>Feature sequence001 492 1199 gene locus_tag LOCUS_00010 492 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3794 1467 gene locus_tag LOCUS_00020 3794 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5660 3822 gene locus_tag LOCUS_00030 5660 3822 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_00030 6281 5700 gene locus_tag LOCUS_00040 gene tpx 6281 5700 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_00040 6595 6443 gene locus_tag LOCUS_00050 6595 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6795 6607 gene locus_tag LOCUS_00060 gene rpmG 6795 6607 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_00060 7037 6813 gene locus_tag LOCUS_00070 gene rpmB 7037 6813 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_00070 9602 7173 gene locus_tag LOCUS_00080 9602 7173 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_00080 10376 9639 gene locus_tag LOCUS_00090 10376 9639 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_00090 11145 10402 gene locus_tag LOCUS_00100 11145 10402 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_00100 12051 11416 gene locus_tag LOCUS_00110 12051 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12843 12430 gene locus_tag LOCUS_00120 12843 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13376 12957 gene locus_tag LOCUS_00130 13376 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039966.1 protein_id gnl|my_center|LOCUS_00130 13856 13398 gene locus_tag LOCUS_00140 13856 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14483 13869 gene locus_tag LOCUS_00150 gene recR 14483 13869 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_00150 >Feature sequence002 2531 702 gene locus_tag LOCUS_00160 gene uvrC 2531 702 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783702.1 protein_id gnl|my_center|LOCUS_00160 2644 2718 gene locus_tag LOCUS_t00010 2644 2718 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2860 4656 gene locus_tag LOCUS_00170 gene typA 2860 4656 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_00170 5292 4735 gene locus_tag LOCUS_00180 gene def 5292 4735 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_00180 5901 5491 gene locus_tag LOCUS_00190 gene mce 5901 5491 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_00190 6104 6802 gene locus_tag LOCUS_00200 6104 6802 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_00200 6842 8053 gene locus_tag LOCUS_00210 6842 8053 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_00210 8385 10337 gene locus_tag LOCUS_00220 8385 10337 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_00220 10354 10839 gene locus_tag LOCUS_00230 10354 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 10853 12280 gene locus_tag LOCUS_00240 10853 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 12614 14389 gene locus_tag LOCUS_00250 12614 14389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 >Feature sequence003 1019 1228 gene locus_tag LOCUS_00260 1019 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 1219 1506 gene locus_tag LOCUS_00270 1219 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 2797 1553 gene locus_tag LOCUS_00280 gene purD 2797 1553 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101936.1 protein_id gnl|my_center|LOCUS_00280 2927 3000 gene locus_tag LOCUS_t00020 2927 3000 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4026 3067 gene locus_tag LOCUS_00290 4026 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 5897 4251 gene locus_tag LOCUS_00300 5897 4251 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_00300 6115 7221 gene locus_tag LOCUS_00310 6115 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 7377 8726 gene locus_tag LOCUS_00320 7377 8726 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_00320 8807 11035 gene locus_tag LOCUS_00330 8807 11035 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_00330 11035 12270 gene locus_tag LOCUS_00340 11035 12270 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203495.1 protein_id gnl|my_center|LOCUS_00340 12317 13564 gene locus_tag LOCUS_00350 12317 13564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_00350 13767 14846 gene locus_tag LOCUS_00360 13767 14846 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_00360 14867 15286 gene locus_tag LOCUS_00370 14867 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 >Feature sequence004 44 1183 gene locus_tag LOCUS_00380 44 1183 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_00380 1320 2102 gene locus_tag LOCUS_00390 1320 2102 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903461.1 protein_id gnl|my_center|LOCUS_00390 2128 3132 gene locus_tag LOCUS_00400 2128 3132 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_00400 3662 3219 gene locus_tag LOCUS_00410 3662 3219 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680919.1 protein_id gnl|my_center|LOCUS_00410 4579 3836 gene locus_tag LOCUS_00420 4579 3836 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_00420 5204 4590 gene locus_tag LOCUS_00430 5204 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 5463 5681 gene locus_tag LOCUS_00440 5463 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5828 6544 gene locus_tag LOCUS_00450 5828 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 7055 6582 gene locus_tag LOCUS_00460 7055 6582 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_00460 11104 7076 gene locus_tag LOCUS_00470 gene dnaE 11104 7076 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_00470 11333 12319 gene locus_tag LOCUS_00480 11333 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 12480 13217 gene locus_tag LOCUS_00490 12480 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 14008 13256 gene locus_tag LOCUS_00500 14008 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 14443 14081 gene locus_tag LOCUS_00510 14443 14081 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_00510 >Feature sequence005 6398 60 gene locus_tag LOCUS_00520 6398 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 6765 6406 gene locus_tag LOCUS_00530 6765 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 7643 6972 gene locus_tag LOCUS_00540 gene pssA 7643 6972 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_00540 7798 8319 gene locus_tag LOCUS_00550 7798 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 8322 8831 gene locus_tag LOCUS_00560 8322 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 8831 9583 gene locus_tag LOCUS_00570 8831 9583 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764712.1 protein_id gnl|my_center|LOCUS_00570 9580 10191 gene locus_tag LOCUS_00580 9580 10191 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_00580 12370 10262 gene locus_tag LOCUS_00590 12370 10262 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764533.1 protein_id gnl|my_center|LOCUS_00590 >Feature sequence006 152 1279 gene locus_tag LOCUS_00600 152 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_00600 2150 1293 gene locus_tag LOCUS_00610 2150 1293 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_00610 2613 5810 gene locus_tag LOCUS_00620 gene carB 2613 5810 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_00620 5870 6802 gene locus_tag LOCUS_00630 5870 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_00630 6820 7953 gene locus_tag LOCUS_00640 6820 7953 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_00640 8162 9502 gene locus_tag LOCUS_00650 gene gdhA 8162 9502 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_00650 10645 9605 gene locus_tag LOCUS_00660 gene mltG 10645 9605 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_00660 11293 10649 gene locus_tag LOCUS_00670 11293 10649 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_00670 11775 11383 gene locus_tag LOCUS_00680 11775 11383 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence007 189 524 gene locus_tag LOCUS_00690 gene rbfA 189 524 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_00690 559 1791 gene locus_tag LOCUS_00700 559 1791 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_00700 1832 4195 gene locus_tag LOCUS_00710 1832 4195 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_00710 4488 5399 gene locus_tag LOCUS_00720 4488 5399 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_00720 5554 7395 gene locus_tag LOCUS_00730 5554 7395 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791976.1 protein_id gnl|my_center|LOCUS_00730 7413 8411 gene locus_tag LOCUS_00740 7413 8411 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_00740 9193 11286 gene locus_tag LOCUS_00750 gene nrdD 9193 11286 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_00750 11330 11797 gene locus_tag LOCUS_00760 11330 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence008 1778 261 gene locus_tag LOCUS_00770 1778 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 2647 1967 gene locus_tag LOCUS_00780 2647 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 2947 4950 gene locus_tag LOCUS_00790 2947 4950 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_00790 5089 5937 gene locus_tag LOCUS_00800 5089 5937 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_00800 6765 5941 gene locus_tag LOCUS_00810 6765 5941 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228264.1 protein_id gnl|my_center|LOCUS_00810 7848 6778 gene locus_tag LOCUS_00820 7848 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 10433 7986 gene locus_tag LOCUS_00830 10433 7986 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence009 3635 465 gene locus_tag LOCUS_00840 gene infB 3635 465 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_00840 5026 3773 gene locus_tag LOCUS_00850 gene nusA 5026 3773 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763665.1 protein_id gnl|my_center|LOCUS_00850 5519 5061 gene locus_tag LOCUS_00860 gene rimP 5519 5061 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962637.1 protein_id gnl|my_center|LOCUS_00860 5790 6530 gene locus_tag LOCUS_00870 gene sufC 5790 6530 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_00870 6538 7878 gene locus_tag LOCUS_00880 gene sufD 6538 7878 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_00880 9174 7909 gene locus_tag LOCUS_00890 9174 7909 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_00890 9781 10767 gene locus_tag LOCUS_00900 9781 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 >Feature sequence010 2646 634 gene locus_tag LOCUS_00910 gene ligA 2646 634 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_00910 3429 2656 gene locus_tag LOCUS_00920 3429 2656 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_00920 3755 6463 gene locus_tag LOCUS_00930 3755 6463 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_00930 6549 8354 gene locus_tag LOCUS_00940 6549 8354 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_00940 9641 8634 gene locus_tag LOCUS_00950 9641 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 >Feature sequence011 698 2203 gene locus_tag LOCUS_00960 698 2203 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_00960 2414 4480 gene locus_tag LOCUS_00970 gene btuB 2414 4480 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 protein_id gnl|my_center|LOCUS_00970 6125 4671 gene locus_tag LOCUS_00980 6125 4671 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_00980 7332 6316 gene locus_tag LOCUS_00990 gene ruvB 7332 6316 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_00990 8620 7400 gene locus_tag LOCUS_01000 8620 7400 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_01000 8826 10355 gene locus_tag LOCUS_01010 gene purH 8826 10355 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence012 <1 551 gene locus_tag LOCUS_01020 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002215631.1:Fic/DOC family protein 580 1287 gene locus_tag LOCUS_01030 580 1287 CDS product SMUG2 DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 protein_id gnl|my_center|LOCUS_01030 1382 2368 gene locus_tag LOCUS_01040 1382 2368 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919530.1 protein_id gnl|my_center|LOCUS_01040 2778 2509 gene locus_tag LOCUS_01050 gene rpsN 2778 2509 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762042.1 protein_id gnl|my_center|LOCUS_01050 3342 2794 gene locus_tag LOCUS_01060 gene rplE 3342 2794 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 protein_id gnl|my_center|LOCUS_01060 3662 3339 gene locus_tag LOCUS_01070 gene rplX 3662 3339 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_01070 4077 3712 gene locus_tag LOCUS_01080 gene rplN 4077 3712 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_01080 4338 4081 gene locus_tag LOCUS_01090 gene rpsQ 4338 4081 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_01090 4562 4356 gene locus_tag LOCUS_01100 gene rpmC 4562 4356 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_01100 5011 4580 gene locus_tag LOCUS_01110 gene rplP 5011 4580 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_01110 5809 5042 gene locus_tag LOCUS_01120 gene rpsC 5809 5042 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_01120 6230 5793 gene locus_tag LOCUS_01130 gene rplV 6230 5793 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_01130 6540 6274 gene locus_tag LOCUS_01140 gene rpsS 6540 6274 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_01140 7391 6567 gene locus_tag LOCUS_01150 gene rplB 7391 6567 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_01150 7776 7486 gene locus_tag LOCUS_01160 gene rplW 7776 7486 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_01160 8418 7780 gene locus_tag LOCUS_01170 gene rplD 8418 7780 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762035.1 protein_id gnl|my_center|LOCUS_01170 9040 8420 gene locus_tag LOCUS_01180 gene rplC 9040 8420 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_01180 9670 9323 gene locus_tag LOCUS_01190 gene folB 9670 9323 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262834.1 protein_id gnl|my_center|LOCUS_01190 <10411 9719 gene locus_tag LOCUS_01200 <10411 9719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795608.1:endonuclease MutS2 >Feature sequence013 79 336 gene locus_tag LOCUS_01210 79 336 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_01210 340 1533 gene locus_tag LOCUS_01220 340 1533 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_01220 1523 2578 gene locus_tag LOCUS_01230 1523 2578 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_01230 2615 2989 gene locus_tag LOCUS_01240 2615 2989 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_01240 2986 3447 gene locus_tag LOCUS_01250 2986 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964348.1 protein_id gnl|my_center|LOCUS_01250 5858 3633 gene locus_tag LOCUS_01260 gene pnp 5858 3633 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_01260 6306 7799 gene locus_tag LOCUS_01270 6306 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8208 8675 gene locus_tag LOCUS_01280 8208 8675 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785717.1 protein_id gnl|my_center|LOCUS_01280 8723 9697 gene locus_tag LOCUS_01290 gene floA 8723 9697 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_01290 >Feature sequence014 509 318 gene locus_tag LOCUS_01300 509 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 709 512 gene locus_tag LOCUS_01310 709 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 1874 1026 gene locus_tag LOCUS_01320 1874 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3755 2169 gene locus_tag LOCUS_01330 3755 2169 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767969.1 protein_id gnl|my_center|LOCUS_01330 4153 4395 gene locus_tag LOCUS_01340 4153 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 5384 4560 gene locus_tag LOCUS_01350 5384 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 5964 5449 gene locus_tag LOCUS_01360 5964 5449 CDS product DUF4625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784028.1 protein_id gnl|my_center|LOCUS_01360 8244 6004 gene locus_tag LOCUS_01370 8244 6004 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201930.1 protein_id gnl|my_center|LOCUS_01370 8777 8376 gene locus_tag LOCUS_01380 8777 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 9938 8847 gene locus_tag LOCUS_01390 9938 8847 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021093.1 protein_id gnl|my_center|LOCUS_01390 >Feature sequence015 <1 656 gene locus_tag LOCUS_01400 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789269.1:2,3-diphosphoglycerate-dependent phosphoglycerate mutase 693 1997 gene locus_tag LOCUS_01410 693 1997 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_01410 2037 3236 gene locus_tag LOCUS_01420 2037 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 3521 3129 gene locus_tag LOCUS_01430 3521 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 4040 3624 gene locus_tag LOCUS_01440 gene ruvX 4040 3624 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_01440 4128 6392 gene locus_tag LOCUS_01450 4128 6392 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_01450 6971 8713 gene locus_tag LOCUS_01460 gene rho 6971 8713 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_01460 8783 9304 gene locus_tag LOCUS_01470 8783 9304 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence016 530 129 gene locus_tag LOCUS_01480 530 129 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_01480 1217 561 gene locus_tag LOCUS_01490 1217 561 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897858.1 protein_id gnl|my_center|LOCUS_01490 2023 1232 gene locus_tag LOCUS_01500 2023 1232 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_01500 5732 2400 gene locus_tag LOCUS_01510 gene mfd 5732 2400 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_01510 5968 7467 gene locus_tag LOCUS_01520 gene atpD 5968 7467 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_01520 7514 7753 gene locus_tag LOCUS_01530 7514 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 7795 8193 gene locus_tag LOCUS_01540 7795 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 8190 9293 gene locus_tag LOCUS_01550 gene atpB 8190 9293 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_01550 >Feature sequence017 1936 1151 gene locus_tag LOCUS_01560 1936 1151 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682206.1 protein_id gnl|my_center|LOCUS_01560 3524 1947 gene locus_tag LOCUS_01570 3524 1947 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_01570 4000 3548 gene locus_tag LOCUS_01580 gene rpiB 4000 3548 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_01580 6510 3997 gene locus_tag LOCUS_01590 6510 3997 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_01590 8329 6680 gene locus_tag LOCUS_01600 8329 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 8936 8415 gene locus_tag LOCUS_01610 8936 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 >Feature sequence018 1783 1268 gene locus_tag LOCUS_01620 1783 1268 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763510.1 protein_id gnl|my_center|LOCUS_01620 2534 1794 gene locus_tag LOCUS_01630 2534 1794 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020948.1 protein_id gnl|my_center|LOCUS_01630 4044 2578 gene locus_tag LOCUS_01640 gene cysS 4044 2578 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_01640 5889 4384 gene locus_tag LOCUS_01650 5889 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 6596 6024 gene locus_tag LOCUS_01660 6596 6024 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_01660 6707 7675 gene locus_tag LOCUS_01670 6707 7675 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_01670 8847 7792 gene locus_tag LOCUS_01680 8847 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence019 <1 1341 gene locus_tag LOCUS_01690 <1 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107187.1:YgiQ family radical SAM protein 1662 1408 gene locus_tag LOCUS_01700 gene rpsT 1662 1408 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_01700 1768 1695 gene locus_tag LOCUS_t00030 1768 1695 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3450 1918 gene locus_tag LOCUS_01710 3450 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 3610 5481 gene locus_tag LOCUS_01720 3610 5481 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761752.1 protein_id gnl|my_center|LOCUS_01720 5588 6115 gene locus_tag LOCUS_01730 5588 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 6212 7390 gene locus_tag LOCUS_01740 6212 7390 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_01740 >Feature sequence020 461 3484 gene locus_tag LOCUS_01750 461 3484 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108497.1 protein_id gnl|my_center|LOCUS_01750 4329 3679 gene locus_tag LOCUS_01760 4329 3679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_01760 5227 4343 gene locus_tag LOCUS_01770 5227 4343 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_01770 5338 8223 gene locus_tag LOCUS_01780 5338 8223 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence021 302 1135 gene locus_tag LOCUS_01790 302 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796354.1 protein_id gnl|my_center|LOCUS_01790 1277 2704 gene locus_tag LOCUS_01800 1277 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2701 3978 gene locus_tag LOCUS_01810 2701 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4050 6164 gene locus_tag LOCUS_01820 4050 6164 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_01820 7223 6342 gene locus_tag LOCUS_01830 7223 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 8129 7293 gene locus_tag LOCUS_01840 8129 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787364.1 protein_id gnl|my_center|LOCUS_01840 >Feature sequence022 2312 1359 gene locus_tag LOCUS_01850 2312 1359 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202005.1 protein_id gnl|my_center|LOCUS_01850 3591 2332 gene locus_tag LOCUS_01860 3591 2332 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966346.1 protein_id gnl|my_center|LOCUS_01860 4550 3591 gene locus_tag LOCUS_01870 4550 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203513.1 protein_id gnl|my_center|LOCUS_01870 5715 4561 gene locus_tag LOCUS_01880 5715 4561 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048106.1 protein_id gnl|my_center|LOCUS_01880 5870 6460 gene locus_tag LOCUS_01890 5870 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 6614 7882 gene locus_tag LOCUS_01900 6614 7882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence023 3585 205 gene locus_tag LOCUS_01910 gene porU 3585 205 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_01910 4234 3623 gene locus_tag LOCUS_01920 4234 3623 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_01920 4733 4272 gene locus_tag LOCUS_01930 4733 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 5322 4774 gene locus_tag LOCUS_01940 5322 4774 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_01940 6309 5407 gene locus_tag LOCUS_01950 6309 5407 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264473.1 protein_id gnl|my_center|LOCUS_01950 6698 7927 gene locus_tag LOCUS_01960 6698 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence024 2303 1236 gene locus_tag LOCUS_01970 gene nuoH 2303 1236 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_01970 3987 2356 gene locus_tag LOCUS_01980 3987 2356 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760950.1 protein_id gnl|my_center|LOCUS_01980 4594 3980 gene locus_tag LOCUS_01990 4594 3980 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_01990 4938 4585 gene locus_tag LOCUS_02000 4938 4585 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_02000 6886 5234 gene locus_tag LOCUS_02010 6886 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 7152 7418 gene locus_tag LOCUS_02020 7152 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 7396 7686 gene locus_tag LOCUS_02030 7396 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence025 2980 632 gene locus_tag LOCUS_02040 2980 632 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_02040 3813 3193 gene locus_tag LOCUS_02050 3813 3193 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107302.1 protein_id gnl|my_center|LOCUS_02050 5263 4097 gene locus_tag LOCUS_02060 5263 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5922 5647 gene locus_tag LOCUS_02070 5922 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6314 6069 gene locus_tag LOCUS_02080 6314 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6619 6353 gene locus_tag LOCUS_02090 6619 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7295 6636 gene locus_tag LOCUS_02100 7295 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 7531 7322 gene locus_tag LOCUS_02110 7531 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 >Feature sequence026 798 388 gene locus_tag LOCUS_02120 798 388 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_02120 1372 806 gene locus_tag LOCUS_02130 gene pth 1372 806 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764745.1 protein_id gnl|my_center|LOCUS_02130 2431 1391 gene locus_tag LOCUS_02140 2431 1391 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_02140 2860 2450 gene locus_tag LOCUS_02150 2860 2450 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119515.1 protein_id gnl|my_center|LOCUS_02150 3410 2967 gene locus_tag LOCUS_02160 3410 2967 CDS product copper resistance protein NlpE N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748182.1 protein_id gnl|my_center|LOCUS_02160 3508 4812 gene locus_tag LOCUS_02170 gene xseA 3508 4812 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_02170 5495 4905 gene locus_tag LOCUS_02180 gene nadD 5495 4905 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_02180 6382 5501 gene locus_tag LOCUS_02190 6382 5501 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_02190 6508 7641 gene locus_tag LOCUS_02200 6508 7641 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence027 1909 62 gene locus_tag LOCUS_02210 1909 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2896 1979 gene locus_tag LOCUS_02220 2896 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 3709 3056 gene locus_tag LOCUS_02230 3709 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 4521 3757 gene locus_tag LOCUS_02240 4521 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 5815 4595 gene locus_tag LOCUS_02250 5815 4595 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_02250 6340 5822 gene locus_tag LOCUS_02260 6340 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 7247 6363 gene locus_tag LOCUS_02270 gene xerC 7247 6363 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_02270 7451 7260 gene locus_tag LOCUS_02280 gene rpsU 7451 7260 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence028 <1 1336 gene locus_tag LOCUS_02290 <1 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107706.1:YihY/virulence factor BrkB family protein 1364 2452 gene locus_tag LOCUS_02300 1364 2452 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202097.1 protein_id gnl|my_center|LOCUS_02300 3364 2504 gene locus_tag LOCUS_02310 gene panC 3364 2504 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764495.1 protein_id gnl|my_center|LOCUS_02310 3480 5384 gene locus_tag LOCUS_02320 gene dxs 3480 5384 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_02320 5457 6788 gene locus_tag LOCUS_02330 gene trkA 5457 6788 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence029 <1 2539 gene locus_tag LOCUS_02340 <1 2539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_102756879.1:BspA family leucine-rich repeat surface protein 4328 2727 gene locus_tag LOCUS_02350 4328 2727 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_02350 4797 4372 gene locus_tag LOCUS_02360 4797 4372 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_02360 5669 4827 gene locus_tag LOCUS_02370 gene nfo 5669 4827 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706116.1 protein_id gnl|my_center|LOCUS_02370 6520 5684 gene locus_tag LOCUS_02380 gene dapF 6520 5684 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_02380 7301 6588 gene locus_tag LOCUS_02390 7301 6588 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_02390 >Feature sequence030 963 145 gene locus_tag LOCUS_02400 963 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2787 1000 gene locus_tag LOCUS_02410 2787 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3289 2801 gene locus_tag LOCUS_02420 3289 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence031 1673 828 gene locus_tag LOCUS_02430 1673 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3046 1820 gene locus_tag LOCUS_02440 gene aroA 3046 1820 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_02440 4356 3007 gene locus_tag LOCUS_02450 4356 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4480 5238 gene locus_tag LOCUS_02460 4480 5238 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_02460 5646 5257 gene locus_tag LOCUS_02470 5646 5257 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_02470 6157 5684 gene locus_tag LOCUS_02480 6157 5684 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_02480 7197 6358 gene locus_tag LOCUS_02490 7197 6358 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373267.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence032 1543 2274 gene locus_tag LOCUS_02500 1543 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 2448 3893 gene locus_tag LOCUS_02510 2448 3893 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760238.1 protein_id gnl|my_center|LOCUS_02510 4139 4867 gene locus_tag LOCUS_02520 4139 4867 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_02520 4907 5695 gene locus_tag LOCUS_02530 4907 5695 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_02530 5769 6179 gene locus_tag LOCUS_02540 5769 6179 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence033 755 2560 gene locus_tag LOCUS_02550 755 2560 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 protein_id gnl|my_center|LOCUS_02550 5322 2836 gene locus_tag LOCUS_02560 5322 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 <7364 5368 gene locus_tag LOCUS_02570 <7364 5368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:OmpA family protein >Feature sequence034 1056 835 gene locus_tag LOCUS_02580 1056 835 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812628.1 protein_id gnl|my_center|LOCUS_02580 1293 1099 gene locus_tag LOCUS_02590 1293 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1531 2418 gene locus_tag LOCUS_02600 1531 2418 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_02600 2496 2891 gene locus_tag LOCUS_02610 gene rnpA 2496 2891 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964465.1 protein_id gnl|my_center|LOCUS_02610 3965 3078 gene locus_tag LOCUS_02620 gene queG 3965 3078 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_02620 4161 5531 gene locus_tag LOCUS_02630 4161 5531 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_02630 6855 5602 gene locus_tag LOCUS_02640 gene mtaB 6855 5602 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence035 287 3547 gene locus_tag LOCUS_02650 gene secA 287 3547 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_02650 3780 4760 gene locus_tag LOCUS_02660 3780 4760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_02660 5329 4733 gene locus_tag LOCUS_02670 5329 4733 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_02670 5431 5502 gene locus_tag LOCUS_t00040 5431 5502 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6107 5955 gene locus_tag LOCUS_02680 6107 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence036 164 2425 gene locus_tag LOCUS_02690 164 2425 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_02690 3413 2379 gene locus_tag LOCUS_02700 3413 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 3504 4940 gene locus_tag LOCUS_02710 gene sufB 3504 4940 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_02710 5826 5026 gene locus_tag LOCUS_02720 gene lpxA 5826 5026 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_02720 <6976 5941 gene locus_tag LOCUS_02730 <6976 5941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759880.1:bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase >Feature sequence037 <1 1187 gene locus_tag LOCUS_02740 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107919.1:CDP-glycerol glycerophosphotransferase family protein 1246 2265 gene locus_tag LOCUS_02750 1246 2265 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_02750 2309 2590 gene locus_tag LOCUS_02760 2309 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2630 3529 gene locus_tag LOCUS_02770 2630 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_02770 3582 5087 gene locus_tag LOCUS_02780 3582 5087 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_02780 >Feature sequence038 <1 530 gene locus_tag LOCUS_02790 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766194.1:amidohydrolase 692 2632 gene locus_tag LOCUS_02800 gene thrS 692 2632 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_02800 2636 3460 gene locus_tag LOCUS_02810 gene bamD 2636 3460 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_02810 3546 3875 gene locus_tag LOCUS_02820 3546 3875 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_02820 3968 5758 gene locus_tag LOCUS_02830 3968 5758 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784128.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence039 518 333 gene locus_tag LOCUS_02840 518 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 2002 755 gene locus_tag LOCUS_02850 2002 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 3317 2268 gene locus_tag LOCUS_02860 gene hydE 3317 2268 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_02860 4773 3298 gene locus_tag LOCUS_02870 4773 3298 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763223.1 protein_id gnl|my_center|LOCUS_02870 5421 5891 gene locus_tag LOCUS_02880 gene greA 5421 5891 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_02880 5907 6302 gene locus_tag LOCUS_02890 5907 6302 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_02890 6430 6504 gene locus_tag LOCUS_t00050 6430 6504 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence040 236 1693 gene locus_tag LOCUS_02900 gene rny 236 1693 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_02900 1719 2276 gene locus_tag LOCUS_02910 1719 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 2324 3991 gene locus_tag LOCUS_02920 gene ettA 2324 3991 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763451.1 protein_id gnl|my_center|LOCUS_02920 4922 4491 gene locus_tag LOCUS_02930 4922 4491 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_02930 6211 4919 gene locus_tag LOCUS_02940 gene tyrS 6211 4919 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_02940 6765 6322 gene locus_tag LOCUS_02950 gene ssb 6765 6322 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_02950 >Feature sequence041 115 39 gene locus_tag LOCUS_t00060 115 39 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 278 598 gene locus_tag LOCUS_02960 278 598 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108936.1 protein_id gnl|my_center|LOCUS_02960 683 1240 gene locus_tag LOCUS_02970 gene lptC 683 1240 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_02970 1334 2824 gene locus_tag LOCUS_02980 gene rseP 1334 2824 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_02980 5153 2877 gene locus_tag LOCUS_02990 5153 2877 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_02990 6255 5227 gene locus_tag LOCUS_03000 gene purM 6255 5227 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence042 <1 725 gene locus_tag LOCUS_03010 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764111.1:ATP-dependent Clp protease ATP-binding subunit ClpX 764 2809 gene locus_tag LOCUS_03020 764 2809 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_03020 2843 3637 gene locus_tag LOCUS_03030 2843 3637 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_03030 3665 4171 gene locus_tag LOCUS_03040 gene rimM 3665 4171 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_03040 4205 4858 gene locus_tag LOCUS_03050 gene lipB 4205 4858 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence043 205 2109 gene locus_tag LOCUS_03060 205 2109 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_03060 2167 3000 gene locus_tag LOCUS_03070 gene nadC 2167 3000 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_03070 3045 4706 gene locus_tag LOCUS_03080 3045 4706 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_03080 4754 6703 gene locus_tag LOCUS_03090 4754 6703 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979843.1 protein_id gnl|my_center|LOCUS_03090 >Feature sequence044 2095 1004 gene locus_tag LOCUS_03100 2095 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3403 2222 gene locus_tag LOCUS_03110 3403 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5427 3400 gene locus_tag LOCUS_03120 5427 3400 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_03120 <6708 5926 gene locus_tag LOCUS_03130 <6708 5926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769710.1:TrkH family potassium uptake protein >Feature sequence045 206 1174 gene locus_tag LOCUS_03140 206 1174 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_03140 1255 2697 gene locus_tag LOCUS_03150 gene purF 1255 2697 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 protein_id gnl|my_center|LOCUS_03150 2986 4500 gene locus_tag LOCUS_03160 2986 4500 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679758.1 protein_id gnl|my_center|LOCUS_03160 5098 4637 gene locus_tag LOCUS_03170 5098 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5633 6184 gene locus_tag LOCUS_03180 5633 6184 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942604.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence046 <1 687 gene locus_tag LOCUS_03190 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962553.1:S46 family peptidase 760 1488 gene locus_tag LOCUS_03200 760 1488 CDS product DUF4272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917823.1 protein_id gnl|my_center|LOCUS_03200 1683 2687 gene locus_tag LOCUS_03210 1683 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 2894 3289 gene locus_tag LOCUS_03220 gene rpsH 2894 3289 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_03220 3310 3861 gene locus_tag LOCUS_03230 gene rplF 3310 3861 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_03230 3884 4228 gene locus_tag LOCUS_03240 gene rplR 3884 4228 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_03240 4235 4753 gene locus_tag LOCUS_03250 gene rpsE 4235 4753 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_03250 4772 4948 gene locus_tag LOCUS_03260 gene rpmD 4772 4948 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_03260 5266 5117 gene locus_tag LOCUS_03270 5266 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence047 <1 629 gene locus_tag LOCUS_03280 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775476.1:ParB/RepB/Spo0J family partition protein 656 1333 gene locus_tag LOCUS_03290 656 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1390 2703 gene locus_tag LOCUS_03300 1390 2703 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_03300 4397 2868 gene locus_tag LOCUS_03310 gene gltX 4397 2868 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_03310 6188 4437 gene locus_tag LOCUS_03320 gene aspS 6188 4437 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence048 108 353 gene locus_tag LOCUS_03330 108 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761566.1 protein_id gnl|my_center|LOCUS_03330 434 1057 gene locus_tag LOCUS_03340 434 1057 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_03340 1089 2372 gene locus_tag LOCUS_03350 1089 2372 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_03350 2412 3173 gene locus_tag LOCUS_03360 gene lptB 2412 3173 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_03360 3862 3254 gene locus_tag LOCUS_03370 3862 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 5491 4022 gene locus_tag LOCUS_03380 5491 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5839 5767 gene locus_tag LOCUS_t00070 5839 5767 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence049 539 1978 gene locus_tag LOCUS_03390 539 1978 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_03390 2067 2759 gene locus_tag LOCUS_03400 2067 2759 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_03400 2804 4177 gene locus_tag LOCUS_03410 gene murC 2804 4177 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence050 1297 1067 gene locus_tag LOCUS_03420 1297 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 1688 1281 gene locus_tag LOCUS_03430 1688 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 1999 1772 gene locus_tag LOCUS_03440 1999 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 2667 2056 gene locus_tag LOCUS_03450 2667 2056 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_03450 2824 4776 gene locus_tag LOCUS_03460 2824 4776 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_03460 4773 6023 gene locus_tag LOCUS_03470 4773 6023 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_03470 >Feature sequence051 907 1122 gene locus_tag LOCUS_03480 907 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1368 2645 gene locus_tag LOCUS_03490 gene eno 1368 2645 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_03490 3686 2745 gene locus_tag LOCUS_03500 3686 2745 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_03500 4670 3771 gene locus_tag LOCUS_03510 4670 3771 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_03510 5235 4663 gene locus_tag LOCUS_03520 5235 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 <6237 5266 gene locus_tag LOCUS_03530 <6237 5266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787941.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD >Feature sequence052 175 885 gene locus_tag LOCUS_03540 175 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 913 1860 gene locus_tag LOCUS_03550 913 1860 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_03550 1927 3246 gene locus_tag LOCUS_03560 1927 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 3296 4336 gene locus_tag LOCUS_03570 3296 4336 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_03570 4339 5259 gene locus_tag LOCUS_03580 4339 5259 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081271.1 protein_id gnl|my_center|LOCUS_03580 5655 5266 gene locus_tag LOCUS_03590 5655 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 6124 5702 gene locus_tag LOCUS_03600 6124 5702 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence053 598 1620 gene locus_tag LOCUS_03610 598 1620 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229865.1 protein_id gnl|my_center|LOCUS_03610 1723 2838 gene locus_tag LOCUS_03620 1723 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2921 3943 gene locus_tag LOCUS_03630 2921 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 3949 4944 gene locus_tag LOCUS_03640 3949 4944 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107917.1 protein_id gnl|my_center|LOCUS_03640 4932 5813 gene locus_tag LOCUS_03650 4932 5813 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801667.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence054 1522 980 gene locus_tag LOCUS_03660 1522 980 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032850560.1 protein_id gnl|my_center|LOCUS_03660 2720 1581 gene locus_tag LOCUS_03670 gene lpxB 2720 1581 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_03670 2964 3812 gene locus_tag LOCUS_03680 gene folD 2964 3812 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 protein_id gnl|my_center|LOCUS_03680 4070 4894 gene locus_tag LOCUS_03690 4070 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03690 5264 4908 gene locus_tag LOCUS_03700 5264 4908 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784476.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence055 107 1180 gene locus_tag LOCUS_03710 107 1180 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_03710 1271 1513 gene locus_tag LOCUS_03720 1271 1513 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_03720 1558 2469 gene locus_tag LOCUS_03730 1558 2469 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_03730 4788 2635 gene locus_tag LOCUS_03740 4788 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5804 5352 gene locus_tag LOCUS_03750 5804 5352 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760391.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence056 209 934 gene locus_tag LOCUS_03760 209 934 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_03760 1885 1022 gene locus_tag LOCUS_03770 1885 1022 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_03770 2315 2959 gene locus_tag LOCUS_03780 2315 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2949 5018 gene locus_tag LOCUS_03790 2949 5018 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_03790 5015 5653 gene locus_tag LOCUS_03800 5015 5653 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence057 2021 87 gene locus_tag LOCUS_03810 2021 87 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_03810 2245 3093 gene locus_tag LOCUS_03820 2245 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 3062 4600 gene locus_tag LOCUS_03830 gene eptA 3062 4600 CDS product phosphoethanolamine--lipid A transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157542.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence058 1473 1204 gene locus_tag LOCUS_03840 1473 1204 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_03840 1721 2521 gene locus_tag LOCUS_03850 1721 2521 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_03850 3152 2595 gene locus_tag LOCUS_03860 3152 2595 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_03860 3587 3177 gene locus_tag LOCUS_03870 gene ybeY 3587 3177 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_03870 4369 3626 gene locus_tag LOCUS_03880 gene truA 4369 3626 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_03880 5384 4389 gene locus_tag LOCUS_03890 5384 4389 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784257.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence059 693 127 gene locus_tag LOCUS_03900 693 127 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437445.1 protein_id gnl|my_center|LOCUS_03900 1829 1110 gene locus_tag LOCUS_03910 1829 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 3896 1959 gene locus_tag LOCUS_03920 3896 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence060 549 2663 gene locus_tag LOCUS_03930 549 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2955 5273 gene locus_tag LOCUS_03940 2955 5273 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107378.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence061 942 313 gene locus_tag LOCUS_03950 942 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 1699 950 gene locus_tag LOCUS_03960 1699 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 3109 2306 gene locus_tag LOCUS_03970 3109 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021095.1 protein_id gnl|my_center|LOCUS_03970 3725 3129 gene locus_tag LOCUS_03980 3725 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4695 3775 gene locus_tag LOCUS_03990 4695 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 <5642 4692 gene locus_tag LOCUS_04000 <5642 4692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242807.1:glycosyltransferase family 4 protein >Feature sequence062 2374 554 gene locus_tag LOCUS_04010 2374 554 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_04010 4156 2786 gene locus_tag LOCUS_04020 4156 2786 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454646.1 protein_id gnl|my_center|LOCUS_04020 5321 4206 gene locus_tag LOCUS_04030 5321 4206 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964882.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence063 440 2284 gene locus_tag LOCUS_04040 gene glmS 440 2284 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_04040 2329 3495 gene locus_tag LOCUS_04050 gene nspC 2329 3495 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_04050 3590 3501 gene locus_tag LOCUS_t00080 3590 3501 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4940 3738 gene locus_tag LOCUS_04060 4940 3738 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986826.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence064 2003 465 gene locus_tag LOCUS_04070 2003 465 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_04070 2946 2041 gene locus_tag LOCUS_04080 2946 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3650 2973 gene locus_tag LOCUS_04090 3650 2973 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_04090 5401 3716 gene locus_tag LOCUS_04100 gene sulP 5401 3716 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence065 176 1000 gene locus_tag LOCUS_04110 176 1000 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203215.1 protein_id gnl|my_center|LOCUS_04110 1004 1756 gene locus_tag LOCUS_04120 1004 1756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944147.1 protein_id gnl|my_center|LOCUS_04120 1743 2537 gene locus_tag LOCUS_04130 1743 2537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877600.1 protein_id gnl|my_center|LOCUS_04130 3179 2538 gene locus_tag LOCUS_04140 3179 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3548 4387 gene locus_tag LOCUS_04150 3548 4387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_04150 4427 4810 gene locus_tag LOCUS_04160 4427 4810 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence066 2750 117 gene locus_tag LOCUS_04170 gene feoB 2750 117 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795491.1 protein_id gnl|my_center|LOCUS_04170 3732 2794 gene locus_tag LOCUS_04180 3732 2794 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_04180 5436 3979 gene locus_tag LOCUS_04190 gene gldJ 5436 3979 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence067 746 453 gene locus_tag LOCUS_04200 746 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_04200 4103 930 gene locus_tag LOCUS_04210 4103 930 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_04210 5183 4146 gene locus_tag LOCUS_04220 5183 4146 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762064.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence068 198 1613 gene locus_tag LOCUS_04230 gene gldK 198 1613 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_04230 1679 2548 gene locus_tag LOCUS_04240 gene gldL 1679 2548 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_04240 2607 4187 gene locus_tag LOCUS_04250 gene gldM 2607 4187 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_04250 4237 5208 gene locus_tag LOCUS_04260 4237 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence069 326 1870 gene locus_tag LOCUS_04270 326 1870 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_04270 2533 1913 gene locus_tag LOCUS_04280 2533 1913 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_04280 3187 2687 gene locus_tag LOCUS_04290 gene tpx 3187 2687 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084394.1 protein_id gnl|my_center|LOCUS_04290 4154 3309 gene locus_tag LOCUS_04300 4154 3309 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_04300 <5445 4265 gene locus_tag LOCUS_04310 <5445 4265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783573.1:L-aspartate oxidase >Feature sequence070 1981 101 gene locus_tag LOCUS_04320 1981 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2297 2223 gene locus_tag LOCUS_t00090 2297 2223 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3429 2611 gene locus_tag LOCUS_04330 gene tsf 3429 2611 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_04330 4364 3549 gene locus_tag LOCUS_04340 gene rpsB 4364 3549 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_04340 4807 4732 gene locus_tag LOCUS_t00100 4807 4732 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 1504 494 gene locus_tag LOCUS_04350 1504 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04350 3495 1507 gene locus_tag LOCUS_04360 3495 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 4066 4578 gene locus_tag LOCUS_04370 4066 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5176 4652 gene locus_tag LOCUS_04380 5176 4652 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201864.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence072 1602 328 gene locus_tag LOCUS_04390 gene serS 1602 328 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_04390 2961 1783 gene locus_tag LOCUS_04400 2961 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 4253 2958 gene locus_tag LOCUS_04410 4253 2958 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639968.1 protein_id gnl|my_center|LOCUS_04410 5078 4404 gene locus_tag LOCUS_04420 gene trmD 5078 4404 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence073 151 1050 gene locus_tag LOCUS_04430 151 1050 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_04430 1064 2725 gene locus_tag LOCUS_04440 gene recN 1064 2725 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_04440 2740 3324 gene locus_tag LOCUS_04450 2740 3324 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_04450 3324 4250 gene locus_tag LOCUS_04460 3324 4250 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785778.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence074 2452 131 gene locus_tag LOCUS_04470 2452 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2688 3449 gene locus_tag LOCUS_04480 2688 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4796 3993 gene locus_tag LOCUS_04490 4796 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence075 687 97 gene locus_tag LOCUS_04500 687 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292165.1 protein_id gnl|my_center|LOCUS_04500 1091 3862 gene locus_tag LOCUS_04510 1091 3862 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_04510 4276 3926 gene locus_tag LOCUS_04520 4276 3926 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760912.1 protein_id gnl|my_center|LOCUS_04520 5010 4288 gene locus_tag LOCUS_04530 gene dapB 5010 4288 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence076 <1 1085 gene locus_tag LOCUS_04540 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788748.1:DNA polymerase III subunit beta 1117 1968 gene locus_tag LOCUS_04550 gene prmC 1117 1968 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_04550 1971 2435 gene locus_tag LOCUS_04560 1971 2435 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_04560 2506 3108 gene locus_tag LOCUS_04570 2506 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 3845 3360 gene locus_tag LOCUS_04580 3845 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 <5193 3855 gene locus_tag LOCUS_04590 <5193 3855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791796.1:peptidase domain-containing ABC transporter >Feature sequence077 661 2679 gene locus_tag LOCUS_04600 661 2679 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_04600 3499 2771 gene locus_tag LOCUS_04610 gene fabG 3499 2771 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_04610 5015 3516 gene locus_tag LOCUS_04620 5015 3516 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence078 <1 801 gene locus_tag LOCUS_04630 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986841.1:Stk1 family PASTA domain-containing Ser/Thr kinase 878 1663 gene locus_tag LOCUS_04640 gene mazG 878 1663 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_04640 1698 2159 gene locus_tag LOCUS_04650 1698 2159 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016553.1 protein_id gnl|my_center|LOCUS_04650 2235 4370 gene locus_tag LOCUS_04660 2235 4370 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence079 108 896 gene locus_tag LOCUS_04670 108 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 1432 926 gene locus_tag LOCUS_04680 1432 926 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_04680 4911 1429 gene locus_tag LOCUS_04690 4911 1429 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence080 40 1482 gene locus_tag LOCUS_04700 40 1482 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_04700 1645 2184 gene locus_tag LOCUS_04710 1645 2184 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071067.1 protein_id gnl|my_center|LOCUS_04710 3389 2223 gene locus_tag LOCUS_04720 3389 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528599.1 protein_id gnl|my_center|LOCUS_04720 4331 3477 gene locus_tag LOCUS_04730 gene lgt 4331 3477 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108644.1 protein_id gnl|my_center|LOCUS_04730 5055 4357 gene locus_tag LOCUS_04740 5055 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence081 71 346 gene locus_tag LOCUS_04750 71 346 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_04750 864 376 gene locus_tag LOCUS_04760 gene ispF 864 376 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_04760 1002 2192 gene locus_tag LOCUS_04770 1002 2192 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107809.1 protein_id gnl|my_center|LOCUS_04770 2368 2736 gene locus_tag LOCUS_04780 2368 2736 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681167.1 protein_id gnl|my_center|LOCUS_04780 2780 4702 gene locus_tag LOCUS_04790 2780 4702 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence082 764 36 gene locus_tag LOCUS_04800 764 36 CDS product DUF6064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765763.1 protein_id gnl|my_center|LOCUS_04800 1253 768 gene locus_tag LOCUS_04810 1253 768 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761611.1 protein_id gnl|my_center|LOCUS_04810 2025 1258 gene locus_tag LOCUS_04820 2025 1258 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765764.1 protein_id gnl|my_center|LOCUS_04820 2193 4013 gene locus_tag LOCUS_04830 2193 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4043 4489 gene locus_tag LOCUS_04840 gene aroQ 4043 4489 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence083 28 531 gene locus_tag LOCUS_04850 28 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 794 1408 gene locus_tag LOCUS_04860 794 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 1467 2000 gene locus_tag LOCUS_04870 1467 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 2034 2876 gene locus_tag LOCUS_04880 2034 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3025 3582 gene locus_tag LOCUS_04890 3025 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262912.1 protein_id gnl|my_center|LOCUS_04890 3594 4412 gene locus_tag LOCUS_04900 3594 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681682.1 protein_id gnl|my_center|LOCUS_04900 4524 4883 gene locus_tag LOCUS_04910 4524 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence084 4949 2715 gene locus_tag LOCUS_04920 4949 2715 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107297.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence085 982 212 gene locus_tag LOCUS_04930 982 212 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_04930 1743 1072 gene locus_tag LOCUS_04940 1743 1072 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_04940 2721 1750 gene locus_tag LOCUS_04950 2721 1750 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_04950 2989 3315 gene locus_tag LOCUS_04960 2989 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4887 3373 gene locus_tag LOCUS_04970 4887 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence086 1829 882 gene locus_tag LOCUS_04980 1829 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 2844 1921 gene locus_tag LOCUS_04990 2844 1921 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_04990 3670 2861 gene locus_tag LOCUS_05000 3670 2861 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763634.1 protein_id gnl|my_center|LOCUS_05000 <5010 3699 gene locus_tag LOCUS_05010 <5010 3699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761713.1:ribonuclease R >Feature sequence087 1489 62 gene locus_tag LOCUS_05020 1489 62 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_05020 1527 2705 gene locus_tag LOCUS_05030 1527 2705 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_05030 3087 3395 gene locus_tag LOCUS_05040 3087 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05040 3414 4052 gene locus_tag LOCUS_05050 3414 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05050 <4982 4133 gene locus_tag LOCUS_05060 <4982 4133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763156.1:excinuclease ABC subunit UvrB >Feature sequence088 604 2604 gene locus_tag LOCUS_05070 604 2604 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786503.1 protein_id gnl|my_center|LOCUS_05070 3404 4150 gene locus_tag LOCUS_05080 3404 4150 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence089 638 483 gene locus_tag LOCUS_05090 638 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 919 638 gene locus_tag LOCUS_05100 919 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1532 1182 gene locus_tag LOCUS_05110 1532 1182 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061630.1 protein_id gnl|my_center|LOCUS_05110 1897 2223 gene locus_tag LOCUS_05120 1897 2223 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_05120 2265 3503 gene locus_tag LOCUS_05130 2265 3503 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964839.1 protein_id gnl|my_center|LOCUS_05130 3490 4020 gene locus_tag LOCUS_05140 3490 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence090 3 638 gene locus_tag LOCUS_05150 3 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 645 1904 gene locus_tag LOCUS_05160 645 1904 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_05160 1948 2547 gene locus_tag LOCUS_05170 1948 2547 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108963.1 protein_id gnl|my_center|LOCUS_05170 2531 3466 gene locus_tag LOCUS_05180 2531 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 4689 3481 gene locus_tag LOCUS_05190 gene hydF 4689 3481 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence091 91 1473 gene locus_tag LOCUS_05200 91 1473 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_05200 3917 1758 gene locus_tag LOCUS_05210 3917 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4687 3983 gene locus_tag LOCUS_05220 4687 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence092 225 560 gene locus_tag LOCUS_05230 gene yajC 225 560 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_05230 715 1596 gene locus_tag LOCUS_05240 715 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 1593 2174 gene locus_tag LOCUS_05250 gene coaE 1593 2174 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_05250 2229 3980 gene locus_tag LOCUS_05260 2229 3980 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_05260 <4814 4047 gene locus_tag LOCUS_05270 <4814 4047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203550.1:asparagine--tRNA ligase >Feature sequence093 <1 747 gene locus_tag LOCUS_05280 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964374.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein 811 2235 gene locus_tag LOCUS_05290 811 2235 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_05290 2222 2956 gene locus_tag LOCUS_05300 2222 2956 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_05300 2969 3733 gene locus_tag LOCUS_05310 2969 3733 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_05310 3770 3858 gene locus_tag LOCUS_t00110 3770 3858 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3914 4288 gene locus_tag LOCUS_05320 3914 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence094 1674 3929 gene locus_tag LOCUS_05330 1674 3929 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_05330 3946 4527 gene locus_tag LOCUS_05340 3946 4527 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence095 2238 2837 gene locus_tag LOCUS_05350 2238 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2824 3798 gene locus_tag LOCUS_05360 2824 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3808 4080 gene locus_tag LOCUS_05370 3808 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4276 4757 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctataagacacttataatttctactattgtagat >Feature sequence096 17 628 gene locus_tag LOCUS_05380 17 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 1840 728 gene locus_tag LOCUS_05390 gene prfA 1840 728 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_05390 1973 3328 gene locus_tag LOCUS_05400 1973 3328 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_05400 3595 4593 gene locus_tag LOCUS_05410 gene gap 3595 4593 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence097 2409 2825 gene locus_tag LOCUS_05420 2409 2825 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097334.1 protein_id gnl|my_center|LOCUS_05420 2847 4235 gene locus_tag LOCUS_05430 gene mnmE 2847 4235 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence098 832 398 gene locus_tag LOCUS_05440 gene coaD 832 398 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_05440 1481 879 gene locus_tag LOCUS_05450 gene yihA 1481 879 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_05450 3560 1506 gene locus_tag LOCUS_05460 gene metG 3560 1506 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_05460 3833 4114 gene locus_tag LOCUS_05470 3833 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 <4749 4216 gene locus_tag LOCUS_05480 <4749 4216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019623259.1:GTP diphosphokinase >Feature sequence099 <1 826 gene locus_tag LOCUS_05490 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962994.1:histidine ammonia-lyase 1907 942 gene locus_tag LOCUS_05500 1907 942 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_05500 2985 1891 gene locus_tag LOCUS_05510 2985 1891 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_05510 4260 3001 gene locus_tag LOCUS_05520 4260 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence100 <1 2146 gene locus_tag LOCUS_05530 <1 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763951.1:elongation factor G 3465 2257 gene locus_tag LOCUS_05540 gene rocD 3465 2257 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_05540 4556 3600 gene locus_tag LOCUS_05550 4556 3600 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence101 <1 1707 gene locus_tag LOCUS_05560 <1 1707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025814212.1:BatD family protein 1744 2496 gene locus_tag LOCUS_05570 1744 2496 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_05570 3242 2520 gene locus_tag LOCUS_05580 3242 2520 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_05580 4419 3262 gene locus_tag LOCUS_05590 4419 3262 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence102 <1 798 gene locus_tag LOCUS_05600 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108113.1:polyprenyl synthetase family protein 825 1721 gene locus_tag LOCUS_05610 825 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108112.1 protein_id gnl|my_center|LOCUS_05610 2771 1758 gene locus_tag LOCUS_05620 gene murB 2771 1758 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_05620 3242 2784 gene locus_tag LOCUS_05630 gene bcp 3242 2784 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_05630 3539 3258 gene locus_tag LOCUS_05640 3539 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence103 <1 2328 gene locus_tag LOCUS_05650 <1 2328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201927.1:AsmA-like C-terminal region-containing protein 2344 3195 gene locus_tag LOCUS_05660 2344 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4450 3218 gene locus_tag LOCUS_05670 4450 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence104 602 1438 gene locus_tag LOCUS_05680 602 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4176 1558 gene locus_tag LOCUS_05690 gene mutS 4176 1558 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence105 <1 620 gene locus_tag LOCUS_05700 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005694271.1:aminodeoxychorismate synthase component I 604 1212 gene locus_tag LOCUS_05710 604 1212 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694272.1 protein_id gnl|my_center|LOCUS_05710 1368 2897 gene locus_tag LOCUS_05720 1368 2897 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005916172.1 protein_id gnl|my_center|LOCUS_05720 2981 3553 gene locus_tag LOCUS_05730 2981 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence106 515 1798 gene locus_tag LOCUS_05740 515 1798 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795347.1 protein_id gnl|my_center|LOCUS_05740 3708 1987 gene locus_tag LOCUS_05750 3708 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence107 1299 1892 gene locus_tag LOCUS_05760 1299 1892 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_05760 3942 2005 gene locus_tag LOCUS_05770 3942 2005 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence108 <1 773 gene locus_tag LOCUS_05780 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787151.1:TonB-dependent receptor 807 2243 gene locus_tag LOCUS_05790 807 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4014 3001 gene locus_tag LOCUS_05800 4014 3001 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_05800 <4562 4037 gene locus_tag LOCUS_05810 <4562 4037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768080.1:transcription antitermination factor NusB >Feature sequence109 802 419 gene locus_tag LOCUS_05820 802 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1476 1874 gene locus_tag LOCUS_05830 1476 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1895 2470 gene locus_tag LOCUS_05840 1895 2470 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_05840 2528 3520 gene locus_tag LOCUS_05850 gene obgE 2528 3520 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_05850 3563 4132 gene locus_tag LOCUS_05860 3563 4132 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence110 334 1464 gene locus_tag LOCUS_05870 gene tgt 334 1464 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761519.1 protein_id gnl|my_center|LOCUS_05870 1481 2650 gene locus_tag LOCUS_05880 1481 2650 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_05880 2757 3860 gene locus_tag LOCUS_05890 gene ychF 2757 3860 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_05890 4328 3870 gene locus_tag LOCUS_05900 4328 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence111 795 2123 gene locus_tag LOCUS_05910 gene ctpM 795 2123 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_05910 3476 2205 gene locus_tag LOCUS_05920 3476 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 3600 4340 gene locus_tag LOCUS_05930 gene gldF 3600 4340 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence112 1446 145 gene locus_tag LOCUS_05940 1446 145 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_05940 2683 1451 gene locus_tag LOCUS_05950 2683 1451 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_05950 4012 2702 gene locus_tag LOCUS_05960 gene mraY 4012 2702 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence113 >Feature sequence114 357 854 gene locus_tag LOCUS_05970 gene atpF 357 854 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_05970 860 1399 gene locus_tag LOCUS_05980 gene atpH 860 1399 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_05980 1516 3096 gene locus_tag LOCUS_05990 gene atpA 1516 3096 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_05990 3163 4038 gene locus_tag LOCUS_06000 3163 4038 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence115 <1 1918 gene locus_tag LOCUS_06010 <1 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107719.1:glycosyltransferase family 2 protein 1947 2525 gene locus_tag LOCUS_06020 1947 2525 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775732.1 protein_id gnl|my_center|LOCUS_06020 2584 3888 gene locus_tag LOCUS_06030 2584 3888 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence116 <1 1418 gene locus_tag LOCUS_06040 <1 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203753.1:leucine--tRNA ligase 1492 3141 gene locus_tag LOCUS_06050 1492 3141 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_06050 3161 3583 gene locus_tag LOCUS_06060 3161 3583 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791034.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence117 604 95 gene locus_tag LOCUS_06070 604 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1174 617 gene locus_tag LOCUS_06080 1174 617 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_06080 2560 1469 gene locus_tag LOCUS_06090 gene gcvT 2560 1469 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_06090 3812 2589 gene locus_tag LOCUS_06100 gene pepT 3812 2589 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_06100 3903 4331 gene locus_tag LOCUS_06110 3903 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence118 2259 1390 gene locus_tag LOCUS_06120 2259 1390 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660290.1 protein_id gnl|my_center|LOCUS_06120 3313 2294 gene locus_tag LOCUS_06130 3313 2294 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785797.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence119 <1 868 gene locus_tag LOCUS_06140 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203586.1:nucleotidyltransferase 859 1971 gene locus_tag LOCUS_06150 gene galE 859 1971 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_06150 2026 3036 gene locus_tag LOCUS_06160 gene pheS 2026 3036 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_06160 3050 3211 gene locus_tag LOCUS_06170 3050 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 3211 4209 gene locus_tag LOCUS_06180 gene dusB 3211 4209 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797153.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence120 32 1651 gene locus_tag LOCUS_06190 32 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2522 1734 gene locus_tag LOCUS_06200 2522 1734 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_06200 <4311 2497 gene locus_tag LOCUS_06210 <4311 2497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783490.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit >Feature sequence121 425 1657 gene locus_tag LOCUS_06220 425 1657 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_06220 1690 3438 gene locus_tag LOCUS_06230 gene sppA 1690 3438 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence122 544 855 gene locus_tag LOCUS_06240 544 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2360 927 gene locus_tag LOCUS_06250 gene aspA 2360 927 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_06250 3270 2383 gene locus_tag LOCUS_06260 gene rfbD 3270 2383 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_06260 4179 3325 gene locus_tag LOCUS_06270 gene folP 4179 3325 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence123 <1 1852 gene locus_tag LOCUS_06280 <1 1852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783855.1:ABC transporter ATP-binding protein 1849 3249 gene locus_tag LOCUS_06290 1849 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3266 4165 gene locus_tag LOCUS_06300 3266 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence124 <4195 112 gene locus_tag LOCUS_06310 <4195 112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804126.1:DNA-directed RNA polymerase subunit beta' >Feature sequence125 83 406 gene locus_tag LOCUS_06320 83 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 1861 419 gene locus_tag LOCUS_06330 1861 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence126 874 431 gene locus_tag LOCUS_06340 874 431 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_06340 1929 868 gene locus_tag LOCUS_06350 gene aroC 1929 868 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766481.1 protein_id gnl|my_center|LOCUS_06350 2511 1951 gene locus_tag LOCUS_06360 2511 1951 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_06360 3201 2560 gene locus_tag LOCUS_06370 3201 2560 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801226.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence127 269 661 gene locus_tag LOCUS_06380 269 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 724 1182 gene locus_tag LOCUS_06390 724 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111796.1 protein_id gnl|my_center|LOCUS_06390 1870 1277 gene locus_tag LOCUS_06400 1870 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2763 2017 gene locus_tag LOCUS_06410 2763 2017 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_06410 <4146 2750 gene locus_tag LOCUS_06420 <4146 2750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003021152.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase >Feature sequence128 2321 12 gene locus_tag LOCUS_06430 2321 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence129 163 1059 gene locus_tag LOCUS_06440 163 1059 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_06440 1090 2274 gene locus_tag LOCUS_06450 1090 2274 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_06450 2275 3873 gene locus_tag LOCUS_06460 2275 3873 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence130 2027 1056 gene locus_tag LOCUS_06470 2027 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3711 2110 gene locus_tag LOCUS_06480 3711 2110 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788170.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence131 93 165 gene locus_tag LOCUS_t00120 93 165 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 239 1426 gene locus_tag LOCUS_06490 gene tuf 239 1426 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_06490 1501 1576 gene locus_tag LOCUS_t00130 1501 1576 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1600 1785 gene locus_tag LOCUS_06500 1600 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 1807 2367 gene locus_tag LOCUS_06510 gene nusG 1807 2367 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence132 159 617 gene locus_tag LOCUS_06520 159 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 689 1123 gene locus_tag LOCUS_06530 689 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 1123 2247 gene locus_tag LOCUS_06540 1123 2247 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_06540 <4052 2343 gene locus_tag LOCUS_06550 <4052 2343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791939.1:tetratricopeptide repeat protein >Feature sequence133 503 2830 gene locus_tag LOCUS_06560 503 2830 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence134 13 687 gene locus_tag LOCUS_06570 13 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 731 1483 gene locus_tag LOCUS_06580 731 1483 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence135 650 1621 gene locus_tag LOCUS_06590 650 1621 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_06590 1868 1683 gene locus_tag LOCUS_06600 gene rpmF 1868 1683 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_06600 2405 1875 gene locus_tag LOCUS_06610 2405 1875 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_06610 3532 2615 gene locus_tag LOCUS_06620 3532 2615 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108346.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence136 1099 1965 gene locus_tag LOCUS_06630 gene miaA 1099 1965 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_06630 2003 2626 gene locus_tag LOCUS_06640 2003 2626 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_06640 3831 2665 gene locus_tag LOCUS_06650 3831 2665 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence137 148 1395 gene locus_tag LOCUS_06660 148 1395 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_06660 1441 2502 gene locus_tag LOCUS_06670 1441 2502 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_06670 2548 3681 gene locus_tag LOCUS_06680 2548 3681 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_06680 3698 3862 gene locus_tag LOCUS_06690 3698 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence138 <1 818 gene locus_tag LOCUS_06700 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460941.1:methylaspartate mutase subunit E 874 2118 gene locus_tag LOCUS_06710 874 2118 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_06710 2141 3520 gene locus_tag LOCUS_06720 2141 3520 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124259.1 protein_id gnl|my_center|LOCUS_06720 3536 3853 gene locus_tag LOCUS_06730 3536 3853 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583697.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence139 2213 465 gene locus_tag LOCUS_06740 gene recJ 2213 465 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_06740 2406 3656 gene locus_tag LOCUS_06750 2406 3656 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence140 698 90 gene locus_tag LOCUS_06760 698 90 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_06760 2059 698 gene locus_tag LOCUS_06770 gene hisS 2059 698 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_06770 3142 2087 gene locus_tag LOCUS_06780 gene queA 3142 2087 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_06780 3751 3290 gene locus_tag LOCUS_06790 gene rlmH 3751 3290 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence141 <1 2104 gene locus_tag LOCUS_06800 <1 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790883.1:methylmalonyl-CoA mutase 2943 2326 gene locus_tag LOCUS_06810 2943 2326 CDS product YkgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658466.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence142 1424 2764 gene locus_tag LOCUS_06820 gene lpdA 1424 2764 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_06820 <3918 2866 gene locus_tag LOCUS_06830 <3918 2866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838096.1:OmpA family protein >Feature sequence143 896 231 gene locus_tag LOCUS_06840 gene mnmD 896 231 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 protein_id gnl|my_center|LOCUS_06840 1513 917 gene locus_tag LOCUS_06850 gene pnuC 1513 917 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_06850 1831 1517 gene locus_tag LOCUS_06860 1831 1517 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459318.1 protein_id gnl|my_center|LOCUS_06860 3100 1880 gene locus_tag LOCUS_06870 3100 1880 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_06870 <3914 3278 gene locus_tag LOCUS_06880 <3914 3278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766212.1:S46 family peptidase >Feature sequence144 2987 1572 gene locus_tag LOCUS_06890 gene creD 2987 1572 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_06890 3269 3535 gene locus_tag LOCUS_06900 3269 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3544 3810 gene locus_tag LOCUS_06910 3544 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence145 69 1079 gene locus_tag LOCUS_06920 69 1079 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_06920 1174 1674 gene locus_tag LOCUS_06930 1174 1674 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_06930 1671 2108 gene locus_tag LOCUS_06940 1671 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2136 2585 gene locus_tag LOCUS_06950 2136 2585 CDS product DUF6108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841026.1 protein_id gnl|my_center|LOCUS_06950 2697 3542 gene locus_tag LOCUS_06960 2697 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence146 1829 1080 gene locus_tag LOCUS_06970 1829 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2554 1859 gene locus_tag LOCUS_06980 2554 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3756 2671 gene locus_tag LOCUS_06990 gene serC 3756 2671 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence147 <1 985 gene locus_tag LOCUS_07000 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_079703094.1:DUF5687 family protein 1489 1061 gene locus_tag LOCUS_07010 1489 1061 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_07010 2504 1626 gene locus_tag LOCUS_07020 2504 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3657 2767 gene locus_tag LOCUS_07030 3657 2767 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence148 1229 114 gene locus_tag LOCUS_07040 1229 114 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_07040 1488 1562 gene locus_tag LOCUS_t00140 1488 1562 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3668 1596 gene locus_tag LOCUS_07050 gene dnaG 3668 1596 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence149 565 14 gene locus_tag LOCUS_07060 565 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1010 573 gene locus_tag LOCUS_07070 1010 573 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_07070 2393 1122 gene locus_tag LOCUS_07080 2393 1122 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_07080 3761 2580 gene locus_tag LOCUS_07090 3761 2580 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence150 1691 135 gene locus_tag LOCUS_07100 gene eptA 1691 135 CDS product phosphoethanolamine--lipid A transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157542.1 protein_id gnl|my_center|LOCUS_07100 1928 3595 gene locus_tag LOCUS_07110 1928 3595 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence151 <1 2106 gene locus_tag LOCUS_07120 <1 2106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803825.1:glycosyltransferase family 1 protein 2359 2814 gene locus_tag LOCUS_07130 gene rplM 2359 2814 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760800.1 protein_id gnl|my_center|LOCUS_07130 2823 3209 gene locus_tag LOCUS_07140 gene rpsI 2823 3209 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence152 3300 1888 gene locus_tag LOCUS_07150 3300 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence153 190 726 gene locus_tag LOCUS_07160 190 726 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108149.1 protein_id gnl|my_center|LOCUS_07160 1612 749 gene locus_tag LOCUS_07170 1612 749 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_07170 2450 1638 gene locus_tag LOCUS_07180 gene ispE 2450 1638 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_07180 2581 3633 gene locus_tag LOCUS_07190 gene hemW 2581 3633 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence154 402 974 gene locus_tag LOCUS_07200 402 974 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681208.1 protein_id gnl|my_center|LOCUS_07200 1101 1658 gene locus_tag LOCUS_07210 1101 1658 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_07210 1794 2075 gene locus_tag LOCUS_07220 1794 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2132 2602 gene locus_tag LOCUS_07230 2132 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2657 2728 gene locus_tag LOCUS_t00150 2657 2728 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 <3690 2834 gene locus_tag LOCUS_07240 <3690 2834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032813763.1:excinuclease ABC subunit UvrA >Feature sequence155 355 2397 gene locus_tag LOCUS_07250 355 2397 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841441.1 protein_id gnl|my_center|LOCUS_07250 2752 2474 gene locus_tag LOCUS_07260 2752 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2977 2756 gene locus_tag LOCUS_07270 2977 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence156 1568 153 gene locus_tag LOCUS_07280 1568 153 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_07280 2549 1596 gene locus_tag LOCUS_07290 2549 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3201 2770 gene locus_tag LOCUS_07300 3201 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence157 <1 737 gene locus_tag LOCUS_07310 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071319.1:FKBP-type peptidyl-prolyl cis-trans isomerase 826 899 gene locus_tag LOCUS_t00160 826 899 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1800 1006 gene locus_tag LOCUS_07320 1800 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2838 1813 gene locus_tag LOCUS_07330 2838 1813 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766890.1 protein_id gnl|my_center|LOCUS_07330 3452 2883 gene locus_tag LOCUS_07340 3452 2883 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109354.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence158 1945 368 gene locus_tag LOCUS_07350 1945 368 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107693.1 protein_id gnl|my_center|LOCUS_07350 2048 3109 gene locus_tag LOCUS_07360 gene gmd 2048 3109 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence159 <1 1181 gene locus_tag LOCUS_07370 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786352.1:Rne/Rng family ribonuclease 1210 1938 gene locus_tag LOCUS_07380 1210 1938 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_07380 1996 3261 gene locus_tag LOCUS_07390 1996 3261 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence160 1729 191 gene locus_tag LOCUS_07400 1729 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3021 1819 gene locus_tag LOCUS_07410 3021 1819 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_07410 3552 3163 gene locus_tag LOCUS_07420 3552 3163 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790413.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence161 347 1378 gene locus_tag LOCUS_07430 347 1378 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_07430 1388 2644 gene locus_tag LOCUS_07440 1388 2644 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_07440 2672 3346 gene locus_tag LOCUS_07450 2672 3346 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932742.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence162 1643 195 gene locus_tag LOCUS_07460 gene guaB 1643 195 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017001.1 protein_id gnl|my_center|LOCUS_07460 2973 1678 gene locus_tag LOCUS_07470 gene purB 2973 1678 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 protein_id gnl|my_center|LOCUS_07470 3222 3506 gene locus_tag LOCUS_07480 3222 3506 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883059.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence163 44 1966 gene locus_tag LOCUS_07490 44 1966 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_07490 2480 2088 gene locus_tag LOCUS_07500 2480 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence164 98 1774 gene locus_tag LOCUS_07510 98 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2582 1944 gene locus_tag LOCUS_07520 gene nth 2582 1944 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_07520 <3532 2671 gene locus_tag LOCUS_07530 <3532 2671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202434.1:nitronate monooxygenase >Feature sequence165 <1 781 gene locus_tag LOCUS_07540 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062694591.1:PepSY-associated TM helix domain-containing protein 943 869 gene locus_tag LOCUS_t00170 943 869 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1181 2713 gene locus_tag LOCUS_07550 1181 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 <3512 2939 gene locus_tag LOCUS_07560 <3512 2939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058235.1:molybdopterin-synthase adenylyltransferase MoeB >Feature sequence166 45 1301 gene locus_tag LOCUS_07570 gene fabF 45 1301 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_07570 2707 1679 gene locus_tag LOCUS_07580 gene holA 2707 1679 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_07580 2758 3213 gene locus_tag LOCUS_07590 2758 3213 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761554.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence167 1576 230 gene locus_tag LOCUS_07600 gene tig 1576 230 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_07600 3304 1817 gene locus_tag LOCUS_07610 3304 1817 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence168 <1 1010 gene locus_tag LOCUS_07620 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789619.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1730 1248 gene locus_tag LOCUS_07630 1730 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2125 1724 gene locus_tag LOCUS_07640 2125 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3022 2336 gene locus_tag LOCUS_07650 3022 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence169 458 1048 gene locus_tag LOCUS_07660 458 1048 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_07660 1781 1032 gene locus_tag LOCUS_07670 1781 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2140 1910 gene locus_tag LOCUS_07680 2140 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 <3485 2405 gene locus_tag LOCUS_07690 <3485 2405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768087.1:ABC transporter substrate-binding protein >Feature sequence170 262 1449 gene locus_tag LOCUS_07700 262 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2070 1564 gene locus_tag LOCUS_07710 2070 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797867.1 protein_id gnl|my_center|LOCUS_07710 3314 2067 gene locus_tag LOCUS_07720 3314 2067 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence171 1351 170 gene locus_tag LOCUS_07730 1351 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 1987 1382 gene locus_tag LOCUS_07740 1987 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence172 982 305 gene locus_tag LOCUS_07750 gene uvrY 982 305 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216518.1 protein_id gnl|my_center|LOCUS_07750 2744 1008 gene locus_tag LOCUS_07760 2744 1008 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012792659.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence173 1252 464 gene locus_tag LOCUS_07770 1252 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2176 1958 gene locus_tag LOCUS_07780 2176 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3096 2191 gene locus_tag LOCUS_07790 3096 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence174 <1 1582 gene locus_tag LOCUS_07800 <1 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761973.1:phosphoenolpyruvate carboxykinase (ATP) 2605 1643 gene locus_tag LOCUS_07810 2605 1643 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_07810 2841 3314 gene locus_tag LOCUS_07820 2841 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence175 61 447 gene locus_tag LOCUS_07830 61 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 469 1587 gene locus_tag LOCUS_07840 469 1587 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202849.1 protein_id gnl|my_center|LOCUS_07840 3212 1656 gene locus_tag LOCUS_07850 3212 1656 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence176 210 1145 gene locus_tag LOCUS_07860 gene cas1 210 1145 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_07860 1192 1551 gene locus_tag LOCUS_07870 1192 1551 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_07870 2543 2025 gene locus_tag LOCUS_07880 2543 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3066 2548 gene locus_tag LOCUS_07890 3066 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence177 2232 1237 gene locus_tag LOCUS_07900 2232 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3359 2250 gene locus_tag LOCUS_07910 3359 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence178 1089 2147 gene locus_tag LOCUS_07920 gene rfbB 1089 2147 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202143.1 protein_id gnl|my_center|LOCUS_07920 2168 2713 gene locus_tag LOCUS_07930 2168 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence179 31 225 gene locus_tag LOCUS_07940 31 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1826 339 gene locus_tag LOCUS_07950 1826 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence180 188 925 gene locus_tag LOCUS_07960 188 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1112 2011 gene locus_tag LOCUS_07970 1112 2011 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_07970 2787 2578 gene locus_tag LOCUS_07980 2787 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2734 3087 gene locus_tag LOCUS_07990 2734 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence181 1702 605 gene locus_tag LOCUS_08000 gene pyrB 1702 605 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_08000 2373 1741 gene locus_tag LOCUS_08010 gene pyrE 2373 1741 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989825.1 protein_id gnl|my_center|LOCUS_08010 3293 2409 gene locus_tag LOCUS_08020 gene uppP 3293 2409 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881444.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence182 1000 176 gene locus_tag LOCUS_08030 1000 176 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108275.1 protein_id gnl|my_center|LOCUS_08030 3264 1030 gene locus_tag LOCUS_08040 3264 1030 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence183 231 1262 gene locus_tag LOCUS_08050 231 1262 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_08050 1329 2897 gene locus_tag LOCUS_08060 1329 2897 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_08060 2937 3101 gene locus_tag LOCUS_08070 2937 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence184 1885 722 gene locus_tag LOCUS_08080 1885 722 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence185 2529 1414 gene locus_tag LOCUS_08090 2529 1414 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765918.1 protein_id gnl|my_center|LOCUS_08090 <3322 2567 gene locus_tag LOCUS_08100 <3322 2567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786918.1:cytochrome ubiquinol oxidase subunit I >Feature sequence186 <1 1286 gene locus_tag LOCUS_08110 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791020.1:phosphoglucosamine mutase 2625 1576 gene locus_tag LOCUS_08120 2625 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3083 2733 gene locus_tag LOCUS_08130 3083 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence187 582 1889 gene locus_tag LOCUS_08140 582 1889 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_08140 2026 2649 gene locus_tag LOCUS_08150 2026 2649 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence188 403 843 gene locus_tag LOCUS_08160 403 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 919 1839 gene locus_tag LOCUS_08170 919 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1993 2694 gene locus_tag LOCUS_08180 1993 2694 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence189 251 2776 gene locus_tag LOCUS_08190 gene alaS 251 2776 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence190 464 393 gene locus_tag LOCUS_t00180 464 393 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 591 1913 gene locus_tag LOCUS_08200 591 1913 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_08200 1921 2643 gene locus_tag LOCUS_08210 gene rsmI 1921 2643 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_08210 <3286 2688 gene locus_tag LOCUS_08220 <3286 2688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000810537.1:sodium:proton antiporter >Feature sequence191 812 1507 gene locus_tag LOCUS_08230 812 1507 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_08230 <3275 1651 gene locus_tag LOCUS_08240 <3275 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943350.1:fibronectin type III >Feature sequence192 608 1489 gene locus_tag LOCUS_08250 608 1489 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_08250 1850 3226 gene locus_tag LOCUS_08260 gene dnaA 1850 3226 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence193 641 1987 gene locus_tag LOCUS_08270 641 1987 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_08270 2009 2527 gene locus_tag LOCUS_08280 2009 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2542 3198 gene locus_tag LOCUS_08290 gene rpe 2542 3198 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802152.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence194 473 57 gene locus_tag LOCUS_08300 gene mscL 473 57 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759941.1 protein_id gnl|my_center|LOCUS_08300 1733 510 gene locus_tag LOCUS_08310 1733 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1951 2694 gene locus_tag LOCUS_08320 1951 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence195 150 347 gene locus_tag LOCUS_08330 gene rpmI 150 347 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_08330 439 792 gene locus_tag LOCUS_08340 gene rplT 439 792 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_08340 1019 1648 gene locus_tag LOCUS_08350 1019 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 <3215 1677 gene locus_tag LOCUS_08360 <3215 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109022.1:ATP-dependent DNA helicase RecG >Feature sequence196 59 132 gene locus_tag LOCUS_t00190 59 132 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 150 234 gene locus_tag LOCUS_t00200 150 234 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 260 344 gene locus_tag LOCUS_t00210 260 344 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1411 476 gene locus_tag LOCUS_08370 1411 476 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816458.1 protein_id gnl|my_center|LOCUS_08370 <3212 1434 gene locus_tag LOCUS_08380 <3212 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796864.1:Ig-like domain-containing protein >Feature sequence197 753 825 gene locus_tag LOCUS_t00220 753 825 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1009 2811 gene locus_tag LOCUS_08390 gene lepA 1009 2811 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_08390 2819 3001 gene locus_tag LOCUS_08400 2819 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence198 362 2587 gene locus_tag LOCUS_08410 362 2587 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661694.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence199 327 989 gene locus_tag LOCUS_08420 327 989 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_08420 1003 2310 gene locus_tag LOCUS_08430 1003 2310 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047913.1 protein_id gnl|my_center|LOCUS_08430 2396 3169 gene locus_tag LOCUS_08440 2396 3169 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence200 72 419 gene locus_tag LOCUS_08450 gene rplS 72 419 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_08450 624 1721 gene locus_tag LOCUS_08460 624 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1739 3154 gene locus_tag LOCUS_08470 1739 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence201 724 443 gene locus_tag LOCUS_08480 724 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2182 725 gene locus_tag LOCUS_08490 gene abfD 2182 725 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence202 2902 59 gene locus_tag LOCUS_08500 gene gcvP 2902 59 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765866.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence203 1564 38 gene locus_tag LOCUS_08510 1564 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_08510 2952 1561 gene locus_tag LOCUS_08520 2952 1561 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence204 <1 767 gene locus_tag LOCUS_08530 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048173276.1:ABC transporter ATP-binding protein 951 1460 gene locus_tag LOCUS_08540 951 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531831.1 protein_id gnl|my_center|LOCUS_08540 2130 3026 gene locus_tag LOCUS_08550 2130 3026 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence205 311 1633 gene locus_tag LOCUS_08560 311 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2931 1684 gene locus_tag LOCUS_08570 2931 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence206 37 414 gene locus_tag LOCUS_08580 gene gcvH 37 414 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_08580 1331 495 gene locus_tag LOCUS_08590 1331 495 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_08590 1945 1316 gene locus_tag LOCUS_08600 1945 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2798 2097 gene locus_tag LOCUS_08610 2798 2097 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence207 1363 362 gene locus_tag LOCUS_08620 1363 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 <3121 1781 gene locus_tag LOCUS_08630 <3121 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120931.1:DUF4465 domain-containing protein >Feature sequence208 1436 441 gene locus_tag LOCUS_08640 1436 441 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_08640 2049 1441 gene locus_tag LOCUS_08650 gene rpsD 2049 1441 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_08650 2470 2081 gene locus_tag LOCUS_08660 gene rpsK 2470 2081 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_08660 2883 2503 gene locus_tag LOCUS_08670 gene rpsM 2883 2503 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence209 1999 143 gene locus_tag LOCUS_08680 gene mrdA 1999 143 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_08680 2558 2049 gene locus_tag LOCUS_08690 2558 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 <3105 2555 gene locus_tag LOCUS_08700 <3105 2555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792052.1:rod shape-determining protein MreC >Feature sequence210 239 1219 gene locus_tag LOCUS_08710 239 1219 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_08710 1237 2274 gene locus_tag LOCUS_08720 1237 2274 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_08720 2271 2927 gene locus_tag LOCUS_08730 2271 2927 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803588.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence211 >Feature sequence212 2410 611 gene locus_tag LOCUS_08740 2410 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 2797 2471 gene locus_tag LOCUS_08750 2797 2471 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence213 1318 863 gene locus_tag LOCUS_08760 gene dtd 1318 863 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_08760 2261 1329 gene locus_tag LOCUS_08770 gene nadA 2261 1329 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762783.1 protein_id gnl|my_center|LOCUS_08770 2876 2286 gene locus_tag LOCUS_08780 gene folE 2876 2286 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence214 33 794 gene locus_tag LOCUS_08790 33 794 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_08790 1021 1914 gene locus_tag LOCUS_08800 1021 1914 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108892.1 protein_id gnl|my_center|LOCUS_08800 1930 2751 gene locus_tag LOCUS_08810 1930 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence215 2938 1922 gene locus_tag LOCUS_08820 2938 1922 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108892.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence216 824 1240 gene locus_tag LOCUS_08830 824 1240 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869856.1 protein_id gnl|my_center|LOCUS_08830 2028 1324 gene locus_tag LOCUS_08840 gene cmk 2028 1324 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence217 561 1424 gene locus_tag LOCUS_08850 gene lipA 561 1424 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764405.1 protein_id gnl|my_center|LOCUS_08850 2006 1413 gene locus_tag LOCUS_08860 gene aroL 2006 1413 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938191.1 protein_id gnl|my_center|LOCUS_08860 2052 2136 gene locus_tag LOCUS_t00230 2052 2136 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence218 25 1674 gene locus_tag LOCUS_08870 25 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1853 2671 gene locus_tag LOCUS_08880 gene panB 1853 2671 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787461.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence219 277 1425 gene locus_tag LOCUS_08890 277 1425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107326.1 protein_id gnl|my_center|LOCUS_08890 1444 2559 gene locus_tag LOCUS_08900 1444 2559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence220 644 249 gene locus_tag LOCUS_08910 644 249 CDS product flexirubin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964367.1 protein_id gnl|my_center|LOCUS_08910 1459 890 gene locus_tag LOCUS_08920 1459 890 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764781.1 protein_id gnl|my_center|LOCUS_08920 1561 2010 gene locus_tag LOCUS_08930 gene tagD 1561 2010 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880882.1 protein_id gnl|my_center|LOCUS_08930 2037 2765 gene locus_tag LOCUS_08940 2037 2765 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227250.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence221 2274 937 gene locus_tag LOCUS_08950 2274 937 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100249.1 protein_id gnl|my_center|LOCUS_08950 2183 2371 gene locus_tag LOCUS_08960 2183 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 <3005 2473 gene locus_tag LOCUS_08970 <3005 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775374.1:ribosome recycling factor >Feature sequence222 410 1207 gene locus_tag LOCUS_08980 410 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2130 1405 gene locus_tag LOCUS_08990 2130 1405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100836.1 protein_id gnl|my_center|LOCUS_08990 <2988 2134 gene locus_tag LOCUS_09000 <2988 2134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964365.1:BtrH N-terminal domain-containing protein >Feature sequence223 >Feature sequence224 903 235 gene locus_tag LOCUS_09010 gene ung 903 235 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_09010 1260 913 gene locus_tag LOCUS_09020 1260 913 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_09020 1771 1337 gene locus_tag LOCUS_09030 1771 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2551 2009 gene locus_tag LOCUS_09040 2551 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence225 896 516 gene locus_tag LOCUS_09050 896 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1550 909 gene locus_tag LOCUS_09060 1550 909 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence226 <1 1363 gene locus_tag LOCUS_09070 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963229.1:gliding motility-associated ABC transporter substrate-binding protein GldG >Feature sequence227 694 2376 gene locus_tag LOCUS_09080 694 2376 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798520.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence228 124 1347 gene locus_tag LOCUS_09090 124 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2188 1478 gene locus_tag LOCUS_09100 2188 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 <2855 2247 gene locus_tag LOCUS_09110 <2855 2247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109203.1:LolA-like putative outer membrane lipoprotein chaperone >Feature sequence229 83 1618 gene locus_tag LOCUS_09120 gene guaA 83 1618 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162837124.1 protein_id gnl|my_center|LOCUS_09120 1746 2642 gene locus_tag LOCUS_09130 gene miaA 1746 2642 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence230 2000 246 gene locus_tag LOCUS_09140 2000 246 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence231 >Feature sequence232 >Feature sequence233 2153 960 gene locus_tag LOCUS_09150 gene hflX 2153 960 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence234 1107 379 gene locus_tag LOCUS_09160 gene mtgA 1107 379 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_09160 1540 1133 gene locus_tag LOCUS_09170 1540 1133 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_09170 <2803 1564 gene locus_tag LOCUS_09180 <2803 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032555746.1:peptidase U32 family protein >Feature sequence235 2132 429 gene locus_tag LOCUS_09190 2132 429 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_09190 <2797 2170 gene locus_tag LOCUS_09200 <2797 2170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763251.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence236 >Feature sequence237 937 110 gene locus_tag LOCUS_09210 937 110 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_09210 2163 1210 gene locus_tag LOCUS_09220 gene prfB 2163 1210 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09220 2669 2343 gene locus_tag LOCUS_09230 2669 2343 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767264.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence238 1458 1802 gene locus_tag LOCUS_09240 1458 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2156 2599 gene locus_tag LOCUS_09250 2156 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence239 1078 35 gene locus_tag LOCUS_09260 1078 35 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_09260 2687 1134 gene locus_tag LOCUS_09270 2687 1134 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence240 1437 2366 gene locus_tag LOCUS_09280 1437 2366 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence241 881 597 gene locus_tag LOCUS_09290 881 597 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_09290 1092 1880 gene locus_tag LOCUS_09300 1092 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 <2769 1942 gene locus_tag LOCUS_09310 <2769 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965886.1:nitroreductase family protein >Feature sequence242 618 37 gene locus_tag LOCUS_09320 618 37 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_09320 2764 842 gene locus_tag LOCUS_09330 2764 842 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108840.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence243 505 2622 gene locus_tag LOCUS_09340 gene fusA 505 2622 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence244 971 156 gene locus_tag LOCUS_09350 971 156 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_09350 2652 1012 gene locus_tag LOCUS_09360 2652 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence245 54 911 gene locus_tag LOCUS_09370 54 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1032 1736 gene locus_tag LOCUS_09380 1032 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1733 2341 gene locus_tag LOCUS_09390 1733 2341 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763053.1 protein_id gnl|my_center|LOCUS_09390 2344 2676 gene locus_tag LOCUS_09400 2344 2676 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778408.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence246 157 1248 gene locus_tag LOCUS_09410 gene dprA 157 1248 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_09410 1410 1336 gene locus_tag LOCUS_t00240 1410 1336 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2433 1477 gene locus_tag LOCUS_09420 2433 1477 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence247 <1 527 gene locus_tag LOCUS_09430 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804150.1:MBOAT family protein 1111 2034 gene locus_tag LOCUS_09440 gene xerD 1111 2034 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence248 798 1025 gene locus_tag LOCUS_09450 798 1025 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_09450 1046 2128 gene locus_tag LOCUS_09460 1046 2128 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence249 806 96 gene locus_tag LOCUS_09470 gene deoD 806 96 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_09470 2651 903 gene locus_tag LOCUS_09480 2651 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence250 <1 603 gene locus_tag LOCUS_09490 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202920.1:phenylalanine--tRNA ligase subunit beta 629 1576 gene locus_tag LOCUS_09500 gene lpxK 629 1576 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_09500 1662 2288 gene locus_tag LOCUS_09510 1662 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence251 72 1130 gene locus_tag LOCUS_09520 72 1130 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_09520 1253 1585 gene locus_tag LOCUS_09530 1253 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1604 2617 gene locus_tag LOCUS_09540 1604 2617 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence252 969 496 gene locus_tag LOCUS_09550 969 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 <2705 1133 gene locus_tag LOCUS_09560 <2705 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962492.1:OmpA family protein >Feature sequence253 2304 523 gene locus_tag LOCUS_09570 2304 523 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_09570 2549 2622 gene locus_tag LOCUS_t00250 2549 2622 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence254 810 884 gene locus_tag LOCUS_t00260 810 884 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2446 983 gene locus_tag LOCUS_09580 2446 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence255 1038 265 gene locus_tag LOCUS_09590 1038 265 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_09590 1955 1203 gene locus_tag LOCUS_09600 1955 1203 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence256 1026 142 gene locus_tag LOCUS_09610 1026 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1459 1106 gene locus_tag LOCUS_09620 1459 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2573 1512 gene locus_tag LOCUS_09630 gene pdxA 2573 1512 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence257 130 1434 gene locus_tag LOCUS_09640 130 1434 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_09640 1557 2582 gene locus_tag LOCUS_09650 gene trpS 1557 2582 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence258 8 772 gene locus_tag LOCUS_09660 gene rsmA 8 772 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_09660 834 1781 gene locus_tag LOCUS_09670 gene corA 834 1781 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_09670 1822 2364 gene locus_tag LOCUS_09680 1822 2364 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence259 <1 1121 gene locus_tag LOCUS_09690 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764496.1:bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase 1191 2078 gene locus_tag LOCUS_09700 1191 2078 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766430.1 protein_id gnl|my_center|LOCUS_09700 <2650 2086 gene locus_tag LOCUS_09710 <2650 2086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201996.1:xanthan lyase >Feature sequence260 449 66 gene locus_tag LOCUS_09720 gene rpsL 449 66 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_09720 <2645 716 gene locus_tag LOCUS_09730 <2645 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202911.1:pyruvate, phosphate dikinase >Feature sequence261 <1 591 gene locus_tag LOCUS_09740 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964359.1:beta-ketoacyl synthase N-terminal-like domain-containing protein 686 1549 gene locus_tag LOCUS_09750 gene rfbA 686 1549 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108090.1 protein_id gnl|my_center|LOCUS_09750 1562 2110 gene locus_tag LOCUS_09760 gene rfbC 1562 2110 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence262 <1 931 gene locus_tag LOCUS_09770 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761573.1:AAA family ATPase 981 1862 gene locus_tag LOCUS_09780 981 1862 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence263 2553 733 gene locus_tag LOCUS_09790 gene rpsA 2553 733 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence264 77 2 gene locus_tag LOCUS_t00270 77 2 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 279 2042 gene locus_tag LOCUS_09800 279 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence265 656 949 gene locus_tag LOCUS_09810 656 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 <2628 1635 gene locus_tag LOCUS_09820 <2628 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931754.1:fibrobacter succinogenes major paralogous domain-containing protein >Feature sequence266 805 1395 gene locus_tag LOCUS_09830 805 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1408 2025 gene locus_tag LOCUS_09840 1408 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence267 191 505 gene locus_tag LOCUS_09850 gene rplU 191 505 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_09850 530 793 gene locus_tag LOCUS_09860 gene rpmA 530 793 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_09860 1027 1512 gene locus_tag LOCUS_09870 1027 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1624 2487 gene locus_tag LOCUS_09880 gene speB 1624 2487 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence268 1580 1155 gene locus_tag LOCUS_09890 1580 1155 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_09890 1940 1626 gene locus_tag LOCUS_09900 1940 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2214 2020 gene locus_tag LOCUS_09910 2214 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence269 <1 503 gene locus_tag LOCUS_09920 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902040.1:RluA family pseudouridine synthase 436 777 gene locus_tag LOCUS_09930 436 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2428 878 gene locus_tag LOCUS_09940 gene ahpF 2428 878 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695883.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence270 355 41 gene locus_tag LOCUS_09950 355 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1117 356 gene locus_tag LOCUS_09960 gene surE 1117 356 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764237.1 protein_id gnl|my_center|LOCUS_09960 <2578 1172 gene locus_tag LOCUS_09970 <2578 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767963.1:C69 family dipeptidase >Feature sequence271 <1 1980 gene locus_tag LOCUS_09980 <1 1980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785772.1:ATP-dependent chaperone ClpB >Feature sequence272 1575 295 gene locus_tag LOCUS_09990 1575 295 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_09990 1779 1864 gene locus_tag LOCUS_t00280 1779 1864 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1913 2176 gene locus_tag LOCUS_10000 1913 2176 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678397.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence273 <2552 944 gene locus_tag LOCUS_10010 <2552 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008661694.1:TonB-dependent receptor family protein >Feature sequence274 188 1000 gene locus_tag LOCUS_10020 188 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1135 2433 gene locus_tag LOCUS_10030 1135 2433 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence275 2379 376 gene locus_tag LOCUS_10040 2379 376 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_10040 2531 2459 gene locus_tag LOCUS_t00290 2531 2459 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence276 660 37 gene locus_tag LOCUS_10050 660 37 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_10050 2212 644 gene locus_tag LOCUS_10060 2212 644 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence277 1843 452 gene locus_tag LOCUS_10070 1843 452 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_10070 2391 2113 gene locus_tag LOCUS_10080 2391 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence278 806 225 gene locus_tag LOCUS_10090 806 225 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_10090 2277 1021 gene locus_tag LOCUS_10100 2277 1021 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_10100