|my_center|LOCUS_21420 55328 54546 gene locus_tag LOCUS_21430 55328 54546 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_21430 56188 55364 gene locus_tag LOCUS_21440 56188 55364 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_21440 57696 56419 gene locus_tag LOCUS_21450 57696 56419 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_21450 58652 57810 gene locus_tag LOCUS_21460 58652 57810 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211916.1 protein_id gnl|my_center|LOCUS_21460 59431 58679 gene locus_tag LOCUS_21470 59431 58679 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703673.1 protein_id gnl|my_center|LOCUS_21470 59560 60282 gene locus_tag LOCUS_21480 59560 60282 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369365.1 protein_id gnl|my_center|LOCUS_21480 61156 60599 gene locus_tag LOCUS_21490 61156 60599 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206142.1 protein_id gnl|my_center|LOCUS_21490 61634 62638 gene locus_tag LOCUS_21500 gene dusA 61634 62638 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208379.1 protein_id gnl|my_center|LOCUS_21500 63604 62714 gene locus_tag LOCUS_21510 63604 62714 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208376.1 protein_id gnl|my_center|LOCUS_21510 64529 64020 gene locus_tag LOCUS_21520 64529 64020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 65715 64606 gene locus_tag LOCUS_21530 65715 64606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 67044 66274 gene locus_tag LOCUS_21540 67044 66274 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208375.1 protein_id gnl|my_center|LOCUS_21540 69934 67178 gene locus_tag LOCUS_21550 gene acnA 69934 67178 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208374.1 protein_id gnl|my_center|LOCUS_21550 70973 70149 gene locus_tag LOCUS_21560 70973 70149 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208373.1 protein_id gnl|my_center|LOCUS_21560 71941 70973 gene locus_tag LOCUS_21570 71941 70973 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208372.1 protein_id gnl|my_center|LOCUS_21570 72962 72204 gene locus_tag LOCUS_21580 72962 72204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117238.1 protein_id gnl|my_center|LOCUS_21580 74701 73112 gene locus_tag LOCUS_21590 74701 73112 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066204.1 protein_id gnl|my_center|LOCUS_21590 75562 75020 gene locus_tag LOCUS_21600 75562 75020 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117499.1 protein_id gnl|my_center|LOCUS_21600 76768 76193 gene locus_tag LOCUS_21610 gene sfmF 76768 76193 CDS product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603408.1 protein_id gnl|my_center|LOCUS_21610 77803 76778 gene locus_tag LOCUS_21620 77803 76778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 80429 77817 gene locus_tag LOCUS_21630 80429 77817 CDS product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095933.1 protein_id gnl|my_center|LOCUS_21630 81159 80458 gene locus_tag LOCUS_21640 gene fimC 81159 80458 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095932.1 protein_id gnl|my_center|LOCUS_21640 81691 81179 gene locus_tag LOCUS_21650 81691 81179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 82266 81730 gene locus_tag LOCUS_21660 gene fimA 82266 81730 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095930.1 protein_id gnl|my_center|LOCUS_21660 84727 82664 gene locus_tag LOCUS_21670 84727 82664 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066201.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence18 500 1870 gene locus_tag LOCUS_21680 500 1870 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208062.1 protein_id gnl|my_center|LOCUS_21680 2943 1924 gene locus_tag LOCUS_21690 gene galE 2943 1924 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208059.1 protein_id gnl|my_center|LOCUS_21690 4564 2954 gene locus_tag LOCUS_21700 gene pgi 4564 2954 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208058.1 protein_id gnl|my_center|LOCUS_21700 5841 4582 gene locus_tag LOCUS_21710 5841 4582 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 protein_id gnl|my_center|LOCUS_21710 6732 5857 gene locus_tag LOCUS_21720 gene galU 6732 5857 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208056.1 protein_id gnl|my_center|LOCUS_21720 7377 6757 gene locus_tag LOCUS_21730 7377 6757 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462478.1 protein_id gnl|my_center|LOCUS_21730 8224 7394 gene locus_tag LOCUS_21740 8224 7394 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208054.1 protein_id gnl|my_center|LOCUS_21740 9121 8252 gene locus_tag LOCUS_21750 9121 8252 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_21750 10265 9078 gene locus_tag LOCUS_21760 10265 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 12798 11548 gene locus_tag LOCUS_21770 12798 11548 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966346.1 protein_id gnl|my_center|LOCUS_21770 13688 12795 gene locus_tag LOCUS_21780 13688 12795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 14256 13708 gene locus_tag LOCUS_21790 gene rfbC 14256 13708 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100804.1 protein_id gnl|my_center|LOCUS_21790 15196 14294 gene locus_tag LOCUS_21800 gene rfbA 15196 14294 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 protein_id gnl|my_center|LOCUS_21800 16113 15196 gene locus_tag LOCUS_21810 gene rfbD 16113 15196 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771401.1 protein_id gnl|my_center|LOCUS_21810 17187 16117 gene locus_tag LOCUS_21820 gene rfbB 17187 16117 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 protein_id gnl|my_center|LOCUS_21820 17574 18686 gene locus_tag LOCUS_21830 17574 18686 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208042.1 protein_id gnl|my_center|LOCUS_21830 18686 19114 gene locus_tag LOCUS_21840 18686 19114 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208041.1 protein_id gnl|my_center|LOCUS_21840 19136 21331 gene locus_tag LOCUS_21850 19136 21331 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208040.1 protein_id gnl|my_center|LOCUS_21850 21521 22231 gene locus_tag LOCUS_21860 21521 22231 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208039.1 protein_id gnl|my_center|LOCUS_21860 22279 22968 gene locus_tag LOCUS_21870 22279 22968 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208038.1 protein_id gnl|my_center|LOCUS_21870 24584 23043 gene locus_tag LOCUS_21880 gene murJ 24584 23043 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804817.1 protein_id gnl|my_center|LOCUS_21880 25256 24669 gene locus_tag LOCUS_21890 gene ampD 25256 24669 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_21890 25410 26255 gene locus_tag LOCUS_21900 gene nadC 25410 26255 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208036.1 protein_id gnl|my_center|LOCUS_21900 26404 27567 gene locus_tag LOCUS_21910 26404 27567 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538730.1 protein_id gnl|my_center|LOCUS_21910 27749 29614 gene locus_tag LOCUS_21920 27749 29614 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208061.1 protein_id gnl|my_center|LOCUS_21920 29787 29623 gene locus_tag LOCUS_21930 29787 29623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 32205 30025 gene locus_tag LOCUS_21940 32205 30025 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208034.1 protein_id gnl|my_center|LOCUS_21940 32126 32374 gene locus_tag LOCUS_21950 32126 32374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 33240 32524 gene locus_tag LOCUS_21960 gene rph 33240 32524 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120794.1 protein_id gnl|my_center|LOCUS_21960 34561 33425 gene locus_tag LOCUS_21970 34561 33425 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704057.1 protein_id gnl|my_center|LOCUS_21970 34665 35459 gene locus_tag LOCUS_21980 34665 35459 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705836.1 protein_id gnl|my_center|LOCUS_21980 36695 35556 gene locus_tag LOCUS_21990 36695 35556 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208032.1 protein_id gnl|my_center|LOCUS_21990 37837 36815 gene locus_tag LOCUS_22000 37837 36815 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208031.1 protein_id gnl|my_center|LOCUS_22000 38012 38656 gene locus_tag LOCUS_22010 38012 38656 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120796.1 protein_id gnl|my_center|LOCUS_22010 38747 39328 gene locus_tag LOCUS_22020 38747 39328 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_22020 39442 39594 gene locus_tag LOCUS_22030 39442 39594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 39587 40798 gene locus_tag LOCUS_22040 39587 40798 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113088.1 protein_id gnl|my_center|LOCUS_22040 41482 40865 gene locus_tag LOCUS_22050 41482 40865 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804825.1 protein_id gnl|my_center|LOCUS_22050 41932 42645 gene locus_tag LOCUS_22060 gene ubiG 41932 42645 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804826.1 protein_id gnl|my_center|LOCUS_22060 42645 43316 gene locus_tag LOCUS_22070 42645 43316 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_22070 43444 44190 gene locus_tag LOCUS_22080 43444 44190 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_22080 44395 44550 gene locus_tag LOCUS_22090 44395 44550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 44541 44720 gene locus_tag LOCUS_22100 44541 44720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 44830 45225 gene locus_tag LOCUS_22110 44830 45225 CDS product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120752.1 protein_id gnl|my_center|LOCUS_22110 45445 45741 gene locus_tag LOCUS_22120 45445 45741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 46109 46471 gene locus_tag LOCUS_22130 46109 46471 CDS product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120775.1 protein_id gnl|my_center|LOCUS_22130 46848 48203 gene locus_tag LOCUS_22140 gene argA 46848 48203 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120768.1 protein_id gnl|my_center|LOCUS_22140 48533 49492 gene locus_tag LOCUS_22150 48533 49492 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208029.1 protein_id gnl|my_center|LOCUS_22150 49526 50518 gene locus_tag LOCUS_22160 49526 50518 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208028.1 protein_id gnl|my_center|LOCUS_22160 50547 51716 gene locus_tag LOCUS_22170 gene ssuD 50547 51716 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208027.1 protein_id gnl|my_center|LOCUS_22170 51713 52534 gene locus_tag LOCUS_22180 gene ssuC 51713 52534 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_22180 52544 53341 gene locus_tag LOCUS_22190 52544 53341 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208026.1 protein_id gnl|my_center|LOCUS_22190 53841 54455 gene locus_tag LOCUS_22200 53841 54455 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071782.1 protein_id gnl|my_center|LOCUS_22200 55125 54559 gene locus_tag LOCUS_22210 55125 54559 CDS product 5'-nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208025.1 protein_id gnl|my_center|LOCUS_22210 55303 55845 gene locus_tag LOCUS_22220 55303 55845 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208020.1 protein_id gnl|my_center|LOCUS_22220 56656 56126 gene locus_tag LOCUS_22230 56656 56126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 57199 56744 gene locus_tag LOCUS_22240 57199 56744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 57872 57201 gene locus_tag LOCUS_22250 57872 57201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 58401 57844 gene locus_tag LOCUS_22260 58401 57844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 58975 58709 gene locus_tag LOCUS_22270 58975 58709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 59791 59015 gene locus_tag LOCUS_22280 59791 59015 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206364.1 protein_id gnl|my_center|LOCUS_22280 60743 59784 gene locus_tag LOCUS_22290 gene tagF 60743 59784 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206363.1 protein_id gnl|my_center|LOCUS_22290 64644 60778 gene locus_tag LOCUS_22300 64644 60778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 66064 64679 gene locus_tag LOCUS_22310 66064 64679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206359.1 protein_id gnl|my_center|LOCUS_22310 67057 66065 gene locus_tag LOCUS_22320 gene tssG 67057 66065 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206358.1 protein_id gnl|my_center|LOCUS_22320 68829 67021 gene locus_tag LOCUS_22330 gene tssF 68829 67021 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206357.1 protein_id gnl|my_center|LOCUS_22330 69318 68845 gene locus_tag LOCUS_22340 gene tssE 69318 68845 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048404.1 protein_id gnl|my_center|LOCUS_22340 69887 69384 gene locus_tag LOCUS_22350 69887 69384 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653195.1 protein_id gnl|my_center|LOCUS_22350 71416 69935 gene locus_tag LOCUS_22360 gene tssC 71416 69935 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206356.1 protein_id gnl|my_center|LOCUS_22360 71918 71409 gene locus_tag LOCUS_22370 gene tssB 71918 71409 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005041656.1 protein_id gnl|my_center|LOCUS_22370 72491 71949 gene locus_tag LOCUS_22380 72491 71949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 72967 75645 gene locus_tag LOCUS_22390 gene tssH 72967 75645 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206366.1 protein_id gnl|my_center|LOCUS_22390 75663 76772 gene locus_tag LOCUS_22400 gene tssA 75663 76772 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206367.1 protein_id gnl|my_center|LOCUS_22400 76779 78143 gene locus_tag LOCUS_22410 gene tssK 76779 78143 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206368.1 protein_id gnl|my_center|LOCUS_22410 78156 78959 gene locus_tag LOCUS_22420 gene icmH 78156 78959 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206369.1 protein_id gnl|my_center|LOCUS_22420 78970 79548 gene locus_tag LOCUS_22430 78970 79548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 79545 80528 gene locus_tag LOCUS_22440 79545 80528 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206371.1 protein_id gnl|my_center|LOCUS_22440 81087 80776 gene locus_tag LOCUS_22450 81087 80776 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208019.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence19 3 233 gene locus_tag LOCUS_22460 3 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1778 441 gene locus_tag LOCUS_22470 1778 441 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730982.1 protein_id gnl|my_center|LOCUS_22470 3262 1805 gene locus_tag LOCUS_22480 gene gabD 3262 1805 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176534.1 protein_id gnl|my_center|LOCUS_22480 4705 3269 gene locus_tag LOCUS_22490 4705 3269 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_22490 5862 4708 gene locus_tag LOCUS_22500 5862 4708 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_22500 7546 6584 gene locus_tag LOCUS_22510 gene speB 7546 6584 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187785.1 protein_id gnl|my_center|LOCUS_22510 9098 7587 gene locus_tag LOCUS_22520 9098 7587 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729850.1 protein_id gnl|my_center|LOCUS_22520 10031 9120 gene locus_tag LOCUS_22530 10031 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 10790 10038 gene locus_tag LOCUS_22540 10790 10038 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_22540 12006 12776 gene locus_tag LOCUS_22550 12006 12776 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 protein_id gnl|my_center|LOCUS_22550 12788 14005 gene locus_tag LOCUS_22560 gene rhmD 12788 14005 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 protein_id gnl|my_center|LOCUS_22560 14429 15226 gene locus_tag LOCUS_22570 gene yfaU 14429 15226 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992948.1 protein_id gnl|my_center|LOCUS_22570 15261 16691 gene locus_tag LOCUS_22580 gene aldA 15261 16691 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115944.1 protein_id gnl|my_center|LOCUS_22580 16822 17691 gene locus_tag LOCUS_22590 16822 17691 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_22590 17691 18005 gene locus_tag LOCUS_22600 gene rhaM 17691 18005 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619511.1 protein_id gnl|my_center|LOCUS_22600 18024 19091 gene locus_tag LOCUS_22610 gene rhaT 18024 19091 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_22610 19102 19872 gene locus_tag LOCUS_22620 gene fabG 19102 19872 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_22620 19899 21152 gene locus_tag LOCUS_22630 19899 21152 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207595.1 protein_id gnl|my_center|LOCUS_22630 21723 21648 gene locus_tag LOCUS_t00360 21723 21648 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21844 21769 gene locus_tag LOCUS_t00370 21844 21769 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21964 21891 gene locus_tag LOCUS_t00380 21964 21891 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22182 22490 gene locus_tag LOCUS_22640 22182 22490 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 protein_id gnl|my_center|LOCUS_22640 22509 22901 gene locus_tag LOCUS_22650 22509 22901 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208111.1 protein_id gnl|my_center|LOCUS_22650 22986 23822 gene locus_tag LOCUS_22660 22986 23822 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071966.1 protein_id gnl|my_center|LOCUS_22660 23836 24249 gene locus_tag LOCUS_22670 23836 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114091.1 protein_id gnl|my_center|LOCUS_22670 24972 24322 gene locus_tag LOCUS_22680 24972 24322 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_22680 25169 25585 gene locus_tag LOCUS_22690 25169 25585 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208113.1 protein_id gnl|my_center|LOCUS_22690 25702 26328 gene locus_tag LOCUS_22700 25702 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 26449 28017 gene locus_tag LOCUS_22710 gene guaA 26449 28017 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114136.1 protein_id gnl|my_center|LOCUS_22710 28090 29685 gene locus_tag LOCUS_22720 28090 29685 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 protein_id gnl|my_center|LOCUS_22720 30533 29766 gene locus_tag LOCUS_22730 30533 29766 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078653.1 protein_id gnl|my_center|LOCUS_22730 31704 30832 gene locus_tag LOCUS_22740 31704 30832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 32043 32975 gene locus_tag LOCUS_22750 gene prfB 32043 32975 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121932.1 protein_id gnl|my_center|LOCUS_22750 33083 33415 gene locus_tag LOCUS_22760 33083 33415 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121891.1 protein_id gnl|my_center|LOCUS_22760 33452 34510 gene locus_tag LOCUS_22770 33452 34510 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207922.1 protein_id gnl|my_center|LOCUS_22770 34816 36141 gene locus_tag LOCUS_22780 34816 36141 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207921.1 protein_id gnl|my_center|LOCUS_22780 36213 36926 gene locus_tag LOCUS_22790 36213 36926 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207920.1 protein_id gnl|my_center|LOCUS_22790 37913 36909 gene locus_tag LOCUS_22800 37913 36909 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_22800 38618 38037 gene locus_tag LOCUS_22810 38618 38037 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066837.1 protein_id gnl|my_center|LOCUS_22810 38912 40855 gene locus_tag LOCUS_22820 gene acs 38912 40855 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207919.1 protein_id gnl|my_center|LOCUS_22820 41028 42209 gene locus_tag LOCUS_22830 41028 42209 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_22830 43857 42736 gene locus_tag LOCUS_22840 gene blaADC 43857 42736 CDS product extended-spectrum class C beta-lactamase ADC-149 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207272.1 protein_id gnl|my_center|LOCUS_22840 45335 44217 gene locus_tag LOCUS_22850 gene sfnG 45335 44217 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207915.1 protein_id gnl|my_center|LOCUS_22850 46118 45381 gene locus_tag LOCUS_22860 gene msuE 46118 45381 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207914.1 protein_id gnl|my_center|LOCUS_22860 46496 47149 gene locus_tag LOCUS_22870 46496 47149 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_22870 47385 48623 gene locus_tag LOCUS_22880 47385 48623 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_22880 48840 51239 gene locus_tag LOCUS_22890 48840 51239 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004902067.1 protein_id gnl|my_center|LOCUS_22890 51661 52185 gene locus_tag LOCUS_22900 51661 52185 CDS product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208143.1 protein_id gnl|my_center|LOCUS_22900 52596 52234 gene locus_tag LOCUS_22910 52596 52234 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208144.1 protein_id gnl|my_center|LOCUS_22910 52874 52665 gene locus_tag LOCUS_22920 52874 52665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208145.1 protein_id gnl|my_center|LOCUS_22920 54352 52940 gene locus_tag LOCUS_22930 gene creD 54352 52940 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208146.1 protein_id gnl|my_center|LOCUS_22930 55930 54470 gene locus_tag LOCUS_22940 gene creC 55930 54470 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208147.1 protein_id gnl|my_center|LOCUS_22940 56653 55934 gene locus_tag LOCUS_22950 gene creB 56653 55934 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208148.1 protein_id gnl|my_center|LOCUS_22950 57705 57106 gene locus_tag LOCUS_22960 57705 57106 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208120.1 protein_id gnl|my_center|LOCUS_22960 59584 57794 gene locus_tag LOCUS_22970 gene argS 59584 57794 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208121.1 protein_id gnl|my_center|LOCUS_22970 60460 60699 gene locus_tag LOCUS_22980 60460 60699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 60757 61026 gene locus_tag LOCUS_22990 60757 61026 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 protein_id gnl|my_center|LOCUS_22990 61519 61040 gene locus_tag LOCUS_23000 61519 61040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 61959 63656 gene locus_tag LOCUS_23010 61959 63656 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114135.1 protein_id gnl|my_center|LOCUS_23010 63883 67209 gene locus_tag LOCUS_23020 63883 67209 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207953.1 protein_id gnl|my_center|LOCUS_23020 67209 67658 gene locus_tag LOCUS_23030 67209 67658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 67659 69800 gene locus_tag LOCUS_23040 67659 69800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 69810 70334 gene locus_tag LOCUS_23050 69810 70334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 70602 71483 gene locus_tag LOCUS_23060 70602 71483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 71627 72001 gene locus_tag LOCUS_23070 71627 72001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 72123 72392 gene locus_tag LOCUS_23080 72123 72392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 72371 72646 gene locus_tag LOCUS_23090 72371 72646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 73659 72739 gene locus_tag LOCUS_23100 73659 72739 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208122.1 protein_id gnl|my_center|LOCUS_23100 73863 74441 gene locus_tag LOCUS_23110 73863 74441 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804759.1 protein_id gnl|my_center|LOCUS_23110 74582 75133 gene locus_tag LOCUS_23120 74582 75133 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115157.1 protein_id gnl|my_center|LOCUS_23120 75981 75184 gene locus_tag LOCUS_23130 gene znuB 75981 75184 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208123.1 protein_id gnl|my_center|LOCUS_23130 76785 75985 gene locus_tag LOCUS_23140 gene znuC 76785 75985 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208124.1 protein_id gnl|my_center|LOCUS_23140 77255 76758 gene locus_tag LOCUS_23150 77255 76758 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 protein_id gnl|my_center|LOCUS_23150 77393 78235 gene locus_tag LOCUS_23160 77393 78235 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208126.1 protein_id gnl|my_center|LOCUS_23160 78407 78805 gene locus_tag LOCUS_23170 78407 78805 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072004.1 protein_id gnl|my_center|LOCUS_23170 78909 79784 gene locus_tag LOCUS_23180 gene atpB 78909 79784 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114072.1 protein_id gnl|my_center|LOCUS_23180 79868 80113 gene locus_tag LOCUS_23190 gene atpE 79868 80113 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424060.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence20 303 2384 gene locus_tag LOCUS_23200 gene ppk1 303 2384 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206067.1 protein_id gnl|my_center|LOCUS_23200 3672 2494 gene locus_tag LOCUS_23210 gene tet 3672 2494 CDS product tetracycline efflux MFS transporter Tet(30) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973639.1 protein_id gnl|my_center|LOCUS_23210 4948 4043 gene locus_tag LOCUS_23220 gene oxyR 4948 4043 CDS product LysR family transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117503.1 protein_id gnl|my_center|LOCUS_23220 5900 4962 gene locus_tag LOCUS_23230 gene estB 5900 4962 CDS product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_23230 7147 5957 gene locus_tag LOCUS_23240 gene rubB 7147 5957 CDS product rubredoxin reductase RubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206071.1 protein_id gnl|my_center|LOCUS_23240 7411 7247 gene locus_tag LOCUS_23250 gene rubA 7411 7247 CDS product rubredoxin RubA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760495.1 protein_id gnl|my_center|LOCUS_23250 7916 8452 gene locus_tag LOCUS_23260 7916 8452 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728726.1 protein_id gnl|my_center|LOCUS_23260 9021 8524 gene locus_tag LOCUS_23270 9021 8524 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206073.1 protein_id gnl|my_center|LOCUS_23270 9323 9763 gene locus_tag LOCUS_23280 9323 9763 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206072.1 protein_id gnl|my_center|LOCUS_23280 10544 9783 gene locus_tag LOCUS_23290 10544 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 10648 12174 gene locus_tag LOCUS_23300 gene lysS 10648 12174 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206074.1 protein_id gnl|my_center|LOCUS_23300 13253 12240 gene locus_tag LOCUS_23310 gene trpS 13253 12240 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116097.1 protein_id gnl|my_center|LOCUS_23310 13450 14379 gene locus_tag LOCUS_23320 13450 14379 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_23320 14429 15319 gene locus_tag LOCUS_23330 14429 15319 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207472.1 protein_id gnl|my_center|LOCUS_23330 15547 17046 gene locus_tag LOCUS_23340 15547 17046 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207471.1 protein_id gnl|my_center|LOCUS_23340 18122 17151 gene locus_tag LOCUS_23350 18122 17151 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 protein_id gnl|my_center|LOCUS_23350 18278 18592 gene locus_tag LOCUS_23360 18278 18592 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 protein_id gnl|my_center|LOCUS_23360 19083 18646 gene locus_tag LOCUS_23370 19083 18646 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207464.1 protein_id gnl|my_center|LOCUS_23370 19526 20311 gene locus_tag LOCUS_23380 gene paaG 19526 20311 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_23380 20318 21085 gene locus_tag LOCUS_23390 20318 21085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207465.1 protein_id gnl|my_center|LOCUS_23390 21348 22403 gene locus_tag LOCUS_23400 gene hppD 21348 22403 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119157.1 protein_id gnl|my_center|LOCUS_23400 23256 22477 gene locus_tag LOCUS_23410 23256 22477 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119135.1 protein_id gnl|my_center|LOCUS_23410 24183 23542 gene locus_tag LOCUS_23420 24183 23542 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 protein_id gnl|my_center|LOCUS_23420 24899 24195 gene locus_tag LOCUS_23430 24899 24195 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206697.1 protein_id gnl|my_center|LOCUS_23430 25450 24905 gene locus_tag LOCUS_23440 25450 24905 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_23440 26102 25470 gene locus_tag LOCUS_23450 gene maiA 26102 25470 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_23450 27393 26089 gene locus_tag LOCUS_23460 gene fahA 27393 26089 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_23460 27745 29133 gene locus_tag LOCUS_23470 27745 29133 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119258.1 protein_id gnl|my_center|LOCUS_23470 29843 29214 gene locus_tag LOCUS_23480 29843 29214 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207463.1 protein_id gnl|my_center|LOCUS_23480 30896 30012 gene locus_tag LOCUS_23490 30896 30012 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206177.1 protein_id gnl|my_center|LOCUS_23490 31771 31295 gene locus_tag LOCUS_23500 gene greA 31771 31295 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115570.1 protein_id gnl|my_center|LOCUS_23500 35096 31863 gene locus_tag LOCUS_23510 gene carB 35096 31863 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067595.1 protein_id gnl|my_center|LOCUS_23510 36265 35111 gene locus_tag LOCUS_23520 gene carA 36265 35111 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207460.1 protein_id gnl|my_center|LOCUS_23520 36585 37049 gene locus_tag LOCUS_23530 36585 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207459.1 protein_id gnl|my_center|LOCUS_23530 37683 37144 gene locus_tag LOCUS_23540 37683 37144 CDS product DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115550.1 protein_id gnl|my_center|LOCUS_23540 38018 37695 gene locus_tag LOCUS_23550 gene yhbY 38018 37695 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207458.1 protein_id gnl|my_center|LOCUS_23550 38217 38867 gene locus_tag LOCUS_23560 gene rlmE 38217 38867 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235573.1 protein_id gnl|my_center|LOCUS_23560 39146 40936 gene locus_tag LOCUS_23570 gene ftsH 39146 40936 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115544.1 protein_id gnl|my_center|LOCUS_23570 41066 41920 gene locus_tag LOCUS_23580 gene folP 41066 41920 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207457.1 protein_id gnl|my_center|LOCUS_23580 42117 42431 gene locus_tag LOCUS_23590 42117 42431 CDS product DUF5713 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115563.1 protein_id gnl|my_center|LOCUS_23590 42781 42857 gene locus_tag LOCUS_t00390 42781 42857 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 44834 43794 gene locus_tag LOCUS_23600 44834 43794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 46465 44840 gene locus_tag LOCUS_23610 46465 44840 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205965.1 protein_id gnl|my_center|LOCUS_23610 47352 46867 gene locus_tag LOCUS_23620 47352 46867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205966.1 protein_id gnl|my_center|LOCUS_23620 48660 47854 gene locus_tag LOCUS_23630 48660 47854 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936067.1 protein_id gnl|my_center|LOCUS_23630 48977 49933 gene locus_tag LOCUS_23640 48977 49933 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 protein_id gnl|my_center|LOCUS_23640 50552 51505 gene locus_tag LOCUS_23650 50552 51505 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 protein_id gnl|my_center|LOCUS_23650 51534 52379 gene locus_tag LOCUS_23660 51534 52379 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 protein_id gnl|my_center|LOCUS_23660 52397 54178 gene locus_tag LOCUS_23670 52397 54178 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 protein_id gnl|my_center|LOCUS_23670 54815 54225 gene locus_tag LOCUS_23680 54815 54225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 55073 55741 gene locus_tag LOCUS_23690 55073 55741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 55811 56428 gene locus_tag LOCUS_23700 55811 56428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 58556 56754 gene locus_tag LOCUS_23710 58556 56754 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207263.1 protein_id gnl|my_center|LOCUS_23710 59635 58553 gene locus_tag LOCUS_23720 59635 58553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23720 60120 59620 gene locus_tag LOCUS_23730 60120 59620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23730 61658 60384 gene locus_tag LOCUS_23740 gene gltA 61658 60384 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116327.1 protein_id gnl|my_center|LOCUS_23740 62737 63126 gene locus_tag LOCUS_23750 gene sdhC 62737 63126 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207477.1 protein_id gnl|my_center|LOCUS_23750 63126 63491 gene locus_tag LOCUS_23760 gene sdhD 63126 63491 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833672.1 protein_id gnl|my_center|LOCUS_23760 63504 65402 gene locus_tag LOCUS_23770 gene sdhA 63504 65402 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116225.1 protein_id gnl|my_center|LOCUS_23770 65417 66127 gene locus_tag LOCUS_23780 65417 66127 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207476.1 protein_id gnl|my_center|LOCUS_23780 66753 69590 gene locus_tag LOCUS_23790 66753 69590 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207474.1 protein_id gnl|my_center|LOCUS_23790 69590 70804 gene locus_tag LOCUS_23800 gene odhB 69590 70804 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064561.1 protein_id gnl|my_center|LOCUS_23800 70865 72301 gene locus_tag LOCUS_23810 gene lpdA 70865 72301 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116053.1 protein_id gnl|my_center|LOCUS_23810 72470 73636 gene locus_tag LOCUS_23820 gene sucC 72470 73636 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048573.1 protein_id gnl|my_center|LOCUS_23820 73649 74539 gene locus_tag LOCUS_23830 gene sucD 73649 74539 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222615.1 protein_id gnl|my_center|LOCUS_23830 75407 74637 gene locus_tag LOCUS_23840 75407 74637 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013843.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence21 1140 334 gene locus_tag LOCUS_23850 gene trpC 1140 334 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207267.1 protein_id gnl|my_center|LOCUS_23850 2205 1159 gene locus_tag LOCUS_23860 gene trpD 2205 1159 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118605.1 protein_id gnl|my_center|LOCUS_23860 2808 2221 gene locus_tag LOCUS_23870 2808 2221 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207264.1 protein_id gnl|my_center|LOCUS_23870 3770 3294 gene locus_tag LOCUS_23880 3770 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 4818 4390 gene locus_tag LOCUS_23890 4818 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 5433 5032 gene locus_tag LOCUS_23900 5433 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 5955 6452 gene locus_tag LOCUS_23910 5955 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 7110 7186 gene locus_tag LOCUS_t00400 7110 7186 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7513 7734 gene locus_tag LOCUS_23920 7513 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070233.1 protein_id gnl|my_center|LOCUS_23920 7972 8172 gene locus_tag LOCUS_23930 7972 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 8688 8948 gene locus_tag LOCUS_23940 8688 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 9872 10813 gene locus_tag LOCUS_23950 9872 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207702.1 protein_id gnl|my_center|LOCUS_23950 10898 11467 gene locus_tag LOCUS_23960 10898 11467 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_23960 11877 13292 gene locus_tag LOCUS_23970 gene glnA 11877 13292 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002052696.1 protein_id gnl|my_center|LOCUS_23970 14214 13807 gene locus_tag LOCUS_23980 14214 13807 CDS product DUF3106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118619.1 protein_id gnl|my_center|LOCUS_23980 14530 14204 gene locus_tag LOCUS_23990 14530 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118556.1 protein_id gnl|my_center|LOCUS_23990 15137 14523 gene locus_tag LOCUS_24000 15137 14523 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118814.1 protein_id gnl|my_center|LOCUS_24000 16070 15294 gene locus_tag LOCUS_24010 16070 15294 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 protein_id gnl|my_center|LOCUS_24010 17153 16179 gene locus_tag LOCUS_24020 17153 16179 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207393.1 protein_id gnl|my_center|LOCUS_24020 17328 17513 gene locus_tag LOCUS_24030 17328 17513 CDS product NF038105 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067763.1 protein_id gnl|my_center|LOCUS_24030 17595 18200 gene locus_tag LOCUS_24040 17595 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 18895 18326 gene locus_tag LOCUS_24050 gene pal 18895 18326 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118513.1 protein_id gnl|my_center|LOCUS_24050 20229 18946 gene locus_tag LOCUS_24060 gene tolB 20229 18946 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118491.1 protein_id gnl|my_center|LOCUS_24060 20930 20451 gene locus_tag LOCUS_24070 20930 20451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 21463 21002 gene locus_tag LOCUS_24080 21463 21002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 22873 21512 gene locus_tag LOCUS_24090 22873 21512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 23326 22877 gene locus_tag LOCUS_24100 gene tolR 23326 22877 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 protein_id gnl|my_center|LOCUS_24100 24024 23326 gene locus_tag LOCUS_24110 gene tolQ 24024 23326 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207390.1 protein_id gnl|my_center|LOCUS_24110 24456 24049 gene locus_tag LOCUS_24120 gene ybgC 24456 24049 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699892.1 protein_id gnl|my_center|LOCUS_24120 25282 25025 gene locus_tag LOCUS_24130 25282 25025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 25724 25272 gene locus_tag LOCUS_24140 25724 25272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 26175 26684 gene locus_tag LOCUS_24150 26175 26684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 26684 27391 gene locus_tag LOCUS_24160 26684 27391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 27396 27686 gene locus_tag LOCUS_24170 27396 27686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 28277 30466 gene locus_tag LOCUS_24180 28277 30466 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 protein_id gnl|my_center|LOCUS_24180 31625 30624 gene locus_tag LOCUS_24190 gene ruvB 31625 30624 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002052424.1 protein_id gnl|my_center|LOCUS_24190 32245 31643 gene locus_tag LOCUS_24200 gene ruvA 32245 31643 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118762.1 protein_id gnl|my_center|LOCUS_24200 32934 32269 gene locus_tag LOCUS_24210 32934 32269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747124.1 protein_id gnl|my_center|LOCUS_24210 34274 32934 gene locus_tag LOCUS_24220 34274 32934 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207388.1 protein_id gnl|my_center|LOCUS_24220 34611 35186 gene locus_tag LOCUS_24230 34611 35186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 35226 35966 gene locus_tag LOCUS_24240 35226 35966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 36152 39985 gene locus_tag LOCUS_24250 gene purL 36152 39985 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207387.1 protein_id gnl|my_center|LOCUS_24250 40647 41159 gene locus_tag LOCUS_24260 40647 41159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 41163 41576 gene locus_tag LOCUS_24270 41163 41576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 41770 42039 gene locus_tag LOCUS_24280 41770 42039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 43868 42579 gene locus_tag LOCUS_24290 gene gltP 43868 42579 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175646.1 protein_id gnl|my_center|LOCUS_24290 45254 44139 gene locus_tag LOCUS_24300 45254 44139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 protein_id gnl|my_center|LOCUS_24300 46380 45247 gene locus_tag LOCUS_24310 46380 45247 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118383.1 protein_id gnl|my_center|LOCUS_24310 47615 46383 gene locus_tag LOCUS_24320 47615 46383 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207408.1 protein_id gnl|my_center|LOCUS_24320 49033 47630 gene locus_tag LOCUS_24330 49033 47630 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207407.1 protein_id gnl|my_center|LOCUS_24330 49323 49733 gene locus_tag LOCUS_24340 49323 49733 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967708.1 protein_id gnl|my_center|LOCUS_24340 50217 50615 gene locus_tag LOCUS_24350 50217 50615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 50761 51840 gene locus_tag LOCUS_24360 gene serC 50761 51840 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207406.1 protein_id gnl|my_center|LOCUS_24360 53651 52716 gene locus_tag LOCUS_24370 53651 52716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118998.1 protein_id gnl|my_center|LOCUS_24370 53916 54386 gene locus_tag LOCUS_24380 53916 54386 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207405.1 protein_id gnl|my_center|LOCUS_24380 54491 55405 gene locus_tag LOCUS_24390 54491 55405 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_24390 55621 57012 gene locus_tag LOCUS_24400 55621 57012 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206503.1 protein_id gnl|my_center|LOCUS_24400 57352 58602 gene locus_tag LOCUS_24410 57352 58602 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208266.1 protein_id gnl|my_center|LOCUS_24410 58635 59891 gene locus_tag LOCUS_24420 58635 59891 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208267.1 protein_id gnl|my_center|LOCUS_24420 60225 61052 gene locus_tag LOCUS_24430 60225 61052 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101741.1 protein_id gnl|my_center|LOCUS_24430 61191 62141 gene locus_tag LOCUS_24440 61191 62141 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113533.1 protein_id gnl|my_center|LOCUS_24440 62760 62194 gene locus_tag LOCUS_24450 62760 62194 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120773.1 protein_id gnl|my_center|LOCUS_24450 63307 65088 gene locus_tag LOCUS_24460 63307 65088 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116088.1 protein_id gnl|my_center|LOCUS_24460 65178 66347 gene locus_tag LOCUS_24470 65178 66347 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_24470 66453 67952 gene locus_tag LOCUS_24480 66453 67952 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116671.1 protein_id gnl|my_center|LOCUS_24480 69441 68020 gene locus_tag LOCUS_24490 gene cysS 69441 68020 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206254.1 protein_id gnl|my_center|LOCUS_24490 69638 70630 gene locus_tag LOCUS_24500 69638 70630 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122342.1 protein_id gnl|my_center|LOCUS_24500 70634 71173 gene locus_tag LOCUS_24510 70634 71173 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122322.1 protein_id gnl|my_center|LOCUS_24510 71213 71758 gene locus_tag LOCUS_24520 gene lptC 71213 71758 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070181.1 protein_id gnl|my_center|LOCUS_24520 71745 72311 gene locus_tag LOCUS_24530 gene lptA 71745 72311 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122334.1 protein_id gnl|my_center|LOCUS_24530 72311 73054 gene locus_tag LOCUS_24540 gene lptB 72311 73054 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122331.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence22 3761 174 gene locus_tag LOCUS_24550 3761 174 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206344.1 protein_id gnl|my_center|LOCUS_24550 4066 5748 gene locus_tag LOCUS_24560 4066 5748 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206058.1 protein_id gnl|my_center|LOCUS_24560 5745 6740 gene locus_tag LOCUS_24570 5745 6740 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206057.1 protein_id gnl|my_center|LOCUS_24570 9604 6872 gene locus_tag LOCUS_24580 9604 6872 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626055.1 protein_id gnl|my_center|LOCUS_24580 10686 10108 gene locus_tag LOCUS_24590 10686 10108 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002062720.1 protein_id gnl|my_center|LOCUS_24590 11741 10758 gene locus_tag LOCUS_24600 11741 10758 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112303.1 protein_id gnl|my_center|LOCUS_24600 12222 11731 gene locus_tag LOCUS_24610 12222 11731 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 protein_id gnl|my_center|LOCUS_24610 13465 12659 gene locus_tag LOCUS_24620 13465 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 15803 13533 gene locus_tag LOCUS_24630 15803 13533 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703276.1 protein_id gnl|my_center|LOCUS_24630 17164 16244 gene locus_tag LOCUS_24640 gene dsdC 17164 16244 CDS product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331803.1 protein_id gnl|my_center|LOCUS_24640 17888 19234 gene locus_tag LOCUS_24650 gene dsdA 17888 19234 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426437.1 protein_id gnl|my_center|LOCUS_24650 20427 19561 gene locus_tag LOCUS_24660 20427 19561 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206939.1 protein_id gnl|my_center|LOCUS_24660 22068 21112 gene locus_tag LOCUS_24670 22068 21112 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206330.1 protein_id gnl|my_center|LOCUS_24670 23055 22270 gene locus_tag LOCUS_24680 23055 22270 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206706.1 protein_id gnl|my_center|LOCUS_24680 24514 23090 gene locus_tag LOCUS_24690 24514 23090 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206705.1 protein_id gnl|my_center|LOCUS_24690 25111 25992 gene locus_tag LOCUS_24700 25111 25992 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206698.1 protein_id gnl|my_center|LOCUS_24700 26135 26836 gene locus_tag LOCUS_24710 26135 26836 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206697.1 protein_id gnl|my_center|LOCUS_24710 26839 27486 gene locus_tag LOCUS_24720 26839 27486 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 protein_id gnl|my_center|LOCUS_24720 28194 27571 gene locus_tag LOCUS_24730 28194 27571 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206200.1 protein_id gnl|my_center|LOCUS_24730 28598 29857 gene locus_tag LOCUS_24740 28598 29857 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268659.1 protein_id gnl|my_center|LOCUS_24740 30266 31537 gene locus_tag LOCUS_24750 30266 31537 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_24750 31723 32382 gene locus_tag LOCUS_24760 31723 32382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 32890 32456 gene locus_tag LOCUS_24770 32890 32456 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206283.1 protein_id gnl|my_center|LOCUS_24770 34201 32963 gene locus_tag LOCUS_24780 34201 32963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 34729 34253 gene locus_tag LOCUS_24790 34729 34253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 35085 36545 gene locus_tag LOCUS_24800 35085 36545 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206143.1 protein_id gnl|my_center|LOCUS_24800 36763 37404 gene locus_tag LOCUS_24810 36763 37404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 38314 37475 gene locus_tag LOCUS_24820 gene bamE 38314 37475 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 protein_id gnl|my_center|LOCUS_24820 42331 38420 gene locus_tag LOCUS_24830 42331 38420 CDS product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133116924.1 protein_id gnl|my_center|LOCUS_24830 42606 43988 gene locus_tag LOCUS_24840 42606 43988 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_24840 44092 44553 gene locus_tag LOCUS_24850 44092 44553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 45506 44610 gene locus_tag LOCUS_24860 45506 44610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 protein_id gnl|my_center|LOCUS_24860 46838 45726 gene locus_tag LOCUS_24870 46838 45726 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_24870 48052 47003 gene locus_tag LOCUS_24880 48052 47003 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_24880 48457 48107 gene locus_tag LOCUS_24890 48457 48107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 48883 48506 gene locus_tag LOCUS_24900 48883 48506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 50212 49049 gene locus_tag LOCUS_24910 50212 49049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 51263 52474 gene locus_tag LOCUS_24920 51263 52474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 52599 52832 gene locus_tag LOCUS_24930 52599 52832 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071638.1 protein_id gnl|my_center|LOCUS_24930 53184 54419 gene locus_tag LOCUS_24940 53184 54419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 54416 55504 gene locus_tag LOCUS_24950 54416 55504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 55904 55815 gene locus_tag LOCUS_t00410 55904 55815 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56489 55995 gene locus_tag LOCUS_24960 gene greB 56489 55995 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207440.1 protein_id gnl|my_center|LOCUS_24960 57054 58163 gene locus_tag LOCUS_24970 57054 58163 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207441.1 protein_id gnl|my_center|LOCUS_24970 58705 58322 gene locus_tag LOCUS_24980 58705 58322 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_24980 59839 58931 gene locus_tag LOCUS_24990 gene ttcA 59839 58931 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118895.1 protein_id gnl|my_center|LOCUS_24990 60347 61219 gene locus_tag LOCUS_25000 60347 61219 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207442.1 protein_id gnl|my_center|LOCUS_25000 61563 62468 gene locus_tag LOCUS_25010 gene htpX 61563 62468 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118851.1 protein_id gnl|my_center|LOCUS_25010 62944 62591 gene locus_tag LOCUS_25020 62944 62591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 63579 62998 gene locus_tag LOCUS_25030 63579 62998 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207443.1 protein_id gnl|my_center|LOCUS_25030 64772 63741 gene locus_tag LOCUS_25040 64772 63741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 65291 66325 gene locus_tag LOCUS_25050 gene pyrC 65291 66325 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070491.1 protein_id gnl|my_center|LOCUS_25050 66322 66969 gene locus_tag LOCUS_25060 gene rnt 66322 66969 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117536.1 protein_id gnl|my_center|LOCUS_25060 66990 67065 gene locus_tag LOCUS_t00420 66990 67065 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 67303 68640 gene locus_tag LOCUS_25070 67303 68640 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207841.1 protein_id gnl|my_center|LOCUS_25070 68974 69049 gene locus_tag LOCUS_t00430 68974 69049 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 69450 70814 gene locus_tag LOCUS_25080 69450 70814 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207841.1 protein_id gnl|my_center|LOCUS_25080 70945 71829 gene locus_tag LOCUS_25090 70945 71829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207842.1 protein_id gnl|my_center|LOCUS_25090 71978 72053 gene locus_tag LOCUS_t00440 71978 72053 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 72095 72170 gene locus_tag LOCUS_t00450 72095 72170 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 72471 72286 gene locus_tag LOCUS_25100 72471 72286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence23 507 1445 gene locus_tag LOCUS_25110 507 1445 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208418.1 protein_id gnl|my_center|LOCUS_25110 1570 2538 gene locus_tag LOCUS_25120 gene gigA 1570 2538 CDS product RsbU family protein phosphatase GigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117221.1 protein_id gnl|my_center|LOCUS_25120 2652 3176 gene locus_tag LOCUS_25130 gene gigB 2652 3176 CDS product anti-anti-sigma factor GigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117273.1 protein_id gnl|my_center|LOCUS_25130 3210 4034 gene locus_tag LOCUS_25140 3210 4034 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208417.1 protein_id gnl|my_center|LOCUS_25140 4114 4551 gene locus_tag LOCUS_25150 4114 4551 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208415.1 protein_id gnl|my_center|LOCUS_25150 4638 5063 gene locus_tag LOCUS_25160 4638 5063 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 protein_id gnl|my_center|LOCUS_25160 6653 5226 gene locus_tag LOCUS_25170 gene gspE 6653 5226 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208413.1 protein_id gnl|my_center|LOCUS_25170 6825 7646 gene locus_tag LOCUS_25180 6825 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804297.1 protein_id gnl|my_center|LOCUS_25180 7662 8597 gene locus_tag LOCUS_25190 7662 8597 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066312.1 protein_id gnl|my_center|LOCUS_25190 8724 9164 gene locus_tag LOCUS_25200 8724 9164 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_25200 9573 10193 gene locus_tag LOCUS_25210 9573 10193 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_25210 10588 10235 gene locus_tag LOCUS_25220 10588 10235 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116446.1 protein_id gnl|my_center|LOCUS_25220 11581 10715 gene locus_tag LOCUS_25230 gene ygiD 11581 10715 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_25230 12144 11677 gene locus_tag LOCUS_25240 12144 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 12723 12238 gene locus_tag LOCUS_25250 12723 12238 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207592.1 protein_id gnl|my_center|LOCUS_25250 14359 12716 gene locus_tag LOCUS_25260 14359 12716 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207593.1 protein_id gnl|my_center|LOCUS_25260 14901 14707 gene locus_tag LOCUS_25270 14901 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537779.1 protein_id gnl|my_center|LOCUS_25270 15632 15102 gene locus_tag LOCUS_25280 15632 15102 CDS product DUF1543 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139542.1 protein_id gnl|my_center|LOCUS_25280 16369 15650 gene locus_tag LOCUS_25290 16369 15650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 17745 16504 gene locus_tag LOCUS_25300 gene trpB 17745 16504 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 protein_id gnl|my_center|LOCUS_25300 18379 17729 gene locus_tag LOCUS_25310 18379 17729 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207615.1 protein_id gnl|my_center|LOCUS_25310 18753 20615 gene locus_tag LOCUS_25320 18753 20615 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207616.1 protein_id gnl|my_center|LOCUS_25320 20723 21301 gene locus_tag LOCUS_25330 20723 21301 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207617.1 protein_id gnl|my_center|LOCUS_25330 21478 22200 gene locus_tag LOCUS_25340 21478 22200 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207618.1 protein_id gnl|my_center|LOCUS_25340 22558 23721 gene locus_tag LOCUS_25350 22558 23721 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_25350 23831 24160 gene locus_tag LOCUS_25360 23831 24160 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_25360 24293 25696 gene locus_tag LOCUS_25370 24293 25696 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207620.1 protein_id gnl|my_center|LOCUS_25370 25851 26450 gene locus_tag LOCUS_25380 25851 26450 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207621.1 protein_id gnl|my_center|LOCUS_25380 26472 26852 gene locus_tag LOCUS_25390 26472 26852 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360957.1 protein_id gnl|my_center|LOCUS_25390 27742 27056 gene locus_tag LOCUS_25400 27742 27056 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116101.1 protein_id gnl|my_center|LOCUS_25400 29491 27758 gene locus_tag LOCUS_25410 gene baeS 29491 27758 CDS product sensor histidine kinase efflux regulator BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207622.1 protein_id gnl|my_center|LOCUS_25410 29630 30250 gene locus_tag LOCUS_25420 29630 30250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 31101 30562 gene locus_tag LOCUS_25430 gene yjgA 31101 30562 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208401.1 protein_id gnl|my_center|LOCUS_25430 31373 31104 gene locus_tag LOCUS_25440 31373 31104 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984428.1 protein_id gnl|my_center|LOCUS_25440 32221 31370 gene locus_tag LOCUS_25450 gene rapZ 32221 31370 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208400.1 protein_id gnl|my_center|LOCUS_25450 33092 32247 gene locus_tag LOCUS_25460 gene panC 33092 32247 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208399.1 protein_id gnl|my_center|LOCUS_25460 33905 33096 gene locus_tag LOCUS_25470 gene panB 33905 33096 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117298.1 protein_id gnl|my_center|LOCUS_25470 34436 33951 gene locus_tag LOCUS_25480 gene folK 34436 33951 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208398.1 protein_id gnl|my_center|LOCUS_25480 35923 34433 gene locus_tag LOCUS_25490 gene pcnB 35923 34433 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208397.1 protein_id gnl|my_center|LOCUS_25490 36608 36135 gene locus_tag LOCUS_25500 36608 36135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 37380 36616 gene locus_tag LOCUS_25510 gene mazG 37380 36616 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208395.1 protein_id gnl|my_center|LOCUS_25510 37487 38260 gene locus_tag LOCUS_25520 37487 38260 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 protein_id gnl|my_center|LOCUS_25520 38547 38834 gene locus_tag LOCUS_25530 38547 38834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 41229 38923 gene locus_tag LOCUS_25540 41229 38923 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117181.1 protein_id gnl|my_center|LOCUS_25540 42651 41257 gene locus_tag LOCUS_25550 gene rlmD 42651 41257 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208393.1 protein_id gnl|my_center|LOCUS_25550 43481 42660 gene locus_tag LOCUS_25560 43481 42660 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208392.1 protein_id gnl|my_center|LOCUS_25560 44458 43538 gene locus_tag LOCUS_25570 gene cysM 44458 43538 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208391.1 protein_id gnl|my_center|LOCUS_25570 44773 47577 gene locus_tag LOCUS_25580 44773 47577 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208390.1 protein_id gnl|my_center|LOCUS_25580 47798 48586 gene locus_tag LOCUS_25590 47798 48586 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 protein_id gnl|my_center|LOCUS_25590 48626 49495 gene locus_tag LOCUS_25600 48626 49495 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208388.1 protein_id gnl|my_center|LOCUS_25600 49593 50387 gene locus_tag LOCUS_25610 49593 50387 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208387.1 protein_id gnl|my_center|LOCUS_25610 50459 50890 gene locus_tag LOCUS_25620 gene rsfS 50459 50890 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098046.1 protein_id gnl|my_center|LOCUS_25620 52629 51406 gene locus_tag LOCUS_25630 52629 51406 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_25630 53342 52965 gene locus_tag LOCUS_25640 53342 52965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 55105 53696 gene locus_tag LOCUS_25650 gene der 55105 53696 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208345.1 protein_id gnl|my_center|LOCUS_25650 56438 55290 gene locus_tag LOCUS_25660 gene bamB 56438 55290 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208344.1 protein_id gnl|my_center|LOCUS_25660 57139 56438 gene locus_tag LOCUS_25670 57139 56438 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208343.1 protein_id gnl|my_center|LOCUS_25670 58465 57170 gene locus_tag LOCUS_25680 gene hisS 58465 57170 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208342.1 protein_id gnl|my_center|LOCUS_25680 59577 58462 gene locus_tag LOCUS_25690 gene ispG 59577 58462 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208340.1 protein_id gnl|my_center|LOCUS_25690 60387 59599 gene locus_tag LOCUS_25700 60387 59599 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208339.1 protein_id gnl|my_center|LOCUS_25700 61181 60378 gene locus_tag LOCUS_25710 gene pilW 61181 60378 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_25710 62491 61241 gene locus_tag LOCUS_25720 gene rlmN 62491 61241 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115097.1 protein_id gnl|my_center|LOCUS_25720 62437 62622 gene locus_tag LOCUS_25730 62437 62622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 63099 62668 gene locus_tag LOCUS_25740 gene ndk 63099 62668 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963851.1 protein_id gnl|my_center|LOCUS_25740 63442 63242 gene locus_tag LOCUS_25750 gene iscX 63442 63242 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_25750 64167 63616 gene locus_tag LOCUS_25760 64167 63616 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208337.1 protein_id gnl|my_center|LOCUS_25760 65484 64198 gene locus_tag LOCUS_25770 65484 64198 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208336.1 protein_id gnl|my_center|LOCUS_25770 66380 65571 gene locus_tag LOCUS_25780 66380 65571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 67400 66477 gene locus_tag LOCUS_25790 67400 66477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 68474 67458 gene locus_tag LOCUS_25800 gene ilvC 68474 67458 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115094.1 protein_id gnl|my_center|LOCUS_25800 69113 68622 gene locus_tag LOCUS_25810 gene ilvN 69113 68622 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_25810 70837 69110 gene locus_tag LOCUS_25820 70837 69110 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079103.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence24 126 1109 gene locus_tag LOCUS_25830 126 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1224 1925 gene locus_tag LOCUS_25840 1224 1925 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 protein_id gnl|my_center|LOCUS_25840 2048 2602 gene locus_tag LOCUS_25850 gene folE 2048 2602 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118643.1 protein_id gnl|my_center|LOCUS_25850 2680 3039 gene locus_tag LOCUS_25860 2680 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3354 4097 gene locus_tag LOCUS_25870 3354 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071068.1 protein_id gnl|my_center|LOCUS_25870 4808 4122 gene locus_tag LOCUS_25880 4808 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 6084 5212 gene locus_tag LOCUS_25890 6084 5212 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_25890 7412 6231 gene locus_tag LOCUS_25900 7412 6231 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_25900 10592 7521 gene locus_tag LOCUS_25910 10592 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 11822 10647 gene locus_tag LOCUS_25920 11822 10647 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207741.1 protein_id gnl|my_center|LOCUS_25920 12903 12088 gene locus_tag LOCUS_25930 gene eutC 12903 12088 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207089.1 protein_id gnl|my_center|LOCUS_25930 14300 12918 gene locus_tag LOCUS_25940 14300 12918 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207088.1 protein_id gnl|my_center|LOCUS_25940 15733 14303 gene locus_tag LOCUS_25950 gene eat 15733 14303 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207087.1 protein_id gnl|my_center|LOCUS_25950 16035 16853 gene locus_tag LOCUS_25960 16035 16853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 18807 16876 gene locus_tag LOCUS_25970 18807 16876 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207273.1 protein_id gnl|my_center|LOCUS_25970 19441 18971 gene locus_tag LOCUS_25980 19441 18971 CDS product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_25980 20413 19586 gene locus_tag LOCUS_25990 20413 19586 CDS product DUF817 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207274.1 protein_id gnl|my_center|LOCUS_25990 21487 20414 gene locus_tag LOCUS_26000 gene hemE 21487 20414 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207275.1 protein_id gnl|my_center|LOCUS_26000 21760 22989 gene locus_tag LOCUS_26010 21760 22989 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118952.1 protein_id gnl|my_center|LOCUS_26010 23163 23852 gene locus_tag LOCUS_26020 23163 23852 CDS product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207293.1 protein_id gnl|my_center|LOCUS_26020 24704 23952 gene locus_tag LOCUS_26030 24704 23952 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_26030 25258 25019 gene locus_tag LOCUS_26040 25258 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 26359 25460 gene locus_tag LOCUS_26050 26359 25460 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207572.1 protein_id gnl|my_center|LOCUS_26050 27734 26376 gene locus_tag LOCUS_26060 gene rutG 27734 26376 CDS product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207571.1 protein_id gnl|my_center|LOCUS_26060 28325 27759 gene locus_tag LOCUS_26070 gene rutF 28325 27759 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207570.1 protein_id gnl|my_center|LOCUS_26070 28803 28420 gene locus_tag LOCUS_26080 gene rutC 28803 28420 CDS product pyrimidine utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207569.1 protein_id gnl|my_center|LOCUS_26080 29669 28890 gene locus_tag LOCUS_26090 gene rutB 29669 28890 CDS product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207568.1 protein_id gnl|my_center|LOCUS_26090 30781 29666 gene locus_tag LOCUS_26100 gene rutA 30781 29666 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207567.1 protein_id gnl|my_center|LOCUS_26100 31698 31111 gene locus_tag LOCUS_26110 31698 31111 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207566.1 protein_id gnl|my_center|LOCUS_26110 32495 31704 gene locus_tag LOCUS_26120 gene rutD 32495 31704 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207565.1 protein_id gnl|my_center|LOCUS_26120 33382 32771 gene locus_tag LOCUS_26130 gene umuD 33382 32771 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069871.1 protein_id gnl|my_center|LOCUS_26130 33660 33893 gene locus_tag LOCUS_26140 33660 33893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114518.1 protein_id gnl|my_center|LOCUS_26140 34328 35272 gene locus_tag LOCUS_26150 34328 35272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 35272 36153 gene locus_tag LOCUS_26160 35272 36153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_26160 36234 37238 gene locus_tag LOCUS_26170 36234 37238 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827578.1 protein_id gnl|my_center|LOCUS_26170 37235 38122 gene locus_tag LOCUS_26180 37235 38122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 38139 38471 gene locus_tag LOCUS_26190 gene abeS 38139 38471 CDS product multidrug efflux SMR transporter AbeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_26190 39791 38973 gene locus_tag LOCUS_26200 gene prmC 39791 38973 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207128.1 protein_id gnl|my_center|LOCUS_26200 40879 39791 gene locus_tag LOCUS_26210 gene prfA 40879 39791 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119588.1 protein_id gnl|my_center|LOCUS_26210 41186 40992 gene locus_tag LOCUS_26220 41186 40992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 41271 41702 gene locus_tag LOCUS_26230 41271 41702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119687.1 protein_id gnl|my_center|LOCUS_26230 42298 42816 gene locus_tag LOCUS_26240 42298 42816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119687.1 protein_id gnl|my_center|LOCUS_26240 42993 44006 gene locus_tag LOCUS_26250 42993 44006 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068512.1 protein_id gnl|my_center|LOCUS_26250 44234 44713 gene locus_tag LOCUS_26260 gene yiaA 44234 44713 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208936.1 protein_id gnl|my_center|LOCUS_26260 45696 46256 gene locus_tag LOCUS_26270 45696 46256 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207131.1 protein_id gnl|my_center|LOCUS_26270 46947 46300 gene locus_tag LOCUS_26280 46947 46300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 48001 47165 gene locus_tag LOCUS_26290 48001 47165 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119749.1 protein_id gnl|my_center|LOCUS_26290 48156 50534 gene locus_tag LOCUS_26300 gene ppsA 48156 50534 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803576.1 protein_id gnl|my_center|LOCUS_26300 50873 51649 gene locus_tag LOCUS_26310 50873 51649 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119677.1 protein_id gnl|my_center|LOCUS_26310 51945 53009 gene locus_tag LOCUS_26320 gene cyoA 51945 53009 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119579.1 protein_id gnl|my_center|LOCUS_26320 53013 55004 gene locus_tag LOCUS_26330 gene cyoB 53013 55004 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068497.1 protein_id gnl|my_center|LOCUS_26330 55009 55629 gene locus_tag LOCUS_26340 gene cyoC 55009 55629 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119759.1 protein_id gnl|my_center|LOCUS_26340 55629 55952 gene locus_tag LOCUS_26350 55629 55952 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094534.1 protein_id gnl|my_center|LOCUS_26350 55959 56837 gene locus_tag LOCUS_26360 gene cyoE 55959 56837 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207135.1 protein_id gnl|my_center|LOCUS_26360 58328 57843 gene locus_tag LOCUS_26370 58328 57843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 58587 58973 gene locus_tag LOCUS_26380 gene rpsF 58587 58973 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119610.1 protein_id gnl|my_center|LOCUS_26380 58985 59212 gene locus_tag LOCUS_26390 gene rpsR 58985 59212 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090661.1 protein_id gnl|my_center|LOCUS_26390 59222 59668 gene locus_tag LOCUS_26400 gene rplI 59222 59668 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382591.1 protein_id gnl|my_center|LOCUS_26400 59889 61334 gene locus_tag LOCUS_26410 gene dnaB 59889 61334 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119718.1 protein_id gnl|my_center|LOCUS_26410 61793 61371 gene locus_tag LOCUS_26420 61793 61371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 62087 63160 gene locus_tag LOCUS_26430 gene alr 62087 63160 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207136.1 protein_id gnl|my_center|LOCUS_26430 63867 63427 gene locus_tag LOCUS_26440 63867 63427 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073517.1 protein_id gnl|my_center|LOCUS_26440 64376 63957 gene locus_tag LOCUS_26450 64376 63957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 65201 64467 gene locus_tag LOCUS_26460 65201 64467 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207137.1 protein_id gnl|my_center|LOCUS_26460 66051 65272 gene locus_tag LOCUS_26470 66051 65272 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 protein_id gnl|my_center|LOCUS_26470 66656 66048 gene locus_tag LOCUS_26480 66656 66048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 68294 66693 gene locus_tag LOCUS_26490 68294 66693 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207140.1 protein_id gnl|my_center|LOCUS_26490 68598 69593 gene locus_tag LOCUS_26500 68598 69593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 70663 69986 gene locus_tag LOCUS_26510 70663 69986 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence25 299 3022 gene locus_tag LOCUS_26520 299 3022 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206344.1 protein_id gnl|my_center|LOCUS_26520 3048 4445 gene locus_tag LOCUS_26530 3048 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 4531 5793 gene locus_tag LOCUS_26540 4531 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 5864 6175 gene locus_tag LOCUS_26550 5864 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 6509 7012 gene locus_tag LOCUS_26560 6509 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 7174 8370 gene locus_tag LOCUS_26570 7174 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 9542 8436 gene locus_tag LOCUS_26580 9542 8436 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_26580 10178 9762 gene locus_tag LOCUS_26590 10178 9762 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_26590 10473 10207 gene locus_tag LOCUS_26600 10473 10207 CDS product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206654.1 protein_id gnl|my_center|LOCUS_26600 11427 10555 gene locus_tag LOCUS_26610 11427 10555 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207572.1 protein_id gnl|my_center|LOCUS_26610 12528 11437 gene locus_tag LOCUS_26620 12528 11437 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206656.1 protein_id gnl|my_center|LOCUS_26620 12670 13857 gene locus_tag LOCUS_26630 12670 13857 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206657.1 protein_id gnl|my_center|LOCUS_26630 13969 14298 gene locus_tag LOCUS_26640 13969 14298 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113538.1 protein_id gnl|my_center|LOCUS_26640 14309 14905 gene locus_tag LOCUS_26650 gene recR 14309 14905 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113756.1 protein_id gnl|my_center|LOCUS_26650 15259 16401 gene locus_tag LOCUS_26660 15259 16401 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206658.1 protein_id gnl|my_center|LOCUS_26660 16606 16911 gene locus_tag LOCUS_26670 16606 16911 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113722.1 protein_id gnl|my_center|LOCUS_26670 16904 17317 gene locus_tag LOCUS_26680 16904 17317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113949.1 protein_id gnl|my_center|LOCUS_26680 17338 18189 gene locus_tag LOCUS_26690 17338 18189 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 protein_id gnl|my_center|LOCUS_26690 18205 19392 gene locus_tag LOCUS_26700 18205 19392 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498060.1 protein_id gnl|my_center|LOCUS_26700 19794 21002 gene locus_tag LOCUS_26710 gene trpB 19794 21002 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206663.1 protein_id gnl|my_center|LOCUS_26710 21215 22648 gene locus_tag LOCUS_26720 21215 22648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 23160 22729 gene locus_tag LOCUS_26730 23160 22729 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_26730 23568 23308 gene locus_tag LOCUS_26740 23568 23308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 24097 23864 gene locus_tag LOCUS_26750 24097 23864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121063.1 protein_id gnl|my_center|LOCUS_26750 24321 24680 gene locus_tag LOCUS_26760 24321 24680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120892.1 protein_id gnl|my_center|LOCUS_26760 24941 25267 gene locus_tag LOCUS_26770 24941 25267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 26888 25278 gene locus_tag LOCUS_26780 26888 25278 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_26780 28296 26902 gene locus_tag LOCUS_26790 28296 26902 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763634.1 protein_id gnl|my_center|LOCUS_26790 28474 29583 gene locus_tag LOCUS_26800 gene ftsY 28474 29583 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121114.1 protein_id gnl|my_center|LOCUS_26800 29997 30590 gene locus_tag LOCUS_26810 29997 30590 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121011.1 protein_id gnl|my_center|LOCUS_26810 31181 33343 gene locus_tag LOCUS_26820 31181 33343 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206605.1 protein_id gnl|my_center|LOCUS_26820 33522 34142 gene locus_tag LOCUS_26830 33522 34142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 34251 34916 gene locus_tag LOCUS_26840 34251 34916 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206617.1 protein_id gnl|my_center|LOCUS_26840 35390 34926 gene locus_tag LOCUS_26850 35390 34926 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206969.1 protein_id gnl|my_center|LOCUS_26850 36342 37880 gene locus_tag LOCUS_26860 gene yoaE 36342 37880 CDS product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366041.1 protein_id gnl|my_center|LOCUS_26860 38868 38002 gene locus_tag LOCUS_26870 38868 38002 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206965.1 protein_id gnl|my_center|LOCUS_26870 38990 39448 gene locus_tag LOCUS_26880 38990 39448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_26880 39726 39490 gene locus_tag LOCUS_26890 39726 39490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 41653 40361 gene locus_tag LOCUS_26900 gene brnQ 41653 40361 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206962.1 protein_id gnl|my_center|LOCUS_26900 41991 42785 gene locus_tag LOCUS_26910 gene map 41991 42785 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206961.1 protein_id gnl|my_center|LOCUS_26910 44577 43405 gene locus_tag LOCUS_26920 44577 43405 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207052.1 protein_id gnl|my_center|LOCUS_26920 44894 44742 gene locus_tag LOCUS_26930 44894 44742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 45595 44942 gene locus_tag LOCUS_26940 gene leuE 45595 44942 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207051.1 protein_id gnl|my_center|LOCUS_26940 46695 45712 gene locus_tag LOCUS_26950 gene tal 46695 45712 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207050.1 protein_id gnl|my_center|LOCUS_26950 47674 46784 gene locus_tag LOCUS_26960 47674 46784 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207049.1 protein_id gnl|my_center|LOCUS_26960 47831 48256 gene locus_tag LOCUS_26970 47831 48256 CDS product AceI family chlorhexidine efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207048.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26970 48498 50567 gene locus_tag LOCUS_26980 48498 50567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 50679 52394 gene locus_tag LOCUS_26990 50679 52394 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_26990 52953 53537 gene locus_tag LOCUS_27000 52953 53537 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 protein_id gnl|my_center|LOCUS_27000 53552 55165 gene locus_tag LOCUS_27010 53552 55165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 55474 55842 gene locus_tag LOCUS_27020 55474 55842 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207084.1 protein_id gnl|my_center|LOCUS_27020 56145 55954 gene locus_tag LOCUS_27030 56145 55954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 57297 56431 gene locus_tag LOCUS_27040 gene thiM 57297 56431 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207083.1 protein_id gnl|my_center|LOCUS_27040 58398 57307 gene locus_tag LOCUS_27050 58398 57307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207082.1 protein_id gnl|my_center|LOCUS_27050 58564 58887 gene locus_tag LOCUS_27060 58564 58887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 59269 59006 gene locus_tag LOCUS_27070 59269 59006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 60587 59394 gene locus_tag LOCUS_27080 60587 59394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 61182 61844 gene locus_tag LOCUS_27090 61182 61844 CDS product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206959.1 protein_id gnl|my_center|LOCUS_27090 62094 62639 gene locus_tag LOCUS_27100 62094 62639 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_27100 62990 62694 gene locus_tag LOCUS_27110 62990 62694 CDS product cyd operon YbgE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791954.1 protein_id gnl|my_center|LOCUS_27110 64270 63125 gene locus_tag LOCUS_27120 gene cydB 64270 63125 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206958.1 protein_id gnl|my_center|LOCUS_27120 65853 64267 gene locus_tag LOCUS_27130 65853 64267 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206957.1 protein_id gnl|my_center|LOCUS_27130 66044 65853 gene locus_tag LOCUS_27140 66044 65853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 66580 67014 gene locus_tag LOCUS_27150 66580 67014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27150 67860 67246 gene locus_tag LOCUS_27160 67860 67246 CDS product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121106.1 protein_id gnl|my_center|LOCUS_27160 68205 67879 gene locus_tag LOCUS_27170 68205 67879 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121079.1 protein_id gnl|my_center|LOCUS_27170 69210 68206 gene locus_tag LOCUS_27180 69210 68206 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_27180 69471 69938 gene locus_tag LOCUS_27190 69471 69938 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142237840.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence26 544 194 gene locus_tag LOCUS_27200 544 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 1614 613 gene locus_tag LOCUS_27210 1614 613 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_27210 3053 1734 gene locus_tag LOCUS_27220 3053 1734 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070381.1 protein_id gnl|my_center|LOCUS_27220 3557 3366 gene locus_tag LOCUS_27230 3557 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 5291 3894 gene locus_tag LOCUS_27240 5291 3894 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_27240 8406 5302 gene locus_tag LOCUS_27250 8406 5302 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104174.1 protein_id gnl|my_center|LOCUS_27250 11498 8403 gene locus_tag LOCUS_27260 11498 8403 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267713.1 protein_id gnl|my_center|LOCUS_27260 12710 11502 gene locus_tag LOCUS_27270 12710 11502 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_27270 12969 13487 gene locus_tag LOCUS_27280 12969 13487 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206292.1 protein_id gnl|my_center|LOCUS_27280 13693 15909 gene locus_tag LOCUS_27290 13693 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 16802 16107 gene locus_tag LOCUS_27300 16802 16107 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207936.1 protein_id gnl|my_center|LOCUS_27300 17823 17029 gene locus_tag LOCUS_27310 17823 17029 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207937.1 protein_id gnl|my_center|LOCUS_27310 20041 17984 gene locus_tag LOCUS_27320 gene cirA 20041 17984 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489223.1 protein_id gnl|my_center|LOCUS_27320 20229 22719 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctatgtggcagtgaac 23307 23231 gene locus_tag LOCUS_t00460 23307 23231 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25367 23352 gene locus_tag LOCUS_27330 25367 23352 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463435.1 protein_id gnl|my_center|LOCUS_27330 26285 25377 gene locus_tag LOCUS_27340 26285 25377 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072204.1 protein_id gnl|my_center|LOCUS_27340 27258 26299 gene locus_tag LOCUS_27350 27258 26299 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_27350 28466 27423 gene locus_tag LOCUS_27360 28466 27423 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186428.1 protein_id gnl|my_center|LOCUS_27360 29447 29145 gene locus_tag LOCUS_27370 29447 29145 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980869.1 protein_id gnl|my_center|LOCUS_27370 31575 29473 gene locus_tag LOCUS_27380 31575 29473 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207301.1 protein_id gnl|my_center|LOCUS_27380 32518 31949 gene locus_tag LOCUS_27390 gene efp 32518 31949 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118666.1 protein_id gnl|my_center|LOCUS_27390 32923 33939 gene locus_tag LOCUS_27400 gene epmB 32923 33939 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_27400 33954 35708 gene locus_tag LOCUS_27410 33954 35708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207304.1 protein_id gnl|my_center|LOCUS_27410 35705 37927 gene locus_tag LOCUS_27420 35705 37927 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207305.1 protein_id gnl|my_center|LOCUS_27420 38270 38046 gene locus_tag LOCUS_27430 gene rpmE 38270 38046 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200845.1 protein_id gnl|my_center|LOCUS_27430 39481 38501 gene locus_tag LOCUS_27440 39481 38501 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207306.1 protein_id gnl|my_center|LOCUS_27440 40047 39646 gene locus_tag LOCUS_27450 gene gloA 40047 39646 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118996.1 protein_id gnl|my_center|LOCUS_27450 42545 40359 gene locus_tag LOCUS_27460 42545 40359 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207307.1 protein_id gnl|my_center|LOCUS_27460 42727 45351 gene locus_tag LOCUS_27470 42727 45351 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067989.1 protein_id gnl|my_center|LOCUS_27470 45806 45462 gene locus_tag LOCUS_27480 gene grxD 45806 45462 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120913.1 protein_id gnl|my_center|LOCUS_27480 45969 47180 gene locus_tag LOCUS_27490 45969 47180 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121101.1 protein_id gnl|my_center|LOCUS_27490 48233 47301 gene locus_tag LOCUS_27500 48233 47301 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118686.1 protein_id gnl|my_center|LOCUS_27500 49167 48328 gene locus_tag LOCUS_27510 49167 48328 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119027.1 protein_id gnl|my_center|LOCUS_27510 50058 49273 gene locus_tag LOCUS_27520 gene surE 50058 49273 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073294.1 protein_id gnl|my_center|LOCUS_27520 50480 50845 gene locus_tag LOCUS_27530 50480 50845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207308.1 protein_id gnl|my_center|LOCUS_27530 51020 51415 gene locus_tag LOCUS_27540 51020 51415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118406.1 protein_id gnl|my_center|LOCUS_27540 51556 52704 gene locus_tag LOCUS_27550 gene dacC 51556 52704 CDS product D-alanyl-D-alanine carboxypeptidase PBP5/6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118558.1 protein_id gnl|my_center|LOCUS_27550 52838 53386 gene locus_tag LOCUS_27560 52838 53386 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207309.1 protein_id gnl|my_center|LOCUS_27560 53859 53665 gene locus_tag LOCUS_27570 53859 53665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 54641 54159 gene locus_tag LOCUS_27580 54641 54159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 55700 54654 gene locus_tag LOCUS_27590 55700 54654 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207030.1 protein_id gnl|my_center|LOCUS_27590 56468 55713 gene locus_tag LOCUS_27600 56468 55713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 56936 57421 gene locus_tag LOCUS_27610 56936 57421 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119006.1 protein_id gnl|my_center|LOCUS_27610 57414 58565 gene locus_tag LOCUS_27620 gene mnmA 57414 58565 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073282.1 protein_id gnl|my_center|LOCUS_27620 58593 59324 gene locus_tag LOCUS_27630 gene hflD 58593 59324 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207310.1 protein_id gnl|my_center|LOCUS_27630 59445 60833 gene locus_tag LOCUS_27640 gene purB 59445 60833 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118712.1 protein_id gnl|my_center|LOCUS_27640 60937 61566 gene locus_tag LOCUS_27650 60937 61566 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207311.1 protein_id gnl|my_center|LOCUS_27650 62005 61628 gene locus_tag LOCUS_27660 62005 61628 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201297.1 protein_id gnl|my_center|LOCUS_27660 62132 62983 gene locus_tag LOCUS_27670 gene qorB 62132 62983 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560563.1 protein_id gnl|my_center|LOCUS_27670 63756 63076 gene locus_tag LOCUS_27680 63756 63076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207352.1 protein_id gnl|my_center|LOCUS_27680 64504 63770 gene locus_tag LOCUS_27690 64504 63770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207353.1 protein_id gnl|my_center|LOCUS_27690 65387 64929 gene locus_tag LOCUS_27700 65387 64929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 65915 65430 gene locus_tag LOCUS_27710 65915 65430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 67487 66030 gene locus_tag LOCUS_27720 67487 66030 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207354.1 protein_id gnl|my_center|LOCUS_27720 69123 67840 gene locus_tag LOCUS_27730 69123 67840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence27 1647 409 gene locus_tag LOCUS_27740 1647 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1928 2539 gene locus_tag LOCUS_27750 1928 2539 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037422.1 protein_id gnl|my_center|LOCUS_27750 3280 2738 gene locus_tag LOCUS_27760 3280 2738 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206533.1 protein_id gnl|my_center|LOCUS_27760 3608 4315 gene locus_tag LOCUS_27770 3608 4315 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206532.1 protein_id gnl|my_center|LOCUS_27770 4479 4859 gene locus_tag LOCUS_27780 4479 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 5409 4927 gene locus_tag LOCUS_27790 5409 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483316.1 protein_id gnl|my_center|LOCUS_27790 5513 6250 gene locus_tag LOCUS_27800 5513 6250 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206530.1 protein_id gnl|my_center|LOCUS_27800 6252 6587 gene locus_tag LOCUS_27810 gene ygaH 6252 6587 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002133404.1 protein_id gnl|my_center|LOCUS_27810 7697 8905 gene locus_tag LOCUS_27820 gene purT 7697 8905 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206528.1 protein_id gnl|my_center|LOCUS_27820 8932 11598 gene locus_tag LOCUS_27830 gene glnD 8932 11598 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608324.1 protein_id gnl|my_center|LOCUS_27830 11627 12796 gene locus_tag LOCUS_27840 gene dapC 11627 12796 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206527.1 protein_id gnl|my_center|LOCUS_27840 13929 13294 gene locus_tag LOCUS_27850 13929 13294 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269231.1 protein_id gnl|my_center|LOCUS_27850 14462 15046 gene locus_tag LOCUS_27860 14462 15046 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707013.1 protein_id gnl|my_center|LOCUS_27860 15139 15618 gene locus_tag LOCUS_27870 15139 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 15965 17158 gene locus_tag LOCUS_27880 15965 17158 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_27880 17160 20312 gene locus_tag LOCUS_27890 17160 20312 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 protein_id gnl|my_center|LOCUS_27890 21014 20394 gene locus_tag LOCUS_27900 21014 20394 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076407.1 protein_id gnl|my_center|LOCUS_27900 21891 21088 gene locus_tag LOCUS_27910 21891 21088 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151652833.1 protein_id gnl|my_center|LOCUS_27910 22451 21969 gene locus_tag LOCUS_27920 22451 21969 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 protein_id gnl|my_center|LOCUS_27920 22867 22448 gene locus_tag LOCUS_27930 gene msrB 22867 22448 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114184.1 protein_id gnl|my_center|LOCUS_27930 23019 24254 gene locus_tag LOCUS_27940 23019 24254 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206525.1 protein_id gnl|my_center|LOCUS_27940 24558 25616 gene locus_tag LOCUS_27950 24558 25616 CDS product type II asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206524.1 protein_id gnl|my_center|LOCUS_27950 25735 26274 gene locus_tag LOCUS_27960 25735 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 26679 27707 gene locus_tag LOCUS_27970 26679 27707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207195.1 protein_id gnl|my_center|LOCUS_27970 29305 28280 gene locus_tag LOCUS_27980 gene tsaD 29305 28280 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068344.1 protein_id gnl|my_center|LOCUS_27980 29451 29666 gene locus_tag LOCUS_27990 gene rpsU 29451 29666 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136722.1 protein_id gnl|my_center|LOCUS_27990 29706 30152 gene locus_tag LOCUS_28000 29706 30152 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115302.1 protein_id gnl|my_center|LOCUS_28000 31213 30854 gene locus_tag LOCUS_28010 31213 30854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 32765 31323 gene locus_tag LOCUS_28020 32765 31323 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207196.1 protein_id gnl|my_center|LOCUS_28020 33830 32862 gene locus_tag LOCUS_28030 33830 32862 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115253.1 protein_id gnl|my_center|LOCUS_28030 34595 33879 gene locus_tag LOCUS_28040 34595 33879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207197.1 protein_id gnl|my_center|LOCUS_28040 34937 34725 gene locus_tag LOCUS_28050 34937 34725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206557.1 protein_id gnl|my_center|LOCUS_28050 35619 37247 gene locus_tag LOCUS_28060 35619 37247 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705057.1 protein_id gnl|my_center|LOCUS_28060 39211 37355 gene locus_tag LOCUS_28070 39211 37355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 43887 39346 gene locus_tag LOCUS_28080 43887 39346 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207109.1 protein_id gnl|my_center|LOCUS_28080 46649 43923 gene locus_tag LOCUS_28090 46649 43923 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207110.1 protein_id gnl|my_center|LOCUS_28090 46825 48144 gene locus_tag LOCUS_28100 46825 48144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207111.1 protein_id gnl|my_center|LOCUS_28100 48146 48781 gene locus_tag LOCUS_28110 gene coq7 48146 48781 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 protein_id gnl|my_center|LOCUS_28110 49426 48905 gene locus_tag LOCUS_28120 49426 48905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 49875 49438 gene locus_tag LOCUS_28130 49875 49438 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207119.1 protein_id gnl|my_center|LOCUS_28130 50212 49832 gene locus_tag LOCUS_28140 gene folB 50212 49832 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207120.1 protein_id gnl|my_center|LOCUS_28140 51613 50315 gene locus_tag LOCUS_28150 51613 50315 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_28150 52435 51653 gene locus_tag LOCUS_28160 52435 51653 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791496.1 protein_id gnl|my_center|LOCUS_28160 52685 53158 gene locus_tag LOCUS_28170 52685 53158 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050132.1 protein_id gnl|my_center|LOCUS_28170 53437 53252 gene locus_tag LOCUS_28180 53437 53252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 54553 53804 gene locus_tag LOCUS_28190 54553 53804 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114471.1 protein_id gnl|my_center|LOCUS_28190 55223 54660 gene locus_tag LOCUS_28200 55223 54660 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_28200 56108 57214 gene locus_tag LOCUS_28210 56108 57214 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207246.1 protein_id gnl|my_center|LOCUS_28210 57671 58201 gene locus_tag LOCUS_28220 57671 58201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 59091 58507 gene locus_tag LOCUS_28230 59091 58507 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 protein_id gnl|my_center|LOCUS_28230 59226 60425 gene locus_tag LOCUS_28240 59226 60425 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 protein_id gnl|my_center|LOCUS_28240 61295 60705 gene locus_tag LOCUS_28250 61295 60705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 61936 61643 gene locus_tag LOCUS_28260 61936 61643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 62780 61950 gene locus_tag LOCUS_28270 62780 61950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 63428 63081 gene locus_tag LOCUS_28280 63428 63081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 64126 63428 gene locus_tag LOCUS_28290 64126 63428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28290 64301 64083 gene locus_tag LOCUS_28300 64301 64083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 64761 64519 gene locus_tag LOCUS_28310 64761 64519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 65050 64751 gene locus_tag LOCUS_28320 65050 64751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 66337 65051 gene locus_tag LOCUS_28330 66337 65051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence28 <1 1059 gene locus_tag LOCUS_28340 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206125.1:type VI secretion system Vgr family protein 1052 2047 gene locus_tag LOCUS_28350 1052 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2109 3110 gene locus_tag LOCUS_28360 2109 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3119 5026 gene locus_tag LOCUS_28370 3119 5026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206127.1 protein_id gnl|my_center|LOCUS_28370 6067 5150 gene locus_tag LOCUS_28380 6067 5150 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206919.1 protein_id gnl|my_center|LOCUS_28380 6174 7412 gene locus_tag LOCUS_28390 6174 7412 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206918.1 protein_id gnl|my_center|LOCUS_28390 7545 8666 gene locus_tag LOCUS_28400 7545 8666 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_28400 8663 9361 gene locus_tag LOCUS_28410 8663 9361 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_28410 9403 10146 gene locus_tag LOCUS_28420 9403 10146 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_28420 10350 11063 gene locus_tag LOCUS_28430 10350 11063 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206941.1 protein_id gnl|my_center|LOCUS_28430 11152 11313 gene locus_tag LOCUS_28440 11152 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 11851 11564 gene locus_tag LOCUS_28450 11851 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 12174 12869 gene locus_tag LOCUS_28460 12174 12869 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_28460 13006 13707 gene locus_tag LOCUS_28470 13006 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 13807 14310 gene locus_tag LOCUS_28480 13807 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 14373 14963 gene locus_tag LOCUS_28490 14373 14963 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206731.1 protein_id gnl|my_center|LOCUS_28490 16013 15150 gene locus_tag LOCUS_28500 16013 15150 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207004.1 protein_id gnl|my_center|LOCUS_28500 16170 17570 gene locus_tag LOCUS_28510 16170 17570 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207005.1 protein_id gnl|my_center|LOCUS_28510 17772 18422 gene locus_tag LOCUS_28520 17772 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 19954 18476 gene locus_tag LOCUS_28530 19954 18476 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206732.1 protein_id gnl|my_center|LOCUS_28530 20145 21254 gene locus_tag LOCUS_28540 20145 21254 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206736.1 protein_id gnl|my_center|LOCUS_28540 21417 21725 gene locus_tag LOCUS_28550 21417 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 22019 22963 gene locus_tag LOCUS_28560 22019 22963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681687.1 protein_id gnl|my_center|LOCUS_28560 23002 24261 gene locus_tag LOCUS_28570 23002 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 24359 24739 gene locus_tag LOCUS_28580 24359 24739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 24673 25104 gene locus_tag LOCUS_28590 24673 25104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 25136 25561 gene locus_tag LOCUS_28600 25136 25561 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140715.1 protein_id gnl|my_center|LOCUS_28600 27259 25691 gene locus_tag LOCUS_28610 27259 25691 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207054.1 protein_id gnl|my_center|LOCUS_28610 28801 27596 gene locus_tag LOCUS_28620 28801 27596 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071835.1 protein_id gnl|my_center|LOCUS_28620 29139 29909 gene locus_tag LOCUS_28630 29139 29909 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653834.1 protein_id gnl|my_center|LOCUS_28630 30058 31023 gene locus_tag LOCUS_28640 30058 31023 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_28640 31407 31174 gene locus_tag LOCUS_28650 31407 31174 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206240.1 protein_id gnl|my_center|LOCUS_28650 33578 31965 gene locus_tag LOCUS_28660 33578 31965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 34114 35067 gene locus_tag LOCUS_28670 34114 35067 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207024.1 protein_id gnl|my_center|LOCUS_28670 35805 35110 gene locus_tag LOCUS_28680 35805 35110 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206486.1 protein_id gnl|my_center|LOCUS_28680 36161 35805 gene locus_tag LOCUS_28690 36161 35805 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206485.1 protein_id gnl|my_center|LOCUS_28690 36345 37244 gene locus_tag LOCUS_28700 36345 37244 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206484.1 protein_id gnl|my_center|LOCUS_28700 37316 37504 gene locus_tag LOCUS_28710 37316 37504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 38424 37615 gene locus_tag LOCUS_28720 38424 37615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 38838 38599 gene locus_tag LOCUS_28730 38838 38599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 39393 38941 gene locus_tag LOCUS_28740 39393 38941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 40175 39918 gene locus_tag LOCUS_28750 40175 39918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 40814 40503 gene locus_tag LOCUS_28760 40814 40503 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172486.1 protein_id gnl|my_center|LOCUS_28760 42142 40811 gene locus_tag LOCUS_28770 42142 40811 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626009.1 protein_id gnl|my_center|LOCUS_28770 42771 42307 gene locus_tag LOCUS_28780 42771 42307 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328737.1 protein_id gnl|my_center|LOCUS_28780 42881 43786 gene locus_tag LOCUS_28790 gene rarD 42881 43786 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 protein_id gnl|my_center|LOCUS_28790 44723 43935 gene locus_tag LOCUS_28800 gene paaG 44723 43935 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_28800 46565 44763 gene locus_tag LOCUS_28810 46565 44763 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206443.1 protein_id gnl|my_center|LOCUS_28810 46898 47332 gene locus_tag LOCUS_28820 46898 47332 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206442.1 protein_id gnl|my_center|LOCUS_28820 48592 47384 gene locus_tag LOCUS_28830 48592 47384 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206441.1 protein_id gnl|my_center|LOCUS_28830 49929 48613 gene locus_tag LOCUS_28840 gene dcaP 49929 48613 CDS product outer membrane trimeric porin-like protein DcaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733488.1 protein_id gnl|my_center|LOCUS_28840 50622 49969 gene locus_tag LOCUS_28850 50622 49969 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206440.1 protein_id gnl|my_center|LOCUS_28850 51290 50622 gene locus_tag LOCUS_28860 51290 50622 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608696.1 protein_id gnl|my_center|LOCUS_28860 52662 51337 gene locus_tag LOCUS_28870 52662 51337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206439.1 protein_id gnl|my_center|LOCUS_28870 53844 52690 gene locus_tag LOCUS_28880 53844 52690 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069932.1 protein_id gnl|my_center|LOCUS_28880 54156 54944 gene locus_tag LOCUS_28890 54156 54944 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 protein_id gnl|my_center|LOCUS_28890 54974 55735 gene locus_tag LOCUS_28900 54974 55735 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206437.1 protein_id gnl|my_center|LOCUS_28900 55793 57316 gene locus_tag LOCUS_28910 55793 57316 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206436.1 protein_id gnl|my_center|LOCUS_28910 57331 58536 gene locus_tag LOCUS_28920 57331 58536 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_28920 58642 59484 gene locus_tag LOCUS_28930 58642 59484 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081480.1 protein_id gnl|my_center|LOCUS_28930 59559 60725 gene locus_tag LOCUS_28940 59559 60725 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206434.1 protein_id gnl|my_center|LOCUS_28940 61628 60783 gene locus_tag LOCUS_28950 61628 60783 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996082.1 protein_id gnl|my_center|LOCUS_28950 63016 61799 gene locus_tag LOCUS_28960 63016 61799 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_28960 63350 64501 gene locus_tag LOCUS_28970 63350 64501 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206430.1 protein_id gnl|my_center|LOCUS_28970 64563 65813 gene locus_tag LOCUS_28980 64563 65813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206429.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence29 872 306 gene locus_tag LOCUS_28990 872 306 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207658.1 protein_id gnl|my_center|LOCUS_28990 2217 1150 gene locus_tag LOCUS_29000 2217 1150 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207659.1 protein_id gnl|my_center|LOCUS_29000 2420 2875 gene locus_tag LOCUS_29010 2420 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 3209 4213 gene locus_tag LOCUS_29020 3209 4213 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_29020 4343 4678 gene locus_tag LOCUS_29030 gene erpA 4343 4678 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115421.1 protein_id gnl|my_center|LOCUS_29030 5591 4749 gene locus_tag LOCUS_29040 5591 4749 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207692.1 protein_id gnl|my_center|LOCUS_29040 6968 5841 gene locus_tag LOCUS_29050 6968 5841 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207693.1 protein_id gnl|my_center|LOCUS_29050 7051 8265 gene locus_tag LOCUS_29060 gene tyrS 7051 8265 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115433.1 protein_id gnl|my_center|LOCUS_29060 9335 8328 gene locus_tag LOCUS_29070 9335 8328 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 protein_id gnl|my_center|LOCUS_29070 9757 11691 gene locus_tag LOCUS_29080 9757 11691 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804875.1 protein_id gnl|my_center|LOCUS_29080 12649 13656 gene locus_tag LOCUS_29090 12649 13656 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 protein_id gnl|my_center|LOCUS_29090 16287 13819 gene locus_tag LOCUS_29100 gene gyrB 16287 13819 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115497.1 protein_id gnl|my_center|LOCUS_29100 17422 16340 gene locus_tag LOCUS_29110 gene recF 17422 16340 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115479.1 protein_id gnl|my_center|LOCUS_29110 18597 17449 gene locus_tag LOCUS_29120 18597 17449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 20102 18708 gene locus_tag LOCUS_29130 gene dnaA 20102 18708 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115442.1 protein_id gnl|my_center|LOCUS_29130 20534 20680 gene locus_tag LOCUS_29140 20534 20680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 20803 20937 gene locus_tag LOCUS_29150 gene rpmH 20803 20937 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831329.1 protein_id gnl|my_center|LOCUS_29150 20971 21363 gene locus_tag LOCUS_29160 gene rnpA 20971 21363 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207683.1 protein_id gnl|my_center|LOCUS_29160 21373 21693 gene locus_tag LOCUS_29170 21373 21693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 21699 23435 gene locus_tag LOCUS_29180 gene yidC 21699 23435 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207682.1 protein_id gnl|my_center|LOCUS_29180 23525 24889 gene locus_tag LOCUS_29190 gene mnmE 23525 24889 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207681.1 protein_id gnl|my_center|LOCUS_29190 25024 25386 gene locus_tag LOCUS_29200 25024 25386 CDS product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207058.1 protein_id gnl|my_center|LOCUS_29200 26562 25405 gene locus_tag LOCUS_29210 26562 25405 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207151.1 protein_id gnl|my_center|LOCUS_29210 27022 26756 gene locus_tag LOCUS_29220 27022 26756 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115414.1 protein_id gnl|my_center|LOCUS_29220 27110 28087 gene locus_tag LOCUS_29230 gene dmeF 27110 28087 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207680.1 protein_id gnl|my_center|LOCUS_29230 28226 28927 gene locus_tag LOCUS_29240 28226 28927 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207679.1 protein_id gnl|my_center|LOCUS_29240 29246 28995 gene locus_tag LOCUS_29250 29246 28995 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115476.1 protein_id gnl|my_center|LOCUS_29250 29975 29448 gene locus_tag LOCUS_29260 gene hpt 29975 29448 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115408.1 protein_id gnl|my_center|LOCUS_29260 31544 30228 gene locus_tag LOCUS_29270 gene guaD 31544 30228 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 protein_id gnl|my_center|LOCUS_29270 31766 32239 gene locus_tag LOCUS_29280 31766 32239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 33541 32381 gene locus_tag LOCUS_29290 33541 32381 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207676.1 protein_id gnl|my_center|LOCUS_29290 33956 33576 gene locus_tag LOCUS_29300 33956 33576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256722.1 protein_id gnl|my_center|LOCUS_29300 34173 34757 gene locus_tag LOCUS_29310 34173 34757 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836309.1 protein_id gnl|my_center|LOCUS_29310 35843 34878 gene locus_tag LOCUS_29320 35843 34878 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207675.1 protein_id gnl|my_center|LOCUS_29320 36672 36133 gene locus_tag LOCUS_29330 36672 36133 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709539.1 protein_id gnl|my_center|LOCUS_29330 37951 36902 gene locus_tag LOCUS_29340 37951 36902 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093428.1 protein_id gnl|my_center|LOCUS_29340 37929 38144 gene locus_tag LOCUS_29350 37929 38144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 38285 38572 gene locus_tag LOCUS_29360 38285 38572 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_29360 38626 38910 gene locus_tag LOCUS_29370 38626 38910 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405647.1 protein_id gnl|my_center|LOCUS_29370 38977 39351 gene locus_tag LOCUS_29380 38977 39351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 40763 39396 gene locus_tag LOCUS_29390 gene mpl 40763 39396 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207672.1 protein_id gnl|my_center|LOCUS_29390 41062 41538 gene locus_tag LOCUS_29400 41062 41538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 41604 41948 gene locus_tag LOCUS_29410 41604 41948 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207671.1 protein_id gnl|my_center|LOCUS_29410 42240 42752 gene locus_tag LOCUS_29420 gene purE 42240 42752 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115451.1 protein_id gnl|my_center|LOCUS_29420 42768 43889 gene locus_tag LOCUS_29430 42768 43889 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207670.1 protein_id gnl|my_center|LOCUS_29430 44517 45806 gene locus_tag LOCUS_29440 44517 45806 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 protein_id gnl|my_center|LOCUS_29440 46255 45878 gene locus_tag LOCUS_29450 46255 45878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207668.1 protein_id gnl|my_center|LOCUS_29450 47293 46373 gene locus_tag LOCUS_29460 47293 46373 CDS product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207667.1 protein_id gnl|my_center|LOCUS_29460 47296 47493 gene locus_tag LOCUS_29470 47296 47493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 47462 47956 gene locus_tag LOCUS_29480 47462 47956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 48976 48482 gene locus_tag LOCUS_29490 48976 48482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207664.1 protein_id gnl|my_center|LOCUS_29490 49298 49002 gene locus_tag LOCUS_29500 49298 49002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 49711 49349 gene locus_tag LOCUS_29510 49711 49349 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488020.1 protein_id gnl|my_center|LOCUS_29510 51873 49930 gene locus_tag LOCUS_29520 gene dnaK 51873 49930 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115449.1 protein_id gnl|my_center|LOCUS_29520 52612 52040 gene locus_tag LOCUS_29530 gene grpE 52612 52040 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115470.1 protein_id gnl|my_center|LOCUS_29530 53404 53670 gene locus_tag LOCUS_29540 53404 53670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 54758 53751 gene locus_tag LOCUS_29550 54758 53751 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 protein_id gnl|my_center|LOCUS_29550 55159 56106 gene locus_tag LOCUS_29560 gene tauA 55159 56106 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114314.1 protein_id gnl|my_center|LOCUS_29560 56125 56946 gene locus_tag LOCUS_29570 gene tauB 56125 56946 CDS product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767098.1 protein_id gnl|my_center|LOCUS_29570 56946 57788 gene locus_tag LOCUS_29580 gene tauC 56946 57788 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 protein_id gnl|my_center|LOCUS_29580 57923 58786 gene locus_tag LOCUS_29590 gene tauD 57923 58786 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_29590 59130 60992 gene locus_tag LOCUS_29600 gene nadN 59130 60992 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_29600 61608 63731 gene locus_tag LOCUS_29610 61608 63731 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 protein_id gnl|my_center|LOCUS_29610 >Feature sequence30 1878 220 gene locus_tag LOCUS_29620 gene betA 1878 220 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066521.1 protein_id gnl|my_center|LOCUS_29620 2939 1899 gene locus_tag LOCUS_29630 2939 1899 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252895.1 protein_id gnl|my_center|LOCUS_29630 4464 2986 gene locus_tag LOCUS_29640 4464 2986 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398620.1 protein_id gnl|my_center|LOCUS_29640 4949 6277 gene locus_tag LOCUS_29650 4949 6277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730167.1 protein_id gnl|my_center|LOCUS_29650 6294 6794 gene locus_tag LOCUS_29660 6294 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 6794 7546 gene locus_tag LOCUS_29670 6794 7546 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878534.1 protein_id gnl|my_center|LOCUS_29670 7609 8907 gene locus_tag LOCUS_29680 gene oprB 7609 8907 CDS product carbohydrate porin OprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116413.1 protein_id gnl|my_center|LOCUS_29680 10441 9014 gene locus_tag LOCUS_29690 10441 9014 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206691.1 protein_id gnl|my_center|LOCUS_29690 10578 11453 gene locus_tag LOCUS_29700 10578 11453 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206693.1 protein_id gnl|my_center|LOCUS_29700 12500 11478 gene locus_tag LOCUS_29710 gene dusB 12500 11478 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207350.1 protein_id gnl|my_center|LOCUS_29710 12584 13792 gene locus_tag LOCUS_29720 12584 13792 CDS product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207351.1 protein_id gnl|my_center|LOCUS_29720 13759 14406 gene locus_tag LOCUS_29730 13759 14406 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067866.1 protein_id gnl|my_center|LOCUS_29730 14747 16321 gene locus_tag LOCUS_29740 14747 16321 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 protein_id gnl|my_center|LOCUS_29740 16321 17547 gene locus_tag LOCUS_29750 16321 17547 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123362.1 protein_id gnl|my_center|LOCUS_29750 17600 17968 gene locus_tag LOCUS_29760 17600 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 18008 19111 gene locus_tag LOCUS_29770 18008 19111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 19141 19965 gene locus_tag LOCUS_29780 19141 19965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 19982 20893 gene locus_tag LOCUS_29790 19982 20893 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205998.1 protein_id gnl|my_center|LOCUS_29790 20966 21814 gene locus_tag LOCUS_29800 20966 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 21839 22270 gene locus_tag LOCUS_29810 21839 22270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205997.1 protein_id gnl|my_center|LOCUS_29810 22358 25246 gene locus_tag LOCUS_29820 22358 25246 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205999.1 protein_id gnl|my_center|LOCUS_29820 26489 25356 gene locus_tag LOCUS_29830 gene proB 26489 25356 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118789.1 protein_id gnl|my_center|LOCUS_29830 27762 26548 gene locus_tag LOCUS_29840 gene cgtA 27762 26548 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118576.1 protein_id gnl|my_center|LOCUS_29840 28060 28650 gene locus_tag LOCUS_29850 gene prfH 28060 28650 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602103.1 protein_id gnl|my_center|LOCUS_29850 30157 28811 gene locus_tag LOCUS_29860 30157 28811 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207216.1 protein_id gnl|my_center|LOCUS_29860 30579 31574 gene locus_tag LOCUS_29870 30579 31574 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_29870 32048 31602 gene locus_tag LOCUS_29880 32048 31602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 32506 32240 gene locus_tag LOCUS_29890 32506 32240 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_29890 33411 32509 gene locus_tag LOCUS_29900 33411 32509 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118179.1 protein_id gnl|my_center|LOCUS_29900 33606 35999 gene locus_tag LOCUS_29910 gene mrcB 33606 35999 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073474.1 protein_id gnl|my_center|LOCUS_29910 36053 36637 gene locus_tag LOCUS_29920 36053 36637 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207218.1 protein_id gnl|my_center|LOCUS_29920 38036 37083 gene locus_tag LOCUS_29930 38036 37083 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207219.1 protein_id gnl|my_center|LOCUS_29930 38177 38347 gene locus_tag LOCUS_29940 38177 38347 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118129.1 protein_id gnl|my_center|LOCUS_29940 39892 38558 gene locus_tag LOCUS_29950 39892 38558 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207220.1 protein_id gnl|my_center|LOCUS_29950 40600 39935 gene locus_tag LOCUS_29960 40600 39935 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207221.1 protein_id gnl|my_center|LOCUS_29960 41105 40746 gene locus_tag LOCUS_29970 41105 40746 CDS product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207222.1 protein_id gnl|my_center|LOCUS_29970 42971 41214 gene locus_tag LOCUS_29980 42971 41214 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 protein_id gnl|my_center|LOCUS_29980 43142 44425 gene locus_tag LOCUS_29990 43142 44425 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073461.1 protein_id gnl|my_center|LOCUS_29990 44711 45682 gene locus_tag LOCUS_30000 44711 45682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 46410 45778 gene locus_tag LOCUS_30010 46410 45778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118705.1 protein_id gnl|my_center|LOCUS_30010 46500 46871 gene locus_tag LOCUS_30020 46500 46871 CDS product DUF3144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118682.1 protein_id gnl|my_center|LOCUS_30020 46925 47329 gene locus_tag LOCUS_30030 46925 47329 CDS product DUF3144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118682.1 protein_id gnl|my_center|LOCUS_30030 47535 48599 gene locus_tag LOCUS_30040 47535 48599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 48945 48667 gene locus_tag LOCUS_30050 48945 48667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30050 50524 49229 gene locus_tag LOCUS_30060 gene hemL 50524 49229 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207323.1 protein_id gnl|my_center|LOCUS_30060 51187 50564 gene locus_tag LOCUS_30070 gene thiE 51187 50564 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207324.1 protein_id gnl|my_center|LOCUS_30070 52325 51285 gene locus_tag LOCUS_30080 52325 51285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 53035 52349 gene locus_tag LOCUS_30090 53035 52349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 54436 53159 gene locus_tag LOCUS_30100 54436 53159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 55687 54518 gene locus_tag LOCUS_30110 55687 54518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 56345 55962 gene locus_tag LOCUS_30120 56345 55962 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207325.1 protein_id gnl|my_center|LOCUS_30120 56554 58014 gene locus_tag LOCUS_30130 56554 58014 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207327.1 protein_id gnl|my_center|LOCUS_30130 58194 59651 gene locus_tag LOCUS_30140 58194 59651 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207327.1 protein_id gnl|my_center|LOCUS_30140 60787 60056 gene locus_tag LOCUS_30150 gene tsaA 60787 60056 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207224.1 protein_id gnl|my_center|LOCUS_30150 60887 61666 gene locus_tag LOCUS_30160 60887 61666 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118187.1 protein_id gnl|my_center|LOCUS_30160 >Feature sequence31 511 107 gene locus_tag LOCUS_30170 511 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 1571 642 gene locus_tag LOCUS_30180 gene rarD 1571 642 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207355.1 protein_id gnl|my_center|LOCUS_30180 2306 1716 gene locus_tag LOCUS_30190 2306 1716 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207356.1 protein_id gnl|my_center|LOCUS_30190 4467 2446 gene locus_tag LOCUS_30200 gene uvrB 4467 2446 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118463.1 protein_id gnl|my_center|LOCUS_30200 4645 5424 gene locus_tag LOCUS_30210 4645 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207357.1 protein_id gnl|my_center|LOCUS_30210 5537 6970 gene locus_tag LOCUS_30220 5537 6970 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207358.1 protein_id gnl|my_center|LOCUS_30220 7144 8601 gene locus_tag LOCUS_30230 7144 8601 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207358.1 protein_id gnl|my_center|LOCUS_30230 8881 8702 gene locus_tag LOCUS_30240 8881 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118942.1 protein_id gnl|my_center|LOCUS_30240 9103 10338 gene locus_tag LOCUS_30250 9103 10338 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_30250 10832 10452 gene locus_tag LOCUS_30260 10832 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 12454 10994 gene locus_tag LOCUS_30270 gene adeC 12454 10994 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811956.1 protein_id gnl|my_center|LOCUS_30270 15624 12454 gene locus_tag LOCUS_30280 gene mexQ 15624 12454 CDS product multidrug efflux RND transporter permease subunit MexQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 protein_id gnl|my_center|LOCUS_30280 16808 15624 gene locus_tag LOCUS_30290 gene mexP 16808 15624 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119548.1 protein_id gnl|my_center|LOCUS_30290 18167 17382 gene locus_tag LOCUS_30300 18167 17382 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103062.1 protein_id gnl|my_center|LOCUS_30300 18315 19544 gene locus_tag LOCUS_30310 18315 19544 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206045.1 protein_id gnl|my_center|LOCUS_30310 20612 19719 gene locus_tag LOCUS_30320 20612 19719 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216318.1 protein_id gnl|my_center|LOCUS_30320 20713 22065 gene locus_tag LOCUS_30330 20713 22065 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556298.1 protein_id gnl|my_center|LOCUS_30330 22046 22438 gene locus_tag LOCUS_30340 22046 22438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206343.1 protein_id gnl|my_center|LOCUS_30340 23243 22710 gene locus_tag LOCUS_30350 23243 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 23724 23272 gene locus_tag LOCUS_30360 23724 23272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 24349 24807 gene locus_tag LOCUS_30370 24349 24807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 25597 27825 gene locus_tag LOCUS_30380 25597 27825 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207038.1 protein_id gnl|my_center|LOCUS_30380 28193 28864 gene locus_tag LOCUS_30390 28193 28864 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_30390 28891 30234 gene locus_tag LOCUS_30400 28891 30234 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_30400 31086 30262 gene locus_tag LOCUS_30410 31086 30262 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202744.1 protein_id gnl|my_center|LOCUS_30410 33102 31837 gene locus_tag LOCUS_30420 33102 31837 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206914.1 protein_id gnl|my_center|LOCUS_30420 34321 33404 gene locus_tag LOCUS_30430 34321 33404 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206896.1 protein_id gnl|my_center|LOCUS_30430 34897 37368 gene locus_tag LOCUS_30440 34897 37368 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206901.1 protein_id gnl|my_center|LOCUS_30440 38212 37535 gene locus_tag LOCUS_30450 38212 37535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 38303 38503 gene locus_tag LOCUS_30460 38303 38503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 38500 38943 gene locus_tag LOCUS_30470 38500 38943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 38943 39323 gene locus_tag LOCUS_30480 38943 39323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 39333 40076 gene locus_tag LOCUS_30490 39333 40076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 40090 40782 gene locus_tag LOCUS_30500 40090 40782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 41825 40863 gene locus_tag LOCUS_30510 41825 40863 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 protein_id gnl|my_center|LOCUS_30510 42853 41900 gene locus_tag LOCUS_30520 42853 41900 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206907.1 protein_id gnl|my_center|LOCUS_30520 43625 42888 gene locus_tag LOCUS_30530 43625 42888 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206908.1 protein_id gnl|my_center|LOCUS_30530 44121 43636 gene locus_tag LOCUS_30540 44121 43636 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206909.1 protein_id gnl|my_center|LOCUS_30540 45409 44132 gene locus_tag LOCUS_30550 45409 44132 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074154.1 protein_id gnl|my_center|LOCUS_30550 45967 45440 gene locus_tag LOCUS_30560 45967 45440 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206910.1 protein_id gnl|my_center|LOCUS_30560 47177 46011 gene locus_tag LOCUS_30570 47177 46011 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206911.1 protein_id gnl|my_center|LOCUS_30570 48308 47196 gene locus_tag LOCUS_30580 48308 47196 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 protein_id gnl|my_center|LOCUS_30580 48458 48925 gene locus_tag LOCUS_30590 48458 48925 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121038.1 protein_id gnl|my_center|LOCUS_30590 49973 48975 gene locus_tag LOCUS_30600 49973 48975 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088828.1 protein_id gnl|my_center|LOCUS_30600 51081 49975 gene locus_tag LOCUS_30610 51081 49975 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_30610 52177 51182 gene locus_tag LOCUS_30620 52177 51182 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_30620 53611 52268 gene locus_tag LOCUS_30630 53611 52268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206913.1 protein_id gnl|my_center|LOCUS_30630 53988 54380 gene locus_tag LOCUS_30640 53988 54380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 55211 56602 gene locus_tag LOCUS_30650 55211 56602 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_30650 56635 57795 gene locus_tag LOCUS_30660 56635 57795 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_30660 57842 59338 gene locus_tag LOCUS_30670 57842 59338 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206844.1 protein_id gnl|my_center|LOCUS_30670 60138 59386 gene locus_tag LOCUS_30680 60138 59386 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence32 1370 318 gene locus_tag LOCUS_30690 gene pbpG 1370 318 CDS product D-alanyl-D-alanine endopeptidase PBP7/8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121158.1 protein_id gnl|my_center|LOCUS_30690 1603 2238 gene locus_tag LOCUS_30700 1603 2238 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208174.1 protein_id gnl|my_center|LOCUS_30700 2275 3843 gene locus_tag LOCUS_30710 2275 3843 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208173.1 protein_id gnl|my_center|LOCUS_30710 3861 5276 gene locus_tag LOCUS_30720 3861 5276 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208172.1 protein_id gnl|my_center|LOCUS_30720 6544 5372 gene locus_tag LOCUS_30730 6544 5372 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208171.1 protein_id gnl|my_center|LOCUS_30730 8120 6573 gene locus_tag LOCUS_30740 gene gpmI 8120 6573 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208170.1 protein_id gnl|my_center|LOCUS_30740 9357 8287 gene locus_tag LOCUS_30750 gene lptG 9357 8287 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 protein_id gnl|my_center|LOCUS_30750 10544 9357 gene locus_tag LOCUS_30760 gene lptF 10544 9357 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 protein_id gnl|my_center|LOCUS_30760 10602 12050 gene locus_tag LOCUS_30770 10602 12050 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208168.1 protein_id gnl|my_center|LOCUS_30770 12043 12450 gene locus_tag LOCUS_30780 12043 12450 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121193.1 protein_id gnl|my_center|LOCUS_30780 12481 13104 gene locus_tag LOCUS_30790 12481 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121184.1 protein_id gnl|my_center|LOCUS_30790 13297 13515 gene locus_tag LOCUS_30800 13297 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 15027 13864 gene locus_tag LOCUS_30810 15027 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 15948 15361 gene locus_tag LOCUS_30820 gene pgsA 15948 15361 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114808.1 protein_id gnl|my_center|LOCUS_30820 16888 16055 gene locus_tag LOCUS_30830 16888 16055 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208217.1 protein_id gnl|my_center|LOCUS_30830 18791 16992 gene locus_tag LOCUS_30840 gene uvrC 18791 16992 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208216.1 protein_id gnl|my_center|LOCUS_30840 19732 18920 gene locus_tag LOCUS_30850 19732 18920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 20225 19806 gene locus_tag LOCUS_30860 20225 19806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 21274 20330 gene locus_tag LOCUS_30870 21274 20330 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000673.1 protein_id gnl|my_center|LOCUS_30870 22479 21490 gene locus_tag LOCUS_30880 22479 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 22913 25066 gene locus_tag LOCUS_30890 gene fadB 22913 25066 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208211.1 protein_id gnl|my_center|LOCUS_30890 25079 26251 gene locus_tag LOCUS_30900 gene fadA 25079 26251 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065826.1 protein_id gnl|my_center|LOCUS_30900 26525 27019 gene locus_tag LOCUS_30910 26525 27019 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038400.1 protein_id gnl|my_center|LOCUS_30910 27104 27610 gene locus_tag LOCUS_30920 27104 27610 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038400.1 protein_id gnl|my_center|LOCUS_30920 28205 27696 gene locus_tag LOCUS_30930 28205 27696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208209.1 protein_id gnl|my_center|LOCUS_30930 28864 29217 gene locus_tag LOCUS_30940 28864 29217 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114700.1 protein_id gnl|my_center|LOCUS_30940 30166 29336 gene locus_tag LOCUS_30950 30166 29336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 30960 30211 gene locus_tag LOCUS_30960 30960 30211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208207.1 protein_id gnl|my_center|LOCUS_30960 31138 31839 gene locus_tag LOCUS_30970 31138 31839 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208206.1 protein_id gnl|my_center|LOCUS_30970 32482 33633 gene locus_tag LOCUS_30980 32482 33633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208205.1 protein_id gnl|my_center|LOCUS_30980 34118 33714 gene locus_tag LOCUS_30990 34118 33714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 36110 34179 gene locus_tag LOCUS_31000 gene htpG 36110 34179 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208203.1 protein_id gnl|my_center|LOCUS_31000 36552 36205 gene locus_tag LOCUS_31010 36552 36205 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060531.1 protein_id gnl|my_center|LOCUS_31010 37319 36708 gene locus_tag LOCUS_31020 37319 36708 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208202.1 protein_id gnl|my_center|LOCUS_31020 39121 37706 gene locus_tag LOCUS_31030 39121 37706 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 protein_id gnl|my_center|LOCUS_31030 40121 39252 gene locus_tag LOCUS_31040 40121 39252 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208201.1 protein_id gnl|my_center|LOCUS_31040 40242 40730 gene locus_tag LOCUS_31050 40242 40730 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079397.1 protein_id gnl|my_center|LOCUS_31050 41224 40868 gene locus_tag LOCUS_31060 41224 40868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115127.1 protein_id gnl|my_center|LOCUS_31060 41491 42855 gene locus_tag LOCUS_31070 41491 42855 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804358.1 protein_id gnl|my_center|LOCUS_31070 43500 42943 gene locus_tag LOCUS_31080 43500 42943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 45698 43587 gene locus_tag LOCUS_31090 45698 43587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 49984 45791 gene locus_tag LOCUS_31100 gene rpoC 49984 45791 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208200.1 protein_id gnl|my_center|LOCUS_31100 54217 50129 gene locus_tag LOCUS_31110 gene rpoB 54217 50129 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_31110 54896 54525 gene locus_tag LOCUS_31120 gene rplL 54896 54525 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229360.1 protein_id gnl|my_center|LOCUS_31120 55451 54945 gene locus_tag LOCUS_31130 gene rplJ 55451 54945 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115099.1 protein_id gnl|my_center|LOCUS_31130 56510 55815 gene locus_tag LOCUS_31140 gene rplA 56510 55815 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065788.1 protein_id gnl|my_center|LOCUS_31140 56942 56514 gene locus_tag LOCUS_31150 gene rplK 56942 56514 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074682.1 protein_id gnl|my_center|LOCUS_31150 57593 57060 gene locus_tag LOCUS_31160 gene nusG 57593 57060 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115092.1 protein_id gnl|my_center|LOCUS_31160 58041 57601 gene locus_tag LOCUS_31170 gene secE 58041 57601 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114837.1 protein_id gnl|my_center|LOCUS_31170 58191 58116 gene locus_tag LOCUS_t00470 58191 58116 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence33 1297 1470 gene locus_tag LOCUS_31180 1297 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3512 1605 gene locus_tag LOCUS_31190 3512 1605 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208297.1 protein_id gnl|my_center|LOCUS_31190 3548 3793 gene locus_tag LOCUS_31200 3548 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3920 4831 gene locus_tag LOCUS_31210 gene mumR 3920 4831 CDS product LysR family transcriptional regulator MumR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206319.1 protein_id gnl|my_center|LOCUS_31210 5191 6423 gene locus_tag LOCUS_31220 5191 6423 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206320.1 protein_id gnl|my_center|LOCUS_31220 6459 7217 gene locus_tag LOCUS_31230 6459 7217 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206321.1 protein_id gnl|my_center|LOCUS_31230 7230 8036 gene locus_tag LOCUS_31240 7230 8036 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206322.1 protein_id gnl|my_center|LOCUS_31240 8055 9635 gene locus_tag LOCUS_31250 8055 9635 CDS product urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206323.1 protein_id gnl|my_center|LOCUS_31250 9637 11376 gene locus_tag LOCUS_31260 9637 11376 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206324.1 protein_id gnl|my_center|LOCUS_31260 11506 12543 gene locus_tag LOCUS_31270 11506 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 13363 12617 gene locus_tag LOCUS_31280 13363 12617 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173423.1 protein_id gnl|my_center|LOCUS_31280 13513 13851 gene locus_tag LOCUS_31290 13513 13851 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817007.1 protein_id gnl|my_center|LOCUS_31290 13958 14407 gene locus_tag LOCUS_31300 13958 14407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004842579.1 protein_id gnl|my_center|LOCUS_31300 14434 17076 gene locus_tag LOCUS_31310 gene topA 14434 17076 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208301.1 protein_id gnl|my_center|LOCUS_31310 17156 17950 gene locus_tag LOCUS_31320 17156 17950 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_31320 17956 18714 gene locus_tag LOCUS_31330 17956 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_31330 18850 19413 gene locus_tag LOCUS_31340 18850 19413 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208303.1 protein_id gnl|my_center|LOCUS_31340 20001 19549 gene locus_tag LOCUS_31350 20001 19549 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730468.1 protein_id gnl|my_center|LOCUS_31350 20102 21238 gene locus_tag LOCUS_31360 20102 21238 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367172.1 protein_id gnl|my_center|LOCUS_31360 21419 23410 gene locus_tag LOCUS_31370 21419 23410 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208304.1 protein_id gnl|my_center|LOCUS_31370 23496 23747 gene locus_tag LOCUS_31380 23496 23747 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_31380 24066 24569 gene locus_tag LOCUS_31390 24066 24569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114779.1 protein_id gnl|my_center|LOCUS_31390 24678 24956 gene locus_tag LOCUS_31400 24678 24956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114792.1 protein_id gnl|my_center|LOCUS_31400 26774 25056 gene locus_tag LOCUS_31410 26774 25056 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079171.1 protein_id gnl|my_center|LOCUS_31410 27112 26957 gene locus_tag LOCUS_31420 gene rpmG 27112 26957 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205031.1 protein_id gnl|my_center|LOCUS_31420 27361 27125 gene locus_tag LOCUS_31430 gene rpmB 27361 27125 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048256.1 protein_id gnl|my_center|LOCUS_31430 28918 27527 gene locus_tag LOCUS_31440 28918 27527 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115149.1 protein_id gnl|my_center|LOCUS_31440 29087 29779 gene locus_tag LOCUS_31450 29087 29779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 29863 30729 gene locus_tag LOCUS_31460 gene purU 29863 30729 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208307.1 protein_id gnl|my_center|LOCUS_31460 30949 31764 gene locus_tag LOCUS_31470 30949 31764 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208308.1 protein_id gnl|my_center|LOCUS_31470 31793 32416 gene locus_tag LOCUS_31480 31793 32416 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011664.1 protein_id gnl|my_center|LOCUS_31480 32416 32820 gene locus_tag LOCUS_31490 32416 32820 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885432.1 protein_id gnl|my_center|LOCUS_31490 33433 32912 gene locus_tag LOCUS_31500 gene msrA 33433 32912 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005036987.1 protein_id gnl|my_center|LOCUS_31500 34055 33711 gene locus_tag LOCUS_31510 34055 33711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 34586 34248 gene locus_tag LOCUS_31520 34586 34248 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_31520 34713 35609 gene locus_tag LOCUS_31530 34713 35609 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207654.1 protein_id gnl|my_center|LOCUS_31530 35610 36041 gene locus_tag LOCUS_31540 gene trxC 35610 36041 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_31540 36062 36484 gene locus_tag LOCUS_31550 36062 36484 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116010.1 protein_id gnl|my_center|LOCUS_31550 37072 36557 gene locus_tag LOCUS_31560 37072 36557 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207652.1 protein_id gnl|my_center|LOCUS_31560 37714 37211 gene locus_tag LOCUS_31570 37714 37211 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207651.1 protein_id gnl|my_center|LOCUS_31570 38231 37743 gene locus_tag LOCUS_31580 38231 37743 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002051423.1 protein_id gnl|my_center|LOCUS_31580 38323 38637 gene locus_tag LOCUS_31590 38323 38637 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116171.1 protein_id gnl|my_center|LOCUS_31590 40589 38679 gene locus_tag LOCUS_31600 gene mnmC 40589 38679 CDS product FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207650.1 protein_id gnl|my_center|LOCUS_31600 41398 40874 gene locus_tag LOCUS_31610 41398 40874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064163.1 protein_id gnl|my_center|LOCUS_31610 41705 41403 gene locus_tag LOCUS_31620 41705 41403 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116400.1 protein_id gnl|my_center|LOCUS_31620 42347 41733 gene locus_tag LOCUS_31630 42347 41733 CDS product septation protein IspZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064166.1 protein_id gnl|my_center|LOCUS_31630 42392 43243 gene locus_tag LOCUS_31640 42392 43243 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207649.1 protein_id gnl|my_center|LOCUS_31640 44041 43556 gene locus_tag LOCUS_31650 gene ybeY 44041 43556 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119528.1 protein_id gnl|my_center|LOCUS_31650 45160 44051 gene locus_tag LOCUS_31660 45160 44051 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 protein_id gnl|my_center|LOCUS_31660 46653 45199 gene locus_tag LOCUS_31670 gene miaB 46653 45199 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207720.1 protein_id gnl|my_center|LOCUS_31670 46943 48916 gene locus_tag LOCUS_31680 46943 48916 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207719.1 protein_id gnl|my_center|LOCUS_31680 48993 49613 gene locus_tag LOCUS_31690 48993 49613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804634.1 protein_id gnl|my_center|LOCUS_31690 49872 50858 gene locus_tag LOCUS_31700 49872 50858 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_31700 51094 51351 gene locus_tag LOCUS_31710 51094 51351 CDS product DUF2789 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 protein_id gnl|my_center|LOCUS_31710 51982 51455 gene locus_tag LOCUS_31720 51982 51455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207718.1 protein_id gnl|my_center|LOCUS_31720 52773 52171 gene locus_tag LOCUS_31730 52773 52171 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207717.1 protein_id gnl|my_center|LOCUS_31730 52889 53746 gene locus_tag LOCUS_31740 gene rlmJ 52889 53746 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207716.1 protein_id gnl|my_center|LOCUS_31740 53910 54737 gene locus_tag LOCUS_31750 gene pssA 53910 54737 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119541.1 protein_id gnl|my_center|LOCUS_31750 54772 55857 gene locus_tag LOCUS_31760 54772 55857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207715.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence34 1622 243 gene locus_tag LOCUS_31770 1622 243 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207656.1 protein_id gnl|my_center|LOCUS_31770 1766 3802 gene locus_tag LOCUS_31780 1766 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 4558 4118 gene locus_tag LOCUS_31790 4558 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 5660 4641 gene locus_tag LOCUS_31800 5660 4641 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208309.1 protein_id gnl|my_center|LOCUS_31800 6246 5734 gene locus_tag LOCUS_31810 6246 5734 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208310.1 protein_id gnl|my_center|LOCUS_31810 7168 6326 gene locus_tag LOCUS_31820 gene thyA 7168 6326 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208311.1 protein_id gnl|my_center|LOCUS_31820 7338 8135 gene locus_tag LOCUS_31830 7338 8135 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799764.1 protein_id gnl|my_center|LOCUS_31830 8538 9065 gene locus_tag LOCUS_31840 8538 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 9531 9154 gene locus_tag LOCUS_31850 9531 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 9971 9543 gene locus_tag LOCUS_31860 9971 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115133.1 protein_id gnl|my_center|LOCUS_31860 10822 10004 gene locus_tag LOCUS_31870 gene lgt 10822 10004 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208313.1 protein_id gnl|my_center|LOCUS_31870 10917 11699 gene locus_tag LOCUS_31880 10917 11699 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208314.1 protein_id gnl|my_center|LOCUS_31880 13914 11749 gene locus_tag LOCUS_31890 13914 11749 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 protein_id gnl|my_center|LOCUS_31890 15098 14316 gene locus_tag LOCUS_31900 gene tatC 15098 14316 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114673.1 protein_id gnl|my_center|LOCUS_31900 15562 15095 gene locus_tag LOCUS_31910 15562 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 15804 15580 gene locus_tag LOCUS_31920 15804 15580 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208317.1 protein_id gnl|my_center|LOCUS_31920 16059 16859 gene locus_tag LOCUS_31930 16059 16859 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 protein_id gnl|my_center|LOCUS_31930 17598 16975 gene locus_tag LOCUS_31940 gene rdgB 17598 16975 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208319.1 protein_id gnl|my_center|LOCUS_31940 18167 17673 gene locus_tag LOCUS_31950 18167 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 18571 18164 gene locus_tag LOCUS_31960 18571 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 19040 18663 gene locus_tag LOCUS_31970 19040 18663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 19698 19102 gene locus_tag LOCUS_31980 19698 19102 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114702.1 protein_id gnl|my_center|LOCUS_31980 20288 19695 gene locus_tag LOCUS_31990 gene metW 20288 19695 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 protein_id gnl|my_center|LOCUS_31990 21448 20288 gene locus_tag LOCUS_32000 21448 20288 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114709.1 protein_id gnl|my_center|LOCUS_32000 23556 21859 gene locus_tag LOCUS_32010 gene leuA 23556 21859 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114718.1 protein_id gnl|my_center|LOCUS_32010 24934 23834 gene locus_tag LOCUS_32020 24934 23834 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_32020 25680 24997 gene locus_tag LOCUS_32030 25680 24997 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112849.1 protein_id gnl|my_center|LOCUS_32030 28104 25753 gene locus_tag LOCUS_32040 28104 25753 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037900.1 protein_id gnl|my_center|LOCUS_32040 30814 28511 gene locus_tag LOCUS_32050 30814 28511 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207070.1 protein_id gnl|my_center|LOCUS_32050 31246 32577 gene locus_tag LOCUS_32060 gene tig 31246 32577 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208322.1 protein_id gnl|my_center|LOCUS_32060 32767 33378 gene locus_tag LOCUS_32070 gene clpP 32767 33378 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114870.1 protein_id gnl|my_center|LOCUS_32070 33415 34725 gene locus_tag LOCUS_32080 gene clpX 33415 34725 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114726.1 protein_id gnl|my_center|LOCUS_32080 34893 35642 gene locus_tag LOCUS_32090 34893 35642 CDS product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208323.1 protein_id gnl|my_center|LOCUS_32090 36229 35696 gene locus_tag LOCUS_32100 36229 35696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 36835 36302 gene locus_tag LOCUS_32110 36835 36302 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794750.1 protein_id gnl|my_center|LOCUS_32110 37394 36825 gene locus_tag LOCUS_32120 37394 36825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 39000 37477 gene locus_tag LOCUS_32130 39000 37477 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115045.1 protein_id gnl|my_center|LOCUS_32130 39170 39796 gene locus_tag LOCUS_32140 39170 39796 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 protein_id gnl|my_center|LOCUS_32140 40083 42296 gene locus_tag LOCUS_32150 40083 42296 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207935.1 protein_id gnl|my_center|LOCUS_32150 44576 42435 gene locus_tag LOCUS_32160 gene pta 44576 42435 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208324.1 protein_id gnl|my_center|LOCUS_32160 46068 44851 gene locus_tag LOCUS_32170 46068 44851 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208325.1 protein_id gnl|my_center|LOCUS_32170 47892 46627 gene locus_tag LOCUS_32180 47892 46627 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208331.1 protein_id gnl|my_center|LOCUS_32180 48332 49540 gene locus_tag LOCUS_32190 48332 49540 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208332.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence35 990 406 gene locus_tag LOCUS_32200 990 406 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206572.1 protein_id gnl|my_center|LOCUS_32200 1300 1710 gene locus_tag LOCUS_32210 1300 1710 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206571.1 protein_id gnl|my_center|LOCUS_32210 2029 1775 gene locus_tag LOCUS_32220 2029 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 4163 2175 gene locus_tag LOCUS_32230 gene tkt 4163 2175 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206570.1 protein_id gnl|my_center|LOCUS_32230 4685 5851 gene locus_tag LOCUS_32240 gene metK 4685 5851 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 protein_id gnl|my_center|LOCUS_32240 6296 6045 gene locus_tag LOCUS_32250 6296 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 6605 6793 gene locus_tag LOCUS_32260 6605 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 7419 6787 gene locus_tag LOCUS_32270 gene rhtC 7419 6787 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205974.1 protein_id gnl|my_center|LOCUS_32270 8293 7724 gene locus_tag LOCUS_32280 8293 7724 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206565.1 protein_id gnl|my_center|LOCUS_32280 8766 8434 gene locus_tag LOCUS_32290 8766 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 8876 9421 gene locus_tag LOCUS_32300 gene ruvC 8876 9421 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121356.1 protein_id gnl|my_center|LOCUS_32300 9936 9595 gene locus_tag LOCUS_32310 9936 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 10783 9938 gene locus_tag LOCUS_32320 10783 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 11132 10860 gene locus_tag LOCUS_32330 11132 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 12616 11141 gene locus_tag LOCUS_32340 12616 11141 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206560.1 protein_id gnl|my_center|LOCUS_32340 12661 13761 gene locus_tag LOCUS_32350 gene queG 12661 13761 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206559.1 protein_id gnl|my_center|LOCUS_32350 14060 15049 gene locus_tag LOCUS_32360 gene bioB 14060 15049 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206558.1 protein_id gnl|my_center|LOCUS_32360 17094 15202 gene locus_tag LOCUS_32370 17094 15202 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207198.1 protein_id gnl|my_center|LOCUS_32370 18725 17181 gene locus_tag LOCUS_32380 gene purF 18725 17181 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068333.1 protein_id gnl|my_center|LOCUS_32380 19343 18750 gene locus_tag LOCUS_32390 19343 18750 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207199.1 protein_id gnl|my_center|LOCUS_32390 20350 19346 gene locus_tag LOCUS_32400 20350 19346 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207200.1 protein_id gnl|my_center|LOCUS_32400 20923 20441 gene locus_tag LOCUS_32410 gene gspM 20923 20441 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207201.1 protein_id gnl|my_center|LOCUS_32410 22062 20920 gene locus_tag LOCUS_32420 gene gspL 22062 20920 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207202.1 protein_id gnl|my_center|LOCUS_32420 22555 22100 gene locus_tag LOCUS_32430 22555 22100 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 protein_id gnl|my_center|LOCUS_32430 23708 22635 gene locus_tag LOCUS_32440 23708 22635 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207203.1 protein_id gnl|my_center|LOCUS_32440 24368 23793 gene locus_tag LOCUS_32450 24368 23793 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 protein_id gnl|my_center|LOCUS_32450 24665 25045 gene locus_tag LOCUS_32460 24665 25045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073503.1 protein_id gnl|my_center|LOCUS_32460 26273 25122 gene locus_tag LOCUS_32470 gene rhlB 26273 25122 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803629.1 protein_id gnl|my_center|LOCUS_32470 26593 26381 gene locus_tag LOCUS_32480 26593 26381 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126912.1 protein_id gnl|my_center|LOCUS_32480 26973 27227 gene locus_tag LOCUS_32490 26973 27227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 27366 28235 gene locus_tag LOCUS_32500 gene rpoH 27366 28235 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207206.1 protein_id gnl|my_center|LOCUS_32500 28393 28758 gene locus_tag LOCUS_32510 28393 28758 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_32510 28809 29006 gene locus_tag LOCUS_32520 gene thiS 28809 29006 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115323.1 protein_id gnl|my_center|LOCUS_32520 29021 29821 gene locus_tag LOCUS_32530 29021 29821 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154366.1 protein_id gnl|my_center|LOCUS_32530 30323 30973 gene locus_tag LOCUS_32540 30323 30973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 30973 31671 gene locus_tag LOCUS_32550 30973 31671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 31762 32472 gene locus_tag LOCUS_32560 31762 32472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 32829 32515 gene locus_tag LOCUS_32570 32829 32515 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207800.1 protein_id gnl|my_center|LOCUS_32570 33455 32874 gene locus_tag LOCUS_32580 33455 32874 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207799.1 protein_id gnl|my_center|LOCUS_32580 34275 33664 gene locus_tag LOCUS_32590 34275 33664 CDS product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121577.1 protein_id gnl|my_center|LOCUS_32590 34492 35958 gene locus_tag LOCUS_32600 34492 35958 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206973.1 protein_id gnl|my_center|LOCUS_32600 36204 36896 gene locus_tag LOCUS_32610 36204 36896 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_32610 36935 38785 gene locus_tag LOCUS_32620 36935 38785 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811551.1 protein_id gnl|my_center|LOCUS_32620 41292 38839 gene locus_tag LOCUS_32630 41292 38839 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206202.1 protein_id gnl|my_center|LOCUS_32630 43168 41522 gene locus_tag LOCUS_32640 43168 41522 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_32640 44566 43433 gene locus_tag LOCUS_32650 44566 43433 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_32650 45549 44779 gene locus_tag LOCUS_32660 45549 44779 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207124.1 protein_id gnl|my_center|LOCUS_32660 45740 46777 gene locus_tag LOCUS_32670 45740 46777 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207125.1 protein_id gnl|my_center|LOCUS_32670 47015 47362 gene locus_tag LOCUS_32680 47015 47362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence36 <1 1089 gene locus_tag LOCUS_32690 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206344.1:type VI secretion system Vgr family protein 1099 2511 gene locus_tag LOCUS_32700 1099 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3680 4102 gene locus_tag LOCUS_32710 3680 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 5365 4274 gene locus_tag LOCUS_32720 gene ychF 5365 4274 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 protein_id gnl|my_center|LOCUS_32720 6298 5639 gene locus_tag LOCUS_32730 6298 5639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069679.1 protein_id gnl|my_center|LOCUS_32730 7349 6279 gene locus_tag LOCUS_32740 7349 6279 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206534.1 protein_id gnl|my_center|LOCUS_32740 8197 7361 gene locus_tag LOCUS_32750 8197 7361 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206535.1 protein_id gnl|my_center|LOCUS_32750 9089 8208 gene locus_tag LOCUS_32760 9089 8208 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206536.1 protein_id gnl|my_center|LOCUS_32760 10562 9129 gene locus_tag LOCUS_32770 10562 9129 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206537.1 protein_id gnl|my_center|LOCUS_32770 11794 10562 gene locus_tag LOCUS_32780 11794 10562 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206538.1 protein_id gnl|my_center|LOCUS_32780 13034 11829 gene locus_tag LOCUS_32790 13034 11829 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206539.1 protein_id gnl|my_center|LOCUS_32790 13432 14196 gene locus_tag LOCUS_32800 13432 14196 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_32800 14266 14640 gene locus_tag LOCUS_32810 14266 14640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073636.1 protein_id gnl|my_center|LOCUS_32810 14710 15930 gene locus_tag LOCUS_32820 14710 15930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 16098 16367 gene locus_tag LOCUS_32830 16098 16367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 16661 16461 gene locus_tag LOCUS_32840 16661 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 16726 19365 gene locus_tag LOCUS_32850 16726 19365 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068571.1 protein_id gnl|my_center|LOCUS_32850 19438 21600 gene locus_tag LOCUS_32860 19438 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 22226 21792 gene locus_tag LOCUS_32870 22226 21792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 22358 22693 gene locus_tag LOCUS_32880 22358 22693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 24675 23032 gene locus_tag LOCUS_32890 gene mqo 24675 23032 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206017.1 protein_id gnl|my_center|LOCUS_32890 25481 24996 gene locus_tag LOCUS_32900 25481 24996 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206234.1 protein_id gnl|my_center|LOCUS_32900 25943 26926 gene locus_tag LOCUS_32910 25943 26926 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_32910 27001 28032 gene locus_tag LOCUS_32920 27001 28032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 28454 29254 gene locus_tag LOCUS_32930 28454 29254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 29716 30729 gene locus_tag LOCUS_32940 29716 30729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 31678 30770 gene locus_tag LOCUS_32950 31678 30770 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837168.1 protein_id gnl|my_center|LOCUS_32950 32616 32158 gene locus_tag LOCUS_32960 32616 32158 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207103.1 protein_id gnl|my_center|LOCUS_32960 33184 32726 gene locus_tag LOCUS_32970 33184 32726 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207183.1 protein_id gnl|my_center|LOCUS_32970 33289 34197 gene locus_tag LOCUS_32980 33289 34197 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207182.1 protein_id gnl|my_center|LOCUS_32980 34302 35024 gene locus_tag LOCUS_32990 34302 35024 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207102.1 protein_id gnl|my_center|LOCUS_32990 35893 35450 gene locus_tag LOCUS_33000 35893 35450 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122286.1 protein_id gnl|my_center|LOCUS_33000 36301 35990 gene locus_tag LOCUS_33010 36301 35990 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068595.1 protein_id gnl|my_center|LOCUS_33010 37287 36409 gene locus_tag LOCUS_33020 37287 36409 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207101.1 protein_id gnl|my_center|LOCUS_33020 37471 37935 gene locus_tag LOCUS_33030 gene tsaE 37471 37935 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207100.1 protein_id gnl|my_center|LOCUS_33030 38000 40036 gene locus_tag LOCUS_33040 gene mutL 38000 40036 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207099.1 protein_id gnl|my_center|LOCUS_33040 40043 40987 gene locus_tag LOCUS_33050 gene miaA 40043 40987 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207098.1 protein_id gnl|my_center|LOCUS_33050 41080 41592 gene locus_tag LOCUS_33060 41080 41592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence37 362 769 gene locus_tag LOCUS_33070 362 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 774 1991 gene locus_tag LOCUS_33080 774 1991 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207695.1 protein_id gnl|my_center|LOCUS_33080 2008 2487 gene locus_tag LOCUS_33090 2008 2487 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117846.1 protein_id gnl|my_center|LOCUS_33090 2704 2628 gene locus_tag LOCUS_t00480 2704 2628 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2803 2728 gene locus_tag LOCUS_t00490 2803 2728 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2921 2845 gene locus_tag LOCUS_t00500 2921 2845 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3042 2966 gene locus_tag LOCUS_t00510 3042 2966 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4262 3195 gene locus_tag LOCUS_33100 gene nadA 4262 3195 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115913.1 protein_id gnl|my_center|LOCUS_33100 5632 4412 gene locus_tag LOCUS_33110 gene argJ 5632 4412 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 protein_id gnl|my_center|LOCUS_33110 6164 5802 gene locus_tag LOCUS_33120 6164 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116535.1 protein_id gnl|my_center|LOCUS_33120 9023 6303 gene locus_tag LOCUS_33130 gene secA 9023 6303 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116195.1 protein_id gnl|my_center|LOCUS_33130 9355 9993 gene locus_tag LOCUS_33140 9355 9993 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_33140 10644 10171 gene locus_tag LOCUS_33150 gene lysM 10644 10171 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_33150 11169 10933 gene locus_tag LOCUS_33160 gene acpP 11169 10933 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279871.1 protein_id gnl|my_center|LOCUS_33160 11990 11256 gene locus_tag LOCUS_33170 gene fabG 11990 11256 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120395.1 protein_id gnl|my_center|LOCUS_33170 12973 11987 gene locus_tag LOCUS_33180 gene fabD 12973 11987 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120357.1 protein_id gnl|my_center|LOCUS_33180 13325 13140 gene locus_tag LOCUS_33190 gene rpmF 13325 13140 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290730.1 protein_id gnl|my_center|LOCUS_33190 13963 13400 gene locus_tag LOCUS_33200 13963 13400 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120393.1 protein_id gnl|my_center|LOCUS_33200 14061 14726 gene locus_tag LOCUS_33210 14061 14726 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205942.1 protein_id gnl|my_center|LOCUS_33210 14995 15612 gene locus_tag LOCUS_33220 14995 15612 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205941.1 protein_id gnl|my_center|LOCUS_33220 16492 15698 gene locus_tag LOCUS_33230 16492 15698 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762734.1 protein_id gnl|my_center|LOCUS_33230 17083 17811 gene locus_tag LOCUS_33240 17083 17811 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207607.1 protein_id gnl|my_center|LOCUS_33240 17814 18410 gene locus_tag LOCUS_33250 17814 18410 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207608.1 protein_id gnl|my_center|LOCUS_33250 19432 18434 gene locus_tag LOCUS_33260 19432 18434 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207609.1 protein_id gnl|my_center|LOCUS_33260 20718 19429 gene locus_tag LOCUS_33270 gene folC 20718 19429 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207610.1 protein_id gnl|my_center|LOCUS_33270 21611 20715 gene locus_tag LOCUS_33280 gene accD 21611 20715 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804699.1 protein_id gnl|my_center|LOCUS_33280 22411 21608 gene locus_tag LOCUS_33290 gene trpA 22411 21608 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207611.1 protein_id gnl|my_center|LOCUS_33290 22834 24159 gene locus_tag LOCUS_33300 22834 24159 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464256.1 protein_id gnl|my_center|LOCUS_33300 25269 24235 gene locus_tag LOCUS_33310 25269 24235 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207612.1 protein_id gnl|my_center|LOCUS_33310 25424 26299 gene locus_tag LOCUS_33320 25424 26299 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_33320 26349 27224 gene locus_tag LOCUS_33330 26349 27224 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_33330 28350 27355 gene locus_tag LOCUS_33340 28350 27355 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207614.1 protein_id gnl|my_center|LOCUS_33340 30701 28569 gene locus_tag LOCUS_33350 30701 28569 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_33350 31918 30713 gene locus_tag LOCUS_33360 31918 30713 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_33360 32621 32127 gene locus_tag LOCUS_33370 32621 32127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 33228 32704 gene locus_tag LOCUS_33380 33228 32704 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089295.1 protein_id gnl|my_center|LOCUS_33380 33794 33321 gene locus_tag LOCUS_33390 33794 33321 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 protein_id gnl|my_center|LOCUS_33390 34945 33935 gene locus_tag LOCUS_33400 34945 33935 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_33400 35157 36275 gene locus_tag LOCUS_33410 35157 36275 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207596.1 protein_id gnl|my_center|LOCUS_33410 36687 37940 gene locus_tag LOCUS_33420 36687 37940 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207595.1 protein_id gnl|my_center|LOCUS_33420 38090 40477 gene locus_tag LOCUS_33430 38090 40477 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207594.1 protein_id gnl|my_center|LOCUS_33430 40954 40550 gene locus_tag LOCUS_33440 40954 40550 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070816.1 protein_id gnl|my_center|LOCUS_33440 42152 40983 gene locus_tag LOCUS_33450 42152 40983 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207673.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence38 1361 405 gene locus_tag LOCUS_33460 1361 405 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 protein_id gnl|my_center|LOCUS_33460 1632 3242 gene locus_tag LOCUS_33470 gene rtcR 1632 3242 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_33470 3916 3284 gene locus_tag LOCUS_33480 3916 3284 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207209.1 protein_id gnl|my_center|LOCUS_33480 4042 4821 gene locus_tag LOCUS_33490 gene yaaA 4042 4821 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207208.1 protein_id gnl|my_center|LOCUS_33490 5431 4853 gene locus_tag LOCUS_33500 5431 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688872.1 protein_id gnl|my_center|LOCUS_33500 5474 6133 gene locus_tag LOCUS_33510 5474 6133 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 protein_id gnl|my_center|LOCUS_33510 6254 6910 gene locus_tag LOCUS_33520 6254 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 7382 6945 gene locus_tag LOCUS_33530 7382 6945 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 protein_id gnl|my_center|LOCUS_33530 7727 7482 gene locus_tag LOCUS_33540 7727 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 7907 8323 gene locus_tag LOCUS_33550 7907 8323 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971509.1 protein_id gnl|my_center|LOCUS_33550 10427 8415 gene locus_tag LOCUS_33560 10427 8415 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206519.1 protein_id gnl|my_center|LOCUS_33560 11457 10531 gene locus_tag LOCUS_33570 11457 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206520.1 protein_id gnl|my_center|LOCUS_33570 12516 11692 gene locus_tag LOCUS_33580 gene cysE 12516 11692 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206521.1 protein_id gnl|my_center|LOCUS_33580 13349 12516 gene locus_tag LOCUS_33590 13349 12516 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206522.1 protein_id gnl|my_center|LOCUS_33590 16961 13389 gene locus_tag LOCUS_33600 gene dnaE 16961 13389 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206523.1 protein_id gnl|my_center|LOCUS_33600 18153 17281 gene locus_tag LOCUS_33610 18153 17281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115248.1 protein_id gnl|my_center|LOCUS_33610 18353 19864 gene locus_tag LOCUS_33620 18353 19864 CDS product DUF3336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_33620 19861 20673 gene locus_tag LOCUS_33630 19861 20673 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207194.1 protein_id gnl|my_center|LOCUS_33630 20782 20866 gene locus_tag LOCUS_t00520 20782 20866 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20908 20981 gene locus_tag LOCUS_t00530 20908 20981 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 21019 21103 gene locus_tag LOCUS_t00540 21019 21103 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21449 21246 gene locus_tag LOCUS_33640 21449 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119766.1 protein_id gnl|my_center|LOCUS_33640 22042 21848 gene locus_tag LOCUS_33650 22042 21848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 23267 22536 gene locus_tag LOCUS_33660 gene gloB 23267 22536 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207149.1 protein_id gnl|my_center|LOCUS_33660 24091 23462 gene locus_tag LOCUS_33670 24091 23462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 24946 24251 gene locus_tag LOCUS_33680 24946 24251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207148.1 protein_id gnl|my_center|LOCUS_33680 25968 24943 gene locus_tag LOCUS_33690 25968 24943 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119636.1 protein_id gnl|my_center|LOCUS_33690 26916 26044 gene locus_tag LOCUS_33700 26916 26044 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207147.1 protein_id gnl|my_center|LOCUS_33700 27629 28249 gene locus_tag LOCUS_33710 27629 28249 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208208.1 protein_id gnl|my_center|LOCUS_33710 29690 28407 gene locus_tag LOCUS_33720 gene purD 29690 28407 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207146.1 protein_id gnl|my_center|LOCUS_33720 31401 29827 gene locus_tag LOCUS_33730 gene purH 31401 29827 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207145.1 protein_id gnl|my_center|LOCUS_33730 31765 31496 gene locus_tag LOCUS_33740 gene fis 31765 31496 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000816.1 protein_id gnl|my_center|LOCUS_33740 32997 32140 gene locus_tag LOCUS_33750 32997 32140 CDS product zinc-ribbon and DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207144.1 protein_id gnl|my_center|LOCUS_33750 33921 33019 gene locus_tag LOCUS_33760 gene prmA 33921 33019 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119634.1 protein_id gnl|my_center|LOCUS_33760 34924 34046 gene locus_tag LOCUS_33770 34924 34046 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206870.1 protein_id gnl|my_center|LOCUS_33770 35844 35419 gene locus_tag LOCUS_33780 35844 35419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 36098 37978 gene locus_tag LOCUS_33790 gene mnmG 36098 37978 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207143.1 protein_id gnl|my_center|LOCUS_33790 38105 39049 gene locus_tag LOCUS_33800 38105 39049 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140115.1 protein_id gnl|my_center|LOCUS_33800 >Feature sequence39 773 222 gene locus_tag LOCUS_33810 773 222 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206183.1 protein_id gnl|my_center|LOCUS_33810 995 1375 gene locus_tag LOCUS_33820 995 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206184.1 protein_id gnl|my_center|LOCUS_33820 1433 2002 gene locus_tag LOCUS_33830 gene rnhB 1433 2002 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163155.1 protein_id gnl|my_center|LOCUS_33830 2333 2082 gene locus_tag LOCUS_33840 gene csrA 2333 2082 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906487.1 protein_id gnl|my_center|LOCUS_33840 3857 2577 gene locus_tag LOCUS_33850 3857 2577 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115333.1 protein_id gnl|my_center|LOCUS_33850 6614 3921 gene locus_tag LOCUS_33860 gene alaS 6614 3921 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206185.1 protein_id gnl|my_center|LOCUS_33860 7636 6860 gene locus_tag LOCUS_33870 7636 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 8379 7666 gene locus_tag LOCUS_33880 8379 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 8622 9644 gene locus_tag LOCUS_33890 8622 9644 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 protein_id gnl|my_center|LOCUS_33890 9764 10060 gene locus_tag LOCUS_33900 9764 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 10418 10119 gene locus_tag LOCUS_33910 10418 10119 CDS product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522986.1 protein_id gnl|my_center|LOCUS_33910 11158 10415 gene locus_tag LOCUS_33920 11158 10415 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530159.1 protein_id gnl|my_center|LOCUS_33920 11308 11769 gene locus_tag LOCUS_33930 11308 11769 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 protein_id gnl|my_center|LOCUS_33930 12339 11773 gene locus_tag LOCUS_33940 12339 11773 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111523.1 protein_id gnl|my_center|LOCUS_33940 12784 12380 gene locus_tag LOCUS_33950 12784 12380 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207916.1 protein_id gnl|my_center|LOCUS_33950 12906 13448 gene locus_tag LOCUS_33960 12906 13448 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207917.1 protein_id gnl|my_center|LOCUS_33960 14024 13515 gene locus_tag LOCUS_33970 14024 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 14339 15505 gene locus_tag LOCUS_33980 14339 15505 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206187.1 protein_id gnl|my_center|LOCUS_33980 15576 16895 gene locus_tag LOCUS_33990 15576 16895 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121613.1 protein_id gnl|my_center|LOCUS_33990 17071 17862 gene locus_tag LOCUS_34000 17071 17862 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121572.1 protein_id gnl|my_center|LOCUS_34000 18004 18309 gene locus_tag LOCUS_34010 18004 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121533.1 protein_id gnl|my_center|LOCUS_34010 18422 19207 gene locus_tag LOCUS_34020 18422 19207 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121572.1 protein_id gnl|my_center|LOCUS_34020 20369 19320 gene locus_tag LOCUS_34030 20369 19320 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206188.1 protein_id gnl|my_center|LOCUS_34030 21400 20690 gene locus_tag LOCUS_34040 gene crp 21400 20690 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070320.1 protein_id gnl|my_center|LOCUS_34040 21552 21974 gene locus_tag LOCUS_34050 21552 21974 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_34050 22918 22154 gene locus_tag LOCUS_34060 22918 22154 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206191.1 protein_id gnl|my_center|LOCUS_34060 25178 23229 gene locus_tag LOCUS_34070 25178 23229 CDS product family 2A encapsulin nanocompartment cargo protein cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206474.1 protein_id gnl|my_center|LOCUS_34070 26085 25153 gene locus_tag LOCUS_34080 26085 25153 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_34080 26721 26233 gene locus_tag LOCUS_34090 26721 26233 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206476.1 protein_id gnl|my_center|LOCUS_34090 26995 27903 gene locus_tag LOCUS_34100 26995 27903 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206475.1 protein_id gnl|my_center|LOCUS_34100 29460 28360 gene locus_tag LOCUS_34110 29460 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 29769 32348 gene locus_tag LOCUS_34120 gene clpB 29769 32348 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070314.1 protein_id gnl|my_center|LOCUS_34120 33597 32515 gene locus_tag LOCUS_34130 33597 32515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 34700 33570 gene locus_tag LOCUS_34140 34700 33570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 34929 34729 gene locus_tag LOCUS_34150 34929 34729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 35441 35905 gene locus_tag LOCUS_34160 35441 35905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 38121 35917 gene locus_tag LOCUS_34170 gene rlmKL 38121 35917 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206194.1 protein_id gnl|my_center|LOCUS_34170 38352 38933 gene locus_tag LOCUS_34180 38352 38933 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207872.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence40 <1 746 gene locus_tag LOCUS_34190 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206344.1:type VI secretion system Vgr family protein 748 1296 gene locus_tag LOCUS_34200 748 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 1296 1901 gene locus_tag LOCUS_34210 1296 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 1903 3351 gene locus_tag LOCUS_34220 1903 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 3359 4036 gene locus_tag LOCUS_34230 3359 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 4248 4853 gene locus_tag LOCUS_34240 4248 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 4874 5143 gene locus_tag LOCUS_34250 4874 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 5140 5595 gene locus_tag LOCUS_34260 5140 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 5630 6319 gene locus_tag LOCUS_34270 5630 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 6377 7093 gene locus_tag LOCUS_34280 6377 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 7071 7796 gene locus_tag LOCUS_34290 7071 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 7824 8417 gene locus_tag LOCUS_34300 7824 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 8490 9167 gene locus_tag LOCUS_34310 8490 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 9164 9718 gene locus_tag LOCUS_34320 9164 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 9755 10132 gene locus_tag LOCUS_34330 9755 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 11047 10121 gene locus_tag LOCUS_34340 11047 10121 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205925.1 protein_id gnl|my_center|LOCUS_34340 12152 11343 gene locus_tag LOCUS_34350 12152 11343 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_34350 12297 13703 gene locus_tag LOCUS_34360 gene ffh 12297 13703 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120334.1 protein_id gnl|my_center|LOCUS_34360 13837 14406 gene locus_tag LOCUS_34370 13837 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 15088 14447 gene locus_tag LOCUS_34380 15088 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 15964 15233 gene locus_tag LOCUS_34390 15964 15233 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071015.1 protein_id gnl|my_center|LOCUS_34390 16819 16064 gene locus_tag LOCUS_34400 16819 16064 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205928.1 protein_id gnl|my_center|LOCUS_34400 16850 17653 gene locus_tag LOCUS_34410 16850 17653 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205929.1 protein_id gnl|my_center|LOCUS_34410 17821 18516 gene locus_tag LOCUS_34420 17821 18516 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120391.1 protein_id gnl|my_center|LOCUS_34420 18530 21982 gene locus_tag LOCUS_34430 gene smc 18530 21982 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205930.1 protein_id gnl|my_center|LOCUS_34430 21984 23021 gene locus_tag LOCUS_34440 21984 23021 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205931.1 protein_id gnl|my_center|LOCUS_34440 23102 25132 gene locus_tag LOCUS_34450 gene ligA 23102 25132 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205932.1 protein_id gnl|my_center|LOCUS_34450 25269 25982 gene locus_tag LOCUS_34460 25269 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 26369 28516 gene locus_tag LOCUS_34470 26369 28516 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209600593.1 protein_id gnl|my_center|LOCUS_34470 29683 28619 gene locus_tag LOCUS_34480 29683 28619 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_34480 30070 30534 gene locus_tag LOCUS_34490 gene bfr 30070 30534 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214863.1 protein_id gnl|my_center|LOCUS_34490 31221 30652 gene locus_tag LOCUS_34500 31221 30652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 31317 31679 gene locus_tag LOCUS_34510 31317 31679 CDS product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812206.1 protein_id gnl|my_center|LOCUS_34510 31860 32525 gene locus_tag LOCUS_34520 31860 32525 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205936.1 protein_id gnl|my_center|LOCUS_34520 32636 33955 gene locus_tag LOCUS_34530 gene bioA 32636 33955 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205937.1 protein_id gnl|my_center|LOCUS_34530 33952 35121 gene locus_tag LOCUS_34540 33952 35121 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205938.1 protein_id gnl|my_center|LOCUS_34540 35145 35933 gene locus_tag LOCUS_34550 gene bioC 35145 35933 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205939.1 protein_id gnl|my_center|LOCUS_34550 35930 36574 gene locus_tag LOCUS_34560 gene bioD 35930 36574 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205940.1 protein_id gnl|my_center|LOCUS_34560 36674 37132 gene locus_tag LOCUS_34570 36674 37132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 37371 37715 gene locus_tag LOCUS_34580 37371 37715 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_34580 38371 38835 gene locus_tag LOCUS_34590 38371 38835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence41 851 1204 gene locus_tag LOCUS_34600 851 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 1436 2116 gene locus_tag LOCUS_34610 1436 2116 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035648.1 protein_id gnl|my_center|LOCUS_34610 2396 2217 gene locus_tag LOCUS_34620 2396 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 3115 2873 gene locus_tag LOCUS_34630 3115 2873 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140127.1 protein_id gnl|my_center|LOCUS_34630 4060 3344 gene locus_tag LOCUS_34640 4060 3344 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207090.1 protein_id gnl|my_center|LOCUS_34640 4694 4140 gene locus_tag LOCUS_34650 4694 4140 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090825.1 protein_id gnl|my_center|LOCUS_34650 4784 5530 gene locus_tag LOCUS_34660 4784 5530 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_34660 5605 6198 gene locus_tag LOCUS_34670 5605 6198 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_34670 7321 6404 gene locus_tag LOCUS_34680 7321 6404 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_34680 7444 8331 gene locus_tag LOCUS_34690 7444 8331 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207505.1 protein_id gnl|my_center|LOCUS_34690 8391 8810 gene locus_tag LOCUS_34700 8391 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 8892 9230 gene locus_tag LOCUS_34710 8892 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216461.1 protein_id gnl|my_center|LOCUS_34710 10857 9346 gene locus_tag LOCUS_34720 10857 9346 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207086.1 protein_id gnl|my_center|LOCUS_34720 11216 12397 gene locus_tag LOCUS_34730 11216 12397 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119349.1 protein_id gnl|my_center|LOCUS_34730 13412 12450 gene locus_tag LOCUS_34740 13412 12450 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_34740 14347 13505 gene locus_tag LOCUS_34750 14347 13505 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208385.1 protein_id gnl|my_center|LOCUS_34750 15725 14553 gene locus_tag LOCUS_34760 15725 14553 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119340.1 protein_id gnl|my_center|LOCUS_34760 16398 17516 gene locus_tag LOCUS_34770 16398 17516 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207246.1 protein_id gnl|my_center|LOCUS_34770 18944 17664 gene locus_tag LOCUS_34780 18944 17664 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207047.1 protein_id gnl|my_center|LOCUS_34780 19003 19185 gene locus_tag LOCUS_34790 19003 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 19425 20816 gene locus_tag LOCUS_34800 19425 20816 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_34800 20998 21852 gene locus_tag LOCUS_34810 20998 21852 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207045.1 protein_id gnl|my_center|LOCUS_34810 21929 23191 gene locus_tag LOCUS_34820 21929 23191 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 protein_id gnl|my_center|LOCUS_34820 23790 23206 gene locus_tag LOCUS_34830 23790 23206 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207043.1 protein_id gnl|my_center|LOCUS_34830 23905 25392 gene locus_tag LOCUS_34840 gene amvA 23905 25392 CDS product multidrug efflux MFS transporter AmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207042.1 protein_id gnl|my_center|LOCUS_34840 25579 26316 gene locus_tag LOCUS_34850 25579 26316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 26384 28615 gene locus_tag LOCUS_34860 26384 28615 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207039.1 protein_id gnl|my_center|LOCUS_34860 29257 29976 gene locus_tag LOCUS_34870 29257 29976 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706774.1 protein_id gnl|my_center|LOCUS_34870 30472 30038 gene locus_tag LOCUS_34880 30472 30038 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207037.1 protein_id gnl|my_center|LOCUS_34880 31761 30955 gene locus_tag LOCUS_34890 31761 30955 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207246.1 protein_id gnl|my_center|LOCUS_34890 33627 32473 gene locus_tag LOCUS_34900 33627 32473 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207036.1 protein_id gnl|my_center|LOCUS_34900 33750 34262 gene locus_tag LOCUS_34910 33750 34262 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207034.1 protein_id gnl|my_center|LOCUS_34910 34293 35321 gene locus_tag LOCUS_34920 gene murB 34293 35321 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207033.1 protein_id gnl|my_center|LOCUS_34920 35336 36484 gene locus_tag LOCUS_34930 35336 36484 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207032.1 protein_id gnl|my_center|LOCUS_34930 36484 37512 gene locus_tag LOCUS_34940 36484 37512 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115207.1 protein_id gnl|my_center|LOCUS_34940 >Feature sequence42 2221 1652 gene locus_tag LOCUS_34950 2221 1652 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501183.1 protein_id gnl|my_center|LOCUS_34950 3077 2247 gene locus_tag LOCUS_34960 gene proC 3077 2247 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804294.1 protein_id gnl|my_center|LOCUS_34960 4333 3074 gene locus_tag LOCUS_34970 gene tilS 4333 3074 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208410.1 protein_id gnl|my_center|LOCUS_34970 5214 4390 gene locus_tag LOCUS_34980 5214 4390 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066304.1 protein_id gnl|my_center|LOCUS_34980 6842 5322 gene locus_tag LOCUS_34990 gene ppx 6842 5322 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208409.1 protein_id gnl|my_center|LOCUS_34990 7136 7462 gene locus_tag LOCUS_35000 gene trxA 7136 7462 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054512.1 protein_id gnl|my_center|LOCUS_35000 7807 9075 gene locus_tag LOCUS_35010 gene rho 7807 9075 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117304.1 protein_id gnl|my_center|LOCUS_35010 9458 9730 gene locus_tag LOCUS_35020 9458 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 10774 10478 gene locus_tag LOCUS_35030 10774 10478 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126166.1 protein_id gnl|my_center|LOCUS_35030 13152 10771 gene locus_tag LOCUS_35040 gene pheT 13152 10771 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208407.1 protein_id gnl|my_center|LOCUS_35040 14261 13281 gene locus_tag LOCUS_35050 gene pheS 14261 13281 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117277.1 protein_id gnl|my_center|LOCUS_35050 14479 15516 gene locus_tag LOCUS_35060 14479 15516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208406.1 protein_id gnl|my_center|LOCUS_35060 16108 15560 gene locus_tag LOCUS_35070 16108 15560 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_35070 16885 16355 gene locus_tag LOCUS_35080 16885 16355 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366428.1 protein_id gnl|my_center|LOCUS_35080 17173 16976 gene locus_tag LOCUS_35090 17173 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 17713 17297 gene locus_tag LOCUS_35100 17713 17297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818687.1 protein_id gnl|my_center|LOCUS_35100 18133 19002 gene locus_tag LOCUS_35110 18133 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 19406 19047 gene locus_tag LOCUS_35120 gene rplT 19406 19047 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124858.1 protein_id gnl|my_center|LOCUS_35120 19612 19418 gene locus_tag LOCUS_35130 gene rpmI 19612 19418 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054552.1 protein_id gnl|my_center|LOCUS_35130 19837 21087 gene locus_tag LOCUS_35140 gene nreB 19837 21087 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_35140 21222 22007 gene locus_tag LOCUS_35150 21222 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 22111 22761 gene locus_tag LOCUS_35160 22111 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 23183 22758 gene locus_tag LOCUS_35170 23183 22758 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 protein_id gnl|my_center|LOCUS_35170 23646 23188 gene locus_tag LOCUS_35180 23646 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 23930 23643 gene locus_tag LOCUS_35190 23930 23643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 24630 24013 gene locus_tag LOCUS_35200 24630 24013 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208403.1 protein_id gnl|my_center|LOCUS_35200 25144 24827 gene locus_tag LOCUS_35210 25144 24827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207835.1 protein_id gnl|my_center|LOCUS_35210 25701 25231 gene locus_tag LOCUS_35220 25701 25231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 27710 25788 gene locus_tag LOCUS_35230 gene thrS 27710 25788 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117224.1 protein_id gnl|my_center|LOCUS_35230 27967 29025 gene locus_tag LOCUS_35240 27967 29025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 30241 29081 gene locus_tag LOCUS_35250 30241 29081 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_35250 31601 30327 gene locus_tag LOCUS_35260 31601 30327 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_35260 33380 31614 gene locus_tag LOCUS_35270 33380 31614 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 protein_id gnl|my_center|LOCUS_35270 33503 34552 gene locus_tag LOCUS_35280 33503 34552 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444337.1 protein_id gnl|my_center|LOCUS_35280 34786 36432 gene locus_tag LOCUS_35290 34786 36432 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208402.1 protein_id gnl|my_center|LOCUS_35290 36579 37124 gene locus_tag LOCUS_35300 36579 37124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence43 1017 187 gene locus_tag LOCUS_35310 1017 187 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207330.1 protein_id gnl|my_center|LOCUS_35310 1205 1552 gene locus_tag LOCUS_35320 1205 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 1741 2541 gene locus_tag LOCUS_35330 1741 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 3995 2604 gene locus_tag LOCUS_35340 3995 2604 CDS product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207331.1 protein_id gnl|my_center|LOCUS_35340 4191 4775 gene locus_tag LOCUS_35350 4191 4775 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207122.1 protein_id gnl|my_center|LOCUS_35350 5088 6116 gene locus_tag LOCUS_35360 5088 6116 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207333.1 protein_id gnl|my_center|LOCUS_35360 6275 7633 gene locus_tag LOCUS_35370 6275 7633 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066765.1 protein_id gnl|my_center|LOCUS_35370 8943 7702 gene locus_tag LOCUS_35380 8943 7702 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207259.1 protein_id gnl|my_center|LOCUS_35380 10005 9127 gene locus_tag LOCUS_35390 gene ubiA 10005 9127 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207260.1 protein_id gnl|my_center|LOCUS_35390 10520 10023 gene locus_tag LOCUS_35400 10520 10023 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207261.1 protein_id gnl|my_center|LOCUS_35400 10798 12330 gene locus_tag LOCUS_35410 10798 12330 CDS product mucoidy inhibitor MuiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 protein_id gnl|my_center|LOCUS_35410 12812 12408 gene locus_tag LOCUS_35420 gene rnk 12812 12408 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_35420 14295 13042 gene locus_tag LOCUS_35430 14295 13042 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_35430 15682 14456 gene locus_tag LOCUS_35440 15682 14456 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207237.1 protein_id gnl|my_center|LOCUS_35440 18058 16751 gene locus_tag LOCUS_35450 18058 16751 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207237.1 protein_id gnl|my_center|LOCUS_35450 18487 18660 gene locus_tag LOCUS_35460 18487 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 18605 19306 gene locus_tag LOCUS_35470 18605 19306 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118253.1 protein_id gnl|my_center|LOCUS_35470 19393 20088 gene locus_tag LOCUS_35480 19393 20088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207238.1 protein_id gnl|my_center|LOCUS_35480 20552 20842 gene locus_tag LOCUS_35490 20552 20842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 21199 20972 gene locus_tag LOCUS_35500 21199 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 22490 22311 gene locus_tag LOCUS_35510 22490 22311 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528379.1 protein_id gnl|my_center|LOCUS_35510 23105 22749 gene locus_tag LOCUS_35520 23105 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 protein_id gnl|my_center|LOCUS_35520 23450 23872 gene locus_tag LOCUS_35530 23450 23872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 24858 24646 gene locus_tag LOCUS_35540 24858 24646 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093358.1 protein_id gnl|my_center|LOCUS_35540 25232 24855 gene locus_tag LOCUS_35550 25232 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105252.1 protein_id gnl|my_center|LOCUS_35550 25913 25533 gene locus_tag LOCUS_35560 25913 25533 CDS product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005973382.1 protein_id gnl|my_center|LOCUS_35560 26892 26737 gene locus_tag LOCUS_35570 26892 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 27838 27500 gene locus_tag LOCUS_35580 27838 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 28336 28055 gene locus_tag LOCUS_35590 28336 28055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 28501 29052 gene locus_tag LOCUS_35600 28501 29052 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207112.1 protein_id gnl|my_center|LOCUS_35600 30151 29558 gene locus_tag LOCUS_35610 30151 29558 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617693.1 protein_id gnl|my_center|LOCUS_35610 30487 30675 gene locus_tag LOCUS_35620 30487 30675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 31069 30839 gene locus_tag LOCUS_35630 31069 30839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 31563 31366 gene locus_tag LOCUS_35640 31563 31366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 31975 31900 gene locus_tag LOCUS_t00550 31975 31900 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32163 33098 gene locus_tag LOCUS_35650 32163 33098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118101.1 protein_id gnl|my_center|LOCUS_35650 33095 33868 gene locus_tag LOCUS_35660 33095 33868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118099.1 protein_id gnl|my_center|LOCUS_35660 33868 34692 gene locus_tag LOCUS_35670 gene queF 33868 34692 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207239.1 protein_id gnl|my_center|LOCUS_35670 34710 35360 gene locus_tag LOCUS_35680 34710 35360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118229.1 protein_id gnl|my_center|LOCUS_35680 >Feature sequence44 2304 988 gene locus_tag LOCUS_35690 2304 988 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206586.1 protein_id gnl|my_center|LOCUS_35690 4769 2304 gene locus_tag LOCUS_35700 4769 2304 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206587.1 protein_id gnl|my_center|LOCUS_35700 4889 5905 gene locus_tag LOCUS_35710 4889 5905 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206588.1 protein_id gnl|my_center|LOCUS_35710 5902 6591 gene locus_tag LOCUS_35720 5902 6591 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_35720 6678 7310 gene locus_tag LOCUS_35730 gene rsmG 6678 7310 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121443.1 protein_id gnl|my_center|LOCUS_35730 7335 8117 gene locus_tag LOCUS_35740 7335 8117 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121458.1 protein_id gnl|my_center|LOCUS_35740 8114 9004 gene locus_tag LOCUS_35750 8114 9004 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206589.1 protein_id gnl|my_center|LOCUS_35750 9039 9671 gene locus_tag LOCUS_35760 9039 9671 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_35760 9692 10114 gene locus_tag LOCUS_35770 9692 10114 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_35770 10118 11848 gene locus_tag LOCUS_35780 gene msbA 10118 11848 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206591.1 protein_id gnl|my_center|LOCUS_35780 11852 12868 gene locus_tag LOCUS_35790 gene lpxK 11852 12868 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206592.1 protein_id gnl|my_center|LOCUS_35790 12873 13634 gene locus_tag LOCUS_35800 gene kdsB 12873 13634 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206593.1 protein_id gnl|my_center|LOCUS_35800 13673 14653 gene locus_tag LOCUS_35810 13673 14653 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206594.1 protein_id gnl|my_center|LOCUS_35810 14680 15021 gene locus_tag LOCUS_35820 14680 15021 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121335.1 protein_id gnl|my_center|LOCUS_35820 15049 15822 gene locus_tag LOCUS_35830 15049 15822 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069538.1 protein_id gnl|my_center|LOCUS_35830 15907 16521 gene locus_tag LOCUS_35840 15907 16521 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206595.1 protein_id gnl|my_center|LOCUS_35840 16527 17093 gene locus_tag LOCUS_35850 16527 17093 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206596.1 protein_id gnl|my_center|LOCUS_35850 17080 17463 gene locus_tag LOCUS_35860 gene gspI 17080 17463 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121425.1 protein_id gnl|my_center|LOCUS_35860 17466 18119 gene locus_tag LOCUS_35870 gene gspJ 17466 18119 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206597.1 protein_id gnl|my_center|LOCUS_35870 18112 19083 gene locus_tag LOCUS_35880 gene gspK 18112 19083 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_35880 19309 19905 gene locus_tag LOCUS_35890 19309 19905 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 protein_id gnl|my_center|LOCUS_35890 19980 20693 gene locus_tag LOCUS_35900 gene ung 19980 20693 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206598.1 protein_id gnl|my_center|LOCUS_35900 20690 21811 gene locus_tag LOCUS_35910 20690 21811 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206599.1 protein_id gnl|my_center|LOCUS_35910 21818 22342 gene locus_tag LOCUS_35920 gene tadA 21818 22342 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121378.1 protein_id gnl|my_center|LOCUS_35920 22429 22863 gene locus_tag LOCUS_35930 22429 22863 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206600.1 protein_id gnl|my_center|LOCUS_35930 22875 23564 gene locus_tag LOCUS_35940 gene cmk 22875 23564 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206601.1 protein_id gnl|my_center|LOCUS_35940 23683 25359 gene locus_tag LOCUS_35950 gene rpsA 23683 25359 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121348.1 protein_id gnl|my_center|LOCUS_35950 25519 25821 gene locus_tag LOCUS_35960 25519 25821 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121337.1 protein_id gnl|my_center|LOCUS_35960 25843 26208 gene locus_tag LOCUS_35970 25843 26208 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121360.1 protein_id gnl|my_center|LOCUS_35970 26611 26294 gene locus_tag LOCUS_35980 26611 26294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 27275 26613 gene locus_tag LOCUS_35990 27275 26613 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099346.1 protein_id gnl|my_center|LOCUS_35990 27393 27941 gene locus_tag LOCUS_36000 27393 27941 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117406.1 protein_id gnl|my_center|LOCUS_36000 28045 28725 gene locus_tag LOCUS_36010 gene pyrF 28045 28725 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069518.1 protein_id gnl|my_center|LOCUS_36010 29739 28831 gene locus_tag LOCUS_36020 29739 28831 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206602.1 protein_id gnl|my_center|LOCUS_36020 31343 29826 gene locus_tag LOCUS_36030 31343 29826 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206603.1 protein_id gnl|my_center|LOCUS_36030 31498 32508 gene locus_tag LOCUS_36040 31498 32508 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206604.1 protein_id gnl|my_center|LOCUS_36040 32617 33771 gene locus_tag LOCUS_36050 gene zapE 32617 33771 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117902.1 protein_id gnl|my_center|LOCUS_36050 >Feature sequence45 632 2533 gene locus_tag LOCUS_36060 632 2533 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 protein_id gnl|my_center|LOCUS_36060 2727 4508 gene locus_tag LOCUS_36070 2727 4508 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116088.1 protein_id gnl|my_center|LOCUS_36070 4919 4575 gene locus_tag LOCUS_36080 4919 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 5280 5774 gene locus_tag LOCUS_36090 5280 5774 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116490.1 protein_id gnl|my_center|LOCUS_36090 6434 5937 gene locus_tag LOCUS_36100 6434 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 6602 7048 gene locus_tag LOCUS_36110 6602 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116392.1 protein_id gnl|my_center|LOCUS_36110 8469 7075 gene locus_tag LOCUS_36120 8469 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 10018 8549 gene locus_tag LOCUS_36130 10018 8549 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_36130 12268 10166 gene locus_tag LOCUS_36140 gene znuD 12268 10166 CDS product zinc piracy TonB-dependent receptor ZnuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_36140 12404 13174 gene locus_tag LOCUS_36150 12404 13174 CDS product DUF4184 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207629.1 protein_id gnl|my_center|LOCUS_36150 13424 15211 gene locus_tag LOCUS_36160 gene aspS 13424 15211 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207630.1 protein_id gnl|my_center|LOCUS_36160 15350 15568 gene locus_tag LOCUS_36170 15350 15568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207632.1 protein_id gnl|my_center|LOCUS_36170 15579 16442 gene locus_tag LOCUS_36180 15579 16442 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_36180 16511 17575 gene locus_tag LOCUS_36190 16511 17575 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963749.1 protein_id gnl|my_center|LOCUS_36190 17698 18603 gene locus_tag LOCUS_36200 17698 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 18707 19612 gene locus_tag LOCUS_36210 18707 19612 CDS product sugar glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703799.1 protein_id gnl|my_center|LOCUS_36210 20553 19615 gene locus_tag LOCUS_36220 20553 19615 CDS product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196337679.1 protein_id gnl|my_center|LOCUS_36220 21387 20629 gene locus_tag LOCUS_36230 21387 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 22384 21377 gene locus_tag LOCUS_36240 22384 21377 CDS product Stealth CR1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003607.1 protein_id gnl|my_center|LOCUS_36240 23195 22425 gene locus_tag LOCUS_36250 23195 22425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_36250 23431 24600 gene locus_tag LOCUS_36260 gene ugd 23431 24600 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 protein_id gnl|my_center|LOCUS_36260 24597 25619 gene locus_tag LOCUS_36270 24597 25619 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532735.1 protein_id gnl|my_center|LOCUS_36270 26636 25710 gene locus_tag LOCUS_36280 26636 25710 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705670.1 protein_id gnl|my_center|LOCUS_36280 29413 26663 gene locus_tag LOCUS_36290 gene glnE 29413 26663 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207642.1 protein_id gnl|my_center|LOCUS_36290 30844 29567 gene locus_tag LOCUS_36300 30844 29567 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207643.1 protein_id gnl|my_center|LOCUS_36300 >Feature sequence46 2443 2706 gene locus_tag LOCUS_36310 2443 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 2714 3580 gene locus_tag LOCUS_36320 2714 3580 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207601.1 protein_id gnl|my_center|LOCUS_36320 3976 3593 gene locus_tag LOCUS_36330 3976 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 4531 3977 gene locus_tag LOCUS_36340 4531 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 5316 4657 gene locus_tag LOCUS_36350 5316 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 6221 5388 gene locus_tag LOCUS_36360 6221 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 6754 6323 gene locus_tag LOCUS_36370 6754 6323 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207602.1 protein_id gnl|my_center|LOCUS_36370 7190 7876 gene locus_tag LOCUS_36380 7190 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 9272 8025 gene locus_tag LOCUS_36390 9272 8025 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207603.1 protein_id gnl|my_center|LOCUS_36390 9374 10018 gene locus_tag LOCUS_36400 9374 10018 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207604.1 protein_id gnl|my_center|LOCUS_36400 10156 11466 gene locus_tag LOCUS_36410 10156 11466 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207605.1 protein_id gnl|my_center|LOCUS_36410 12723 12058 gene locus_tag LOCUS_36420 12723 12058 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208085.1 protein_id gnl|my_center|LOCUS_36420 14818 12878 gene locus_tag LOCUS_36430 14818 12878 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207705.1 protein_id gnl|my_center|LOCUS_36430 16011 15178 gene locus_tag LOCUS_36440 16011 15178 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207706.1 protein_id gnl|my_center|LOCUS_36440 17186 16029 gene locus_tag LOCUS_36450 17186 16029 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207707.1 protein_id gnl|my_center|LOCUS_36450 18899 17286 gene locus_tag LOCUS_36460 18899 17286 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207708.1 protein_id gnl|my_center|LOCUS_36460 19807 18896 gene locus_tag LOCUS_36470 19807 18896 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_36470 21686 19896 gene locus_tag LOCUS_36480 21686 19896 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 protein_id gnl|my_center|LOCUS_36480 21836 22453 gene locus_tag LOCUS_36490 21836 22453 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207711.1 protein_id gnl|my_center|LOCUS_36490 22543 22956 gene locus_tag LOCUS_36500 22543 22956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 23658 23263 gene locus_tag LOCUS_36510 23658 23263 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_36510 23885 23655 gene locus_tag LOCUS_36520 23885 23655 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_36520 25156 23987 gene locus_tag LOCUS_36530 25156 23987 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207712.1 protein_id gnl|my_center|LOCUS_36530 26394 25231 gene locus_tag LOCUS_36540 26394 25231 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207712.1 protein_id gnl|my_center|LOCUS_36540 26589 29945 gene locus_tag LOCUS_36550 26589 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 30600 30439 gene locus_tag LOCUS_36560 30600 30439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 31024 30590 gene locus_tag LOCUS_36570 31024 30590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 >Feature sequence47 <1 701 gene locus_tag LOCUS_36580 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206899.1:3-oxoadipyl-CoA thiolase 710 2068 gene locus_tag LOCUS_36590 710 2068 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206931.1 protein_id gnl|my_center|LOCUS_36590 2065 2844 gene locus_tag LOCUS_36600 gene pcaD 2065 2844 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206930.1 protein_id gnl|my_center|LOCUS_36600 2886 4238 gene locus_tag LOCUS_36610 2886 4238 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206929.1 protein_id gnl|my_center|LOCUS_36610 4270 4683 gene locus_tag LOCUS_36620 gene pcaC 4270 4683 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701356.1 protein_id gnl|my_center|LOCUS_36620 4694 5419 gene locus_tag LOCUS_36630 gene pcaH 4694 5419 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077913.1 protein_id gnl|my_center|LOCUS_36630 5431 6060 gene locus_tag LOCUS_36640 gene pcaG 5431 6060 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206928.1 protein_id gnl|my_center|LOCUS_36640 6236 7075 gene locus_tag LOCUS_36650 gene aroD 6236 7075 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206927.1 protein_id gnl|my_center|LOCUS_36650 7096 8556 gene locus_tag LOCUS_36660 7096 8556 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206926.1 protein_id gnl|my_center|LOCUS_36660 8573 9901 gene locus_tag LOCUS_36670 8573 9901 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206925.1 protein_id gnl|my_center|LOCUS_36670 9918 12341 gene locus_tag LOCUS_36680 9918 12341 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206924.1 protein_id gnl|my_center|LOCUS_36680 13044 13649 gene locus_tag LOCUS_36690 13044 13649 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206555.1 protein_id gnl|my_center|LOCUS_36690 13683 14393 gene locus_tag LOCUS_36700 13683 14393 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529635.1 protein_id gnl|my_center|LOCUS_36700 14454 16976 gene locus_tag LOCUS_36710 14454 16976 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206739.1 protein_id gnl|my_center|LOCUS_36710 17257 17120 gene locus_tag LOCUS_36720 17257 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 17370 18137 gene locus_tag LOCUS_36730 17370 18137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 19288 18389 gene locus_tag LOCUS_36740 19288 18389 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208464.1 protein_id gnl|my_center|LOCUS_36740 19765 19442 gene locus_tag LOCUS_36750 19765 19442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 20756 19863 gene locus_tag LOCUS_36760 20756 19863 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208464.1 protein_id gnl|my_center|LOCUS_36760 21386 21574 gene locus_tag LOCUS_36770 21386 21574 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383180.1 protein_id gnl|my_center|LOCUS_36770 21931 21635 gene locus_tag LOCUS_36780 21931 21635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36780 22294 22007 gene locus_tag LOCUS_36790 22294 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36790 22924 22463 gene locus_tag LOCUS_36800 gene cueR 22924 22463 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613681.1 protein_id gnl|my_center|LOCUS_36800 25425 22942 gene locus_tag LOCUS_36810 25425 22942 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206223.1 protein_id gnl|my_center|LOCUS_36810 26950 26069 gene locus_tag LOCUS_36820 26950 26069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 27384 27013 gene locus_tag LOCUS_36830 27384 27013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 >Feature sequence48 5729 645 gene locus_tag LOCUS_36840 5729 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077139241.1 protein_id gnl|my_center|LOCUS_36840 6158 5814 gene locus_tag LOCUS_36850 6158 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 6835 6260 gene locus_tag LOCUS_36860 6835 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 6975 7205 gene locus_tag LOCUS_36870 6975 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 7150 7341 gene locus_tag LOCUS_36880 7150 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 7811 7735 gene locus_tag LOCUS_t00560 7811 7735 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8386 9195 gene locus_tag LOCUS_36890 8386 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 9512 9730 gene locus_tag LOCUS_36900 9512 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 10073 9636 gene locus_tag LOCUS_36910 10073 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 10682 10092 gene locus_tag LOCUS_36920 10682 10092 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723214.1 protein_id gnl|my_center|LOCUS_36920 11615 10836 gene locus_tag LOCUS_36930 11615 10836 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_36930 12875 11616 gene locus_tag LOCUS_36940 12875 11616 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_36940 13538 13116 gene locus_tag LOCUS_36950 13538 13116 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090812.1 protein_id gnl|my_center|LOCUS_36950 13631 14539 gene locus_tag LOCUS_36960 13631 14539 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206546.1 protein_id gnl|my_center|LOCUS_36960 14694 15248 gene locus_tag LOCUS_36970 14694 15248 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207356.1 protein_id gnl|my_center|LOCUS_36970 15443 16159 gene locus_tag LOCUS_36980 gene trmB 15443 16159 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206201.1 protein_id gnl|my_center|LOCUS_36980 17072 16221 gene locus_tag LOCUS_36990 17072 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076457.1 protein_id gnl|my_center|LOCUS_36990 17228 18631 gene locus_tag LOCUS_37000 17228 18631 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206498.1 protein_id gnl|my_center|LOCUS_37000 18756 18917 gene locus_tag LOCUS_37010 18756 18917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 19736 18957 gene locus_tag LOCUS_37020 19736 18957 CDS product F420-dependent NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_37020 20880 19843 gene locus_tag LOCUS_37030 20880 19843 CDS product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208214.1 protein_id gnl|my_center|LOCUS_37030 22541 21003 gene locus_tag LOCUS_37040 22541 21003 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206198.1 protein_id gnl|my_center|LOCUS_37040 23964 22729 gene locus_tag LOCUS_37050 23964 22729 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206197.1 protein_id gnl|my_center|LOCUS_37050 24997 23981 gene locus_tag LOCUS_37060 24997 23981 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206196.1 protein_id gnl|my_center|LOCUS_37060 25630 25091 gene locus_tag LOCUS_37070 25630 25091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 26168 25809 gene locus_tag LOCUS_37080 26168 25809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206195.1 protein_id gnl|my_center|LOCUS_37080 26604 26302 gene locus_tag LOCUS_37090 26604 26302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 26857 26642 gene locus_tag LOCUS_37100 26857 26642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 >Feature sequence49 1028 252 gene locus_tag LOCUS_37110 1028 252 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207758.1 protein_id gnl|my_center|LOCUS_37110 1075 3120 gene locus_tag LOCUS_37120 gene recG 1075 3120 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078352.1 protein_id gnl|my_center|LOCUS_37120 3296 3937 gene locus_tag LOCUS_37130 3296 3937 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207759.1 protein_id gnl|my_center|LOCUS_37130 4381 3983 gene locus_tag LOCUS_37140 4381 3983 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207760.1 protein_id gnl|my_center|LOCUS_37140 5095 4499 gene locus_tag LOCUS_37150 5095 4499 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 protein_id gnl|my_center|LOCUS_37150 5254 6267 gene locus_tag LOCUS_37160 5254 6267 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116978.1 protein_id gnl|my_center|LOCUS_37160 6674 6387 gene locus_tag LOCUS_37170 6674 6387 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078357.1 protein_id gnl|my_center|LOCUS_37170 7332 6709 gene locus_tag LOCUS_37180 7332 6709 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207761.1 protein_id gnl|my_center|LOCUS_37180 8030 7353 gene locus_tag LOCUS_37190 8030 7353 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207762.1 protein_id gnl|my_center|LOCUS_37190 8809 8030 gene locus_tag LOCUS_37200 gene mlaE 8809 8030 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117010.1 protein_id gnl|my_center|LOCUS_37200 9624 8806 gene locus_tag LOCUS_37210 9624 8806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207763.1 protein_id gnl|my_center|LOCUS_37210 11933 10053 gene locus_tag LOCUS_37220 11933 10053 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207765.1 protein_id gnl|my_center|LOCUS_37220 13231 12401 gene locus_tag LOCUS_37230 13231 12401 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207766.1 protein_id gnl|my_center|LOCUS_37230 15266 13362 gene locus_tag LOCUS_37240 gene dxs 15266 13362 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117085.1 protein_id gnl|my_center|LOCUS_37240 15572 16186 gene locus_tag LOCUS_37250 gene ribA 15572 16186 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116908.1 protein_id gnl|my_center|LOCUS_37250 17744 16380 gene locus_tag LOCUS_37260 gene hemN 17744 16380 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_37260 18021 18962 gene locus_tag LOCUS_37270 gene hemF 18021 18962 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207767.1 protein_id gnl|my_center|LOCUS_37270 19412 19221 gene locus_tag LOCUS_37280 19412 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 19564 20352 gene locus_tag LOCUS_37290 gene aroE 19564 20352 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207768.1 protein_id gnl|my_center|LOCUS_37290 22842 20458 gene locus_tag LOCUS_37300 22842 20458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207769.1 protein_id gnl|my_center|LOCUS_37300 23075 24898 gene locus_tag LOCUS_37310 23075 24898 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_37310 >Feature sequence50 149 619 gene locus_tag LOCUS_37320 149 619 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024691.1 protein_id gnl|my_center|LOCUS_37320 631 1167 gene locus_tag LOCUS_37330 631 1167 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114070.1 protein_id gnl|my_center|LOCUS_37330 1226 2770 gene locus_tag LOCUS_37340 gene atpA 1226 2770 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114049.1 protein_id gnl|my_center|LOCUS_37340 2859 3728 gene locus_tag LOCUS_37350 gene atpG 2859 3728 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114131.1 protein_id gnl|my_center|LOCUS_37350 3755 5149 gene locus_tag LOCUS_37360 gene atpD 3755 5149 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114045.1 protein_id gnl|my_center|LOCUS_37360 5177 5596 gene locus_tag LOCUS_37370 5177 5596 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114076.1 protein_id gnl|my_center|LOCUS_37370 6563 5787 gene locus_tag LOCUS_37380 6563 5787 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_37380 6657 6959 gene locus_tag LOCUS_37390 6657 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 7407 6964 gene locus_tag LOCUS_37400 7407 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 7502 7966 gene locus_tag LOCUS_37410 7502 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 8596 7988 gene locus_tag LOCUS_37420 8596 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208127.1 protein_id gnl|my_center|LOCUS_37420 9403 8858 gene locus_tag LOCUS_37430 9403 8858 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208128.1 protein_id gnl|my_center|LOCUS_37430 10080 9556 gene locus_tag LOCUS_37440 10080 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 11010 10264 gene locus_tag LOCUS_37450 11010 10264 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208129.1 protein_id gnl|my_center|LOCUS_37450 12266 11022 gene locus_tag LOCUS_37460 12266 11022 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072024.1 protein_id gnl|my_center|LOCUS_37460 12407 13051 gene locus_tag LOCUS_37470 12407 13051 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208130.1 protein_id gnl|my_center|LOCUS_37470 13208 14107 gene locus_tag LOCUS_37480 13208 14107 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208131.1 protein_id gnl|my_center|LOCUS_37480 15107 14538 gene locus_tag LOCUS_37490 15107 14538 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072030.1 protein_id gnl|my_center|LOCUS_37490 16282 15155 gene locus_tag LOCUS_37500 gene dprA 16282 15155 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208132.1 protein_id gnl|my_center|LOCUS_37500 17457 16306 gene locus_tag LOCUS_37510 17457 16306 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208133.1 protein_id gnl|my_center|LOCUS_37510 17581 18111 gene locus_tag LOCUS_37520 gene def 17581 18111 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 protein_id gnl|my_center|LOCUS_37520 18219 18683 gene locus_tag LOCUS_37530 18219 18683 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114087.1 protein_id gnl|my_center|LOCUS_37530 18767 20845 gene locus_tag LOCUS_37540 18767 20845 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208134.1 protein_id gnl|my_center|LOCUS_37540 20871 21113 gene locus_tag LOCUS_37550 20871 21113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072046.1 protein_id gnl|my_center|LOCUS_37550 21208 22377 gene locus_tag LOCUS_37560 21208 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 23613 22402 gene locus_tag LOCUS_37570 23613 22402 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208135.1 protein_id gnl|my_center|LOCUS_37570 23700 24326 gene locus_tag LOCUS_37580 23700 24326 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208136.1 protein_id gnl|my_center|LOCUS_37580 >Feature sequence51 592 38 gene locus_tag LOCUS_37590 gene frr 592 38 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115638.1 protein_id gnl|my_center|LOCUS_37590 1394 666 gene locus_tag LOCUS_37600 gene pyrH 1394 666 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852257.1 protein_id gnl|my_center|LOCUS_37600 2803 1460 gene locus_tag LOCUS_37610 gene rimO 2803 1460 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206991.1 protein_id gnl|my_center|LOCUS_37610 3167 4273 gene locus_tag LOCUS_37620 gene glnL 3167 4273 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115631.1 protein_id gnl|my_center|LOCUS_37620 4263 5747 gene locus_tag LOCUS_37630 gene glnG 4263 5747 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206993.1 protein_id gnl|my_center|LOCUS_37630 5866 6591 gene locus_tag LOCUS_37640 5866 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 7244 6645 gene locus_tag LOCUS_37650 7244 6645 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206652.1 protein_id gnl|my_center|LOCUS_37650 7841 7371 gene locus_tag LOCUS_37660 7841 7371 CDS product DUF6231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206651.1 protein_id gnl|my_center|LOCUS_37660 7874 8746 gene locus_tag LOCUS_37670 7874 8746 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206650.1 protein_id gnl|my_center|LOCUS_37670 10120 8945 gene locus_tag LOCUS_37680 gene lpxB 10120 8945 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206649.1 protein_id gnl|my_center|LOCUS_37680 10409 12529 gene locus_tag LOCUS_37690 10409 12529 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 protein_id gnl|my_center|LOCUS_37690 12590 12868 gene locus_tag LOCUS_37700 12590 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206647.1 protein_id gnl|my_center|LOCUS_37700 12872 14434 gene locus_tag LOCUS_37710 12872 14434 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206646.1 protein_id gnl|my_center|LOCUS_37710 14431 14718 gene locus_tag LOCUS_37720 14431 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 15017 16159 gene locus_tag LOCUS_37730 15017 16159 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_37730 16441 18318 gene locus_tag LOCUS_37740 16441 18318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206581.1 protein_id gnl|my_center|LOCUS_37740 18901 18419 gene locus_tag LOCUS_37750 18901 18419 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815617.1 protein_id gnl|my_center|LOCUS_37750 20247 19099 gene locus_tag LOCUS_37760 20247 19099 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206954.1 protein_id gnl|my_center|LOCUS_37760 23216 20277 gene locus_tag LOCUS_37770 23216 20277 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_37770 24209 23454 gene locus_tag LOCUS_37780 24209 23454 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706486.1 protein_id gnl|my_center|LOCUS_37780 >Feature sequence52 2043 1030 gene locus_tag LOCUS_37790 2043 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 2588 2055 gene locus_tag LOCUS_37800 2588 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 4353 3100 gene locus_tag LOCUS_37810 4353 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 4743 5339 gene locus_tag LOCUS_37820 4743 5339 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206095.1 protein_id gnl|my_center|LOCUS_37820 5463 5317 gene locus_tag LOCUS_37830 5463 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 5475 7904 gene locus_tag LOCUS_37840 gene lon 5475 7904 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117591.1 protein_id gnl|my_center|LOCUS_37840 8142 8519 gene locus_tag LOCUS_37850 8142 8519 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_37850 9153 8725 gene locus_tag LOCUS_37860 9153 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 10129 9284 gene locus_tag LOCUS_37870 gene dapF 10129 9284 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207416.1 protein_id gnl|my_center|LOCUS_37870 11387 10143 gene locus_tag LOCUS_37880 gene lysA 11387 10143 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207417.1 protein_id gnl|my_center|LOCUS_37880 11651 11421 gene locus_tag LOCUS_37890 11651 11421 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118887.1 protein_id gnl|my_center|LOCUS_37890 13201 11798 gene locus_tag LOCUS_37900 13201 11798 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207418.1 protein_id gnl|my_center|LOCUS_37900 13409 14869 gene locus_tag LOCUS_37910 gene radA 13409 14869 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073053.1 protein_id gnl|my_center|LOCUS_37910 15324 16319 gene locus_tag LOCUS_37920 15324 16319 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118912.1 protein_id gnl|my_center|LOCUS_37920 16521 16868 gene locus_tag LOCUS_37930 16521 16868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 18168 16993 gene locus_tag LOCUS_37940 18168 16993 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068179.1 protein_id gnl|my_center|LOCUS_37940 18341 19099 gene locus_tag LOCUS_37950 18341 19099 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207257.1 protein_id gnl|my_center|LOCUS_37950 19310 19936 gene locus_tag LOCUS_37960 19310 19936 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208083.1 protein_id gnl|my_center|LOCUS_37960 19990 20655 gene locus_tag LOCUS_37970 19990 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 20730 20805 gene locus_tag LOCUS_t00570 20730 20805 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 20811 20886 gene locus_tag LOCUS_t00580 20811 20886 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence53 370 981 gene locus_tag LOCUS_37980 370 981 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208256.1 protein_id gnl|my_center|LOCUS_37980 1029 1907 gene locus_tag LOCUS_37990 gene murI 1029 1907 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208257.1 protein_id gnl|my_center|LOCUS_37990 2014 3030 gene locus_tag LOCUS_38000 2014 3030 CDS product DUF4062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208258.1 protein_id gnl|my_center|LOCUS_38000 3129 4139 gene locus_tag LOCUS_38010 gene hemH 3129 4139 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065964.1 protein_id gnl|my_center|LOCUS_38010 4186 4830 gene locus_tag LOCUS_38020 4186 4830 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065967.1 protein_id gnl|my_center|LOCUS_38020 5119 4937 gene locus_tag LOCUS_38030 5119 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 5688 6599 gene locus_tag LOCUS_38040 gene pqqB 5688 6599 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206723.1 protein_id gnl|my_center|LOCUS_38040 6611 7369 gene locus_tag LOCUS_38050 gene pqqC 6611 7369 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113690.1 protein_id gnl|my_center|LOCUS_38050 7366 7650 gene locus_tag LOCUS_38060 gene pqqD 7366 7650 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792407.1 protein_id gnl|my_center|LOCUS_38060 7647 8795 gene locus_tag LOCUS_38070 gene pqqE 7647 8795 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206724.1 protein_id gnl|my_center|LOCUS_38070 8815 9870 gene locus_tag LOCUS_38080 8815 9870 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206725.1 protein_id gnl|my_center|LOCUS_38080 10066 9875 gene locus_tag LOCUS_38090 10066 9875 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114956.1 protein_id gnl|my_center|LOCUS_38090 10146 10802 gene locus_tag LOCUS_38100 10146 10802 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 protein_id gnl|my_center|LOCUS_38100 10792 12000 gene locus_tag LOCUS_38110 10792 12000 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208260.1 protein_id gnl|my_center|LOCUS_38110 12089 12499 gene locus_tag LOCUS_38120 12089 12499 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_38120 12926 12594 gene locus_tag LOCUS_38130 12926 12594 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_38130 13073 13912 gene locus_tag LOCUS_38140 13073 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 14031 14411 gene locus_tag LOCUS_38150 gene crcB 14031 14411 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_38150 14752 14504 gene locus_tag LOCUS_38160 14752 14504 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114896.1 protein_id gnl|my_center|LOCUS_38160 16350 15052 gene locus_tag LOCUS_38170 16350 15052 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_38170 16550 16765 gene locus_tag LOCUS_38180 16550 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 18284 16929 gene locus_tag LOCUS_38190 gene abeM 18284 16929 CDS product multidrug efflux MATE transporter AbeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 protein_id gnl|my_center|LOCUS_38190 18789 18328 gene locus_tag LOCUS_38200 18789 18328 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 protein_id gnl|my_center|LOCUS_38200 18868 20064 gene locus_tag LOCUS_38210 gene hemW 18868 20064 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208270.1 protein_id gnl|my_center|LOCUS_38210 20153 20641 gene locus_tag LOCUS_38220 20153 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence54 3 233 gene locus_tag LOCUS_38230 3 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 1875 550 gene locus_tag LOCUS_38240 1875 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 3291 1900 gene locus_tag LOCUS_38250 3291 1900 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703479.1 protein_id gnl|my_center|LOCUS_38250 4434 3430 gene locus_tag LOCUS_38260 4434 3430 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268747.1 protein_id gnl|my_center|LOCUS_38260 6053 4479 gene locus_tag LOCUS_38270 6053 4479 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 protein_id gnl|my_center|LOCUS_38270 6522 6848 gene locus_tag LOCUS_38280 6522 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117704.1 protein_id gnl|my_center|LOCUS_38280 7540 6947 gene locus_tag LOCUS_38290 7540 6947 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_38290 8206 7715 gene locus_tag LOCUS_38300 8206 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 8285 8776 gene locus_tag LOCUS_38310 8285 8776 CDS product copper resistance protein NlpE N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206080.1 protein_id gnl|my_center|LOCUS_38310 9479 8859 gene locus_tag LOCUS_38320 gene rhtC 9479 8859 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205974.1 protein_id gnl|my_center|LOCUS_38320 12757 9635 gene locus_tag LOCUS_38330 12757 9635 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205973.1 protein_id gnl|my_center|LOCUS_38330 13069 14022 gene locus_tag LOCUS_38340 gene trxB 13069 14022 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121722.1 protein_id gnl|my_center|LOCUS_38340 14132 15682 gene locus_tag LOCUS_38350 14132 15682 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_38350 15752 16483 gene locus_tag LOCUS_38360 gene aat 15752 16483 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205972.1 protein_id gnl|my_center|LOCUS_38360 16506 17321 gene locus_tag LOCUS_38370 16506 17321 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205971.1 protein_id gnl|my_center|LOCUS_38370 17821 17363 gene locus_tag LOCUS_38380 gene rimI 17821 17363 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205970.1 protein_id gnl|my_center|LOCUS_38380 18811 17930 gene locus_tag LOCUS_38390 18811 17930 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205969.1 protein_id gnl|my_center|LOCUS_38390 >Feature sequence55 <1 3628 gene locus_tag LOCUS_38400 <1 3628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207470.1:Ig-like domain-containing protein 3740 4336 gene locus_tag LOCUS_38410 3740 4336 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206260.1 protein_id gnl|my_center|LOCUS_38410 4329 4946 gene locus_tag LOCUS_38420 4329 4946 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206261.1 protein_id gnl|my_center|LOCUS_38420 5076 5918 gene locus_tag LOCUS_38430 5076 5918 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115820.1 protein_id gnl|my_center|LOCUS_38430 6997 6332 gene locus_tag LOCUS_38440 6997 6332 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206262.1 protein_id gnl|my_center|LOCUS_38440 8256 7204 gene locus_tag LOCUS_38450 gene hpxD 8256 7204 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_38450 8757 8398 gene locus_tag LOCUS_38460 8757 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 9112 10119 gene locus_tag LOCUS_38470 9112 10119 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118975.1 protein_id gnl|my_center|LOCUS_38470 10223 11602 gene locus_tag LOCUS_38480 gene pstC 10223 11602 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119004.1 protein_id gnl|my_center|LOCUS_38480 11599 12993 gene locus_tag LOCUS_38490 gene pstA 11599 12993 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207314.1 protein_id gnl|my_center|LOCUS_38490 13009 13920 gene locus_tag LOCUS_38500 gene pstB 13009 13920 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118636.1 protein_id gnl|my_center|LOCUS_38500 15631 14279 gene locus_tag LOCUS_38510 15631 14279 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119617.1 protein_id gnl|my_center|LOCUS_38510 16295 17257 gene locus_tag LOCUS_38520 gene sohB 16295 17257 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207313.1 protein_id gnl|my_center|LOCUS_38520 >Feature sequence56 416 1558 gene locus_tag LOCUS_38530 416 1558 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 protein_id gnl|my_center|LOCUS_38530 1846 2151 gene locus_tag LOCUS_38540 1846 2151 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_38540 2758 2240 gene locus_tag LOCUS_38550 2758 2240 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098902.1 protein_id gnl|my_center|LOCUS_38550 3011 4117 gene locus_tag LOCUS_38560 gene pheA 3011 4117 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049199.1 protein_id gnl|my_center|LOCUS_38560 4150 6396 gene locus_tag LOCUS_38570 4150 6396 CDS product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 protein_id gnl|my_center|LOCUS_38570 6531 6911 gene locus_tag LOCUS_38580 6531 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207212.1 protein_id gnl|my_center|LOCUS_38580 6952 7536 gene locus_tag LOCUS_38590 6952 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 8057 7614 gene locus_tag LOCUS_38600 8057 7614 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 protein_id gnl|my_center|LOCUS_38600 9285 8254 gene locus_tag LOCUS_38610 gene rtcA 9285 8254 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602549.1 protein_id gnl|my_center|LOCUS_38610 10484 10023 gene locus_tag LOCUS_38620 10484 10023 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_38620 10907 10503 gene locus_tag LOCUS_38630 10907 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 11336 10923 gene locus_tag LOCUS_38640 11336 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 12606 11341 gene locus_tag LOCUS_38650 12606 11341 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 protein_id gnl|my_center|LOCUS_38650 13606 13325 gene locus_tag LOCUS_38660 13606 13325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 16178 14547 gene locus_tag LOCUS_38670 16178 14547 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_38670 >Feature sequence57 613 1374 gene locus_tag LOCUS_38680 613 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 2311 1418 gene locus_tag LOCUS_38690 2311 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 3384 2311 gene locus_tag LOCUS_38700 3384 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 4834 3401 gene locus_tag LOCUS_38710 4834 3401 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868396.1 protein_id gnl|my_center|LOCUS_38710 5666 4911 gene locus_tag LOCUS_38720 5666 4911 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094942.1 protein_id gnl|my_center|LOCUS_38720 6035 6754 gene locus_tag LOCUS_38730 6035 6754 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_38730 6751 7641 gene locus_tag LOCUS_38740 6751 7641 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_38740 7638 7997 gene locus_tag LOCUS_38750 7638 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 7994 8392 gene locus_tag LOCUS_38760 7994 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 8486 9688 gene locus_tag LOCUS_38770 8486 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 11016 10012 gene locus_tag LOCUS_38780 gene cydB 11016 10012 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206500.1 protein_id gnl|my_center|LOCUS_38780 12452 11016 gene locus_tag LOCUS_38790 12452 11016 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206501.1 protein_id gnl|my_center|LOCUS_38790 12643 12449 gene locus_tag LOCUS_38800 12643 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 13173 12736 gene locus_tag LOCUS_38810 13173 12736 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114087.1 protein_id gnl|my_center|LOCUS_38810 14444 13467 gene locus_tag LOCUS_38820 14444 13467 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120906.1 protein_id gnl|my_center|LOCUS_38820 14571 16358 gene locus_tag LOCUS_38830 14571 16358 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_38830 >Feature sequence58 474 286 gene locus_tag LOCUS_38840 474 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 939 688 gene locus_tag LOCUS_38850 939 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 1944 1198 gene locus_tag LOCUS_38860 1944 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 2583 2089 gene locus_tag LOCUS_38870 2583 2089 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089838.1 protein_id gnl|my_center|LOCUS_38870 3353 2832 gene locus_tag LOCUS_38880 3353 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207539.1 protein_id gnl|my_center|LOCUS_38880 5018 4002 gene locus_tag LOCUS_38890 5018 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 7353 5281 gene locus_tag LOCUS_38900 7353 5281 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_38900 8453 7569 gene locus_tag LOCUS_38910 8453 7569 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206516.1 protein_id gnl|my_center|LOCUS_38910 8631 9212 gene locus_tag LOCUS_38920 8631 9212 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206517.1 protein_id gnl|my_center|LOCUS_38920 9219 9737 gene locus_tag LOCUS_38930 9219 9737 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501457.1 protein_id gnl|my_center|LOCUS_38930 10350 9877 gene locus_tag LOCUS_38940 10350 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206124.1 protein_id gnl|my_center|LOCUS_38940 10604 11182 gene locus_tag LOCUS_38950 10604 11182 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207538.1 protein_id gnl|my_center|LOCUS_38950 11362 11550 gene locus_tag LOCUS_38960 11362 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 12605 11691 gene locus_tag LOCUS_38970 12605 11691 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206896.1 protein_id gnl|my_center|LOCUS_38970 12799 13836 gene locus_tag LOCUS_38980 12799 13836 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206897.1 protein_id gnl|my_center|LOCUS_38980 13851 14141 gene locus_tag LOCUS_38990 gene catC 13851 14141 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897236.1 protein_id gnl|my_center|LOCUS_38990 14292 15212 gene locus_tag LOCUS_39000 gene catA 14292 15212 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113693.1 protein_id gnl|my_center|LOCUS_39000 >Feature sequence59 <1 1447 gene locus_tag LOCUS_39010 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005065953.1:electron transfer flavoprotein-ubiquinone oxidoreductase 2765 1593 gene locus_tag LOCUS_39020 2765 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206415.1 protein_id gnl|my_center|LOCUS_39020 4361 2880 gene locus_tag LOCUS_39030 4361 2880 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436996.1 protein_id gnl|my_center|LOCUS_39030 5704 4991 gene locus_tag LOCUS_39040 5704 4991 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244148.1 protein_id gnl|my_center|LOCUS_39040 6764 5739 gene locus_tag LOCUS_39050 6764 5739 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401358.1 protein_id gnl|my_center|LOCUS_39050 8254 6776 gene locus_tag LOCUS_39060 8254 6776 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 protein_id gnl|my_center|LOCUS_39060 9529 8276 gene locus_tag LOCUS_39070 9529 8276 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401363.1 protein_id gnl|my_center|LOCUS_39070 10527 9655 gene locus_tag LOCUS_39080 gene dapA 10527 9655 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401366.1 protein_id gnl|my_center|LOCUS_39080 10922 11677 gene locus_tag LOCUS_39090 10922 11677 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401353.1 protein_id gnl|my_center|LOCUS_39090 11687 12448 gene locus_tag LOCUS_39100 11687 12448 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_39100 13037 15220 gene locus_tag LOCUS_39110 13037 15220 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206936.1 protein_id gnl|my_center|LOCUS_39110 >Feature sequence60 673 179 gene locus_tag LOCUS_39120 673 179 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_39120 2280 703 gene locus_tag LOCUS_39130 gene gshA 2280 703 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207955.1 protein_id gnl|my_center|LOCUS_39130 2492 3031 gene locus_tag LOCUS_39140 2492 3031 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 protein_id gnl|my_center|LOCUS_39140 3597 3070 gene locus_tag LOCUS_39150 3597 3070 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_39150 3809 4375 gene locus_tag LOCUS_39160 3809 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122008.1 protein_id gnl|my_center|LOCUS_39160 4405 5724 gene locus_tag LOCUS_39170 4405 5724 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066720.1 protein_id gnl|my_center|LOCUS_39170 6622 5864 gene locus_tag LOCUS_39180 6622 5864 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_39180 6774 7211 gene locus_tag LOCUS_39190 6774 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 7850 7413 gene locus_tag LOCUS_39200 7850 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 8391 9371 gene locus_tag LOCUS_39210 8391 9371 CDS product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 protein_id gnl|my_center|LOCUS_39210 9395 10423 gene locus_tag LOCUS_39220 9395 10423 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973349.1 protein_id gnl|my_center|LOCUS_39220 10629 11120 gene locus_tag LOCUS_39230 10629 11120 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence61 2382 3341 gene locus_tag LOCUS_39240 gene fmt 2382 3341 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208014.1 protein_id gnl|my_center|LOCUS_39240 3338 4645 gene locus_tag LOCUS_39250 gene rsmB 3338 4645 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208015.1 protein_id gnl|my_center|LOCUS_39250 4846 4703 gene locus_tag LOCUS_39260 4846 4703 CDS product methionine/alanine import family NSS transporter small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119126.1 protein_id gnl|my_center|LOCUS_39260 6335 4857 gene locus_tag LOCUS_39270 6335 4857 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208016.1 protein_id gnl|my_center|LOCUS_39270 7645 7055 gene locus_tag LOCUS_39280 7645 7055 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_39280 9151 7703 gene locus_tag LOCUS_39290 9151 7703 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_39290 9290 10036 gene locus_tag LOCUS_39300 9290 10036 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_39300 10543 10211 gene locus_tag LOCUS_39310 10543 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310