>Feature sequence001 2118 682 gene locus_tag LOCUS_00010 2118 682 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272456.1 protein_id gnl|my_center|LOCUS_00010 2720 2115 gene locus_tag LOCUS_00020 2720 2115 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_00020 2969 3892 gene locus_tag LOCUS_00030 2969 3892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861095.1 protein_id gnl|my_center|LOCUS_00030 3885 4688 gene locus_tag LOCUS_00040 3885 4688 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861094.1 protein_id gnl|my_center|LOCUS_00040 4702 5505 gene locus_tag LOCUS_00050 4702 5505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861093.1 protein_id gnl|my_center|LOCUS_00050 5766 5679 gene locus_tag LOCUS_t00010 5766 5679 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6145 7530 gene locus_tag LOCUS_00060 6145 7530 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_00060 7735 9177 gene locus_tag LOCUS_00070 7735 9177 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_00070 9188 10363 gene locus_tag LOCUS_00080 9188 10363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476412.1 protein_id gnl|my_center|LOCUS_00080 10866 12488 gene locus_tag LOCUS_00090 10866 12488 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_00090 12502 13005 gene locus_tag LOCUS_00100 gene ilvN 12502 13005 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_00100 13106 14113 gene locus_tag LOCUS_00110 gene ilvC 13106 14113 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_00110 14282 14503 gene locus_tag LOCUS_00120 14282 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15123 14473 gene locus_tag LOCUS_00130 15123 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15526 16659 gene locus_tag LOCUS_00140 15526 16659 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_00140 16740 17828 gene locus_tag LOCUS_00150 16740 17828 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_00150 18073 19092 gene locus_tag LOCUS_00160 18073 19092 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_00160 20932 19217 gene locus_tag LOCUS_00170 20932 19217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21184 21333 gene locus_tag LOCUS_00180 21184 21333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23916 21964 gene locus_tag LOCUS_00190 23916 21964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24543 24058 gene locus_tag LOCUS_00200 gene greA 24543 24058 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_00200 26025 24655 gene locus_tag LOCUS_00210 26025 24655 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_00210 27349 26174 gene locus_tag LOCUS_00220 27349 26174 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_00220 28274 27369 gene locus_tag LOCUS_00230 gene ftsX 28274 27369 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_00230 28954 28271 gene locus_tag LOCUS_00240 gene ftsE 28954 28271 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_00240 30356 29307 gene locus_tag LOCUS_00250 30356 29307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31828 30701 gene locus_tag LOCUS_00260 gene ugpC 31828 30701 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_00260 32726 31998 gene locus_tag LOCUS_00270 32726 31998 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_00270 33480 32890 gene locus_tag LOCUS_00280 33480 32890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35967 33892 gene locus_tag LOCUS_00290 gene fusA 35967 33892 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_00290 37092 37364 gene locus_tag LOCUS_00300 37092 37364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 37839 38642 gene locus_tag LOCUS_00310 gene rlmB 37839 38642 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_00310 38646 42191 gene locus_tag LOCUS_00320 38646 42191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 >Feature sequence002 174 1763 gene locus_tag LOCUS_00330 174 1763 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240529.1 protein_id gnl|my_center|LOCUS_00330 1984 4131 gene locus_tag LOCUS_00340 1984 4131 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_00340 4472 5005 gene locus_tag LOCUS_00350 4472 5005 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965709.1 protein_id gnl|my_center|LOCUS_00350 5096 6475 gene locus_tag LOCUS_00360 5096 6475 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_00360 8864 7095 gene locus_tag LOCUS_00370 8864 7095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_00370 10573 8861 gene locus_tag LOCUS_00380 10573 8861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_00380 11016 10570 gene locus_tag LOCUS_00390 11016 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 12126 11683 gene locus_tag LOCUS_00400 gene rimI 12126 11683 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_00400 12547 12119 gene locus_tag LOCUS_00410 12547 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 13383 12544 gene locus_tag LOCUS_00420 gene rlmA 13383 12544 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_00420 16039 13388 gene locus_tag LOCUS_00430 gene polA 16039 13388 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_00430 16982 16299 gene locus_tag LOCUS_00440 16982 16299 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038082630.1 protein_id gnl|my_center|LOCUS_00440 17348 18157 gene locus_tag LOCUS_00450 17348 18157 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_00450 18949 18161 gene locus_tag LOCUS_00460 18949 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 19512 20099 gene locus_tag LOCUS_00470 gene lexA 19512 20099 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_00470 20549 20217 gene locus_tag LOCUS_00480 20549 20217 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_00480 20695 21048 gene locus_tag LOCUS_00490 20695 21048 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_00490 21617 21207 gene locus_tag LOCUS_00500 21617 21207 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964084.1 protein_id gnl|my_center|LOCUS_00500 22231 22686 gene locus_tag LOCUS_00510 gene def 22231 22686 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423696.1 protein_id gnl|my_center|LOCUS_00510 24091 22727 gene locus_tag LOCUS_00520 24091 22727 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_00520 24487 24302 gene locus_tag LOCUS_00530 24487 24302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 25988 24453 gene locus_tag LOCUS_00540 25988 24453 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860806.1 protein_id gnl|my_center|LOCUS_00540 26698 27714 gene locus_tag LOCUS_00550 26698 27714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 28694 29572 gene locus_tag LOCUS_00560 gene rfbA 28694 29572 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_00560 29589 30143 gene locus_tag LOCUS_00570 gene rfbC 29589 30143 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_00570 30146 31165 gene locus_tag LOCUS_00580 gene rfbB 30146 31165 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_00580 31152 32123 gene locus_tag LOCUS_00590 31152 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 32128 32979 gene locus_tag LOCUS_00600 gene rfbD 32128 32979 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_00600 >Feature sequence003 442 1617 gene locus_tag LOCUS_00610 442 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 2173 3129 gene locus_tag LOCUS_00620 2173 3129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678777.1 protein_id gnl|my_center|LOCUS_00620 3145 4014 gene locus_tag LOCUS_00630 3145 4014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678776.1 protein_id gnl|my_center|LOCUS_00630 4304 5968 gene locus_tag LOCUS_00640 4304 5968 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678775.1 protein_id gnl|my_center|LOCUS_00640 6087 7067 gene locus_tag LOCUS_00650 6087 7067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678774.1 protein_id gnl|my_center|LOCUS_00650 7057 8025 gene locus_tag LOCUS_00660 7057 8025 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677802.1 protein_id gnl|my_center|LOCUS_00660 9119 8265 gene locus_tag LOCUS_00670 9119 8265 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289273.1 protein_id gnl|my_center|LOCUS_00670 10041 9178 gene locus_tag LOCUS_00680 10041 9178 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674020.1 protein_id gnl|my_center|LOCUS_00680 10262 10777 gene locus_tag LOCUS_00690 10262 10777 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047753.1 protein_id gnl|my_center|LOCUS_00690 10762 11367 gene locus_tag LOCUS_00700 10762 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 11496 12833 gene locus_tag LOCUS_00710 11496 12833 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 protein_id gnl|my_center|LOCUS_00710 15318 13120 gene locus_tag LOCUS_00720 gene pnp 15318 13120 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_00720 15763 15500 gene locus_tag LOCUS_00730 gene rpsO 15763 15500 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_00730 16244 17491 gene locus_tag LOCUS_00740 16244 17491 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_00740 18198 19436 gene locus_tag LOCUS_00750 18198 19436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 19506 19760 gene locus_tag LOCUS_00760 19506 19760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 20553 19900 gene locus_tag LOCUS_00770 20553 19900 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_00770 20793 21548 gene locus_tag LOCUS_00780 20793 21548 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458912.1 protein_id gnl|my_center|LOCUS_00780 21592 22113 gene locus_tag LOCUS_00790 21592 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 22356 24527 gene locus_tag LOCUS_00800 22356 24527 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_00800 24524 26200 gene locus_tag LOCUS_00810 24524 26200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 26288 27295 gene locus_tag LOCUS_00820 26288 27295 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_00820 27924 29255 gene locus_tag LOCUS_00830 27924 29255 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_00830 29328 29651 gene locus_tag LOCUS_00840 29328 29651 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_00840 29657 30637 gene locus_tag LOCUS_00850 gene holB 29657 30637 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_00850 >Feature sequence004 <1 707 gene locus_tag LOCUS_00860 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949019.1:RluA family pseudouridine synthase 779 1054 gene locus_tag LOCUS_00870 779 1054 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_00870 1233 3137 gene locus_tag LOCUS_00880 1233 3137 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_00880 3551 3225 gene locus_tag LOCUS_00890 gene hisE 3551 3225 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837137.1 protein_id gnl|my_center|LOCUS_00890 3900 3544 gene locus_tag LOCUS_00900 gene hisI 3900 3544 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 protein_id gnl|my_center|LOCUS_00900 4631 3897 gene locus_tag LOCUS_00910 gene hisA 4631 3897 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_00910 5573 4998 gene locus_tag LOCUS_00920 gene hisB 5573 4998 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674505.1 protein_id gnl|my_center|LOCUS_00920 6646 5576 gene locus_tag LOCUS_00930 gene hisC 6646 5576 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_00930 7934 6639 gene locus_tag LOCUS_00940 gene hisD 7934 6639 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_00940 8581 7931 gene locus_tag LOCUS_00950 gene hisG 8581 7931 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_00950 9788 8595 gene locus_tag LOCUS_00960 gene hisZ 9788 8595 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170323.1 protein_id gnl|my_center|LOCUS_00960 11334 10492 gene locus_tag LOCUS_00970 11334 10492 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_00970 12071 11331 gene locus_tag LOCUS_00980 12071 11331 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 protein_id gnl|my_center|LOCUS_00980 13046 12171 gene locus_tag LOCUS_00990 13046 12171 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_00990 13618 13202 gene locus_tag LOCUS_01000 13618 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_01000 14799 13849 gene locus_tag LOCUS_01010 14799 13849 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582840.1 protein_id gnl|my_center|LOCUS_01010 15170 16495 gene locus_tag LOCUS_01020 15170 16495 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_01020 16474 17286 gene locus_tag LOCUS_01030 16474 17286 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460408.1 protein_id gnl|my_center|LOCUS_01030 18168 17296 gene locus_tag LOCUS_01040 18168 17296 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_01040 18414 19460 gene locus_tag LOCUS_01050 gene uxuA 18414 19460 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_01050 22039 20036 gene locus_tag LOCUS_01060 gene feoB 22039 20036 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_01060 22266 22036 gene locus_tag LOCUS_01070 22266 22036 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_01070 22523 23281 gene locus_tag LOCUS_01080 22523 23281 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245732.1 protein_id gnl|my_center|LOCUS_01080 23402 23734 gene locus_tag LOCUS_01090 23402 23734 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_01090 24147 24926 gene locus_tag LOCUS_01100 24147 24926 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732982.1 protein_id gnl|my_center|LOCUS_01100 25344 25805 gene locus_tag LOCUS_01110 25344 25805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 25965 27401 gene locus_tag LOCUS_01120 25965 27401 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_01120 27401 28672 gene locus_tag LOCUS_01130 27401 28672 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_01130 28669 29025 gene locus_tag LOCUS_01140 28669 29025 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_01140 >Feature sequence005 195 1148 gene locus_tag LOCUS_01150 195 1148 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_01150 1227 2156 gene locus_tag LOCUS_01160 gene fabD 1227 2156 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_01160 2161 2907 gene locus_tag LOCUS_01170 gene fabG 2161 2907 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_01170 2960 4192 gene locus_tag LOCUS_01180 gene fabF 2960 4192 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_01180 4205 4684 gene locus_tag LOCUS_01190 4205 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5417 5827 gene locus_tag LOCUS_01200 5417 5827 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_01200 5847 7199 gene locus_tag LOCUS_01210 5847 7199 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_01210 7203 8075 gene locus_tag LOCUS_01220 gene accD 7203 8075 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901174.1 protein_id gnl|my_center|LOCUS_01220 8076 8858 gene locus_tag LOCUS_01230 8076 8858 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 protein_id gnl|my_center|LOCUS_01230 8855 9673 gene locus_tag LOCUS_01240 8855 9673 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722646.1 protein_id gnl|my_center|LOCUS_01240 9991 10734 gene locus_tag LOCUS_01250 9991 10734 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_01250 11505 10789 gene locus_tag LOCUS_01260 11505 10789 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_01260 12515 11937 gene locus_tag LOCUS_01270 12515 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 12636 12469 gene locus_tag LOCUS_01280 12636 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 14287 12956 gene locus_tag LOCUS_01290 gene gudD 14287 12956 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 protein_id gnl|my_center|LOCUS_01290 14845 14444 gene locus_tag LOCUS_01300 14845 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 15611 15192 gene locus_tag LOCUS_01310 15611 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 15529 15873 gene locus_tag LOCUS_01320 15529 15873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 16262 16825 gene locus_tag LOCUS_01330 16262 16825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 17265 18827 gene locus_tag LOCUS_01340 17265 18827 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155021.1 protein_id gnl|my_center|LOCUS_01340 19550 19116 gene locus_tag LOCUS_01350 19550 19116 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810723.1 protein_id gnl|my_center|LOCUS_01350 19958 19701 gene locus_tag LOCUS_01360 19958 19701 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_01360 20500 21996 gene locus_tag LOCUS_01370 gene malQ 20500 21996 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_01370 22068 24410 gene locus_tag LOCUS_01380 22068 24410 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence006 191 2413 gene locus_tag LOCUS_01390 191 2413 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_01390 2466 3866 gene locus_tag LOCUS_01400 2466 3866 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476670.1 protein_id gnl|my_center|LOCUS_01400 3882 4730 gene locus_tag LOCUS_01410 3882 4730 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_01410 6128 4887 gene locus_tag LOCUS_01420 6128 4887 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903396.1 protein_id gnl|my_center|LOCUS_01420 6885 6676 gene locus_tag LOCUS_01430 6885 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 7647 7135 gene locus_tag LOCUS_01440 7647 7135 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_01440 9237 7855 gene locus_tag LOCUS_01450 9237 7855 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_01450 10226 9669 gene locus_tag LOCUS_01460 10226 9669 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965977.1 protein_id gnl|my_center|LOCUS_01460 10462 10283 gene locus_tag LOCUS_01470 10462 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 10695 11963 gene locus_tag LOCUS_01480 10695 11963 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083032.1 protein_id gnl|my_center|LOCUS_01480 12163 13125 gene locus_tag LOCUS_01490 12163 13125 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_01490 13159 14070 gene locus_tag LOCUS_01500 13159 14070 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_01500 14090 14980 gene locus_tag LOCUS_01510 14090 14980 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385464.1 protein_id gnl|my_center|LOCUS_01510 15464 17758 gene locus_tag LOCUS_01520 15464 17758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 17834 18433 gene locus_tag LOCUS_01530 gene spoIIR 17834 18433 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_01530 18747 18430 gene locus_tag LOCUS_01540 18747 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 18964 19302 gene locus_tag LOCUS_01550 18964 19302 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423377.1 protein_id gnl|my_center|LOCUS_01550 20075 21412 gene locus_tag LOCUS_01560 20075 21412 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_01560 21425 21868 gene locus_tag LOCUS_01570 21425 21868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 21865 23094 gene locus_tag LOCUS_01580 gene rlmD 21865 23094 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence007 2024 369 gene locus_tag LOCUS_01590 gene ilvD 2024 369 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_01590 2898 2134 gene locus_tag LOCUS_01600 2898 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 3146 3361 gene locus_tag LOCUS_01610 3146 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3447 5441 gene locus_tag LOCUS_01620 3447 5441 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_01620 5847 6113 gene locus_tag LOCUS_01630 5847 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 7694 6303 gene locus_tag LOCUS_01640 7694 6303 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_01640 8077 8583 gene locus_tag LOCUS_01650 8077 8583 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864729.1 protein_id gnl|my_center|LOCUS_01650 8600 9829 gene locus_tag LOCUS_01660 8600 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 10127 9813 gene locus_tag LOCUS_01670 10127 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 11202 10240 gene locus_tag LOCUS_01680 11202 10240 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966644.1 protein_id gnl|my_center|LOCUS_01680 12604 11243 gene locus_tag LOCUS_01690 12604 11243 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_01690 14445 13066 gene locus_tag LOCUS_01700 14445 13066 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_01700 15697 14591 gene locus_tag LOCUS_01710 15697 14591 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_01710 16620 15700 gene locus_tag LOCUS_01720 16620 15700 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_01720 16987 17874 gene locus_tag LOCUS_01730 16987 17874 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480335.1 protein_id gnl|my_center|LOCUS_01730 18252 18968 gene locus_tag LOCUS_01740 18252 18968 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_01740 18981 19766 gene locus_tag LOCUS_01750 gene yecC 18981 19766 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816586.1 protein_id gnl|my_center|LOCUS_01750 20249 21547 gene locus_tag LOCUS_01760 20249 21547 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_01760 21576 22901 gene locus_tag LOCUS_01770 21576 22901 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence008 324 746 gene locus_tag LOCUS_01780 324 746 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_01780 730 3741 gene locus_tag LOCUS_01790 730 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 3791 5896 gene locus_tag LOCUS_01800 3791 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 6120 7220 gene locus_tag LOCUS_01810 6120 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 7814 8113 gene locus_tag LOCUS_01820 7814 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 9236 8295 gene locus_tag LOCUS_01830 9236 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 9550 10140 gene locus_tag LOCUS_01840 9550 10140 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258299.1 protein_id gnl|my_center|LOCUS_01840 10159 12438 gene locus_tag LOCUS_01850 10159 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 12469 12702 gene locus_tag LOCUS_01860 12469 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 12885 13322 gene locus_tag LOCUS_01870 12885 13322 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203080.1 protein_id gnl|my_center|LOCUS_01870 13598 13431 gene locus_tag LOCUS_01880 13598 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 17302 13664 gene locus_tag LOCUS_01890 17302 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 18030 18455 gene locus_tag LOCUS_01900 gene mce 18030 18455 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_01900 18671 19027 gene locus_tag LOCUS_01910 18671 19027 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_01910 19075 19296 gene locus_tag LOCUS_01920 19075 19296 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_01920 19354 21180 gene locus_tag LOCUS_01930 19354 21180 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01930 21229 21957 gene locus_tag LOCUS_01940 21229 21957 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_01940 21954 22871 gene locus_tag LOCUS_01950 21954 22871 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence009 814 74 gene locus_tag LOCUS_01960 814 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1839 811 gene locus_tag LOCUS_01970 1839 811 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_01970 2840 1839 gene locus_tag LOCUS_01980 2840 1839 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_01980 3043 2852 gene locus_tag LOCUS_01990 3043 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 4442 3066 gene locus_tag LOCUS_02000 gene murD 4442 3066 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_02000 6084 4600 gene locus_tag LOCUS_02010 gene pap 6084 4600 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_02010 6262 7311 gene locus_tag LOCUS_02020 gene mutY 6262 7311 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_02020 8137 7277 gene locus_tag LOCUS_02030 8137 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 8103 8300 gene locus_tag LOCUS_02040 8103 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 8869 8339 gene locus_tag LOCUS_02050 8869 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 9980 9231 gene locus_tag LOCUS_02060 9980 9231 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_02060 10322 10011 gene locus_tag LOCUS_02070 10322 10011 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650837.1 protein_id gnl|my_center|LOCUS_02070 10677 10315 gene locus_tag LOCUS_02080 10677 10315 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_02080 11117 11044 gene locus_tag LOCUS_t00020 11117 11044 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13263 11353 gene locus_tag LOCUS_02090 gene thrS 13263 11353 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_02090 13937 13647 gene locus_tag LOCUS_02100 13937 13647 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165613498.1 protein_id gnl|my_center|LOCUS_02100 14209 13934 gene locus_tag LOCUS_02110 14209 13934 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_02110 14721 16283 gene locus_tag LOCUS_02120 gene rny 14721 16283 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_02120 17166 19058 gene locus_tag LOCUS_02130 17166 19058 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_02130 19055 19918 gene locus_tag LOCUS_02140 19055 19918 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_02140 19934 20380 gene locus_tag LOCUS_02150 19934 20380 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_02150 20391 20738 gene locus_tag LOCUS_02160 20391 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 20743 21822 gene locus_tag LOCUS_02170 20743 21822 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_02170 21827 22231 gene locus_tag LOCUS_02180 21827 22231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence010 2219 1041 gene locus_tag LOCUS_02190 2219 1041 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_02190 2524 3120 gene locus_tag LOCUS_02200 2524 3120 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_02200 3101 4228 gene locus_tag LOCUS_02210 3101 4228 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_02210 4263 5582 gene locus_tag LOCUS_02220 4263 5582 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_02220 5979 7082 gene locus_tag LOCUS_02230 5979 7082 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_02230 7097 8170 gene locus_tag LOCUS_02240 gene wecB 7097 8170 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_02240 8178 9416 gene locus_tag LOCUS_02250 gene wlbE 8178 9416 CDS product O-antigen biosynthesis protein WlbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807109.1 protein_id gnl|my_center|LOCUS_02250 9565 9936 gene locus_tag LOCUS_02260 9565 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 10638 10072 gene locus_tag LOCUS_02270 10638 10072 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583123.1 protein_id gnl|my_center|LOCUS_02270 10972 11358 gene locus_tag LOCUS_02280 10972 11358 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 protein_id gnl|my_center|LOCUS_02280 11355 13724 gene locus_tag LOCUS_02290 11355 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 14163 14786 gene locus_tag LOCUS_02300 14163 14786 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_02300 15335 16699 gene locus_tag LOCUS_02310 15335 16699 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966714.1 protein_id gnl|my_center|LOCUS_02310 18309 16930 gene locus_tag LOCUS_02320 18309 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 20176 18731 gene locus_tag LOCUS_02330 gene glgA 20176 18731 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_02330 20559 21269 gene locus_tag LOCUS_02340 20559 21269 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583993.1 protein_id gnl|my_center|LOCUS_02340 21309 21941 gene locus_tag LOCUS_02350 gene nth 21309 21941 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence011 <1 1068 gene locus_tag LOCUS_02360 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966684.1:ABC transporter ATP-binding protein 1089 2966 gene locus_tag LOCUS_02370 1089 2966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_02370 3392 3901 gene locus_tag LOCUS_02380 3392 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 5546 4029 gene locus_tag LOCUS_02390 gene garD 5546 4029 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 protein_id gnl|my_center|LOCUS_02390 6097 5687 gene locus_tag LOCUS_02400 6097 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 6382 7398 gene locus_tag LOCUS_02410 gene galE 6382 7398 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_02410 7462 8190 gene locus_tag LOCUS_02420 gene nagB 7462 8190 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_02420 8349 8837 gene locus_tag LOCUS_02430 8349 8837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706546.1 protein_id gnl|my_center|LOCUS_02430 9348 8827 gene locus_tag LOCUS_02440 9348 8827 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_02440 9497 10030 gene locus_tag LOCUS_02450 9497 10030 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 protein_id gnl|my_center|LOCUS_02450 10027 10749 gene locus_tag LOCUS_02460 10027 10749 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 protein_id gnl|my_center|LOCUS_02460 10905 11789 gene locus_tag LOCUS_02470 10905 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 11873 12610 gene locus_tag LOCUS_02480 11873 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 12727 12981 gene locus_tag LOCUS_02490 12727 12981 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_02490 15667 13046 gene locus_tag LOCUS_02500 15667 13046 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_02500 16247 15768 gene locus_tag LOCUS_02510 16247 15768 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141167.1 protein_id gnl|my_center|LOCUS_02510 18637 16382 gene locus_tag LOCUS_02520 18637 16382 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_02520 19314 19910 gene locus_tag LOCUS_02530 19314 19910 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_02530 20407 19979 gene locus_tag LOCUS_02540 20407 19979 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544996.1 protein_id gnl|my_center|LOCUS_02540 21303 20980 gene locus_tag LOCUS_02550 21303 20980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 >Feature sequence012 2657 1281 gene locus_tag LOCUS_02560 gene dnaB 2657 1281 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_02560 2765 3025 gene locus_tag LOCUS_02570 2765 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 3218 3433 gene locus_tag LOCUS_02580 3218 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 3876 3430 gene locus_tag LOCUS_02590 gene rplI 3876 3430 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429267.1 protein_id gnl|my_center|LOCUS_02590 5993 3948 gene locus_tag LOCUS_02600 5993 3948 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_02600 8059 6008 gene locus_tag LOCUS_02610 8059 6008 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_02610 8946 9389 gene locus_tag LOCUS_02620 gene rnhA 8946 9389 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968914.1 protein_id gnl|my_center|LOCUS_02620 9536 10714 gene locus_tag LOCUS_02630 gene nifS 9536 10714 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_02630 10957 11391 gene locus_tag LOCUS_02640 gene nifU 10957 11391 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_02640 11861 11691 gene locus_tag LOCUS_02650 11861 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 13507 11912 gene locus_tag LOCUS_02660 13507 11912 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_02660 13698 13423 gene locus_tag LOCUS_02670 13698 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 15547 14018 gene locus_tag LOCUS_02680 15547 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 15769 16737 gene locus_tag LOCUS_02690 15769 16737 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_02690 16752 17678 gene locus_tag LOCUS_02700 16752 17678 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_02700 17742 19472 gene locus_tag LOCUS_02710 17742 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 20770 19418 gene locus_tag LOCUS_02720 20770 19418 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence013 618 271 gene locus_tag LOCUS_02730 618 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 965 2440 gene locus_tag LOCUS_02740 965 2440 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_02740 2648 3901 gene locus_tag LOCUS_02750 gene rhaA 2648 3901 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730700.1 protein_id gnl|my_center|LOCUS_02750 3934 4752 gene locus_tag LOCUS_02760 gene rhaD 3934 4752 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293380.1 protein_id gnl|my_center|LOCUS_02760 4816 5967 gene locus_tag LOCUS_02770 gene fucO 4816 5967 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_02770 6273 7037 gene locus_tag LOCUS_02780 6273 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 7595 7230 gene locus_tag LOCUS_02790 7595 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 8022 10004 gene locus_tag LOCUS_02800 gene uvrB 8022 10004 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_02800 10010 12844 gene locus_tag LOCUS_02810 gene uvrA 10010 12844 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_02810 13475 13200 gene locus_tag LOCUS_02820 13475 13200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 17525 14406 gene locus_tag LOCUS_02830 17525 14406 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_02830 18368 17691 gene locus_tag LOCUS_02840 18368 17691 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_02840 19582 18365 gene locus_tag LOCUS_02850 gene coaBC 19582 18365 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911730.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence014 2276 1428 gene locus_tag LOCUS_02860 2276 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2620 4404 gene locus_tag LOCUS_02870 2620 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4803 5672 gene locus_tag LOCUS_02880 4803 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 5814 8057 gene locus_tag LOCUS_02890 5814 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 8088 9317 gene locus_tag LOCUS_02900 8088 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 9355 11400 gene locus_tag LOCUS_02910 9355 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 11419 14103 gene locus_tag LOCUS_02920 11419 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 13452 13539 gene locus_tag LOCUS_t00030 13452 13539 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14134 14730 gene locus_tag LOCUS_02930 14134 14730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 14734 15477 gene locus_tag LOCUS_02940 14734 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 15647 16033 gene locus_tag LOCUS_02950 15647 16033 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_02950 16117 17820 gene locus_tag LOCUS_02960 16117 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 17892 18392 gene locus_tag LOCUS_02970 17892 18392 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_02970 18499 18861 gene locus_tag LOCUS_02980 18499 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence015 112 1299 gene locus_tag LOCUS_02990 112 1299 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289643.1 protein_id gnl|my_center|LOCUS_02990 1374 1796 gene locus_tag LOCUS_03000 1374 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 1778 2155 gene locus_tag LOCUS_03010 1778 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 2407 2997 gene locus_tag LOCUS_03020 2407 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2994 3722 gene locus_tag LOCUS_03030 2994 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4153 4689 gene locus_tag LOCUS_03040 4153 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4750 5286 gene locus_tag LOCUS_03050 4750 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 5443 5276 gene locus_tag LOCUS_03060 5443 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5523 6767 gene locus_tag LOCUS_03070 gene pepT 5523 6767 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948200.1 protein_id gnl|my_center|LOCUS_03070 7209 9299 gene locus_tag LOCUS_03080 7209 9299 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_03080 9610 10815 gene locus_tag LOCUS_03090 gene rhmD 9610 10815 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297916.1 protein_id gnl|my_center|LOCUS_03090 11368 12621 gene locus_tag LOCUS_03100 11368 12621 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_03100 12840 13292 gene locus_tag LOCUS_03110 12840 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 13313 14656 gene locus_tag LOCUS_03120 13313 14656 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864507.1 protein_id gnl|my_center|LOCUS_03120 14833 15717 gene locus_tag LOCUS_03130 14833 15717 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_03130 15868 16206 gene locus_tag LOCUS_03140 15868 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 16401 17039 gene locus_tag LOCUS_03150 16401 17039 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence016 678 2066 gene locus_tag LOCUS_03160 678 2066 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_03160 2134 3222 gene locus_tag LOCUS_03170 2134 3222 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_03170 3247 3606 gene locus_tag LOCUS_03180 3247 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 3603 6134 gene locus_tag LOCUS_03190 3603 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6433 7191 gene locus_tag LOCUS_03200 6433 7191 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455962.1 protein_id gnl|my_center|LOCUS_03200 7188 8933 gene locus_tag LOCUS_03210 7188 8933 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_03210 9175 8900 gene locus_tag LOCUS_03220 9175 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 9320 9610 gene locus_tag LOCUS_03230 9320 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 9510 10388 gene locus_tag LOCUS_03240 9510 10388 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_03240 10406 11278 gene locus_tag LOCUS_03250 10406 11278 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_03250 11325 13124 gene locus_tag LOCUS_03260 11325 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 13149 15659 gene locus_tag LOCUS_03270 13149 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 18680 15990 gene locus_tag LOCUS_03280 18680 15990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence017 1505 264 gene locus_tag LOCUS_03290 1505 264 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_03290 2930 1836 gene locus_tag LOCUS_03300 gene hypD 2930 1836 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810717.1 protein_id gnl|my_center|LOCUS_03300 3138 2920 gene locus_tag LOCUS_03310 3138 2920 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_03310 5440 3101 gene locus_tag LOCUS_03320 gene hypF 5440 3101 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933457.1 protein_id gnl|my_center|LOCUS_03320 6093 5437 gene locus_tag LOCUS_03330 gene hypB 6093 5437 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_03330 6436 6053 gene locus_tag LOCUS_03340 gene hypA 6436 6053 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393668.1 protein_id gnl|my_center|LOCUS_03340 6899 7561 gene locus_tag LOCUS_03350 6899 7561 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_03350 7868 9037 gene locus_tag LOCUS_03360 7868 9037 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_03360 9565 9152 gene locus_tag LOCUS_03370 9565 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 11546 10224 gene locus_tag LOCUS_03380 gene melA 11546 10224 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_03380 11812 12636 gene locus_tag LOCUS_03390 11812 12636 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262870.1 protein_id gnl|my_center|LOCUS_03390 13335 13742 gene locus_tag LOCUS_03400 13335 13742 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054516.1 protein_id gnl|my_center|LOCUS_03400 13753 14403 gene locus_tag LOCUS_03410 13753 14403 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_03410 14576 16009 gene locus_tag LOCUS_03420 14576 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 17965 16088 gene locus_tag LOCUS_03430 17965 16088 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775342.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence018 531 220 gene locus_tag LOCUS_03440 531 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 1774 878 gene locus_tag LOCUS_03450 1774 878 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_03450 2264 1827 gene locus_tag LOCUS_03460 2264 1827 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_03460 3251 4300 gene locus_tag LOCUS_03470 gene spoIVB 3251 4300 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_03470 4917 5783 gene locus_tag LOCUS_03480 4917 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 5780 7750 gene locus_tag LOCUS_03490 5780 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 9252 7894 gene locus_tag LOCUS_03500 9252 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 12023 9249 gene locus_tag LOCUS_03510 12023 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 12694 12020 gene locus_tag LOCUS_03520 12694 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 13114 12743 gene locus_tag LOCUS_03530 13114 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 13305 13162 gene locus_tag LOCUS_03540 13305 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 15451 13352 gene locus_tag LOCUS_03550 15451 13352 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963726.1 protein_id gnl|my_center|LOCUS_03550 16321 15473 gene locus_tag LOCUS_03560 16321 15473 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_03560 17785 16349 gene locus_tag LOCUS_03570 17785 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence019 1920 1348 gene locus_tag LOCUS_03580 gene grpE 1920 1348 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_03580 2967 1936 gene locus_tag LOCUS_03590 gene hrcA 2967 1936 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_03590 7223 3666 gene locus_tag LOCUS_03600 gene nifJ 7223 3666 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_03600 7668 8291 gene locus_tag LOCUS_03610 7668 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 8307 8963 gene locus_tag LOCUS_03620 8307 8963 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_03620 10951 9701 gene locus_tag LOCUS_03630 10951 9701 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_03630 12160 10973 gene locus_tag LOCUS_03640 gene thiI 12160 10973 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_03640 13309 12176 gene locus_tag LOCUS_03650 13309 12176 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_03650 13598 15619 gene locus_tag LOCUS_03660 13598 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15775 17301 gene locus_tag LOCUS_03670 15775 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 >Feature sequence020 164 1795 gene locus_tag LOCUS_03680 164 1795 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963677.1 protein_id gnl|my_center|LOCUS_03680 1826 2317 gene locus_tag LOCUS_03690 1826 2317 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_03690 2715 2975 gene locus_tag LOCUS_03700 2715 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3046 3510 gene locus_tag LOCUS_03710 3046 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665895.1 protein_id gnl|my_center|LOCUS_03710 4482 3625 gene locus_tag LOCUS_03720 4482 3625 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_03720 7197 4855 gene locus_tag LOCUS_03730 7197 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 9198 7546 gene locus_tag LOCUS_03740 9198 7546 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_03740 10203 9325 gene locus_tag LOCUS_03750 10203 9325 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_03750 11202 10231 gene locus_tag LOCUS_03760 11202 10231 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286009.1 protein_id gnl|my_center|LOCUS_03760 13132 12047 gene locus_tag LOCUS_03770 13132 12047 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_03770 14305 13148 gene locus_tag LOCUS_03780 14305 13148 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095329.1 protein_id gnl|my_center|LOCUS_03780 14650 15441 gene locus_tag LOCUS_03790 14650 15441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 17113 16016 gene locus_tag LOCUS_03800 17113 16016 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence021 1096 2475 gene locus_tag LOCUS_03810 1096 2475 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898649.1 protein_id gnl|my_center|LOCUS_03810 2670 3716 gene locus_tag LOCUS_03820 2670 3716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436292.1 protein_id gnl|my_center|LOCUS_03820 3713 4597 gene locus_tag LOCUS_03830 3713 4597 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416903.1 protein_id gnl|my_center|LOCUS_03830 4594 5511 gene locus_tag LOCUS_03840 4594 5511 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_03840 5589 6884 gene locus_tag LOCUS_03850 5589 6884 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861962.1 protein_id gnl|my_center|LOCUS_03850 9391 6902 gene locus_tag LOCUS_03860 9391 6902 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_03860 11544 9550 gene locus_tag LOCUS_03870 11544 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12551 11652 gene locus_tag LOCUS_03880 12551 11652 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249287.1 protein_id gnl|my_center|LOCUS_03880 13237 12539 gene locus_tag LOCUS_03890 gene pxpB 13237 12539 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_03890 14048 14839 gene locus_tag LOCUS_03900 14048 14839 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703481.1 protein_id gnl|my_center|LOCUS_03900 14841 15536 gene locus_tag LOCUS_03910 14841 15536 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 protein_id gnl|my_center|LOCUS_03910 15594 16712 gene locus_tag LOCUS_03920 15594 16712 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_03920 16725 17288 gene locus_tag LOCUS_03930 16725 17288 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence022 524 3175 gene locus_tag LOCUS_03940 524 3175 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_03940 3241 3399 gene locus_tag LOCUS_03950 3241 3399 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_03950 4898 3540 gene locus_tag LOCUS_03960 4898 3540 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_03960 5206 4937 gene locus_tag LOCUS_03970 5206 4937 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 protein_id gnl|my_center|LOCUS_03970 5492 6004 gene locus_tag LOCUS_03980 5492 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 5985 6356 gene locus_tag LOCUS_03990 5985 6356 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_03990 6356 7891 gene locus_tag LOCUS_04000 6356 7891 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_04000 7903 8490 gene locus_tag LOCUS_04010 7903 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 8688 8763 gene locus_tag LOCUS_t00040 8688 8763 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9827 9684 gene locus_tag LOCUS_04020 9827 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10543 9950 gene locus_tag LOCUS_04030 10543 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 10794 10558 gene locus_tag LOCUS_04040 10794 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 11132 10914 gene locus_tag LOCUS_04050 11132 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 11581 11243 gene locus_tag LOCUS_04060 11581 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 11759 11983 gene locus_tag LOCUS_04070 11759 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 11980 12534 gene locus_tag LOCUS_04080 11980 12534 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964800.1 protein_id gnl|my_center|LOCUS_04080 12730 13041 gene locus_tag LOCUS_04090 12730 13041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 13051 13839 gene locus_tag LOCUS_04100 13051 13839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 14137 13955 gene locus_tag LOCUS_04110 14137 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 14843 14220 gene locus_tag LOCUS_04120 14843 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 16095 14845 gene locus_tag LOCUS_04130 16095 14845 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_04130 16423 16692 gene locus_tag LOCUS_04140 16423 16692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 16682 16945 gene locus_tag LOCUS_04150 16682 16945 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812263.1 protein_id gnl|my_center|LOCUS_04150 17324 17019 gene locus_tag LOCUS_04160 17324 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence023 1433 2788 gene locus_tag LOCUS_04170 1433 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3063 3821 gene locus_tag LOCUS_04180 gene cobK 3063 3821 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392609.1 protein_id gnl|my_center|LOCUS_04180 3826 4716 gene locus_tag LOCUS_04190 gene ant(6) 3826 4716 CDS product aminoglycoside nucleotidyltransferase ANT(6)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255864.1 protein_id gnl|my_center|LOCUS_04190 4691 5401 gene locus_tag LOCUS_04200 4691 5401 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_04200 7235 5640 gene locus_tag LOCUS_04210 gene hcp 7235 5640 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_04210 7968 7258 gene locus_tag LOCUS_04220 7968 7258 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_04220 8516 8175 gene locus_tag LOCUS_04230 8516 8175 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_04230 8974 9546 gene locus_tag LOCUS_04240 8974 9546 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_04240 9744 10586 gene locus_tag LOCUS_04250 9744 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 10810 11640 gene locus_tag LOCUS_04260 10810 11640 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196184.1 protein_id gnl|my_center|LOCUS_04260 11829 12983 gene locus_tag LOCUS_04270 11829 12983 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_04270 13052 13489 gene locus_tag LOCUS_04280 13052 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 13502 14035 gene locus_tag LOCUS_04290 13502 14035 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_04290 14050 15096 gene locus_tag LOCUS_04300 14050 15096 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200459.1 protein_id gnl|my_center|LOCUS_04300 15110 15802 gene locus_tag LOCUS_04310 15110 15802 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_04310 15863 16663 gene locus_tag LOCUS_04320 15863 16663 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020423.1 protein_id gnl|my_center|LOCUS_04320 17386 16715 gene locus_tag LOCUS_04330 17386 16715 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence024 <1 500 gene locus_tag LOCUS_04340 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987123.1:cation:proton antiporter 4871 1404 gene locus_tag LOCUS_04350 gene mfd 4871 1404 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_04350 5554 4943 gene locus_tag LOCUS_04360 gene pth 5554 4943 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_04360 7733 6774 gene locus_tag LOCUS_04370 7733 6774 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_04370 8538 11168 gene locus_tag LOCUS_04380 gene ppdK 8538 11168 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_04380 11748 12545 gene locus_tag LOCUS_04390 11748 12545 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967090.1 protein_id gnl|my_center|LOCUS_04390 13383 13213 gene locus_tag LOCUS_04400 13383 13213 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_04400 13855 13541 gene locus_tag LOCUS_04410 13855 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 14066 14641 gene locus_tag LOCUS_04420 14066 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 14993 15673 gene locus_tag LOCUS_04430 14993 15673 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_04430 15744 17267 gene locus_tag LOCUS_04440 gene galT 15744 17267 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227402.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence025 1802 222 gene locus_tag LOCUS_04450 1802 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2022 1807 gene locus_tag LOCUS_04460 2022 1807 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 protein_id gnl|my_center|LOCUS_04460 2478 2032 gene locus_tag LOCUS_04470 2478 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4003 2825 gene locus_tag LOCUS_04480 4003 2825 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_04480 5634 4000 gene locus_tag LOCUS_04490 5634 4000 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_04490 6473 5634 gene locus_tag LOCUS_04500 gene dapF 6473 5634 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_04500 7109 6543 gene locus_tag LOCUS_04510 7109 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 8413 7130 gene locus_tag LOCUS_04520 gene glnA 8413 7130 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_04520 8967 9161 gene locus_tag LOCUS_04530 8967 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 9179 10186 gene locus_tag LOCUS_04540 gene asnA 9179 10186 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641196.1 protein_id gnl|my_center|LOCUS_04540 10295 12391 gene locus_tag LOCUS_04550 10295 12391 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_04550 16377 12733 gene locus_tag LOCUS_04560 16377 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 17009 16554 gene locus_tag LOCUS_04570 17009 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence026 269 880 gene locus_tag LOCUS_04580 269 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 920 1663 gene locus_tag LOCUS_04590 920 1663 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_04590 1770 3500 gene locus_tag LOCUS_04600 1770 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3627 4325 gene locus_tag LOCUS_04610 3627 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5396 4596 gene locus_tag LOCUS_04620 5396 4596 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_04620 5811 5554 gene locus_tag LOCUS_04630 gene rpsR 5811 5554 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_04630 6372 5890 gene locus_tag LOCUS_04640 gene ssb 6372 5890 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905962.1 protein_id gnl|my_center|LOCUS_04640 6760 6398 gene locus_tag LOCUS_04650 6760 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 8037 7165 gene locus_tag LOCUS_04660 gene galU 8037 7165 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965632.1 protein_id gnl|my_center|LOCUS_04660 9161 8055 gene locus_tag LOCUS_04670 9161 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9412 10551 gene locus_tag LOCUS_04680 gene prfB 9412 10551 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 protein_id gnl|my_center|LOCUS_04680 11085 12368 gene locus_tag LOCUS_04690 11085 12368 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533110.1 protein_id gnl|my_center|LOCUS_04690 12492 13667 gene locus_tag LOCUS_04700 12492 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 13670 15031 gene locus_tag LOCUS_04710 13670 15031 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048112.1 protein_id gnl|my_center|LOCUS_04710 15067 16140 gene locus_tag LOCUS_04720 15067 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 16152 17258 gene locus_tag LOCUS_04730 gene wlbH 16152 17258 CDS product O-antigen biosynthesis protein WlbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929609.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence027 121 369 gene locus_tag LOCUS_04740 121 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 366 605 gene locus_tag LOCUS_04750 366 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1260 1766 gene locus_tag LOCUS_04760 1260 1766 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287575.1 protein_id gnl|my_center|LOCUS_04760 3559 2147 gene locus_tag LOCUS_04770 3559 2147 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891898.1 protein_id gnl|my_center|LOCUS_04770 3679 4560 gene locus_tag LOCUS_04780 gene pdxS 3679 4560 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963914.1 protein_id gnl|my_center|LOCUS_04780 4560 5138 gene locus_tag LOCUS_04790 gene pdxT 4560 5138 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_04790 5908 5114 gene locus_tag LOCUS_04800 5908 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6665 5973 gene locus_tag LOCUS_04810 6665 5973 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209520.1 protein_id gnl|my_center|LOCUS_04810 8148 6724 gene locus_tag LOCUS_04820 8148 6724 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_04820 8620 8465 gene locus_tag LOCUS_04830 8620 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8981 10072 gene locus_tag LOCUS_04840 8981 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 10437 11249 gene locus_tag LOCUS_04850 10437 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 11551 11267 gene locus_tag LOCUS_04860 11551 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 12425 11541 gene locus_tag LOCUS_04870 gene folP 12425 11541 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927073.1 protein_id gnl|my_center|LOCUS_04870 12991 12422 gene locus_tag LOCUS_04880 gene folE 12991 12422 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429416.1 protein_id gnl|my_center|LOCUS_04880 14248 13010 gene locus_tag LOCUS_04890 14248 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 15817 14471 gene locus_tag LOCUS_04900 15817 14471 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence028 1047 241 gene locus_tag LOCUS_04910 1047 241 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_04910 1668 1060 gene locus_tag LOCUS_04920 1668 1060 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869099.1 protein_id gnl|my_center|LOCUS_04920 2355 1672 gene locus_tag LOCUS_04930 2355 1672 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_04930 2933 2358 gene locus_tag LOCUS_04940 2933 2358 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_04940 3886 2930 gene locus_tag LOCUS_04950 3886 2930 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_04950 5229 3886 gene locus_tag LOCUS_04960 gene rsxC 5229 3886 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_04960 5883 5353 gene locus_tag LOCUS_04970 5883 5353 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131089.1 protein_id gnl|my_center|LOCUS_04970 6240 5887 gene locus_tag LOCUS_04980 6240 5887 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461457.1 protein_id gnl|my_center|LOCUS_04980 7610 6630 gene locus_tag LOCUS_04990 7610 6630 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_04990 8564 7935 gene locus_tag LOCUS_05000 8564 7935 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_05000 9087 10124 gene locus_tag LOCUS_05010 9087 10124 CDS product CD0873 family tyrosine ABC transporter substrate-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860976.1 protein_id gnl|my_center|LOCUS_05010 10149 11063 gene locus_tag LOCUS_05020 10149 11063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_05020 11041 11856 gene locus_tag LOCUS_05030 11041 11856 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_05030 11871 12797 gene locus_tag LOCUS_05040 gene cysK 11871 12797 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_05040 13201 13037 gene locus_tag LOCUS_05050 13201 13037 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_05050 13864 13331 gene locus_tag LOCUS_05060 13864 13331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 14727 13861 gene locus_tag LOCUS_05070 14727 13861 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_05070 15153 15554 gene locus_tag LOCUS_05080 15153 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 15609 16850 gene locus_tag LOCUS_05090 15609 16850 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence029 612 1382 gene locus_tag LOCUS_05100 gene spo0A 612 1382 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_05100 1644 2462 gene locus_tag LOCUS_05110 1644 2462 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_05110 2499 3008 gene locus_tag LOCUS_05120 2499 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3101 3544 gene locus_tag LOCUS_05130 3101 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3681 4349 gene locus_tag LOCUS_05140 3681 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5313 4450 gene locus_tag LOCUS_05150 5313 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 5493 7316 gene locus_tag LOCUS_05160 gene glgB 5493 7316 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 protein_id gnl|my_center|LOCUS_05160 9893 7740 gene locus_tag LOCUS_05170 gene feoB 9893 7740 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_05170 10276 10055 gene locus_tag LOCUS_05180 10276 10055 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427474.1 protein_id gnl|my_center|LOCUS_05180 10521 10312 gene locus_tag LOCUS_05190 10521 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 10730 11131 gene locus_tag LOCUS_05200 10730 11131 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_05200 11641 11315 gene locus_tag LOCUS_05210 11641 11315 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_05210 13491 12103 gene locus_tag LOCUS_05220 13491 12103 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026811032.1 protein_id gnl|my_center|LOCUS_05220 14794 13559 gene locus_tag LOCUS_05230 14794 13559 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081862.1 protein_id gnl|my_center|LOCUS_05230 14929 16173 gene locus_tag LOCUS_05240 14929 16173 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_05240 16346 16774 gene locus_tag LOCUS_05250 16346 16774 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence030 889 512 gene locus_tag LOCUS_05260 889 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1094 2110 gene locus_tag LOCUS_05270 1094 2110 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_05270 3210 2215 gene locus_tag LOCUS_05280 3210 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 4153 3263 gene locus_tag LOCUS_05290 gene xerD 4153 3263 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_05290 5686 4883 gene locus_tag LOCUS_05300 gene proC 5686 4883 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931771.1 protein_id gnl|my_center|LOCUS_05300 7387 6023 gene locus_tag LOCUS_05310 gene scfB 7387 6023 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_05310 7616 7470 gene locus_tag LOCUS_05320 gene scfA 7616 7470 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_05320 8120 7713 gene locus_tag LOCUS_05330 8120 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 8516 8178 gene locus_tag LOCUS_05340 gene yajC 8516 8178 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073008.1 protein_id gnl|my_center|LOCUS_05340 9722 8592 gene locus_tag LOCUS_05350 gene tgt 9722 8592 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_05350 11788 9947 gene locus_tag LOCUS_05360 11788 9947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_05360 13517 11766 gene locus_tag LOCUS_05370 13517 11766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_05370 15389 13638 gene locus_tag LOCUS_05380 15389 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 15541 16821 gene locus_tag LOCUS_05390 15541 16821 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431480.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence031 548 33 gene locus_tag LOCUS_05400 548 33 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458839.1 protein_id gnl|my_center|LOCUS_05400 1741 557 gene locus_tag LOCUS_05410 gene alr 1741 557 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_05410 1960 2100 gene locus_tag LOCUS_05420 1960 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 5988 2206 gene locus_tag LOCUS_05430 5988 2206 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272602.1 protein_id gnl|my_center|LOCUS_05430 10881 6511 gene locus_tag LOCUS_05440 10881 6511 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_05440 11325 11104 gene locus_tag LOCUS_05450 11325 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 12430 11375 gene locus_tag LOCUS_05460 gene ispG 12430 11375 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_05460 13516 12434 gene locus_tag LOCUS_05470 gene rseP 13516 12434 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_05470 14681 13521 gene locus_tag LOCUS_05480 14681 13521 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_05480 15979 15155 gene locus_tag LOCUS_05490 gene cdsA 15979 15155 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_05490 <16638 15980 gene locus_tag LOCUS_05500 <16638 15980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541499.1:isoprenyl transferase >Feature sequence032 459 1226 gene locus_tag LOCUS_05510 459 1226 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_05510 2687 1659 gene locus_tag LOCUS_05520 gene yesN 2687 1659 CDS product two-component system response regulator YesN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244566.1 protein_id gnl|my_center|LOCUS_05520 4452 2662 gene locus_tag LOCUS_05530 gene yesM 4452 2662 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_05530 4720 6111 gene locus_tag LOCUS_05540 4720 6111 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 protein_id gnl|my_center|LOCUS_05540 6638 7540 gene locus_tag LOCUS_05550 6638 7540 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582825.1 protein_id gnl|my_center|LOCUS_05550 7544 8389 gene locus_tag LOCUS_05560 7544 8389 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289647.1 protein_id gnl|my_center|LOCUS_05560 8767 9780 gene locus_tag LOCUS_05570 8767 9780 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986736.1 protein_id gnl|my_center|LOCUS_05570 10821 9898 gene locus_tag LOCUS_05580 gene prmA 10821 9898 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_05580 11301 12854 gene locus_tag LOCUS_05590 11301 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 15227 12843 gene locus_tag LOCUS_05600 15227 12843 CDS product DUF4116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389523.1 protein_id gnl|my_center|LOCUS_05600 15386 16075 gene locus_tag LOCUS_05610 15386 16075 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113632.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence033 938 411 gene locus_tag LOCUS_05620 938 411 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_05620 1582 992 gene locus_tag LOCUS_05630 1582 992 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_05630 2213 2518 gene locus_tag LOCUS_05640 2213 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2621 5119 gene locus_tag LOCUS_05650 2621 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 5100 8516 gene locus_tag LOCUS_05660 5100 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 9118 8525 gene locus_tag LOCUS_05670 9118 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 9083 9268 gene locus_tag LOCUS_05680 9083 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 9612 10292 gene locus_tag LOCUS_05690 9612 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_05690 10309 10515 gene locus_tag LOCUS_05700 10309 10515 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_05700 10525 11589 gene locus_tag LOCUS_05710 10525 11589 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_05710 11589 12344 gene locus_tag LOCUS_05720 11589 12344 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_05720 12341 12787 gene locus_tag LOCUS_05730 12341 12787 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_05730 14676 13180 gene locus_tag LOCUS_05740 gene abfA 14676 13180 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_05740 14809 15606 gene locus_tag LOCUS_05750 14809 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence034 <1 1932 gene locus_tag LOCUS_05760 <1 1932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048130.1:endonuclease MutS2 2253 2972 gene locus_tag LOCUS_05770 2253 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 3277 3651 gene locus_tag LOCUS_05780 3277 3651 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 protein_id gnl|my_center|LOCUS_05780 3682 5016 gene locus_tag LOCUS_05790 gene ffh 3682 5016 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_05790 5124 5366 gene locus_tag LOCUS_05800 gene rpsP 5124 5366 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_05800 5385 5618 gene locus_tag LOCUS_05810 5385 5618 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_05810 5990 6508 gene locus_tag LOCUS_05820 gene rimM 5990 6508 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_05820 6498 7235 gene locus_tag LOCUS_05830 gene trmD 6498 7235 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_05830 7531 7794 gene locus_tag LOCUS_05840 7531 7794 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_05840 7883 9766 gene locus_tag LOCUS_05850 gene uvrC 7883 9766 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_05850 10764 11069 gene locus_tag LOCUS_05860 10764 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 11275 11826 gene locus_tag LOCUS_05870 gene rsmD 11275 11826 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_05870 11823 12317 gene locus_tag LOCUS_05880 gene coaD 11823 12317 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_05880 12314 12775 gene locus_tag LOCUS_05890 12314 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258265.1 protein_id gnl|my_center|LOCUS_05890 13128 14084 gene locus_tag LOCUS_05900 gene rsmH 13128 14084 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_05900 14112 14603 gene locus_tag LOCUS_05910 14112 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence035 1024 41 gene locus_tag LOCUS_05920 1024 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2668 1100 gene locus_tag LOCUS_05930 gene guaA 2668 1100 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_05930 4550 2724 gene locus_tag LOCUS_05940 gene glmS 4550 2724 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_05940 5911 4634 gene locus_tag LOCUS_05950 5911 4634 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205044.1 protein_id gnl|my_center|LOCUS_05950 7400 6195 gene locus_tag LOCUS_05960 7400 6195 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_05960 8731 7394 gene locus_tag LOCUS_05970 8731 7394 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_05970 9539 8778 gene locus_tag LOCUS_05980 gene hisF 9539 8778 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_05980 10195 9569 gene locus_tag LOCUS_05990 gene hisH 10195 9569 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_05990 10551 11132 gene locus_tag LOCUS_06000 10551 11132 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_06000 11682 11224 gene locus_tag LOCUS_06010 11682 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 12145 11660 gene locus_tag LOCUS_06020 12145 11660 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_06020 13043 12663 gene locus_tag LOCUS_06030 13043 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 13726 13040 gene locus_tag LOCUS_06040 13726 13040 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_06040 13894 15354 gene locus_tag LOCUS_06050 13894 15354 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence036 <1 944 gene locus_tag LOCUS_06060 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803841.1:Gfo/Idh/MocA family oxidoreductase 2374 1094 gene locus_tag LOCUS_06070 2374 1094 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_06070 3066 2638 gene locus_tag LOCUS_06080 3066 2638 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_06080 5061 3667 gene locus_tag LOCUS_06090 gene asnS 5061 3667 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966534.1 protein_id gnl|my_center|LOCUS_06090 5382 6788 gene locus_tag LOCUS_06100 5382 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 6785 7729 gene locus_tag LOCUS_06110 gene secF 6785 7729 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_06110 9263 8109 gene locus_tag LOCUS_06120 9263 8109 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675474.1 protein_id gnl|my_center|LOCUS_06120 9631 10596 gene locus_tag LOCUS_06130 gene hprK 9631 10596 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_06130 10904 11635 gene locus_tag LOCUS_06140 10904 11635 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048308.1 protein_id gnl|my_center|LOCUS_06140 11675 12586 gene locus_tag LOCUS_06150 gene murB 11675 12586 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057087.1 protein_id gnl|my_center|LOCUS_06150 12583 13440 gene locus_tag LOCUS_06160 gene rapZ 12583 13440 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829594.1 protein_id gnl|my_center|LOCUS_06160 13584 14519 gene locus_tag LOCUS_06170 gene whiA 13584 14519 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence037 891 178 gene locus_tag LOCUS_06180 891 178 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_06180 2264 912 gene locus_tag LOCUS_06190 2264 912 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_06190 2841 2242 gene locus_tag LOCUS_06200 2841 2242 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399277.1 protein_id gnl|my_center|LOCUS_06200 4182 2971 gene locus_tag LOCUS_06210 4182 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 6369 4678 gene locus_tag LOCUS_06220 gene argS 6369 4678 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_06220 6805 6341 gene locus_tag LOCUS_06230 6805 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 7642 6836 gene locus_tag LOCUS_06240 gene murI 7642 6836 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_06240 8715 7642 gene locus_tag LOCUS_06250 8715 7642 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_06250 9120 9923 gene locus_tag LOCUS_06260 9120 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9930 10643 gene locus_tag LOCUS_06270 9930 10643 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_06270 10640 10969 gene locus_tag LOCUS_06280 gene azlD 10640 10969 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_06280 11536 11727 gene locus_tag LOCUS_06290 11536 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 11846 11995 gene locus_tag LOCUS_06300 gene rpmG 11846 11995 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_06300 12010 12288 gene locus_tag LOCUS_06310 12010 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 12306 12827 gene locus_tag LOCUS_06320 gene nusG 12306 12827 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_06320 12953 13378 gene locus_tag LOCUS_06330 gene rplK 12953 13378 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_06330 13436 14146 gene locus_tag LOCUS_06340 gene rplA 13436 14146 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_06340 14359 14895 gene locus_tag LOCUS_06350 gene rplJ 14359 14895 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_06350 14938 15315 gene locus_tag LOCUS_06360 gene rplL 14938 15315 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence038 395 1522 gene locus_tag LOCUS_06370 395 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1523 2485 gene locus_tag LOCUS_06380 1523 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2508 2840 gene locus_tag LOCUS_06390 2508 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2853 3884 gene locus_tag LOCUS_06400 2853 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3904 4245 gene locus_tag LOCUS_06410 3904 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4242 4583 gene locus_tag LOCUS_06420 4242 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4580 5014 gene locus_tag LOCUS_06430 4580 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5011 5382 gene locus_tag LOCUS_06440 5011 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 5483 6001 gene locus_tag LOCUS_06450 5483 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5998 6918 gene locus_tag LOCUS_06460 5998 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 6921 7268 gene locus_tag LOCUS_06470 6921 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 7270 7638 gene locus_tag LOCUS_06480 7270 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 7625 8701 gene locus_tag LOCUS_06490 7625 8701 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438450.1 protein_id gnl|my_center|LOCUS_06490 8698 9267 gene locus_tag LOCUS_06500 8698 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 9279 9755 gene locus_tag LOCUS_06510 9279 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 9932 11182 gene locus_tag LOCUS_06520 gene hflX 9932 11182 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_06520 11877 13637 gene locus_tag LOCUS_06530 11877 13637 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_06530 15131 13758 gene locus_tag LOCUS_06540 15131 13758 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence039 <1 634 gene locus_tag LOCUS_06550 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001199753.1:segregation/condensation protein A 603 1187 gene locus_tag LOCUS_06560 gene scpB 603 1187 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_06560 1270 1896 gene locus_tag LOCUS_06570 1270 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1983 2420 gene locus_tag LOCUS_06580 gene ytfJ 1983 2420 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350003.1 protein_id gnl|my_center|LOCUS_06580 2766 3914 gene locus_tag LOCUS_06590 2766 3914 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_06590 3937 4437 gene locus_tag LOCUS_06600 3937 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4427 5248 gene locus_tag LOCUS_06610 4427 5248 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_06610 5172 5561 gene locus_tag LOCUS_06620 5172 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5800 7158 gene locus_tag LOCUS_06630 gene mmdA 5800 7158 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868010.1 protein_id gnl|my_center|LOCUS_06630 7205 7615 gene locus_tag LOCUS_06640 7205 7615 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_06640 7630 9030 gene locus_tag LOCUS_06650 7630 9030 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_06650 9325 11304 gene locus_tag LOCUS_06660 gene ligA 9325 11304 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_06660 11495 13447 gene locus_tag LOCUS_06670 11495 13447 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_06670 14388 13774 gene locus_tag LOCUS_06680 14388 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 <15164 14401 gene locus_tag LOCUS_06690 <15164 14401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583944.1:AraC family transcriptional regulator >Feature sequence040 247 2307 gene locus_tag LOCUS_06700 247 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 2307 4496 gene locus_tag LOCUS_06710 2307 4496 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_06710 5069 6202 gene locus_tag LOCUS_06720 5069 6202 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436749.1 protein_id gnl|my_center|LOCUS_06720 6215 7084 gene locus_tag LOCUS_06730 gene ispE 6215 7084 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_06730 7440 8108 gene locus_tag LOCUS_06740 7440 8108 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356501.1 protein_id gnl|my_center|LOCUS_06740 8105 8875 gene locus_tag LOCUS_06750 8105 8875 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_06750 9146 9889 gene locus_tag LOCUS_06760 9146 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 10218 10778 gene locus_tag LOCUS_06770 10218 10778 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_06770 11060 12010 gene locus_tag LOCUS_06780 11060 12010 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080275.1 protein_id gnl|my_center|LOCUS_06780 12007 13053 gene locus_tag LOCUS_06790 12007 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence041 292 2139 gene locus_tag LOCUS_06800 292 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2198 2449 gene locus_tag LOCUS_06810 2198 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2514 3368 gene locus_tag LOCUS_06820 2514 3368 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948435.1 protein_id gnl|my_center|LOCUS_06820 3738 3481 gene locus_tag LOCUS_06830 3738 3481 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_06830 6795 4048 gene locus_tag LOCUS_06840 gene secA 6795 4048 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_06840 7670 7410 gene locus_tag LOCUS_06850 7670 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7929 7747 gene locus_tag LOCUS_06860 7929 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 9234 8032 gene locus_tag LOCUS_06870 9234 8032 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_06870 9707 10156 gene locus_tag LOCUS_06880 9707 10156 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_06880 10286 10480 gene locus_tag LOCUS_06890 10286 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10729 12576 gene locus_tag LOCUS_06900 10729 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 12573 13313 gene locus_tag LOCUS_06910 12573 13313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461247.1 protein_id gnl|my_center|LOCUS_06910 13300 14550 gene locus_tag LOCUS_06920 13300 14550 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943646.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence042 59 1471 gene locus_tag LOCUS_06930 59 1471 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 protein_id gnl|my_center|LOCUS_06930 1665 1426 gene locus_tag LOCUS_06940 1665 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1721 2953 gene locus_tag LOCUS_06950 1721 2953 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 protein_id gnl|my_center|LOCUS_06950 3027 3236 gene locus_tag LOCUS_06960 3027 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3336 3455 gene locus_tag LOCUS_06970 3336 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3530 4474 gene locus_tag LOCUS_06980 3530 4474 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582825.1 protein_id gnl|my_center|LOCUS_06980 4478 5326 gene locus_tag LOCUS_06990 4478 5326 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582826.1 protein_id gnl|my_center|LOCUS_06990 5578 6021 gene locus_tag LOCUS_07000 5578 6021 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_07000 6053 6598 gene locus_tag LOCUS_07010 6053 6598 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_07010 7785 6784 gene locus_tag LOCUS_07020 gene trpS 7785 6784 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_07020 8409 8867 gene locus_tag LOCUS_07030 8409 8867 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811528.1 protein_id gnl|my_center|LOCUS_07030 8967 9143 gene locus_tag LOCUS_07040 8967 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 9212 9487 gene locus_tag LOCUS_07050 9212 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 9768 12122 gene locus_tag LOCUS_07060 gene spoIIE 9768 12122 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898719.1 protein_id gnl|my_center|LOCUS_07060 12527 14224 gene locus_tag LOCUS_07070 gene ptsP 12527 14224 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_07070 14228 14500 gene locus_tag LOCUS_07080 14228 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence043 443 1813 gene locus_tag LOCUS_07090 443 1813 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228115.1 protein_id gnl|my_center|LOCUS_07090 2182 5280 gene locus_tag LOCUS_07100 2182 5280 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_07100 5861 5388 gene locus_tag LOCUS_07110 5861 5388 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574643.1 protein_id gnl|my_center|LOCUS_07110 5800 5982 gene locus_tag LOCUS_07120 5800 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 7046 6105 gene locus_tag LOCUS_07130 7046 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8557 7151 gene locus_tag LOCUS_07140 8557 7151 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_07140 9231 8557 gene locus_tag LOCUS_07150 9231 8557 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_07150 9366 10097 gene locus_tag LOCUS_07160 9366 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 10239 11165 gene locus_tag LOCUS_07170 gene trxB 10239 11165 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_07170 12633 11236 gene locus_tag LOCUS_07180 12633 11236 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_07180 13279 13899 gene locus_tag LOCUS_07190 gene cysE 13279 13899 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence044 1274 1777 gene locus_tag LOCUS_07200 1274 1777 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681732.1 protein_id gnl|my_center|LOCUS_07200 2119 2331 gene locus_tag LOCUS_07210 2119 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2954 2577 gene locus_tag LOCUS_07220 2954 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 3417 4970 gene locus_tag LOCUS_07230 3417 4970 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_07230 4986 7103 gene locus_tag LOCUS_07240 4986 7103 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_07240 7198 8277 gene locus_tag LOCUS_07250 7198 8277 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_07250 10802 8388 gene locus_tag LOCUS_07260 10802 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 11573 11806 gene locus_tag LOCUS_07270 11573 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence045 181 516 gene locus_tag LOCUS_07280 181 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1484 618 gene locus_tag LOCUS_07290 1484 618 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_07290 1766 2026 gene locus_tag LOCUS_07300 1766 2026 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861913.1 protein_id gnl|my_center|LOCUS_07300 2197 3156 gene locus_tag LOCUS_07310 2197 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4569 3070 gene locus_tag LOCUS_07320 4569 3070 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_07320 5263 5955 gene locus_tag LOCUS_07330 5263 5955 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_07330 5982 6989 gene locus_tag LOCUS_07340 5982 6989 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_07340 7072 7929 gene locus_tag LOCUS_07350 7072 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 8130 8324 gene locus_tag LOCUS_07360 8130 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 8348 8776 gene locus_tag LOCUS_07370 8348 8776 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_07370 8966 9685 gene locus_tag LOCUS_07380 8966 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 10679 10891 gene locus_tag LOCUS_07390 10679 10891 CDS product DUF5348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610290.1 protein_id gnl|my_center|LOCUS_07390 11093 12316 gene locus_tag LOCUS_07400 11093 12316 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_07400 13444 14082 gene locus_tag LOCUS_07410 13444 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 14370 14113 gene locus_tag LOCUS_07420 14370 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence046 1941 1087 gene locus_tag LOCUS_07430 1941 1087 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_07430 2129 2479 gene locus_tag LOCUS_07440 2129 2479 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081551.1 protein_id gnl|my_center|LOCUS_07440 2476 2901 gene locus_tag LOCUS_07450 2476 2901 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869443.1 protein_id gnl|my_center|LOCUS_07450 2918 4222 gene locus_tag LOCUS_07460 2918 4222 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_07460 4219 4551 gene locus_tag LOCUS_07470 4219 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4551 5267 gene locus_tag LOCUS_07480 4551 5267 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_07480 5594 5400 gene locus_tag LOCUS_07490 5594 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6184 7236 gene locus_tag LOCUS_07500 6184 7236 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_07500 7264 7887 gene locus_tag LOCUS_07510 7264 7887 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812798.1 protein_id gnl|my_center|LOCUS_07510 7931 8998 gene locus_tag LOCUS_07520 7931 8998 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966298.1 protein_id gnl|my_center|LOCUS_07520 9390 9214 gene locus_tag LOCUS_07530 9390 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 9550 9335 gene locus_tag LOCUS_07540 9550 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 11260 9629 gene locus_tag LOCUS_07550 gene groL 11260 9629 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_07550 11585 11301 gene locus_tag LOCUS_07560 11585 11301 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_07560 13104 11866 gene locus_tag LOCUS_07570 13104 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence047 2672 84 gene locus_tag LOCUS_07580 2672 84 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_07580 4222 4536 gene locus_tag LOCUS_07590 4222 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4859 5278 gene locus_tag LOCUS_07600 4859 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5275 5706 gene locus_tag LOCUS_07610 5275 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 6192 7064 gene locus_tag LOCUS_07620 6192 7064 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_07620 7772 7278 gene locus_tag LOCUS_07630 7772 7278 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948046.1 protein_id gnl|my_center|LOCUS_07630 8385 7855 gene locus_tag LOCUS_07640 8385 7855 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 protein_id gnl|my_center|LOCUS_07640 9604 8681 gene locus_tag LOCUS_07650 9604 8681 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_07650 10038 9601 gene locus_tag LOCUS_07660 gene ruvX 10038 9601 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_07660 10792 10109 gene locus_tag LOCUS_07670 10792 10109 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256529.1 protein_id gnl|my_center|LOCUS_07670 11707 10796 gene locus_tag LOCUS_07680 11707 10796 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_07680 12478 11711 gene locus_tag LOCUS_07690 12478 11711 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263218.1 protein_id gnl|my_center|LOCUS_07690 13421 12489 gene locus_tag LOCUS_07700 gene pyrF 13421 12489 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_07700 <13943 13437 gene locus_tag LOCUS_07710 <13943 13437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861243.1:dihydroorotase >Feature sequence048 2966 1035 gene locus_tag LOCUS_07720 2966 1035 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_07720 4069 3128 gene locus_tag LOCUS_07730 4069 3128 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_07730 4451 5230 gene locus_tag LOCUS_07740 gene tepA 4451 5230 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139806.1 protein_id gnl|my_center|LOCUS_07740 5433 7952 gene locus_tag LOCUS_07750 5433 7952 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965118.1 protein_id gnl|my_center|LOCUS_07750 7988 8917 gene locus_tag LOCUS_07760 7988 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8919 9137 gene locus_tag LOCUS_07770 8919 9137 CDS product DUF3006 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461676.1 protein_id gnl|my_center|LOCUS_07770 9244 9915 gene locus_tag LOCUS_07780 9244 9915 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_07780 10218 12272 gene locus_tag LOCUS_07790 10218 12272 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_07790 12466 13749 gene locus_tag LOCUS_07800 12466 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence049 208 444 gene locus_tag LOCUS_07810 208 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 455 1876 gene locus_tag LOCUS_07820 gene mnmE 455 1876 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_07820 2311 4248 gene locus_tag LOCUS_07830 gene mnmG 2311 4248 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_07830 4220 4933 gene locus_tag LOCUS_07840 gene rsmG 4220 4933 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 protein_id gnl|my_center|LOCUS_07840 5060 5887 gene locus_tag LOCUS_07850 gene noc 5060 5887 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_07850 6272 7042 gene locus_tag LOCUS_07860 6272 7042 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_07860 7058 7912 gene locus_tag LOCUS_07870 7058 7912 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 protein_id gnl|my_center|LOCUS_07870 7949 9229 gene locus_tag LOCUS_07880 gene serS 7949 9229 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963346.1 protein_id gnl|my_center|LOCUS_07880 9353 10084 gene locus_tag LOCUS_07890 9353 10084 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966854.1 protein_id gnl|my_center|LOCUS_07890 10466 10191 gene locus_tag LOCUS_07900 10466 10191 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_07900 10828 10616 gene locus_tag LOCUS_07910 10828 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 10893 11243 gene locus_tag LOCUS_07920 10893 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 12983 11499 gene locus_tag LOCUS_07930 gene guaB 12983 11499 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence050 731 2071 gene locus_tag LOCUS_07940 731 2071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_07940 2410 3255 gene locus_tag LOCUS_07950 2410 3255 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_07950 3255 4199 gene locus_tag LOCUS_07960 3255 4199 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_07960 4543 5457 gene locus_tag LOCUS_07970 4543 5457 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974650.1 protein_id gnl|my_center|LOCUS_07970 5653 8385 gene locus_tag LOCUS_07980 gene cas3 5653 8385 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_07980 8366 10054 gene locus_tag LOCUS_07990 8366 10054 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_07990 9999 10598 gene locus_tag LOCUS_08000 gene casB 9999 10598 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_08000 10688 11758 gene locus_tag LOCUS_08010 gene cas7e 10688 11758 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_08010 11758 12456 gene locus_tag LOCUS_08020 11758 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 12506 13111 gene locus_tag LOCUS_08030 gene cas6e 12506 13111 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_08030 13336 13851 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttccccgcacctgcgggggtgatcc >Feature sequence051 551 1042 gene locus_tag LOCUS_08040 gene sigV 551 1042 CDS product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 protein_id gnl|my_center|LOCUS_08040 1053 1907 gene locus_tag LOCUS_08050 1053 1907 CDS product anti-sigma-V factor rsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436661.1 protein_id gnl|my_center|LOCUS_08050 4099 2444 gene locus_tag LOCUS_08060 4099 2444 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731082.1 protein_id gnl|my_center|LOCUS_08060 4363 5769 gene locus_tag LOCUS_08070 4363 5769 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_08070 6540 7730 gene locus_tag LOCUS_08080 6540 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 7801 9639 gene locus_tag LOCUS_08090 gene recQ 7801 9639 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 protein_id gnl|my_center|LOCUS_08090 10295 11668 gene locus_tag LOCUS_08100 10295 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 12284 11811 gene locus_tag LOCUS_08110 12284 11811 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_08110 12551 12733 gene locus_tag LOCUS_08120 12551 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 13625 12837 gene locus_tag LOCUS_08130 13625 12837 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence052 417 878 gene locus_tag LOCUS_08140 417 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1003 1812 gene locus_tag LOCUS_08150 1003 1812 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_08150 2008 2493 gene locus_tag LOCUS_08160 2008 2493 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_08160 2486 3655 gene locus_tag LOCUS_08170 2486 3655 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_08170 4610 5254 gene locus_tag LOCUS_08180 4610 5254 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_08180 5238 6710 gene locus_tag LOCUS_08190 5238 6710 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_08190 6694 7656 gene locus_tag LOCUS_08200 6694 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8204 9154 gene locus_tag LOCUS_08210 8204 9154 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023456.1 protein_id gnl|my_center|LOCUS_08210 9370 9978 gene locus_tag LOCUS_08220 9370 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 10918 10184 gene locus_tag LOCUS_08230 10918 10184 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_08230 11656 13311 gene locus_tag LOCUS_08240 11656 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence053 411 1886 gene locus_tag LOCUS_08250 411 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3112 2234 gene locus_tag LOCUS_08260 3112 2234 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_08260 4036 3149 gene locus_tag LOCUS_08270 gene hslO 4036 3149 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_08270 4907 4161 gene locus_tag LOCUS_08280 4907 4161 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_08280 5233 4904 gene locus_tag LOCUS_08290 5233 4904 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_08290 6700 5405 gene locus_tag LOCUS_08300 gene lysA 6700 5405 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_08300 7288 6707 gene locus_tag LOCUS_08310 gene yihA 7288 6707 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796925.1 protein_id gnl|my_center|LOCUS_08310 9750 7285 gene locus_tag LOCUS_08320 gene lon 9750 7285 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_08320 11187 9847 gene locus_tag LOCUS_08330 gene clpX 11187 9847 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_08330 11795 11211 gene locus_tag LOCUS_08340 gene clpP 11795 11211 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_08340 13206 11917 gene locus_tag LOCUS_08350 gene tig 13206 11917 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence054 268 1803 gene locus_tag LOCUS_08360 268 1803 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 protein_id gnl|my_center|LOCUS_08360 2330 4525 gene locus_tag LOCUS_08370 2330 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4605 5435 gene locus_tag LOCUS_08380 4605 5435 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_08380 5643 6107 gene locus_tag LOCUS_08390 5643 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6191 6574 gene locus_tag LOCUS_08400 6191 6574 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665817.1 protein_id gnl|my_center|LOCUS_08400 7219 8712 gene locus_tag LOCUS_08410 7219 8712 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_08410 8884 10563 gene locus_tag LOCUS_08420 8884 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 10752 11690 gene locus_tag LOCUS_08430 gene rmgP 10752 11690 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_08430 11687 12601 gene locus_tag LOCUS_08440 11687 12601 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence055 1069 428 gene locus_tag LOCUS_08450 1069 428 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_08450 1947 1054 gene locus_tag LOCUS_08460 gene rsgA 1947 1054 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_08460 4078 1952 gene locus_tag LOCUS_08470 gene pknB 4078 1952 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_08470 4841 4098 gene locus_tag LOCUS_08480 4841 4098 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_08480 5877 4828 gene locus_tag LOCUS_08490 gene rlmN 5877 4828 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_08490 7248 5908 gene locus_tag LOCUS_08500 gene rsmB 7248 5908 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_08500 7955 7251 gene locus_tag LOCUS_08510 7955 7251 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_08510 8890 7976 gene locus_tag LOCUS_08520 gene fmt 8890 7976 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_08520 9377 8901 gene locus_tag LOCUS_08530 gene def 9377 8901 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_08530 11922 9430 gene locus_tag LOCUS_08540 gene priA 11922 9430 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_08540 12275 11925 gene locus_tag LOCUS_08550 12275 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 12879 12256 gene locus_tag LOCUS_08560 gene gmk 12879 12256 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_08560 13147 12872 gene locus_tag LOCUS_08570 13147 12872 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence056 1083 1844 gene locus_tag LOCUS_08580 gene cutC 1083 1844 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365979.1 protein_id gnl|my_center|LOCUS_08580 2421 1834 gene locus_tag LOCUS_08590 2421 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 3234 2836 gene locus_tag LOCUS_08600 3234 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3904 3979 gene locus_tag LOCUS_t00050 3904 3979 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5459 4233 gene locus_tag LOCUS_08610 5459 4233 CDS product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 protein_id gnl|my_center|LOCUS_08610 6621 5497 gene locus_tag LOCUS_08620 6621 5497 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_08620 7511 6915 gene locus_tag LOCUS_08630 7511 6915 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434301.1 protein_id gnl|my_center|LOCUS_08630 9166 7760 gene locus_tag LOCUS_08640 gene uxaC 9166 7760 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_08640 10241 9246 gene locus_tag LOCUS_08650 10241 9246 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_08650 10941 12419 gene locus_tag LOCUS_08660 10941 12419 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence057 21 437 gene locus_tag LOCUS_08670 21 437 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_08670 608 1060 gene locus_tag LOCUS_08680 608 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08680 1136 2956 gene locus_tag LOCUS_08690 gene yicI 1136 2956 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964400.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08690 3904 3131 gene locus_tag LOCUS_08700 gene pdaA 3904 3131 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_08700 4793 3804 gene locus_tag LOCUS_08710 4793 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5272 5451 gene locus_tag LOCUS_08720 5272 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6861 5560 gene locus_tag LOCUS_08730 6861 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7002 7292 gene locus_tag LOCUS_08740 7002 7292 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_08740 7676 8353 gene locus_tag LOCUS_08750 7676 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 8536 9915 gene locus_tag LOCUS_08760 8536 9915 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_08760 9972 11072 gene locus_tag LOCUS_08770 9972 11072 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_08770 12687 11863 gene locus_tag LOCUS_08780 12687 11863 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582683.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence058 489 857 gene locus_tag LOCUS_08790 489 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 992 1282 gene locus_tag LOCUS_08800 992 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1817 2491 gene locus_tag LOCUS_08810 1817 2491 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_08810 2488 3579 gene locus_tag LOCUS_08820 2488 3579 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_08820 3566 4504 gene locus_tag LOCUS_08830 3566 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4504 4890 gene locus_tag LOCUS_08840 4504 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 5574 4951 gene locus_tag LOCUS_08850 5574 4951 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905527.1 protein_id gnl|my_center|LOCUS_08850 6726 5860 gene locus_tag LOCUS_08860 6726 5860 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_08860 7260 7580 gene locus_tag LOCUS_08870 7260 7580 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_08870 7722 8105 gene locus_tag LOCUS_08880 7722 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8386 9600 gene locus_tag LOCUS_08890 8386 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 10487 9906 gene locus_tag LOCUS_08900 10487 9906 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_08900 10839 11621 gene locus_tag LOCUS_08910 10839 11621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 protein_id gnl|my_center|LOCUS_08910 11611 11745 gene locus_tag LOCUS_08920 11611 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence059 1297 128 gene locus_tag LOCUS_08930 1297 128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_08930 2075 1281 gene locus_tag LOCUS_08940 2075 1281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_08940 3799 2075 gene locus_tag LOCUS_08950 3799 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4888 3821 gene locus_tag LOCUS_08960 4888 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5108 5749 gene locus_tag LOCUS_08970 5108 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 5834 6796 gene locus_tag LOCUS_08980 5834 6796 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_08980 6803 7987 gene locus_tag LOCUS_08990 6803 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 7944 9317 gene locus_tag LOCUS_09000 7944 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 9548 9916 gene locus_tag LOCUS_09010 9548 9916 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_09010 9913 10611 gene locus_tag LOCUS_09020 9913 10611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_09020 10605 11408 gene locus_tag LOCUS_09030 10605 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_09030 11422 12339 gene locus_tag LOCUS_09040 11422 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence060 206 952 gene locus_tag LOCUS_09050 206 952 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_09050 949 1770 gene locus_tag LOCUS_09060 gene rsmI 949 1770 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_09060 1793 2494 gene locus_tag LOCUS_09070 gene vanR 1793 2494 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_09070 2481 3605 gene locus_tag LOCUS_09080 2481 3605 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 protein_id gnl|my_center|LOCUS_09080 3721 4506 gene locus_tag LOCUS_09090 3721 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 4627 5247 gene locus_tag LOCUS_09100 4627 5247 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 protein_id gnl|my_center|LOCUS_09100 5438 7423 gene locus_tag LOCUS_09110 5438 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 8392 7757 gene locus_tag LOCUS_09120 8392 7757 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_09120 9048 9135 gene locus_tag LOCUS_t00060 9048 9135 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9524 9369 gene locus_tag LOCUS_09130 9524 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 10417 9521 gene locus_tag LOCUS_09140 10417 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 11800 10637 gene locus_tag LOCUS_09150 11800 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 12059 11829 gene locus_tag LOCUS_09160 12059 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 12319 12089 gene locus_tag LOCUS_09170 12319 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 12512 13012 gene locus_tag LOCUS_09180 12512 13012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence061 255 692 gene locus_tag LOCUS_09190 255 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 917 1477 gene locus_tag LOCUS_09200 917 1477 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_09200 3185 1518 gene locus_tag LOCUS_09210 3185 1518 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_09210 3872 3594 gene locus_tag LOCUS_09220 gene spoVS 3872 3594 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_09220 4916 4146 gene locus_tag LOCUS_09230 4916 4146 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_09230 5165 5953 gene locus_tag LOCUS_09240 5165 5953 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582540.1 protein_id gnl|my_center|LOCUS_09240 6115 6870 gene locus_tag LOCUS_09250 6115 6870 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_09250 7126 6914 gene locus_tag LOCUS_09260 7126 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7287 8957 gene locus_tag LOCUS_09270 gene ilvB 7287 8957 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_09270 8972 9448 gene locus_tag LOCUS_09280 gene ilvN 8972 9448 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_09280 9469 10671 gene locus_tag LOCUS_09290 gene ilvA 9469 10671 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_09290 10825 11535 gene locus_tag LOCUS_09300 10825 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 11667 12776 gene locus_tag LOCUS_09310 11667 12776 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence062 1304 276 gene locus_tag LOCUS_09320 1304 276 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495856.1 protein_id gnl|my_center|LOCUS_09320 2464 1316 gene locus_tag LOCUS_09330 gene dgoD 2464 1316 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526152.1 protein_id gnl|my_center|LOCUS_09330 3127 2480 gene locus_tag LOCUS_09340 gene eda 3127 2480 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_09340 3928 3239 gene locus_tag LOCUS_09350 3928 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 5627 4296 gene locus_tag LOCUS_09360 gene ypeB 5627 4296 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391745.1 protein_id gnl|my_center|LOCUS_09360 5830 6336 gene locus_tag LOCUS_09370 gene ruvC 5830 6336 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_09370 6340 6954 gene locus_tag LOCUS_09380 gene ruvA 6340 6954 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223336.1 protein_id gnl|my_center|LOCUS_09380 7295 8380 gene locus_tag LOCUS_09390 gene ruvB 7295 8380 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_09390 8385 8804 gene locus_tag LOCUS_09400 8385 8804 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 protein_id gnl|my_center|LOCUS_09400 9119 9688 gene locus_tag LOCUS_09410 9119 9688 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_09410 9712 10140 gene locus_tag LOCUS_09420 9712 10140 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888313.1 protein_id gnl|my_center|LOCUS_09420 10196 11545 gene locus_tag LOCUS_09430 gene glmM 10196 11545 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_09430 11645 12532 gene locus_tag LOCUS_09440 11645 12532 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence063 40 1314 gene locus_tag LOCUS_09450 40 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1603 2745 gene locus_tag LOCUS_09460 1603 2745 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_09460 3968 2979 gene locus_tag LOCUS_09470 3968 2979 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_09470 4275 7607 gene locus_tag LOCUS_09480 gene addB 4275 7607 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_09480 7600 11142 gene locus_tag LOCUS_09490 gene addA 7600 11142 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_09490 11139 12011 gene locus_tag LOCUS_09500 11139 12011 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263059.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence064 1837 1187 gene locus_tag LOCUS_09510 1837 1187 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870396.1 protein_id gnl|my_center|LOCUS_09510 2364 3401 gene locus_tag LOCUS_09520 gene queA 2364 3401 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_09520 3656 3850 gene locus_tag LOCUS_09530 3656 3850 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_09530 4303 3923 gene locus_tag LOCUS_09540 4303 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4423 6906 gene locus_tag LOCUS_09550 4423 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 7261 8778 gene locus_tag LOCUS_09560 7261 8778 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061775.1 protein_id gnl|my_center|LOCUS_09560 8915 9355 gene locus_tag LOCUS_09570 8915 9355 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_09570 9374 10618 gene locus_tag LOCUS_09580 9374 10618 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_09580 10839 11735 gene locus_tag LOCUS_09590 gene thrB 10839 11735 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964548.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence065 653 1492 gene locus_tag LOCUS_09600 653 1492 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_09600 1485 2807 gene locus_tag LOCUS_09610 1485 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 protein_id gnl|my_center|LOCUS_09610 3666 6110 gene locus_tag LOCUS_09620 3666 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6741 6220 gene locus_tag LOCUS_09630 gene nrdG 6741 6220 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_09630 9086 6747 gene locus_tag LOCUS_09640 9086 6747 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_09640 9648 10304 gene locus_tag LOCUS_09650 9648 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 10399 11031 gene locus_tag LOCUS_09660 10399 11031 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948833.1 protein_id gnl|my_center|LOCUS_09660 12228 11086 gene locus_tag LOCUS_09670 gene dnaJ 12228 11086 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence066 1315 128 gene locus_tag LOCUS_09680 1315 128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_09680 2313 1312 gene locus_tag LOCUS_09690 2313 1312 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583106.1 protein_id gnl|my_center|LOCUS_09690 2475 2639 gene locus_tag LOCUS_09700 2475 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 4078 2705 gene locus_tag LOCUS_09710 gene radA 4078 2705 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_09710 4224 4961 gene locus_tag LOCUS_09720 gene cwlD 4224 4961 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_09720 5509 4964 gene locus_tag LOCUS_09730 gene yfcE 5509 4964 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_09730 7042 5558 gene locus_tag LOCUS_09740 7042 5558 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015055963.1 protein_id gnl|my_center|LOCUS_09740 7656 7844 gene locus_tag LOCUS_09750 7656 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 8365 7931 gene locus_tag LOCUS_09760 8365 7931 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_09760 9700 8390 gene locus_tag LOCUS_09770 9700 8390 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_09770 12107 9744 gene locus_tag LOCUS_09780 12107 9744 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930732.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence067 1319 69 gene locus_tag LOCUS_09790 1319 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1927 1316 gene locus_tag LOCUS_09800 1927 1316 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_09800 2457 1918 gene locus_tag LOCUS_09810 2457 1918 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_09810 3400 2510 gene locus_tag LOCUS_09820 3400 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4290 3397 gene locus_tag LOCUS_09830 4290 3397 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_09830 4959 4294 gene locus_tag LOCUS_09840 4959 4294 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_09840 5726 4956 gene locus_tag LOCUS_09850 gene thyX 5726 4956 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421197.1 protein_id gnl|my_center|LOCUS_09850 6244 6435 gene locus_tag LOCUS_09860 6244 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 7305 6511 gene locus_tag LOCUS_09870 7305 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 9540 8185 gene locus_tag LOCUS_09880 9540 8185 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_09880 10539 9838 gene locus_tag LOCUS_09890 10539 9838 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461349.1 protein_id gnl|my_center|LOCUS_09890 10780 12162 gene locus_tag LOCUS_09900 10780 12162 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence068 801 223 gene locus_tag LOCUS_09910 801 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1445 798 gene locus_tag LOCUS_09920 1445 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2461 1445 gene locus_tag LOCUS_09930 2461 1445 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_09930 3729 2458 gene locus_tag LOCUS_09940 gene rsxC 3729 2458 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_09940 3872 4462 gene locus_tag LOCUS_09950 3872 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5345 4710 gene locus_tag LOCUS_09960 gene rpe 5345 4710 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_09960 6741 5800 gene locus_tag LOCUS_09970 6741 5800 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_09970 7055 6741 gene locus_tag LOCUS_09980 7055 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7488 7147 gene locus_tag LOCUS_09990 7488 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7958 7650 gene locus_tag LOCUS_10000 7958 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 10052 8352 gene locus_tag LOCUS_10010 10052 8352 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_10010 10622 10155 gene locus_tag LOCUS_10020 10622 10155 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965952.1 protein_id gnl|my_center|LOCUS_10020 10697 10948 gene locus_tag LOCUS_10030 10697 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 10995 11384 gene locus_tag LOCUS_10040 10995 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 11411 11737 gene locus_tag LOCUS_10050 11411 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence069 1648 377 gene locus_tag LOCUS_10060 gene obgE 1648 377 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_10060 2040 1756 gene locus_tag LOCUS_10070 gene rpmA 2040 1756 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_10070 2364 2044 gene locus_tag LOCUS_10080 2364 2044 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130645.1 protein_id gnl|my_center|LOCUS_10080 2674 2426 gene locus_tag LOCUS_10090 gene rplU 2674 2426 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10090 4175 3288 gene locus_tag LOCUS_10100 4175 3288 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_10100 4380 4168 gene locus_tag LOCUS_10110 4380 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5612 4377 gene locus_tag LOCUS_10120 gene xseA 5612 4377 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_10120 6544 5609 gene locus_tag LOCUS_10130 6544 5609 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_10130 6942 6541 gene locus_tag LOCUS_10140 gene nusB 6942 6541 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_10140 7511 6939 gene locus_tag LOCUS_10150 7511 6939 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328577.1 protein_id gnl|my_center|LOCUS_10150 8247 7639 gene locus_tag LOCUS_10160 8247 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8880 8290 gene locus_tag LOCUS_10170 8880 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9343 8870 gene locus_tag LOCUS_10180 9343 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 10506 9340 gene locus_tag LOCUS_10190 10506 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 10900 10511 gene locus_tag LOCUS_10200 gene spoIIIAD 10900 10511 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_10200 11091 10897 gene locus_tag LOCUS_10210 gene spoIIIAC 11091 10897 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_10210 11611 11129 gene locus_tag LOCUS_10220 11611 11129 CDS product stage III sporulation protein AB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393044.1 protein_id gnl|my_center|LOCUS_10220 11906 11541 gene locus_tag LOCUS_10230 11906 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence070 782 417 gene locus_tag LOCUS_10240 782 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1157 2290 gene locus_tag LOCUS_10250 1157 2290 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_10250 2513 3811 gene locus_tag LOCUS_10260 2513 3811 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_10260 4291 3848 gene locus_tag LOCUS_10270 4291 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 4481 6226 gene locus_tag LOCUS_10280 gene iorA 4481 6226 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_10280 6223 6801 gene locus_tag LOCUS_10290 6223 6801 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_10290 6821 7246 gene locus_tag LOCUS_10300 6821 7246 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_10300 7494 9509 gene locus_tag LOCUS_10310 7494 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10698 9973 gene locus_tag LOCUS_10320 gene sigE 10698 9973 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_10320 11584 10667 gene locus_tag LOCUS_10330 gene spoIIGA 11584 10667 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence071 829 179 gene locus_tag LOCUS_10340 829 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1057 2670 gene locus_tag LOCUS_10350 gene ptsP 1057 2670 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_10350 2795 3616 gene locus_tag LOCUS_10360 2795 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3727 4443 gene locus_tag LOCUS_10370 3727 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10370 4349 5122 gene locus_tag LOCUS_10380 4349 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10380 5119 5826 gene locus_tag LOCUS_10390 5119 5826 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_10390 5945 7198 gene locus_tag LOCUS_10400 5945 7198 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_10400 7273 8553 gene locus_tag LOCUS_10410 7273 8553 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_10410 8875 9531 gene locus_tag LOCUS_10420 8875 9531 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_10420 9657 10973 gene locus_tag LOCUS_10430 gene uraA 9657 10973 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703151.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence072 1651 122 gene locus_tag LOCUS_10440 1651 122 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_10440 2518 1856 gene locus_tag LOCUS_10450 gene phoU 2518 1856 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_10450 3377 2601 gene locus_tag LOCUS_10460 gene pstB 3377 2601 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965015.1 protein_id gnl|my_center|LOCUS_10460 4237 3389 gene locus_tag LOCUS_10470 gene pstA 4237 3389 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478161.1 protein_id gnl|my_center|LOCUS_10470 5117 4227 gene locus_tag LOCUS_10480 gene pstC 5117 4227 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_10480 6394 5459 gene locus_tag LOCUS_10490 6394 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 7080 8846 gene locus_tag LOCUS_10500 7080 8846 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_10500 8843 9532 gene locus_tag LOCUS_10510 8843 9532 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_10510 9529 10872 gene locus_tag LOCUS_10520 9529 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence073 <1 634 gene locus_tag LOCUS_10530 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965058.1:chromosome segregation protein SMC 648 1556 gene locus_tag LOCUS_10540 648 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2062 2631 gene locus_tag LOCUS_10550 2062 2631 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 protein_id gnl|my_center|LOCUS_10550 2762 3088 gene locus_tag LOCUS_10560 2762 3088 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_10560 3094 3693 gene locus_tag LOCUS_10570 gene nadD 3094 3693 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_10570 3698 4261 gene locus_tag LOCUS_10580 gene yqeK 3698 4261 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_10580 4316 4687 gene locus_tag LOCUS_10590 gene rsfS 4316 4687 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_10590 4980 7385 gene locus_tag LOCUS_10600 gene leuS 4980 7385 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_10600 7660 7872 gene locus_tag LOCUS_10610 7660 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 8737 7973 gene locus_tag LOCUS_10620 8737 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 9524 8838 gene locus_tag LOCUS_10630 9524 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 10490 9684 gene locus_tag LOCUS_10640 10490 9684 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence074 174 1073 gene locus_tag LOCUS_10650 174 1073 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963968.1 protein_id gnl|my_center|LOCUS_10650 1128 1793 gene locus_tag LOCUS_10660 1128 1793 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_10660 1834 2382 gene locus_tag LOCUS_10670 1834 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963966.1 protein_id gnl|my_center|LOCUS_10670 2624 3496 gene locus_tag LOCUS_10680 2624 3496 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_10680 3493 4764 gene locus_tag LOCUS_10690 3493 4764 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_10690 4745 5404 gene locus_tag LOCUS_10700 gene cmk 4745 5404 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 protein_id gnl|my_center|LOCUS_10700 5634 6260 gene locus_tag LOCUS_10710 5634 6260 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_10710 6365 6859 gene locus_tag LOCUS_10720 6365 6859 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530016.1 protein_id gnl|my_center|LOCUS_10720 6856 8832 gene locus_tag LOCUS_10730 6856 8832 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_10730 9164 9703 gene locus_tag LOCUS_10740 9164 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 9682 9864 gene locus_tag LOCUS_10750 9682 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 9931 10605 gene locus_tag LOCUS_10760 gene yunB 9931 10605 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence075 238 981 gene locus_tag LOCUS_10770 238 981 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721237.1 protein_id gnl|my_center|LOCUS_10770 1487 984 gene locus_tag LOCUS_10780 gene ybaK 1487 984 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_10780 2741 1635 gene locus_tag LOCUS_10790 2741 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3165 2890 gene locus_tag LOCUS_10800 3165 2890 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_10800 4516 3464 gene locus_tag LOCUS_10810 4516 3464 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 protein_id gnl|my_center|LOCUS_10810 5874 4597 gene locus_tag LOCUS_10820 5874 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 6800 5871 gene locus_tag LOCUS_10830 gene cdaA 6800 5871 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_10830 8487 7339 gene locus_tag LOCUS_10840 8487 7339 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_10840 8705 8484 gene locus_tag LOCUS_10850 8705 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 9282 8803 gene locus_tag LOCUS_10860 gene ispF 9282 8803 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_10860 9977 9282 gene locus_tag LOCUS_10870 gene ispD 9977 9282 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_10870 10755 10123 gene locus_tag LOCUS_10880 gene upp 10755 10123 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence076 1167 532 gene locus_tag LOCUS_10890 1167 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2570 1236 gene locus_tag LOCUS_10900 2570 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3167 2589 gene locus_tag LOCUS_10910 3167 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 3544 3335 gene locus_tag LOCUS_10920 3544 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 4495 3605 gene locus_tag LOCUS_10930 4495 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 5366 4500 gene locus_tag LOCUS_10940 5366 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 6630 5380 gene locus_tag LOCUS_10950 6630 5380 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_10950 7718 6627 gene locus_tag LOCUS_10960 7718 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 9036 7753 gene locus_tag LOCUS_10970 9036 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 9684 10685 gene locus_tag LOCUS_10980 9684 10685 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964012.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence077 3896 2523 gene locus_tag LOCUS_10990 3896 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4258 4908 gene locus_tag LOCUS_11000 4258 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4994 6457 gene locus_tag LOCUS_11010 4994 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6537 6752 gene locus_tag LOCUS_11020 6537 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 7480 6947 gene locus_tag LOCUS_11030 7480 6947 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_11030 7955 8899 gene locus_tag LOCUS_11040 7955 8899 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_11040 9653 9339 gene locus_tag LOCUS_11050 9653 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 9810 9643 gene locus_tag LOCUS_11060 9810 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence078 2359 149 gene locus_tag LOCUS_11070 2359 149 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_11070 2787 2422 gene locus_tag LOCUS_11080 2787 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4154 2961 gene locus_tag LOCUS_11090 gene metK 4154 2961 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_11090 4995 4423 gene locus_tag LOCUS_11100 4995 4423 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_11100 6551 5361 gene locus_tag LOCUS_11110 6551 5361 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201963.1 protein_id gnl|my_center|LOCUS_11110 7083 6781 gene locus_tag LOCUS_11120 7083 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8579 7377 gene locus_tag LOCUS_11130 gene tuf 8579 7377 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_11130 <10645 8684 gene locus_tag LOCUS_11140 <10645 8684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393940.1:elongation factor G >Feature sequence079 2113 962 gene locus_tag LOCUS_11150 2113 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2835 2110 gene locus_tag LOCUS_11160 gene sigI 2835 2110 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498572.1 protein_id gnl|my_center|LOCUS_11160 3388 4320 gene locus_tag LOCUS_11170 3388 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4600 6711 gene locus_tag LOCUS_11180 4600 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 8355 6823 gene locus_tag LOCUS_11190 8355 6823 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_11190 9261 8395 gene locus_tag LOCUS_11200 9261 8395 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_11200 10228 9275 gene locus_tag LOCUS_11210 10228 9275 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence080 601 1842 gene locus_tag LOCUS_11220 gene dinB 601 1842 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_11220 2113 1931 gene locus_tag LOCUS_11230 2113 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2934 2320 gene locus_tag LOCUS_11240 2934 2320 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_11240 4398 2953 gene locus_tag LOCUS_11250 4398 2953 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_11250 6178 4418 gene locus_tag LOCUS_11260 6178 4418 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_11260 6814 6212 gene locus_tag LOCUS_11270 6814 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 7223 6915 gene locus_tag LOCUS_11280 7223 6915 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_11280 7751 7308 gene locus_tag LOCUS_11290 7751 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 9773 7824 gene locus_tag LOCUS_11300 9773 7824 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence081 328 1062 gene locus_tag LOCUS_11310 328 1062 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_11310 1823 2698 gene locus_tag LOCUS_11320 1823 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2695 3174 gene locus_tag LOCUS_11330 2695 3174 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_11330 4582 3578 gene locus_tag LOCUS_11340 4582 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4944 5711 gene locus_tag LOCUS_11350 4944 5711 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948636.1 protein_id gnl|my_center|LOCUS_11350 5716 6852 gene locus_tag LOCUS_11360 gene cbiD 5716 6852 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669153.1 protein_id gnl|my_center|LOCUS_11360 6849 7538 gene locus_tag LOCUS_11370 gene cobI 6849 7538 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_11370 7544 8299 gene locus_tag LOCUS_11380 gene cobM 7544 8299 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_11380 8296 9282 gene locus_tag LOCUS_11390 gene cbiG 8296 9282 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901140.1 protein_id gnl|my_center|LOCUS_11390 9279 10031 gene locus_tag LOCUS_11400 gene cobJ 9279 10031 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931509.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence082 470 1339 gene locus_tag LOCUS_11410 470 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1342 1686 gene locus_tag LOCUS_11420 1342 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1676 1969 gene locus_tag LOCUS_11430 1676 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2236 2601 gene locus_tag LOCUS_11440 2236 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2598 2792 gene locus_tag LOCUS_11450 2598 2792 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003063668.1 protein_id gnl|my_center|LOCUS_11450 3596 2883 gene locus_tag LOCUS_11460 3596 2883 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_11460 5110 3593 gene locus_tag LOCUS_11470 5110 3593 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_11470 5726 5274 gene locus_tag LOCUS_11480 5726 5274 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461399.1 protein_id gnl|my_center|LOCUS_11480 7146 6040 gene locus_tag LOCUS_11490 7146 6040 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_11490 7806 7237 gene locus_tag LOCUS_11500 7806 7237 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_11500 8378 7803 gene locus_tag LOCUS_11510 8378 7803 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_11510 9679 8642 gene locus_tag LOCUS_11520 9679 8642 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_11520 <10465 9788 gene locus_tag LOCUS_11530 <10465 9788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391957.1:sugar kinase >Feature sequence083 684 190 gene locus_tag LOCUS_11540 684 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1857 724 gene locus_tag LOCUS_11550 gene pheA 1857 724 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_11550 2945 1857 gene locus_tag LOCUS_11560 gene aroC 2945 1857 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_11560 4197 2926 gene locus_tag LOCUS_11570 gene aroA 4197 2926 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_11570 5267 4194 gene locus_tag LOCUS_11580 gene aroB 5267 4194 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_11580 6100 5264 gene locus_tag LOCUS_11590 6100 5264 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_11590 7119 6100 gene locus_tag LOCUS_11600 gene aroF 7119 6100 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_11600 8895 7468 gene locus_tag LOCUS_11610 8895 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9659 8916 gene locus_tag LOCUS_11620 9659 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 10196 9669 gene locus_tag LOCUS_11630 10196 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence084 1109 60 gene locus_tag LOCUS_11640 1109 60 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_11640 2096 1128 gene locus_tag LOCUS_11650 2096 1128 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_11650 2326 3207 gene locus_tag LOCUS_11660 2326 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3628 4341 gene locus_tag LOCUS_11670 3628 4341 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_11670 4362 5297 gene locus_tag LOCUS_11680 4362 5297 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_11680 5624 5373 gene locus_tag LOCUS_11690 5624 5373 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_11690 6056 6637 gene locus_tag LOCUS_11700 6056 6637 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811072.1 protein_id gnl|my_center|LOCUS_11700 6630 7154 gene locus_tag LOCUS_11710 gene spmB 6630 7154 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029511.1 protein_id gnl|my_center|LOCUS_11710 7426 7881 gene locus_tag LOCUS_11720 gene nrdR 7426 7881 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_11720 8139 9011 gene locus_tag LOCUS_11730 8139 9011 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_11730 9033 10256 gene locus_tag LOCUS_11740 9033 10256 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence085 2564 453 gene locus_tag LOCUS_11750 2564 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4769 3279 gene locus_tag LOCUS_11760 4769 3279 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_11760 9339 4786 gene locus_tag LOCUS_11770 gene gltB 9339 4786 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence086 1254 826 gene locus_tag LOCUS_11780 1254 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1386 1856 gene locus_tag LOCUS_11790 1386 1856 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_11790 2475 1858 gene locus_tag LOCUS_11800 2475 1858 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519103.1 protein_id gnl|my_center|LOCUS_11800 2580 3842 gene locus_tag LOCUS_11810 gene leuC 2580 3842 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_11810 3858 4343 gene locus_tag LOCUS_11820 gene leuD 3858 4343 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_11820 4540 5229 gene locus_tag LOCUS_11830 4540 5229 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_11830 5247 6746 gene locus_tag LOCUS_11840 5247 6746 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_11840 6773 8638 gene locus_tag LOCUS_11850 6773 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9339 8710 gene locus_tag LOCUS_11860 9339 8710 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435186.1 protein_id gnl|my_center|LOCUS_11860 10196 9336 gene locus_tag LOCUS_11870 10196 9336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence087 906 79 gene locus_tag LOCUS_11880 906 79 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_11880 1931 903 gene locus_tag LOCUS_11890 1931 903 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_11890 2904 1933 gene locus_tag LOCUS_11900 2904 1933 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_11900 3332 2892 gene locus_tag LOCUS_11910 3332 2892 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_11910 5314 3317 gene locus_tag LOCUS_11920 5314 3317 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_11920 5710 5327 gene locus_tag LOCUS_11930 5710 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 6515 5727 gene locus_tag LOCUS_11940 6515 5727 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_11940 7965 6574 gene locus_tag LOCUS_11950 gene fumC 7965 6574 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 protein_id gnl|my_center|LOCUS_11950 9014 8067 gene locus_tag LOCUS_11960 9014 8067 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_11960 9705 9016 gene locus_tag LOCUS_11970 9705 9016 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence088 470 1312 gene locus_tag LOCUS_11980 470 1312 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_11980 1327 2265 gene locus_tag LOCUS_11990 1327 2265 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_11990 2293 3090 gene locus_tag LOCUS_12000 2293 3090 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_12000 3983 3258 gene locus_tag LOCUS_12010 3983 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 6162 3976 gene locus_tag LOCUS_12020 6162 3976 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986642.1 protein_id gnl|my_center|LOCUS_12020 7019 6159 gene locus_tag LOCUS_12030 7019 6159 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986643.1 protein_id gnl|my_center|LOCUS_12030 7658 7191 gene locus_tag LOCUS_12040 7658 7191 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 protein_id gnl|my_center|LOCUS_12040 9228 7729 gene locus_tag LOCUS_12050 9228 7729 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986504.1 protein_id gnl|my_center|LOCUS_12050 9874 9206 gene locus_tag LOCUS_12060 9874 9206 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986505.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence089 2753 2274 gene locus_tag LOCUS_12070 gene rlmH 2753 2274 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_12070 3572 2781 gene locus_tag LOCUS_12080 3572 2781 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_12080 4917 3631 gene locus_tag LOCUS_12090 4917 3631 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_12090 6875 5235 gene locus_tag LOCUS_12100 6875 5235 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811628.1 protein_id gnl|my_center|LOCUS_12100 8033 7146 gene locus_tag LOCUS_12110 8033 7146 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_12110 8869 8033 gene locus_tag LOCUS_12120 gene pgeF 8869 8033 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_12120 9835 8930 gene locus_tag LOCUS_12130 9835 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence090 958 458 gene locus_tag LOCUS_12140 958 458 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_12140 1410 2618 gene locus_tag LOCUS_12150 1410 2618 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_12150 2800 4173 gene locus_tag LOCUS_12160 gene argH 2800 4173 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_12160 4202 5245 gene locus_tag LOCUS_12170 gene argC 4202 5245 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861435.1 protein_id gnl|my_center|LOCUS_12170 5373 6593 gene locus_tag LOCUS_12180 gene argJ 5373 6593 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_12180 6612 7469 gene locus_tag LOCUS_12190 gene argB 6612 7469 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_12190 7612 7941 gene locus_tag LOCUS_12200 7612 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 7931 9112 gene locus_tag LOCUS_12210 7931 9112 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_12210 9109 10020 gene locus_tag LOCUS_12220 gene argF 9109 10020 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence091 455 2905 gene locus_tag LOCUS_12230 455 2905 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_12230 3444 4919 gene locus_tag LOCUS_12240 gene trpE 3444 4919 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_12240 4916 5497 gene locus_tag LOCUS_12250 4916 5497 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636333.1 protein_id gnl|my_center|LOCUS_12250 5490 6500 gene locus_tag LOCUS_12260 gene trpD 5490 6500 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_12260 6506 7300 gene locus_tag LOCUS_12270 gene trpC 6506 7300 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_12270 7297 7902 gene locus_tag LOCUS_12280 7297 7902 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592587.1 protein_id gnl|my_center|LOCUS_12280 7911 9095 gene locus_tag LOCUS_12290 gene trpB 7911 9095 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_12290 9092 9868 gene locus_tag LOCUS_12300 gene trpA 9092 9868 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence092 1937 1776 gene locus_tag LOCUS_12310 1937 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2557 1982 gene locus_tag LOCUS_12320 2557 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3085 2582 gene locus_tag LOCUS_12330 3085 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4532 3105 gene locus_tag LOCUS_12340 4532 3105 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817303.1 protein_id gnl|my_center|LOCUS_12340 4750 4532 gene locus_tag LOCUS_12350 4750 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5647 4751 gene locus_tag LOCUS_12360 5647 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 6084 5656 gene locus_tag LOCUS_12370 6084 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 6415 6032 gene locus_tag LOCUS_12380 6415 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 6839 6405 gene locus_tag LOCUS_12390 6839 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 7460 6846 gene locus_tag LOCUS_12400 7460 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 8491 7457 gene locus_tag LOCUS_12410 8491 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 8904 8509 gene locus_tag LOCUS_12420 8904 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 9859 8924 gene locus_tag LOCUS_12430 9859 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence093 1145 135 gene locus_tag LOCUS_12440 1145 135 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147451.1 protein_id gnl|my_center|LOCUS_12440 1360 1575 gene locus_tag LOCUS_12450 1360 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3713 1803 gene locus_tag LOCUS_12460 3713 1803 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_12460 4450 4016 gene locus_tag LOCUS_12470 4450 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943965.1 protein_id gnl|my_center|LOCUS_12470 4926 5714 gene locus_tag LOCUS_12480 4926 5714 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_12480 5750 6316 gene locus_tag LOCUS_12490 5750 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6642 6409 gene locus_tag LOCUS_12500 6642 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 6844 8136 gene locus_tag LOCUS_12510 gene mtaB 6844 8136 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_12510 8232 9416 gene locus_tag LOCUS_12520 8232 9416 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_12520 9420 9986 gene locus_tag LOCUS_12530 9420 9986 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence094 3246 2845 gene locus_tag LOCUS_12540 3246 2845 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544996.1 protein_id gnl|my_center|LOCUS_12540 4365 3268 gene locus_tag LOCUS_12550 gene rpoD 4365 3268 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_12550 6144 4378 gene locus_tag LOCUS_12560 gene dnaG 6144 4378 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_12560 7201 6200 gene locus_tag LOCUS_12570 7201 6200 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_12570 7956 7420 gene locus_tag LOCUS_12580 7956 7420 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12580 8338 8135 gene locus_tag LOCUS_12590 gene rpmE 8338 8135 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_12590 8987 8439 gene locus_tag LOCUS_12600 8987 8439 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480501.1 protein_id gnl|my_center|LOCUS_12600 9798 9004 gene locus_tag LOCUS_12610 9798 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence095 498 2714 gene locus_tag LOCUS_12620 gene pflB 498 2714 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_12620 2814 3560 gene locus_tag LOCUS_12630 gene pflA 2814 3560 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799649.1 protein_id gnl|my_center|LOCUS_12630 3858 4760 gene locus_tag LOCUS_12640 3858 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6481 5045 gene locus_tag LOCUS_12650 gene proS 6481 5045 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_12650 6690 6508 gene locus_tag LOCUS_12660 6690 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 7855 6707 gene locus_tag LOCUS_12670 7855 6707 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_12670 8279 8052 gene locus_tag LOCUS_12680 gene acpP 8279 8052 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_12680 8482 9348 gene locus_tag LOCUS_12690 8482 9348 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_12690 9345 9872 gene locus_tag LOCUS_12700 9345 9872 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence096 1139 66 gene locus_tag LOCUS_12710 gene mtnA 1139 66 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_12710 1989 1153 gene locus_tag LOCUS_12720 1989 1153 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_12720 2776 5892 gene locus_tag LOCUS_12730 gene ileS 2776 5892 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_12730 6771 6283 gene locus_tag LOCUS_12740 6771 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 7653 7120 gene locus_tag LOCUS_12750 7653 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 9296 7806 gene locus_tag LOCUS_12760 gene glpK 9296 7806 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964631.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence097 350 724 gene locus_tag LOCUS_12770 350 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 743 1813 gene locus_tag LOCUS_12780 743 1813 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975797.1 protein_id gnl|my_center|LOCUS_12780 1887 2612 gene locus_tag LOCUS_12790 1887 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2614 2934 gene locus_tag LOCUS_12800 2614 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2946 3548 gene locus_tag LOCUS_12810 2946 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014487.1 protein_id gnl|my_center|LOCUS_12810 3563 5107 gene locus_tag LOCUS_12820 3563 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460135.1 protein_id gnl|my_center|LOCUS_12820 5140 5619 gene locus_tag LOCUS_12830 5140 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5635 6042 gene locus_tag LOCUS_12840 5635 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 6153 8261 gene locus_tag LOCUS_12850 6153 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 8233 8457 gene locus_tag LOCUS_12860 8233 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8464 9378 gene locus_tag LOCUS_12870 8464 9378 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460133.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence098 259 2319 gene locus_tag LOCUS_12880 gene mutL 259 2319 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378991.1 protein_id gnl|my_center|LOCUS_12880 2342 3280 gene locus_tag LOCUS_12890 gene miaA 2342 3280 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_12890 3502 4833 gene locus_tag LOCUS_12900 3502 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4811 5551 gene locus_tag LOCUS_12910 4811 5551 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_12910 5572 6093 gene locus_tag LOCUS_12920 5572 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 6105 6857 gene locus_tag LOCUS_12930 6105 6857 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_12930 6882 7784 gene locus_tag LOCUS_12940 6882 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 7890 8351 gene locus_tag LOCUS_12950 gene lspA 7890 8351 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_12950 8351 9268 gene locus_tag LOCUS_12960 8351 9268 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence099 2676 523 gene locus_tag LOCUS_12970 2676 523 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_12970 3251 2901 gene locus_tag LOCUS_12980 3251 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3319 3561 gene locus_tag LOCUS_12990 3319 3561 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_12990 3558 3935 gene locus_tag LOCUS_13000 3558 3935 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_13000 4766 3936 gene locus_tag LOCUS_13010 4766 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 5145 4786 gene locus_tag LOCUS_13020 5145 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6957 5203 gene locus_tag LOCUS_13030 6957 5203 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010247013.1 protein_id gnl|my_center|LOCUS_13030 7422 7114 gene locus_tag LOCUS_13040 7422 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8372 7512 gene locus_tag LOCUS_13050 8372 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 9242 8463 gene locus_tag LOCUS_13060 9242 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence100 30 2249 gene locus_tag LOCUS_13070 30 2249 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_13070 2282 2932 gene locus_tag LOCUS_13080 2282 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4007 3063 gene locus_tag LOCUS_13090 4007 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4310 5101 gene locus_tag LOCUS_13100 4310 5101 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475488.1 protein_id gnl|my_center|LOCUS_13100 5463 6467 gene locus_tag LOCUS_13110 5463 6467 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_13110 6634 7755 gene locus_tag LOCUS_13120 6634 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 8685 7768 gene locus_tag LOCUS_13130 8685 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence101 1363 2421 gene locus_tag LOCUS_13140 gene purR 1363 2421 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366884.1 protein_id gnl|my_center|LOCUS_13140 3882 2521 gene locus_tag LOCUS_13150 3882 2521 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_13150 4462 6543 gene locus_tag LOCUS_13160 4462 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 7289 6660 gene locus_tag LOCUS_13170 7289 6660 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459715.1 protein_id gnl|my_center|LOCUS_13170 8230 7289 gene locus_tag LOCUS_13180 8230 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 9148 8291 gene locus_tag LOCUS_13190 9148 8291 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence102 442 1581 gene locus_tag LOCUS_13200 442 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2795 1923 gene locus_tag LOCUS_13210 2795 1923 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_13210 3793 2792 gene locus_tag LOCUS_13220 3793 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4594 3983 gene locus_tag LOCUS_13230 4594 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 5418 4594 gene locus_tag LOCUS_13240 5418 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7361 5973 gene locus_tag LOCUS_13250 gene gltA 7361 5973 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_13250 8202 7354 gene locus_tag LOCUS_13260 8202 7354 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence103 2365 614 gene locus_tag LOCUS_13270 gene pyk 2365 614 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_13270 2713 3543 gene locus_tag LOCUS_13280 2713 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3833 5893 gene locus_tag LOCUS_13290 3833 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 6442 6194 gene locus_tag LOCUS_13300 6442 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6640 7842 gene locus_tag LOCUS_13310 6640 7842 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence104 210 686 gene locus_tag LOCUS_13320 210 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 985 2331 gene locus_tag LOCUS_13330 gene gdhA 985 2331 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_13330 2613 4172 gene locus_tag LOCUS_13340 2613 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4423 5676 gene locus_tag LOCUS_13350 4423 5676 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_13350 5741 7351 gene locus_tag LOCUS_13360 5741 7351 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_13360 8793 7519 gene locus_tag LOCUS_13370 8793 7519 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence105 840 256 gene locus_tag LOCUS_13380 840 256 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904666.1 protein_id gnl|my_center|LOCUS_13380 1273 2478 gene locus_tag LOCUS_13390 1273 2478 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_13390 2840 3802 gene locus_tag LOCUS_13400 2840 3802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_13400 3804 4511 gene locus_tag LOCUS_13410 3804 4511 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237713.1 protein_id gnl|my_center|LOCUS_13410 4530 6317 gene locus_tag LOCUS_13420 4530 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 6317 7816 gene locus_tag LOCUS_13430 6317 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence106 2776 152 gene locus_tag LOCUS_13440 gene mutS 2776 152 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_13440 3352 2945 gene locus_tag LOCUS_13450 3352 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 4906 3491 gene locus_tag LOCUS_13460 gene miaB 4906 3491 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_13460 4906 5091 gene locus_tag LOCUS_13470 4906 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 5140 5352 gene locus_tag LOCUS_13480 5140 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6398 5418 gene locus_tag LOCUS_13490 6398 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 6834 7349 gene locus_tag LOCUS_13500 6834 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 8812 7577 gene locus_tag LOCUS_13510 gene galK 8812 7577 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence107 498 974 gene locus_tag LOCUS_13520 498 974 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775651.1 protein_id gnl|my_center|LOCUS_13520 984 1628 gene locus_tag LOCUS_13530 984 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2565 1714 gene locus_tag LOCUS_13540 2565 1714 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811435.1 protein_id gnl|my_center|LOCUS_13540 3497 3727 gene locus_tag LOCUS_13550 3497 3727 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423177.1 protein_id gnl|my_center|LOCUS_13550 3714 4133 gene locus_tag LOCUS_13560 3714 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 4149 4445 gene locus_tag LOCUS_13570 4149 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4470 4928 gene locus_tag LOCUS_13580 4470 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5055 5345 gene locus_tag LOCUS_13590 5055 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 5342 6778 gene locus_tag LOCUS_13600 gene gatA 5342 6778 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_13600 6775 8205 gene locus_tag LOCUS_13610 gene gatB 6775 8205 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_13610 8316 8717 gene locus_tag LOCUS_13620 8316 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence108 1428 154 gene locus_tag LOCUS_13630 1428 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3157 1598 gene locus_tag LOCUS_13640 3157 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4737 3361 gene locus_tag LOCUS_13650 gene rlmD 4737 3361 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_13650 5946 4834 gene locus_tag LOCUS_13660 gene hemW 5946 4834 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 protein_id gnl|my_center|LOCUS_13660 6137 5943 gene locus_tag LOCUS_13670 6137 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8072 6264 gene locus_tag LOCUS_13680 gene lepA 8072 6264 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_13680 <8893 8121 gene locus_tag LOCUS_13690 <8893 8121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803903.1:serine hydrolase domain-containing protein >Feature sequence109 533 1636 gene locus_tag LOCUS_13700 gene gerKC 533 1636 CDS product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 protein_id gnl|my_center|LOCUS_13700 1891 1700 gene locus_tag LOCUS_13710 1891 1700 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461361.1 protein_id gnl|my_center|LOCUS_13710 2196 1894 gene locus_tag LOCUS_13720 2196 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272591.1 protein_id gnl|my_center|LOCUS_13720 2647 3441 gene locus_tag LOCUS_13730 2647 3441 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_13730 4507 3677 gene locus_tag LOCUS_13740 4507 3677 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_13740 5141 4542 gene locus_tag LOCUS_13750 5141 4542 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390781.1 protein_id gnl|my_center|LOCUS_13750 5403 5173 gene locus_tag LOCUS_13760 5403 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5603 5400 gene locus_tag LOCUS_13770 5603 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 6428 5763 gene locus_tag LOCUS_13780 6428 5763 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_13780 7834 6461 gene locus_tag LOCUS_13790 7834 6461 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_13790 <8830 7834 gene locus_tag LOCUS_13800 <8830 7834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033047490.1:V-type ATP synthase subunit A >Feature sequence110 1977 109 gene locus_tag LOCUS_13810 gene asnB 1977 109 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703387.1 protein_id gnl|my_center|LOCUS_13810 2650 2000 gene locus_tag LOCUS_13820 2650 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3710 2631 gene locus_tag LOCUS_13830 gene mnmA 3710 2631 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_13830 4198 3716 gene locus_tag LOCUS_13840 4198 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5125 4283 gene locus_tag LOCUS_13850 5125 4283 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941466.1 protein_id gnl|my_center|LOCUS_13850 6675 5398 gene locus_tag LOCUS_13860 6675 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 8205 7078 gene locus_tag LOCUS_13870 8205 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence111 774 574 gene locus_tag LOCUS_13880 774 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1544 816 gene locus_tag LOCUS_13890 1544 816 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723344.1 protein_id gnl|my_center|LOCUS_13890 2416 1625 gene locus_tag LOCUS_13900 2416 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 4556 2811 gene locus_tag LOCUS_13910 4556 2811 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_13910 6365 4575 gene locus_tag LOCUS_13920 gene nuoF 6365 4575 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_13920 6751 6383 gene locus_tag LOCUS_13930 6751 6383 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_13930 7447 6884 gene locus_tag LOCUS_13940 7447 6884 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_13940 7949 7452 gene locus_tag LOCUS_13950 gene nuoE 7949 7452 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence112 2281 149 gene locus_tag LOCUS_13960 2281 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760433.1 protein_id gnl|my_center|LOCUS_13960 3745 2294 gene locus_tag LOCUS_13970 3745 2294 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533131.1 protein_id gnl|my_center|LOCUS_13970 4434 3757 gene locus_tag LOCUS_13980 4434 3757 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654037.1 protein_id gnl|my_center|LOCUS_13980 5148 4453 gene locus_tag LOCUS_13990 5148 4453 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006715.1 protein_id gnl|my_center|LOCUS_13990 6571 5267 gene locus_tag LOCUS_14000 6571 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 8328 7003 gene locus_tag LOCUS_14010 8328 7003 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence113 860 339 gene locus_tag LOCUS_14020 860 339 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294232.1 protein_id gnl|my_center|LOCUS_14020 1902 1012 gene locus_tag LOCUS_14030 1902 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2105 3445 gene locus_tag LOCUS_14040 2105 3445 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_14040 3442 4158 gene locus_tag LOCUS_14050 3442 4158 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_14050 4617 5252 gene locus_tag LOCUS_14060 4617 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5892 5356 gene locus_tag LOCUS_14070 5892 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 6754 5924 gene locus_tag LOCUS_14080 6754 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 7289 6741 gene locus_tag LOCUS_14090 7289 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986764.1 protein_id gnl|my_center|LOCUS_14090 7756 7286 gene locus_tag LOCUS_14100 7756 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 8255 7746 gene locus_tag LOCUS_14110 8255 7746 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986765.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence114 2016 1120 gene locus_tag LOCUS_14120 2016 1120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_14120 2386 2009 gene locus_tag LOCUS_14130 2386 2009 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284752.1 protein_id gnl|my_center|LOCUS_14130 2739 4322 gene locus_tag LOCUS_14140 2739 4322 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_14140 4442 5998 gene locus_tag LOCUS_14150 4442 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 6272 8314 gene locus_tag LOCUS_14160 6272 8314 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence115 259 963 gene locus_tag LOCUS_14170 259 963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036073.1 protein_id gnl|my_center|LOCUS_14170 951 2474 gene locus_tag LOCUS_14180 951 2474 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814305.1 protein_id gnl|my_center|LOCUS_14180 2478 3428 gene locus_tag LOCUS_14190 2478 3428 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_14190 3425 4321 gene locus_tag LOCUS_14200 gene prmC 3425 4321 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_14200 4338 5684 gene locus_tag LOCUS_14210 4338 5684 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_14210 5749 6351 gene locus_tag LOCUS_14220 5749 6351 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948614.1 protein_id gnl|my_center|LOCUS_14220 7083 6544 gene locus_tag LOCUS_14230 gene dcd 7083 6544 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_14230 7656 7105 gene locus_tag LOCUS_14240 7656 7105 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_14240 8205 7678 gene locus_tag LOCUS_14250 8205 7678 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence116 1918 488 gene locus_tag LOCUS_14260 gene purB 1918 488 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_14260 3480 2020 gene locus_tag LOCUS_14270 gene purF 3480 2020 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_14270 3520 3783 gene locus_tag LOCUS_14280 3520 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4492 3788 gene locus_tag LOCUS_14290 4492 3788 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_14290 7741 4523 gene locus_tag LOCUS_14300 gene carB 7741 4523 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_14300 <8323 7738 gene locus_tag LOCUS_14310 <8323 7738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288877.1:carbamoyl phosphate synthase small subunit >Feature sequence117 1648 173 gene locus_tag LOCUS_14320 1648 173 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_14320 2088 1648 gene locus_tag LOCUS_14330 2088 1648 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_14330 3173 2163 gene locus_tag LOCUS_14340 3173 2163 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_14340 4276 3224 gene locus_tag LOCUS_14350 4276 3224 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631126.1 protein_id gnl|my_center|LOCUS_14350 4543 5436 gene locus_tag LOCUS_14360 4543 5436 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_14360 5520 5846 gene locus_tag LOCUS_14370 5520 5846 CDS product DUF5713 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931839.1 protein_id gnl|my_center|LOCUS_14370 5895 7526 gene locus_tag LOCUS_14380 5895 7526 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_14380 7856 7569 gene locus_tag LOCUS_14390 7856 7569 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812921.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence118 1586 2443 gene locus_tag LOCUS_14400 gene dpsA 1586 2443 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460385.1 protein_id gnl|my_center|LOCUS_14400 2449 3021 gene locus_tag LOCUS_14410 2449 3021 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_14410 3433 3861 gene locus_tag LOCUS_14420 3433 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3906 5174 gene locus_tag LOCUS_14430 3906 5174 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_14430 5707 6990 gene locus_tag LOCUS_14440 5707 6990 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence119 1321 281 gene locus_tag LOCUS_14450 1321 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2438 1338 gene locus_tag LOCUS_14460 gene araD 2438 1338 CDS product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_14460 3706 2435 gene locus_tag LOCUS_14470 3706 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4624 3740 gene locus_tag LOCUS_14480 4624 3740 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_14480 5626 4646 gene locus_tag LOCUS_14490 5626 4646 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_14490 7436 5745 gene locus_tag LOCUS_14500 7436 5745 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence120 2261 225 gene locus_tag LOCUS_14510 2261 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2492 3280 gene locus_tag LOCUS_14520 gene udp 2492 3280 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_14520 3277 4443 gene locus_tag LOCUS_14530 3277 4443 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_14530 4478 4924 gene locus_tag LOCUS_14540 4478 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 6372 5239 gene locus_tag LOCUS_14550 6372 5239 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_14550 6704 7591 gene locus_tag LOCUS_14560 gene garR 6704 7591 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_14560 7700 8107 gene locus_tag LOCUS_14570 7700 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14570 >Feature sequence121 1708 335 gene locus_tag LOCUS_14580 1708 335 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_14580 2213 1791 gene locus_tag LOCUS_14590 2213 1791 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227398.1 protein_id gnl|my_center|LOCUS_14590 2965 2297 gene locus_tag LOCUS_14600 2965 2297 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021652.1 protein_id gnl|my_center|LOCUS_14600 3726 2974 gene locus_tag LOCUS_14610 3726 2974 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_14610 4502 3768 gene locus_tag LOCUS_14620 4502 3768 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223081.1 protein_id gnl|my_center|LOCUS_14620 4831 4580 gene locus_tag LOCUS_14630 4831 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5811 4828 gene locus_tag LOCUS_14640 gene dusB 5811 4828 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_14640 7667 5901 gene locus_tag LOCUS_14650 7667 5901 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence122 1284 2882 gene locus_tag LOCUS_14660 1284 2882 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_14660 2983 3201 gene locus_tag LOCUS_14670 2983 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4839 3376 gene locus_tag LOCUS_14680 4839 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5456 5007 gene locus_tag LOCUS_14690 5456 5007 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_14690 5906 6190 gene locus_tag LOCUS_14700 5906 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 6208 6681 gene locus_tag LOCUS_14710 6208 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 6749 7063 gene locus_tag LOCUS_14720 6749 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 7110 7550 gene locus_tag LOCUS_14730 7110 7550 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391640.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence123 427 906 gene locus_tag LOCUS_14740 427 906 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_14740 1183 3000 gene locus_tag LOCUS_14750 1183 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3662 3279 gene locus_tag LOCUS_14760 3662 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4075 3884 gene locus_tag LOCUS_14770 4075 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4404 4982 gene locus_tag LOCUS_14780 4404 4982 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_14780 4979 5203 gene locus_tag LOCUS_14790 4979 5203 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_14790 5203 5871 gene locus_tag LOCUS_14800 5203 5871 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902031.1 protein_id gnl|my_center|LOCUS_14800 6275 5982 gene locus_tag LOCUS_14810 6275 5982 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 protein_id gnl|my_center|LOCUS_14810 6569 6778 gene locus_tag LOCUS_14820 6569 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 7273 6800 gene locus_tag LOCUS_14830 7273 6800 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence124 192 425 gene locus_tag LOCUS_14840 192 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 515 1789 gene locus_tag LOCUS_14850 515 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2191 4278 gene locus_tag LOCUS_14860 gene topA 2191 4278 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_14860 4275 5603 gene locus_tag LOCUS_14870 gene trmFO 4275 5603 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813284.1 protein_id gnl|my_center|LOCUS_14870 5600 6604 gene locus_tag LOCUS_14880 gene plsX 5600 6604 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_14880 6776 7465 gene locus_tag LOCUS_14890 gene rnc 6776 7465 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence125 <1 815 gene locus_tag LOCUS_14900 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459478.1:histidinol-phosphatase HisJ family protein 1319 999 gene locus_tag LOCUS_14910 1319 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2032 1316 gene locus_tag LOCUS_14920 2032 1316 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_14920 2177 2443 gene locus_tag LOCUS_14930 2177 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3800 2727 gene locus_tag LOCUS_14940 gene leuB 3800 2727 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_14940 5552 3858 gene locus_tag LOCUS_14950 gene leuA 5552 3858 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_14950 7059 6379 gene locus_tag LOCUS_14960 7059 6379 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241899.1 protein_id gnl|my_center|LOCUS_14960 7188 7877 gene locus_tag LOCUS_14970 7188 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence126 655 1491 gene locus_tag LOCUS_14980 655 1491 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_14980 1811 2749 gene locus_tag LOCUS_14990 gene fba 1811 2749 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_14990 3409 6036 gene locus_tag LOCUS_15000 3409 6036 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_15000 6112 7398 gene locus_tag LOCUS_15010 6112 7398 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence127 1416 700 gene locus_tag LOCUS_15020 gene tsaB 1416 700 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_15020 1841 1413 gene locus_tag LOCUS_15030 gene tsaE 1841 1413 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_15030 3537 1867 gene locus_tag LOCUS_15040 3537 1867 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_15040 3745 4893 gene locus_tag LOCUS_15050 gene rodA 3745 4893 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_15050 4916 5677 gene locus_tag LOCUS_15060 4916 5677 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810589.1 protein_id gnl|my_center|LOCUS_15060 6689 6075 gene locus_tag LOCUS_15070 6689 6075 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_15070 7462 6686 gene locus_tag LOCUS_15080 7462 6686 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence128 745 224 gene locus_tag LOCUS_15090 745 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15090 2077 899 gene locus_tag LOCUS_15100 2077 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2498 2121 gene locus_tag LOCUS_15110 2498 2121 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921021.1 protein_id gnl|my_center|LOCUS_15110 2717 2541 gene locus_tag LOCUS_15120 2717 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3577 2792 gene locus_tag LOCUS_15130 3577 2792 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922480.1 protein_id gnl|my_center|LOCUS_15130 3732 3938 gene locus_tag LOCUS_15140 3732 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3925 4152 gene locus_tag LOCUS_15150 3925 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4360 4142 gene locus_tag LOCUS_15160 4360 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4436 4690 gene locus_tag LOCUS_15170 4436 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 4706 4900 gene locus_tag LOCUS_15180 4706 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 4897 5277 gene locus_tag LOCUS_15190 4897 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905370.1 protein_id gnl|my_center|LOCUS_15190 5294 5536 gene locus_tag LOCUS_15200 5294 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5592 5741 gene locus_tag LOCUS_15210 5592 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5903 6049 gene locus_tag LOCUS_15220 5903 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 6079 6228 gene locus_tag LOCUS_15230 6079 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 6215 6367 gene locus_tag LOCUS_15240 6215 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence129 116 823 gene locus_tag LOCUS_15250 116 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1053 1595 gene locus_tag LOCUS_15260 gene raiA 1053 1595 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_15260 1836 2993 gene locus_tag LOCUS_15270 1836 2993 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_15270 2998 3624 gene locus_tag LOCUS_15280 2998 3624 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_15280 4386 3832 gene locus_tag LOCUS_15290 gene pgsA 4386 3832 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_15290 5735 4401 gene locus_tag LOCUS_15300 gene rimO 5735 4401 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_15300 6360 5740 gene locus_tag LOCUS_15310 6360 5740 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_15310 7532 6360 gene locus_tag LOCUS_15320 gene recA 7532 6360 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence130 1228 209 gene locus_tag LOCUS_15330 1228 209 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170440.1 protein_id gnl|my_center|LOCUS_15330 1730 1320 gene locus_tag LOCUS_15340 1730 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2735 1767 gene locus_tag LOCUS_15350 gene bsh 2735 1767 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_15350 4220 3231 gene locus_tag LOCUS_15360 4220 3231 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_15360 6926 4878 gene locus_tag LOCUS_15370 6926 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence131 1038 2354 gene locus_tag LOCUS_15380 1038 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2525 4261 gene locus_tag LOCUS_15390 2525 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4275 5936 gene locus_tag LOCUS_15400 4275 5936 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966681.1 protein_id gnl|my_center|LOCUS_15400 5933 7567 gene locus_tag LOCUS_15410 5933 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence132 789 517 gene locus_tag LOCUS_15420 789 517 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_15420 1651 818 gene locus_tag LOCUS_15430 1651 818 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_15430 3466 2360 gene locus_tag LOCUS_15440 gene recF 3466 2360 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 protein_id gnl|my_center|LOCUS_15440 3672 3463 gene locus_tag LOCUS_15450 gene yaaA 3672 3463 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_15450 4000 3704 gene locus_tag LOCUS_15460 4000 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 5118 4015 gene locus_tag LOCUS_15470 gene dnaN 5118 4015 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_15470 7099 5771 gene locus_tag LOCUS_15480 gene dnaA 7099 5771 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence133 2221 1637 gene locus_tag LOCUS_15490 2221 1637 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_15490 4162 2417 gene locus_tag LOCUS_15500 4162 2417 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_15500 4960 4187 gene locus_tag LOCUS_15510 4960 4187 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_15510 5684 4977 gene locus_tag LOCUS_15520 5684 4977 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_15520 5950 5747 gene locus_tag LOCUS_15530 5950 5747 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_15530 6663 6067 gene locus_tag LOCUS_15540 6663 6067 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_15540 6751 6827 gene locus_tag LOCUS_t00070 6751 6827 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence134 51 2582 gene locus_tag LOCUS_15550 51 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2731 3528 gene locus_tag LOCUS_15560 2731 3528 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_15560 4031 4558 gene locus_tag LOCUS_15570 gene thiW 4031 4558 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_15570 4571 5392 gene locus_tag LOCUS_15580 gene thiM 4571 5392 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_15580 5379 6020 gene locus_tag LOCUS_15590 gene thiE 5379 6020 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436488.1 protein_id gnl|my_center|LOCUS_15590 6299 7009 gene locus_tag LOCUS_15600 gene thiD 6299 7009 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence135 233 2863 gene locus_tag LOCUS_15610 gene clpB 233 2863 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_15610 3033 2830 gene locus_tag LOCUS_15620 3033 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3363 3758 gene locus_tag LOCUS_15630 3363 3758 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948112.1 protein_id gnl|my_center|LOCUS_15630 3755 4438 gene locus_tag LOCUS_15640 3755 4438 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356156.1 protein_id gnl|my_center|LOCUS_15640 6528 4435 gene locus_tag LOCUS_15650 6528 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 7249 6503 gene locus_tag LOCUS_15660 7249 6503 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence136 <1 1237 gene locus_tag LOCUS_15670 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949084.1:phosphoenolpyruvate hydrolase family protein 1257 2576 gene locus_tag LOCUS_15680 1257 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3138 4988 gene locus_tag LOCUS_15690 3138 4988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_15690 5234 7078 gene locus_tag LOCUS_15700 5234 7078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence137 523 2298 gene locus_tag LOCUS_15710 gene uidA 523 2298 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775174.1 protein_id gnl|my_center|LOCUS_15710 2465 3445 gene locus_tag LOCUS_15720 2465 3445 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_15720 5737 3722 gene locus_tag LOCUS_15730 5737 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5910 6836 gene locus_tag LOCUS_15740 5910 6836 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence138 <1 727 gene locus_tag LOCUS_15750 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010981034.1:type I glyceraldehyde-3-phosphate dehydrogenase 1399 3432 gene locus_tag LOCUS_15760 gene glgB 1399 3432 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_15760 3464 4684 gene locus_tag LOCUS_15770 gene glgC 3464 4684 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_15770 4699 5823 gene locus_tag LOCUS_15780 gene glgD 4699 5823 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_15780 5893 7317 gene locus_tag LOCUS_15790 gene glgA 5893 7317 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence139 282 656 gene locus_tag LOCUS_15800 282 656 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_15800 1199 2644 gene locus_tag LOCUS_15810 1199 2644 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_15810 2663 3523 gene locus_tag LOCUS_15820 gene speE 2663 3523 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_15820 3523 4407 gene locus_tag LOCUS_15830 gene speB 3523 4407 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_15830 4674 5933 gene locus_tag LOCUS_15840 4674 5933 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_15840 5930 7141 gene locus_tag LOCUS_15850 gene nspC 5930 7141 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence140 197 1261 gene locus_tag LOCUS_15860 197 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1399 1250 gene locus_tag LOCUS_15870 1399 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1835 2266 gene locus_tag LOCUS_15880 1835 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2376 3473 gene locus_tag LOCUS_15890 2376 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 3655 4566 gene locus_tag LOCUS_15900 3655 4566 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209628184.1 protein_id gnl|my_center|LOCUS_15900 4603 5622 gene locus_tag LOCUS_15910 4603 5622 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804346.1 protein_id gnl|my_center|LOCUS_15910 6944 5700 gene locus_tag LOCUS_15920 6944 5700 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence141 2310 1636 gene locus_tag LOCUS_15930 2310 1636 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879896.1 protein_id gnl|my_center|LOCUS_15930 2712 2314 gene locus_tag LOCUS_15940 2712 2314 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948924.1 protein_id gnl|my_center|LOCUS_15940 3310 2738 gene locus_tag LOCUS_15950 3310 2738 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_15950 3699 3343 gene locus_tag LOCUS_15960 3699 3343 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_15960 4326 3826 gene locus_tag LOCUS_15970 4326 3826 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_15970 4854 6089 gene locus_tag LOCUS_15980 4854 6089 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_15980 6544 6900 gene locus_tag LOCUS_15990 6544 6900 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789114.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence142 1313 378 gene locus_tag LOCUS_16000 1313 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3199 1310 gene locus_tag LOCUS_16010 3199 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3911 3192 gene locus_tag LOCUS_16020 3911 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 5333 3924 gene locus_tag LOCUS_16030 5333 3924 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274807.1 protein_id gnl|my_center|LOCUS_16030 6439 5330 gene locus_tag LOCUS_16040 6439 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence143 1332 301 gene locus_tag LOCUS_16050 1332 301 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_16050 1465 2562 gene locus_tag LOCUS_16060 1465 2562 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_16060 2972 3817 gene locus_tag LOCUS_16070 2972 3817 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458873.1 protein_id gnl|my_center|LOCUS_16070 5089 3908 gene locus_tag LOCUS_16080 5089 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 6198 5455 gene locus_tag LOCUS_16090 gene trmB 6198 5455 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355768.1 protein_id gnl|my_center|LOCUS_16090 6595 6209 gene locus_tag LOCUS_16100 6595 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence144 143 1627 gene locus_tag LOCUS_16110 143 1627 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_16110 2820 1810 gene locus_tag LOCUS_16120 gene tsaD 2820 1810 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_16120 3888 3370 gene locus_tag LOCUS_16130 gene spoVT 3888 3370 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_16130 4400 4044 gene locus_tag LOCUS_16140 4400 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 5984 4410 gene locus_tag LOCUS_16150 5984 4410 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775555.1 protein_id gnl|my_center|LOCUS_16150 <6937 5988 gene locus_tag LOCUS_16160 <6937 5988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_163066848.1:recombinase family protein >Feature sequence145 1706 579 gene locus_tag LOCUS_16170 1706 579 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047786.1 protein_id gnl|my_center|LOCUS_16170 2166 1693 gene locus_tag LOCUS_16180 2166 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2475 2182 gene locus_tag LOCUS_16190 2475 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3455 2472 gene locus_tag LOCUS_16200 3455 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3594 3863 gene locus_tag LOCUS_16210 3594 3863 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_16210 3856 4125 gene locus_tag LOCUS_16220 3856 4125 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812263.1 protein_id gnl|my_center|LOCUS_16220 4870 4169 gene locus_tag LOCUS_16230 4870 4169 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232674.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence146 318 983 gene locus_tag LOCUS_16240 318 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1564 1142 gene locus_tag LOCUS_16250 1564 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_16250 2169 1612 gene locus_tag LOCUS_16260 gene efp 2169 1612 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_16260 3408 2332 gene locus_tag LOCUS_16270 gene pepQ 3408 2332 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_16270 3870 3433 gene locus_tag LOCUS_16280 gene aroQ 3870 3433 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_16280 4402 3893 gene locus_tag LOCUS_16290 4402 3893 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_16290 4679 4503 gene locus_tag LOCUS_16300 4679 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 4901 6697 gene locus_tag LOCUS_16310 4901 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence147 929 384 gene locus_tag LOCUS_16320 929 384 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831173.1 protein_id gnl|my_center|LOCUS_16320 1103 2014 gene locus_tag LOCUS_16330 1103 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 5026 2507 gene locus_tag LOCUS_16340 gene gyrA 5026 2507 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_16340 5748 5110 gene locus_tag LOCUS_16350 5748 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence148 1167 862 gene locus_tag LOCUS_16360 1167 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 2167 1244 gene locus_tag LOCUS_16370 2167 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2772 2182 gene locus_tag LOCUS_16380 2772 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3073 2819 gene locus_tag LOCUS_16390 3073 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3512 3168 gene locus_tag LOCUS_16400 3512 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3849 4052 gene locus_tag LOCUS_16410 3849 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4280 4119 gene locus_tag LOCUS_16420 4280 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 4412 5053 gene locus_tag LOCUS_16430 4412 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6673 5165 gene locus_tag LOCUS_16440 gene abfB 6673 5165 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence149 1650 367 gene locus_tag LOCUS_16450 1650 367 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679977.1 protein_id gnl|my_center|LOCUS_16450 2364 1942 gene locus_tag LOCUS_16460 2364 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2667 3335 gene locus_tag LOCUS_16470 gene sdaAB 2667 3335 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_16470 3365 4231 gene locus_tag LOCUS_16480 gene sdaAA 3365 4231 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963993.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence150 <1 805 gene locus_tag LOCUS_16490 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392614.1:cobyrinate a,c-diamide synthase 824 1882 gene locus_tag LOCUS_16500 gene cobT 824 1882 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_16500 1919 2470 gene locus_tag LOCUS_16510 gene cobU 1919 2470 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258421.1 protein_id gnl|my_center|LOCUS_16510 2674 3255 gene locus_tag LOCUS_16520 2674 3255 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722222.1 protein_id gnl|my_center|LOCUS_16520 3301 4080 gene locus_tag LOCUS_16530 gene cobS 3301 4080 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_16530 4071 4493 gene locus_tag LOCUS_16540 4071 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4469 5434 gene locus_tag LOCUS_16550 gene cbiB 4469 5434 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_16550 5444 6484 gene locus_tag LOCUS_16560 gene cobD 5444 6484 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence151 508 20 gene locus_tag LOCUS_16570 508 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1162 524 gene locus_tag LOCUS_16580 1162 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1544 1305 gene locus_tag LOCUS_16590 1544 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3338 1557 gene locus_tag LOCUS_16600 3338 1557 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109364.1 protein_id gnl|my_center|LOCUS_16600 5241 3613 gene locus_tag LOCUS_16610 5241 3613 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_16610 <6636 5412 gene locus_tag LOCUS_16620 <6636 5412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972693.1:extracellular solute-binding protein >Feature sequence152 553 215 gene locus_tag LOCUS_16630 553 215 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890395.1 protein_id gnl|my_center|LOCUS_16630 729 1079 gene locus_tag LOCUS_16640 729 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2503 1394 gene locus_tag LOCUS_16650 2503 1394 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461018.1 protein_id gnl|my_center|LOCUS_16650 2761 3318 gene locus_tag LOCUS_16660 2761 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 3315 4523 gene locus_tag LOCUS_16670 3315 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 5646 5029 gene locus_tag LOCUS_16680 5646 5029 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461185.1 protein_id gnl|my_center|LOCUS_16680 6584 5643 gene locus_tag LOCUS_16690 6584 5643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809174.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence153 456 1610 gene locus_tag LOCUS_16700 456 1610 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 protein_id gnl|my_center|LOCUS_16700 1607 4693 gene locus_tag LOCUS_16710 1607 4693 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247622.1 protein_id gnl|my_center|LOCUS_16710 5153 5905 gene locus_tag LOCUS_16720 gene larE 5153 5905 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence154 1298 66 gene locus_tag LOCUS_16730 1298 66 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_16730 2404 1562 gene locus_tag LOCUS_16740 2404 1562 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892682.1 protein_id gnl|my_center|LOCUS_16740 4136 3012 gene locus_tag LOCUS_16750 4136 3012 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_16750 4634 6385 gene locus_tag LOCUS_16760 4634 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence155 2297 1320 gene locus_tag LOCUS_16770 2297 1320 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193507.1 protein_id gnl|my_center|LOCUS_16770 3524 2373 gene locus_tag LOCUS_16780 3524 2373 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16780 3715 3521 gene locus_tag LOCUS_16790 3715 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 5135 3741 gene locus_tag LOCUS_16800 5135 3741 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_16800 <6512 5454 gene locus_tag LOCUS_16810 <6512 5454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083312.1:FAD-binding protein >Feature sequence156 3675 1693 gene locus_tag LOCUS_16820 gene gyrB 3675 1693 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_16820 5818 3875 gene locus_tag LOCUS_16830 gene ftsH 5818 3875 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_16830 6414 5860 gene locus_tag LOCUS_16840 gene hpt 6414 5860 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence157 401 1420 gene locus_tag LOCUS_16850 gene pheS 401 1420 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_16850 1436 3817 gene locus_tag LOCUS_16860 gene pheT 1436 3817 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_16860 4078 4323 gene locus_tag LOCUS_16870 4078 4323 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_16870 5225 4455 gene locus_tag LOCUS_16880 5225 4455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 protein_id gnl|my_center|LOCUS_16880 6301 5222 gene locus_tag LOCUS_16890 6301 5222 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669987.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence158 1050 763 gene locus_tag LOCUS_16900 1050 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1323 1162 gene locus_tag LOCUS_16910 1323 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1584 2606 gene locus_tag LOCUS_16920 1584 2606 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970573.1 protein_id gnl|my_center|LOCUS_16920 2651 3610 gene locus_tag LOCUS_16930 gene manA 2651 3610 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_16930 3652 5115 gene locus_tag LOCUS_16940 3652 5115 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence159 1539 19 gene locus_tag LOCUS_16950 1539 19 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_16950 2778 1642 gene locus_tag LOCUS_16960 2778 1642 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_16960 3613 2816 gene locus_tag LOCUS_16970 gene mtnP 3613 2816 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_16970 3905 4693 gene locus_tag LOCUS_16980 3905 4693 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948894.1 protein_id gnl|my_center|LOCUS_16980 4690 5775 gene locus_tag LOCUS_16990 4690 5775 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_16990 5841 6104 gene locus_tag LOCUS_17000 5841 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17000 6101 6340 gene locus_tag LOCUS_17010 6101 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence160 270 1448 gene locus_tag LOCUS_17020 270 1448 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_17020 1605 2489 gene locus_tag LOCUS_17030 1605 2489 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_17030 2505 3596 gene locus_tag LOCUS_17040 2505 3596 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_17040 3600 4361 gene locus_tag LOCUS_17050 3600 4361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_17050 4375 5085 gene locus_tag LOCUS_17060 4375 5085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902265.1 protein_id gnl|my_center|LOCUS_17060 5481 6128 gene locus_tag LOCUS_17070 5481 6128 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence161 2209 53 gene locus_tag LOCUS_17080 2209 53 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_17080 3136 2432 gene locus_tag LOCUS_17090 3136 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 3842 3144 gene locus_tag LOCUS_17100 3842 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5490 4249 gene locus_tag LOCUS_17110 5490 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6135 5608 gene locus_tag LOCUS_17120 6135 5608 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222360.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence162 1320 295 gene locus_tag LOCUS_17130 1320 295 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_17130 2435 1335 gene locus_tag LOCUS_17140 gene prfA 2435 1335 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_17140 2666 2469 gene locus_tag LOCUS_17150 2666 2469 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_17150 2892 3869 gene locus_tag LOCUS_17160 2892 3869 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_17160 5900 4212 gene locus_tag LOCUS_17170 5900 4212 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence163 1204 23 gene locus_tag LOCUS_17180 1204 23 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786824.1 protein_id gnl|my_center|LOCUS_17180 3679 1205 gene locus_tag LOCUS_17190 3679 1205 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084336.1 protein_id gnl|my_center|LOCUS_17190 4749 3640 gene locus_tag LOCUS_17200 4749 3640 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence164 236 1555 gene locus_tag LOCUS_17210 236 1555 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_17210 2254 2718 gene locus_tag LOCUS_17220 2254 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2711 4537 gene locus_tag LOCUS_17230 gene ftsH 2711 4537 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence165 2012 1173 gene locus_tag LOCUS_17240 2012 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3449 2601 gene locus_tag LOCUS_17250 3449 2601 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459863.1 protein_id gnl|my_center|LOCUS_17250 4084 3812 gene locus_tag LOCUS_17260 4084 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4475 4212 gene locus_tag LOCUS_17270 4475 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence166 1005 2018 gene locus_tag LOCUS_17280 1005 2018 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964555.1 protein_id gnl|my_center|LOCUS_17280 2083 2970 gene locus_tag LOCUS_17290 gene mreC 2083 2970 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_17290 2974 3492 gene locus_tag LOCUS_17300 2974 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3644 5899 gene locus_tag LOCUS_17310 3644 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence167 1702 389 gene locus_tag LOCUS_17320 1702 389 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_17320 4620 1714 gene locus_tag LOCUS_17330 4620 1714 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence168 280 972 gene locus_tag LOCUS_17340 280 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1115 1678 gene locus_tag LOCUS_17350 1115 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1647 3584 gene locus_tag LOCUS_17360 1647 3584 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_17360 3601 3864 gene locus_tag LOCUS_17370 3601 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3879 5525 gene locus_tag LOCUS_17380 3879 5525 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975801.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence169 <1 2179 gene locus_tag LOCUS_17390 <1 2179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963838.1:DNA polymerase III subunit alpha 2417 3385 gene locus_tag LOCUS_17400 gene pfkA 2417 3385 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_17400 3699 4010 gene locus_tag LOCUS_17410 3699 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence170 458 1675 gene locus_tag LOCUS_17420 458 1675 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495003.1 protein_id gnl|my_center|LOCUS_17420 1681 2685 gene locus_tag LOCUS_17430 1681 2685 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_17430 2682 3500 gene locus_tag LOCUS_17440 2682 3500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367330.1 protein_id gnl|my_center|LOCUS_17440 3497 4717 gene locus_tag LOCUS_17450 gene hydF 3497 4717 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_17450 4720 4974 gene locus_tag LOCUS_17460 4720 4974 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence171 440 943 gene locus_tag LOCUS_17470 gene purE 440 943 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_17470 964 1998 gene locus_tag LOCUS_17480 gene purM 964 1998 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_17480 1992 2615 gene locus_tag LOCUS_17490 gene purN 1992 2615 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_17490 2631 3341 gene locus_tag LOCUS_17500 2631 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3355 4533 gene locus_tag LOCUS_17510 3355 4533 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_17510 4558 5847 gene locus_tag LOCUS_17520 gene purD 4558 5847 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence172 3 893 gene locus_tag LOCUS_17530 3 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 898 1725 gene locus_tag LOCUS_17540 898 1725 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_17540 1718 2683 gene locus_tag LOCUS_17550 1718 2683 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_17550 2685 4142 gene locus_tag LOCUS_17560 gene glpK 2685 4142 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080610.1 protein_id gnl|my_center|LOCUS_17560 4324 5808 gene locus_tag LOCUS_17570 4324 5808 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence173 2984 2298 gene locus_tag LOCUS_17580 2984 2298 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_17580 3856 2996 gene locus_tag LOCUS_17590 gene metF 3856 2996 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_17590 5848 3881 gene locus_tag LOCUS_17600 5848 3881 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence174 380 234 gene locus_tag LOCUS_17610 380 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1146 523 gene locus_tag LOCUS_17620 1146 523 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_17620 1989 1273 gene locus_tag LOCUS_17630 1989 1273 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922203.1 protein_id gnl|my_center|LOCUS_17630 2407 3357 gene locus_tag LOCUS_17640 2407 3357 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_17640 3503 4561 gene locus_tag LOCUS_17650 3503 4561 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_17650 5124 4663 gene locus_tag LOCUS_17660 5124 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 5527 5144 gene locus_tag LOCUS_17670 5527 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence175 <1 640 gene locus_tag LOCUS_17680 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392546.1:30S ribosomal protein S2 762 1676 gene locus_tag LOCUS_17690 gene tsf 762 1676 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018581.1 protein_id gnl|my_center|LOCUS_17690 3291 1828 gene locus_tag LOCUS_17700 3291 1828 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_17700 4339 3440 gene locus_tag LOCUS_17710 4339 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 4515 4961 gene locus_tag LOCUS_17720 4515 4961 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence176 136 1134 gene locus_tag LOCUS_17730 gene hypE 136 1134 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_17730 1466 2773 gene locus_tag LOCUS_17740 1466 2773 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_17740 2850 3257 gene locus_tag LOCUS_17750 2850 3257 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_17750 3690 4586 gene locus_tag LOCUS_17760 3690 4586 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_17760 4590 5549 gene locus_tag LOCUS_17770 4590 5549 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence177 1024 698 gene locus_tag LOCUS_17780 1024 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1729 1205 gene locus_tag LOCUS_17790 1729 1205 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_17790 2664 1741 gene locus_tag LOCUS_17800 2664 1741 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383736.1 protein_id gnl|my_center|LOCUS_17800 3757 2855 gene locus_tag LOCUS_17810 gene truB 3757 2855 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_17810 4727 3774 gene locus_tag LOCUS_17820 4727 3774 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_17820 5089 4748 gene locus_tag LOCUS_17830 gene rbfA 5089 4748 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262599.1 protein_id gnl|my_center|LOCUS_17830 5295 5107 gene locus_tag LOCUS_17840 5295 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence178 1176 253 gene locus_tag LOCUS_17850 1176 253 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_17850 2894 1257 gene locus_tag LOCUS_17860 2894 1257 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_17860 3327 5396 gene locus_tag LOCUS_17870 3327 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence179 2115 652 gene locus_tag LOCUS_17880 2115 652 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_17880 2810 2136 gene locus_tag LOCUS_17890 2810 2136 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965084.1 protein_id gnl|my_center|LOCUS_17890 3218 3466 gene locus_tag LOCUS_17900 3218 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 4813 3593 gene locus_tag LOCUS_17910 4813 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 5227 4898 gene locus_tag LOCUS_17920 5227 4898 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906388.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence180 1615 2196 gene locus_tag LOCUS_17930 gene sigH 1615 2196 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966429.1 protein_id gnl|my_center|LOCUS_17930 2303 2587 gene locus_tag LOCUS_17940 2303 2587 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_17940 2982 4826 gene locus_tag LOCUS_17950 2982 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5403 4882 gene locus_tag LOCUS_17960 5403 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence181 348 1790 gene locus_tag LOCUS_17970 gene nhaC 348 1790 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711547.1 protein_id gnl|my_center|LOCUS_17970 2140 3930 gene locus_tag LOCUS_17980 2140 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 3977 4822 gene locus_tag LOCUS_17990 3977 4822 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence182 807 127 gene locus_tag LOCUS_18000 807 127 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_18000 1282 1094 gene locus_tag LOCUS_18010 gene rpmB 1282 1094 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_18010 2399 1695 gene locus_tag LOCUS_18020 gene plsY 2399 1695 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_18020 3757 2426 gene locus_tag LOCUS_18030 gene der 3757 2426 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_18030 5067 3742 gene locus_tag LOCUS_18040 5067 3742 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence183 1302 502 gene locus_tag LOCUS_18050 gene queG 1302 502 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 protein_id gnl|my_center|LOCUS_18050 2166 1327 gene locus_tag LOCUS_18060 2166 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3994 2648 gene locus_tag LOCUS_18070 3994 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4551 3991 gene locus_tag LOCUS_18080 4551 3991 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_18080 4850 5029 gene locus_tag LOCUS_18090 4850 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence184 1009 290 gene locus_tag LOCUS_18100 1009 290 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_18100 1860 1006 gene locus_tag LOCUS_18110 1860 1006 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_18110 2654 1857 gene locus_tag LOCUS_18120 gene fecE 2654 1857 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 protein_id gnl|my_center|LOCUS_18120 3690 2647 gene locus_tag LOCUS_18130 3690 2647 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 protein_id gnl|my_center|LOCUS_18130 4696 3647 gene locus_tag LOCUS_18140 4696 3647 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156774516.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence185 444 1508 gene locus_tag LOCUS_18150 444 1508 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966298.1 protein_id gnl|my_center|LOCUS_18150 1619 2599 gene locus_tag LOCUS_18160 1619 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2622 3059 gene locus_tag LOCUS_18170 2622 3059 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 protein_id gnl|my_center|LOCUS_18170 3040 4947 gene locus_tag LOCUS_18180 3040 4947 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence186 811 161 gene locus_tag LOCUS_18190 811 161 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_18190 2158 1277 gene locus_tag LOCUS_18200 2158 1277 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679543.1 protein_id gnl|my_center|LOCUS_18200 3103 4302 gene locus_tag LOCUS_18210 3103 4302 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814996.1 protein_id gnl|my_center|LOCUS_18210 4916 5140 gene locus_tag LOCUS_18220 4916 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence187 1354 116 gene locus_tag LOCUS_18230 1354 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030686.1 protein_id gnl|my_center|LOCUS_18230 1856 2653 gene locus_tag LOCUS_18240 1856 2653 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811567.1 protein_id gnl|my_center|LOCUS_18240 3272 2805 gene locus_tag LOCUS_18250 3272 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4335 3382 gene locus_tag LOCUS_18260 4335 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4956 4348 gene locus_tag LOCUS_18270 4956 4348 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence188 918 157 gene locus_tag LOCUS_18280 gene truA 918 157 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_18280 1752 940 gene locus_tag LOCUS_18290 1752 940 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_18290 2617 1742 gene locus_tag LOCUS_18300 2617 1742 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_18300 3520 2669 gene locus_tag LOCUS_18310 3520 2669 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_18310 4195 3608 gene locus_tag LOCUS_18320 4195 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359842.1 protein_id gnl|my_center|LOCUS_18320 5141 4293 gene locus_tag LOCUS_18330 5141 4293 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence189 493 299 gene locus_tag LOCUS_18340 493 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 2342 576 gene locus_tag LOCUS_18350 2342 576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_18350 2487 2287 gene locus_tag LOCUS_18360 2487 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 4123 2516 gene locus_tag LOCUS_18370 4123 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4787 4299 gene locus_tag LOCUS_18380 4787 4299 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence190 772 272 gene locus_tag LOCUS_18390 gene lepB 772 272 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_18390 1843 1250 gene locus_tag LOCUS_18400 gene lepB 1843 1250 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861178.1 protein_id gnl|my_center|LOCUS_18400 2256 1912 gene locus_tag LOCUS_18410 gene rplS 2256 1912 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_18410 3126 2470 gene locus_tag LOCUS_18420 3126 2470 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_18420 4957 3113 gene locus_tag LOCUS_18430 4957 3113 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence191 1360 101 gene locus_tag LOCUS_18440 gene murA 1360 101 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_18440 2585 1464 gene locus_tag LOCUS_18450 gene murG 2585 1464 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_18450 3716 2634 gene locus_tag LOCUS_18460 gene spoVE 3716 2634 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_18460 3900 3718 gene locus_tag LOCUS_18470 3900 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 4919 3909 gene locus_tag LOCUS_18480 gene mraY 4919 3909 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893058.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence192 2961 334 gene locus_tag LOCUS_18490 gene alaS 2961 334 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_18490 4930 3314 gene locus_tag LOCUS_18500 4930 3314 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438168.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence193 227 922 gene locus_tag LOCUS_18510 gene sleB 227 922 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_18510 1550 999 gene locus_tag LOCUS_18520 1550 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3697 1763 gene locus_tag LOCUS_18530 3697 1763 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026861.1 protein_id gnl|my_center|LOCUS_18530 <5107 4332 gene locus_tag LOCUS_18540 <5107 4332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003362954.1:CAP domain-containing protein >Feature sequence194 330 662 gene locus_tag LOCUS_18550 gene spoIIAA 330 662 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 protein_id gnl|my_center|LOCUS_18550 646 1089 gene locus_tag LOCUS_18560 gene spoIIAB 646 1089 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_18560 1082 1741 gene locus_tag LOCUS_18570 gene sigF 1082 1741 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_18570 2925 1996 gene locus_tag LOCUS_18580 gene metA 2925 1996 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_18580 3117 4376 gene locus_tag LOCUS_18590 3117 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4992 4489 gene locus_tag LOCUS_18600 4992 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence195 <1 529 gene locus_tag LOCUS_18610 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013221961.1:DNA gyrase subunit A 1349 1600 gene locus_tag LOCUS_18620 gene secG 1349 1600 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556760.1 protein_id gnl|my_center|LOCUS_18620 1760 3910 gene locus_tag LOCUS_18630 gene rnr 1760 3910 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_18630 4023 4295 gene locus_tag LOCUS_18640 4023 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 4407 4667 gene locus_tag LOCUS_18650 4407 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence196 1298 3043 gene locus_tag LOCUS_18660 1298 3043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 protein_id gnl|my_center|LOCUS_18660 3033 4811 gene locus_tag LOCUS_18670 3033 4811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732216.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence197 169 1350 gene locus_tag LOCUS_18680 169 1350 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_18680 1846 3201 gene locus_tag LOCUS_18690 1846 3201 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_18690 3402 4064 gene locus_tag LOCUS_18700 3402 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence198 769 401 gene locus_tag LOCUS_18710 769 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1827 2459 gene locus_tag LOCUS_18720 gene catA 1827 2459 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775611.1 protein_id gnl|my_center|LOCUS_18720 2493 3023 gene locus_tag LOCUS_18730 2493 3023 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964804.1 protein_id gnl|my_center|LOCUS_18730 4505 3156 gene locus_tag LOCUS_18740 4505 3156 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence199 1177 122 gene locus_tag LOCUS_18750 1177 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1890 1192 gene locus_tag LOCUS_18760 1890 1192 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_18760 2421 1903 gene locus_tag LOCUS_18770 2421 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2740 3573 gene locus_tag LOCUS_18780 2740 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 4591 3794 gene locus_tag LOCUS_18790 4591 3794 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965895.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence200 706 1506 gene locus_tag LOCUS_18800 gene proB 706 1506 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_18800 1600 2376 gene locus_tag LOCUS_18810 1600 2376 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763459.1 protein_id gnl|my_center|LOCUS_18810 2486 3730 gene locus_tag LOCUS_18820 2486 3730 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_18820 3747 4715 gene locus_tag LOCUS_18830 3747 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence201 813 82 gene locus_tag LOCUS_18840 813 82 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100921.1 protein_id gnl|my_center|LOCUS_18840 2350 806 gene locus_tag LOCUS_18850 2350 806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245821.1 protein_id gnl|my_center|LOCUS_18850 2952 2350 gene locus_tag LOCUS_18860 2952 2350 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777526.1 protein_id gnl|my_center|LOCUS_18860 3630 2995 gene locus_tag LOCUS_18870 gene thiU 3630 2995 CDS product HMP/thiamine ABC transporter substrate-binding protein ThiU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244962.1 protein_id gnl|my_center|LOCUS_18870 3954 4673 gene locus_tag LOCUS_18880 gene sigK 3954 4673 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence202 1726 452 gene locus_tag LOCUS_18890 gene larA 1726 452 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948687.1 protein_id gnl|my_center|LOCUS_18890 2548 1742 gene locus_tag LOCUS_18900 2548 1742 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392694.1 protein_id gnl|my_center|LOCUS_18900 2950 4611 gene locus_tag LOCUS_18910 gene gcl 2950 4611 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence203 665 3403 gene locus_tag LOCUS_18920 665 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3406 4386 gene locus_tag LOCUS_18930 3406 4386 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence204 597 1103 gene locus_tag LOCUS_18940 597 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2659 1592 gene locus_tag LOCUS_18950 gene uxuA 2659 1592 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_18950 4399 2783 gene locus_tag LOCUS_18960 4399 2783 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence205 339 73 gene locus_tag LOCUS_18970 339 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 943 494 gene locus_tag LOCUS_18980 gene dut 943 494 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_18980 1655 1077 gene locus_tag LOCUS_18990 1655 1077 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017089.1 protein_id gnl|my_center|LOCUS_18990 4000 1913 gene locus_tag LOCUS_19000 4000 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence206 483 1826 gene locus_tag LOCUS_19010 483 1826 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_19010 2154 2023 gene locus_tag LOCUS_19020 2154 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2565 3017 gene locus_tag LOCUS_19030 2565 3017 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425587.1 protein_id gnl|my_center|LOCUS_19030 3091 3639 gene locus_tag LOCUS_19040 3091 3639 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_19040 3636 4286 gene locus_tag LOCUS_19050 3636 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19050 4287 4664 gene locus_tag LOCUS_19060 4287 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19060 >Feature sequence207 55 678 gene locus_tag LOCUS_19070 gene dhuI 55 678 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase DhuI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684791.1 protein_id gnl|my_center|LOCUS_19070 1166 1300 gene locus_tag LOCUS_19080 1166 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1641 1976 gene locus_tag LOCUS_19090 gene rnpA 1641 1976 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_19090 1973 2212 gene locus_tag LOCUS_19100 gene yidD 1973 2212 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_19100 2232 3350 gene locus_tag LOCUS_19110 2232 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3452 4321 gene locus_tag LOCUS_19120 3452 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence208 275 838 gene locus_tag LOCUS_19130 275 838 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_19130 852 1280 gene locus_tag LOCUS_19140 852 1280 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_19140 2288 1611 gene locus_tag LOCUS_19150 2288 1611 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 protein_id gnl|my_center|LOCUS_19150 4007 2289 gene locus_tag LOCUS_19160 4007 2289 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence209 563 2371 gene locus_tag LOCUS_19170 gene fucI 563 2371 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_19170 2736 3317 gene locus_tag LOCUS_19180 2736 3317 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_19180 3351 4190 gene locus_tag LOCUS_19190 3351 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence210 223 1080 gene locus_tag LOCUS_19200 223 1080 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_19200 1084 1539 gene locus_tag LOCUS_19210 1084 1539 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_19210 1544 3232 gene locus_tag LOCUS_19220 gene recN 1544 3232 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence211 <1 1080 gene locus_tag LOCUS_19230 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000924246.1:prolipoprotein diacylglyceryl transferase 1184 2038 gene locus_tag LOCUS_19240 gene folD 1184 2038 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_19240 2060 3919 gene locus_tag LOCUS_19250 gene dxs 2060 3919 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence212 2718 154 gene locus_tag LOCUS_19260 2718 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 3062 2715 gene locus_tag LOCUS_19270 3062 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 3372 3055 gene locus_tag LOCUS_19280 3372 3055 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_19280 <4459 3473 gene locus_tag LOCUS_19290 <4459 3473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231912.1:transcription termination factor NusA >Feature sequence213 384 842 gene locus_tag LOCUS_19300 384 842 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_19300 880 1572 gene locus_tag LOCUS_19310 gene araD 880 1572 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897453.1 protein_id gnl|my_center|LOCUS_19310 1855 2697 gene locus_tag LOCUS_19320 1855 2697 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_19320 3665 2817 gene locus_tag LOCUS_19330 3665 2817 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893097.1 protein_id gnl|my_center|LOCUS_19330 3747 4403 gene locus_tag LOCUS_19340 3747 4403 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence214 2469 1669 gene locus_tag LOCUS_19350 2469 1669 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 protein_id gnl|my_center|LOCUS_19350 4254 2818 gene locus_tag LOCUS_19360 4254 2818 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence215 506 1249 gene locus_tag LOCUS_19370 gene minD 506 1249 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503309.1 protein_id gnl|my_center|LOCUS_19370 1324 1728 gene locus_tag LOCUS_19380 gene mgsA 1324 1728 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_19380 2207 3499 gene locus_tag LOCUS_19390 gene hisS 2207 3499 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence216 2660 1293 gene locus_tag LOCUS_19400 2660 1293 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_19400 2865 3023 gene locus_tag LOCUS_19410 2865 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3407 3144 gene locus_tag LOCUS_19420 3407 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4326 3448 gene locus_tag LOCUS_19430 4326 3448 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence217 <1 1135 gene locus_tag LOCUS_19440 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009966633.1:bifunctional lytic transglycosylase/C40 family peptidase 1275 1640 gene locus_tag LOCUS_19450 1275 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1610 4141 gene locus_tag LOCUS_19460 1610 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence218 1169 321 gene locus_tag LOCUS_19470 1169 321 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_19470 1689 1528 gene locus_tag LOCUS_19480 1689 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1640 2878 gene locus_tag LOCUS_19490 1640 2878 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_19490 4051 4126 gene locus_tag LOCUS_t00080 4051 4126 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence219 387 73 gene locus_tag LOCUS_19500 gene rhaM 387 73 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619478.1 protein_id gnl|my_center|LOCUS_19500 981 457 gene locus_tag LOCUS_19510 981 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1411 3834 gene locus_tag LOCUS_19520 1411 3834 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence220 505 669 gene locus_tag LOCUS_19530 505 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 832 757 gene locus_tag LOCUS_t00090 832 757 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1843 983 gene locus_tag LOCUS_19540 1843 983 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289232.1 protein_id gnl|my_center|LOCUS_19540 2889 1840 gene locus_tag LOCUS_19550 2889 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_19550 4198 2912 gene locus_tag LOCUS_19560 4198 2912 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356656.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence221 234 1304 gene locus_tag LOCUS_19570 234 1304 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966073.1 protein_id gnl|my_center|LOCUS_19570 1319 2188 gene locus_tag LOCUS_19580 1319 2188 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_19580 2472 2939 gene locus_tag LOCUS_19590 2472 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 3841 3014 gene locus_tag LOCUS_19600 3841 3014 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence222 350 1273 gene locus_tag LOCUS_19610 350 1273 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963617.1 protein_id gnl|my_center|LOCUS_19610 2308 1664 gene locus_tag LOCUS_19620 2308 1664 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480027.1 protein_id gnl|my_center|LOCUS_19620 2735 3925 gene locus_tag LOCUS_19630 2735 3925 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence223 3 305 gene locus_tag LOCUS_19640 3 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 311 814 gene locus_tag LOCUS_19650 gene ybeY 311 814 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_19650 821 1315 gene locus_tag LOCUS_19660 821 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1317 2243 gene locus_tag LOCUS_19670 gene era 1317 2243 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_19670 2453 2659 gene locus_tag LOCUS_19680 2453 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2601 3347 gene locus_tag LOCUS_19690 gene recO 2601 3347 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460852.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence224 1821 310 gene locus_tag LOCUS_19700 1821 310 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_19700 2150 3082 gene locus_tag LOCUS_19710 2150 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 <4174 3371 gene locus_tag LOCUS_19720 <4174 3371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462186.1:Cof-type HAD-IIB family hydrolase >Feature sequence225 <1 1795 gene locus_tag LOCUS_19730 <1 1795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861289.1:HAD-IC family P-type ATPase 1890 3413 gene locus_tag LOCUS_19740 gene xylB 1890 3413 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence226 1404 508 gene locus_tag LOCUS_19750 1404 508 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_19750 2581 1679 gene locus_tag LOCUS_19760 2581 1679 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_19760 3768 2584 gene locus_tag LOCUS_19770 3768 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence227 1353 181 gene locus_tag LOCUS_19780 1353 181 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_19780 3062 1350 gene locus_tag LOCUS_19790 3062 1350 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986398.1 protein_id gnl|my_center|LOCUS_19790 3416 3171 gene locus_tag LOCUS_19800 3416 3171 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence228 334 690 gene locus_tag LOCUS_19810 gene spoVAE 334 690 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_19810 970 818 gene locus_tag LOCUS_19820 970 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1404 1141 gene locus_tag LOCUS_19830 gene rpsT 1404 1141 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_19830 1531 2406 gene locus_tag LOCUS_19840 gene gpr 1531 2406 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_19840 2474 3679 gene locus_tag LOCUS_19850 2474 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3713 3940 gene locus_tag LOCUS_19860 3713 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence229 163 44 gene locus_tag LOCUS_19870 163 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 183 1850 gene locus_tag LOCUS_19880 183 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1868 2218 gene locus_tag LOCUS_19890 1868 2218 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_19890 2222 2824 gene locus_tag LOCUS_19900 gene recR 2222 2824 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_19900 3071 3538 gene locus_tag LOCUS_19910 gene smpB 3071 3538 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_19910 3630 4005 gene locus_tag LOCUS_tm00010 3630 4005 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence230 548 105 gene locus_tag LOCUS_19920 548 105 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_19920 975 844 gene locus_tag LOCUS_19930 975 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1368 1000 gene locus_tag LOCUS_19940 1368 1000 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268365.1 protein_id gnl|my_center|LOCUS_19940 1596 1802 gene locus_tag LOCUS_19950 1596 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1799 2083 gene locus_tag LOCUS_19960 1799 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2827 2111 gene locus_tag LOCUS_19970 2827 2111 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_19970 3163 3591 gene locus_tag LOCUS_19980 gene rplM 3163 3591 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_19980 3611 4012 gene locus_tag LOCUS_19990 gene rpsI 3611 4012 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence231 1345 2478 gene locus_tag LOCUS_20000 1345 2478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_20000 2475 3293 gene locus_tag LOCUS_20010 2475 3293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence232 208 1353 gene locus_tag LOCUS_20020 gene nagA 208 1353 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868992.1 protein_id gnl|my_center|LOCUS_20020 1681 2766 gene locus_tag LOCUS_20030 gene serC 1681 2766 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_20030 2779 3951 gene locus_tag LOCUS_20040 2779 3951 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence233 1166 2494 gene locus_tag LOCUS_20050 1166 2494 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_20050 2604 3443 gene locus_tag LOCUS_20060 2604 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence234 108 1442 gene locus_tag LOCUS_20070 108 1442 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_20070 1545 2216 gene locus_tag LOCUS_20080 1545 2216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_20080 2341 2595 gene locus_tag LOCUS_20090 2341 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2671 3648 gene locus_tag LOCUS_20100 2671 3648 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence235 54 524 gene locus_tag LOCUS_20110 54 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence236 315 1190 gene locus_tag LOCUS_20120 315 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1183 3384 gene locus_tag LOCUS_20130 1183 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence237 51 875 gene locus_tag LOCUS_20140 51 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 917 1717 gene locus_tag LOCUS_20150 917 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1730 3235 gene locus_tag LOCUS_20160 1730 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence238 57 1991 gene locus_tag LOCUS_20170 57 1991 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_20170 2086 3696 gene locus_tag LOCUS_20180 2086 3696 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence239 586 1857 gene locus_tag LOCUS_20190 586 1857 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_20190 2579 3202 gene locus_tag LOCUS_20200 2579 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3260 3344 gene locus_tag LOCUS_t00100 3260 3344 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence240 306 860 gene locus_tag LOCUS_20210 306 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 877 1140 gene locus_tag LOCUS_20220 877 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1162 2553 gene locus_tag LOCUS_20230 1162 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2574 3479 gene locus_tag LOCUS_20240 2574 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence241 2024 633 gene locus_tag LOCUS_20250 2024 633 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_20250 3181 2471 gene locus_tag LOCUS_20260 3181 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3504 3196 gene locus_tag LOCUS_20270 3504 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence242 1399 95 gene locus_tag LOCUS_20280 1399 95 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_20280 1709 2620 gene locus_tag LOCUS_20290 1709 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2648 3508 gene locus_tag LOCUS_20300 2648 3508 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776251.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence243 113 1318 gene locus_tag LOCUS_20310 113 1318 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_20310 1944 2375 gene locus_tag LOCUS_20320 gene infC 1944 2375 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_20320 2399 2602 gene locus_tag LOCUS_20330 gene rpmI 2399 2602 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 protein_id gnl|my_center|LOCUS_20330 2662 3015 gene locus_tag LOCUS_20340 gene rplT 2662 3015 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence244 <1 736 gene locus_tag LOCUS_20350 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776887.1:sugar ABC transporter permease 752 1633 gene locus_tag LOCUS_20360 752 1633 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_20360 1708 3288 gene locus_tag LOCUS_20370 1708 3288 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence245 875 234 gene locus_tag LOCUS_20380 gene deoC 875 234 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_20380 1103 2290 gene locus_tag LOCUS_20390 1103 2290 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_20390 <3405 2358 gene locus_tag LOCUS_20400 <3405 2358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359496.1:MFS transporter >Feature sequence246 1028 252 gene locus_tag LOCUS_20410 1028 252 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776946.1 protein_id gnl|my_center|LOCUS_20410 1626 1414 gene locus_tag LOCUS_20420 1626 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 <3373 1785 gene locus_tag LOCUS_20430 <3373 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861254.1:thioredoxin domain-containing protein >Feature sequence247 81 1619 gene locus_tag LOCUS_20440 81 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 1641 3119 gene locus_tag LOCUS_20450 gene spoIVA 1641 3119 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965020.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence248 >Feature sequence249 1314 2690 gene locus_tag LOCUS_20460 1314 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2680 2871 gene locus_tag LOCUS_20470 2680 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence250 1643 897 gene locus_tag LOCUS_20480 1643 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2123 2650 gene locus_tag LOCUS_20490 2123 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2665 3126 gene locus_tag LOCUS_20500 2665 3126 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence251 1666 890 gene locus_tag LOCUS_20510 1666 890 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_20510 3093 1765 gene locus_tag LOCUS_20520 3093 1765 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence252 1055 1651 gene locus_tag LOCUS_20530 1055 1651 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_20530 1648 2163 gene locus_tag LOCUS_20540 1648 2163 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_20540 2256 3137 gene locus_tag LOCUS_20550 2256 3137 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775550.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence253 2439 1894 gene locus_tag LOCUS_20560 2439 1894 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_20560 2814 2476 gene locus_tag LOCUS_20570 2814 2476 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence254 1382 2758 gene locus_tag LOCUS_20580 1382 2758 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence255 168 557 gene locus_tag LOCUS_20590 168 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1477 689 gene locus_tag LOCUS_20600 1477 689 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_20600 1576 1950 gene locus_tag LOCUS_20610 1576 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2475 1969 gene locus_tag LOCUS_20620 2475 1969 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_20620 3117 2746 gene locus_tag LOCUS_20630 3117 2746 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence256 694 62 gene locus_tag LOCUS_20640 694 62 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_20640 1449 688 gene locus_tag LOCUS_20650 1449 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1952 1446 gene locus_tag LOCUS_20660 1952 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2158 1949 gene locus_tag LOCUS_20670 2158 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2478 2786 gene locus_tag LOCUS_20680 2478 2786 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_20680 2783 3073 gene locus_tag LOCUS_20690 2783 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence257 138 1790 gene locus_tag LOCUS_20700 gene cdr 138 1790 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087584.1 protein_id gnl|my_center|LOCUS_20700 2744 1863 gene locus_tag LOCUS_20710 2744 1863 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence258 1715 2425 gene locus_tag LOCUS_20720 gene pyrH 1715 2425 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_20720 2510 3064 gene locus_tag LOCUS_20730 gene frr 2510 3064 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence259 30 245 gene locus_tag LOCUS_20740 30 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 265 1143 gene locus_tag LOCUS_20750 265 1143 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_20750 1159 2157 gene locus_tag LOCUS_20760 gene yiaK 1159 2157 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869039.1 protein_id gnl|my_center|LOCUS_20760 2171 2941 gene locus_tag LOCUS_20770 2171 2941 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence260 >Feature sequence261 892 593 gene locus_tag LOCUS_20780 892 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 1690 1010 gene locus_tag LOCUS_20790 1690 1010 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_20790 2833 1964 gene locus_tag LOCUS_20800 2833 1964 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence262 751 569 gene locus_tag LOCUS_20810 751 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 894 748 gene locus_tag LOCUS_20820 894 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1358 1020 gene locus_tag LOCUS_20830 1358 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1598 1386 gene locus_tag LOCUS_20840 1598 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2076 1837 gene locus_tag LOCUS_20850 2076 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2297 2073 gene locus_tag LOCUS_20860 2297 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2819 3046 gene locus_tag LOCUS_20870 2819 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence263 250 621 gene locus_tag LOCUS_20880 gene folB 250 621 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809748.1 protein_id gnl|my_center|LOCUS_20880 618 1118 gene locus_tag LOCUS_20890 gene folK 618 1118 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975682.1 protein_id gnl|my_center|LOCUS_20890 1994 1236 gene locus_tag LOCUS_20900 1994 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2915 2013 gene locus_tag LOCUS_20910 2915 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence264 <1 2028 gene locus_tag LOCUS_20920 <1 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066679.1:extracellular solute-binding protein 2949 2347 gene locus_tag LOCUS_20930 2949 2347 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence265 120 977 gene locus_tag LOCUS_20940 120 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 1248 1039 gene locus_tag LOCUS_20950 1248 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2458 1340 gene locus_tag LOCUS_20960 2458 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460508.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence266 2150 213 gene locus_tag LOCUS_20970 gene gyrB 2150 213 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_20970 2747 2229 gene locus_tag LOCUS_20980 2747 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence267 2016 256 gene locus_tag LOCUS_20990 2016 256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_20990 2496 2056 gene locus_tag LOCUS_21000 2496 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence268 99 353 gene locus_tag LOCUS_21010 99 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2630 846 gene locus_tag LOCUS_21020 gene aspS 2630 846 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence269 483 1289 gene locus_tag LOCUS_21030 483 1289 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21030 1311 1463 gene locus_tag LOCUS_21040 1311 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1718 2587 gene locus_tag LOCUS_21050 1718 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence270 81 1811 gene locus_tag LOCUS_21060 81 1811 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_21060 1856 2659 gene locus_tag LOCUS_21070 1856 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence271 290 1057 gene locus_tag LOCUS_21080 290 1057 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016616.1 protein_id gnl|my_center|LOCUS_21080 2826 1732 gene locus_tag LOCUS_21090 gene ychF 2826 1732 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence272 139 2736 gene locus_tag LOCUS_21100 139 2736 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence273 2 1150 gene locus_tag LOCUS_21110 2 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1159 2325 gene locus_tag LOCUS_21120 1159 2325 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence274 <1 836 gene locus_tag LOCUS_21130 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003440267.1:sporulation integral membrane protein YtvI 1387 848 gene locus_tag LOCUS_21140 1387 848 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_21140 1696 2745 gene locus_tag LOCUS_21150 1696 2745 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631126.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence275 207 659 gene locus_tag LOCUS_21160 gene dtd 207 659 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048079.1 protein_id gnl|my_center|LOCUS_21160 748 1455 gene locus_tag LOCUS_21170 748 1455 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_21170 1459 2727 gene locus_tag LOCUS_21180 1459 2727 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence276 1428 103 gene locus_tag LOCUS_21190 1428 103 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446180.1 protein_id gnl|my_center|LOCUS_21190 1753 1953 gene locus_tag LOCUS_21200 1753 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2151 2387 gene locus_tag LOCUS_21210 2151 2387 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence277 82 570 gene locus_tag LOCUS_21220 82 570 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_21220 584 1174 gene locus_tag LOCUS_21230 584 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1268 2233 gene locus_tag LOCUS_21240 1268 2233 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_21240 2226 2546 gene locus_tag LOCUS_21250 2226 2546 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence278 264 653 gene locus_tag LOCUS_21260 264 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 749 1054 gene locus_tag LOCUS_21270 749 1054 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991882.1 protein_id gnl|my_center|LOCUS_21270 1051 2172 gene locus_tag LOCUS_21280 1051 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence279 1990 803 gene locus_tag LOCUS_21290 gene yqfD 1990 803 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230033.1 protein_id gnl|my_center|LOCUS_21290 2289 2041 gene locus_tag LOCUS_21300 2289 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence280 1003 59 gene locus_tag LOCUS_21310 1003 59 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_21310 1353 994 gene locus_tag LOCUS_21320 1353 994 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_21320 1987 1346 gene locus_tag LOCUS_21330 1987 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 <2578 1987 gene locus_tag LOCUS_21340 <2578 1987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965068.1:ribosome biogenesis GTPase YlqF >Feature sequence281