>Feature sequence01 223 399 gene locus_tag LOCUS_00010 223 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 636 938 gene locus_tag LOCUS_00020 gene ureA 636 938 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694143.1 protein_id gnl|my_center|LOCUS_00020 1038 1406 gene locus_tag LOCUS_00030 1038 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1420 3141 gene locus_tag LOCUS_00040 gene ureB 1420 3141 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724295.1 protein_id gnl|my_center|LOCUS_00040 3268 3774 gene locus_tag LOCUS_00050 gene ureI 3268 3774 CDS product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 protein_id gnl|my_center|LOCUS_00050 3787 4302 gene locus_tag LOCUS_00060 gene ureE 3787 4302 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583097.1 protein_id gnl|my_center|LOCUS_00060 4289 4990 gene locus_tag LOCUS_00070 4289 4990 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357404.1 protein_id gnl|my_center|LOCUS_00070 5032 5640 gene locus_tag LOCUS_00080 gene ureG 5032 5640 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238762.1 protein_id gnl|my_center|LOCUS_00080 5645 6448 gene locus_tag LOCUS_00090 5645 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6758 8551 gene locus_tag LOCUS_00100 6758 8551 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678765.1 protein_id gnl|my_center|LOCUS_00100 8548 9483 gene locus_tag LOCUS_00110 8548 9483 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017005.1 protein_id gnl|my_center|LOCUS_00110 9576 10076 gene locus_tag LOCUS_00120 9576 10076 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902172.1 protein_id gnl|my_center|LOCUS_00120 10080 10886 gene locus_tag LOCUS_00130 10080 10886 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_00130 11043 12038 gene locus_tag LOCUS_00140 11043 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12411 13781 gene locus_tag LOCUS_00150 gene rsxC 12411 13781 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_00150 13781 14755 gene locus_tag LOCUS_00160 13781 14755 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_00160 14752 16125 gene locus_tag LOCUS_00170 14752 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16213 16980 gene locus_tag LOCUS_00180 16213 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17283 17612 gene locus_tag LOCUS_00190 17283 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18856 17783 gene locus_tag LOCUS_00200 18856 17783 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733041.1 protein_id gnl|my_center|LOCUS_00200 20468 18861 gene locus_tag LOCUS_00210 20468 18861 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_00210 20764 22272 gene locus_tag LOCUS_00220 20764 22272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22265 24043 gene locus_tag LOCUS_00230 22265 24043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24040 24921 gene locus_tag LOCUS_00240 gene yidA 24040 24921 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919285.1 protein_id gnl|my_center|LOCUS_00240 24918 25673 gene locus_tag LOCUS_00250 24918 25673 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_00250 27147 25732 gene locus_tag LOCUS_00260 27147 25732 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721673.1 protein_id gnl|my_center|LOCUS_00260 27892 27149 gene locus_tag LOCUS_00270 27892 27149 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721674.1 protein_id gnl|my_center|LOCUS_00270 28629 27892 gene locus_tag LOCUS_00280 28629 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29003 29959 gene locus_tag LOCUS_00290 29003 29959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29975 31375 gene locus_tag LOCUS_00300 29975 31375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31407 32786 gene locus_tag LOCUS_00310 31407 32786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32854 34173 gene locus_tag LOCUS_00320 32854 34173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36890 34254 gene locus_tag LOCUS_00330 36890 34254 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_00330 37433 37209 gene locus_tag LOCUS_00340 37433 37209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 40130 37512 gene locus_tag LOCUS_00350 gene adhE 40130 37512 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_00350 40405 41295 gene locus_tag LOCUS_00360 40405 41295 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897167.1 protein_id gnl|my_center|LOCUS_00360 41390 42592 gene locus_tag LOCUS_00370 41390 42592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44490 42661 gene locus_tag LOCUS_00380 gene typA 44490 42661 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_00380 44725 45351 gene locus_tag LOCUS_00390 44725 45351 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_00390 45687 46577 gene locus_tag LOCUS_00400 gene dapA 45687 46577 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_00400 46639 47403 gene locus_tag LOCUS_00410 gene dapB 46639 47403 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_00410 47737 48582 gene locus_tag LOCUS_00420 47737 48582 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538207.1 protein_id gnl|my_center|LOCUS_00420 48631 49638 gene locus_tag LOCUS_00430 48631 49638 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435855.1 protein_id gnl|my_center|LOCUS_00430 49739 50941 gene locus_tag LOCUS_00440 49739 50941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 50963 51808 gene locus_tag LOCUS_00450 50963 51808 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008272.1 protein_id gnl|my_center|LOCUS_00450 51814 52506 gene locus_tag LOCUS_00460 51814 52506 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202621584.1 protein_id gnl|my_center|LOCUS_00460 52516 52992 gene locus_tag LOCUS_00470 52516 52992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 52973 53986 gene locus_tag LOCUS_00480 52973 53986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54769 54095 gene locus_tag LOCUS_00490 54769 54095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 54991 55425 gene locus_tag LOCUS_00500 54991 55425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 55633 56409 gene locus_tag LOCUS_00510 gene hisA 55633 56409 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460044.1 protein_id gnl|my_center|LOCUS_00510 56541 57068 gene locus_tag LOCUS_00520 gene raiA 56541 57068 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_00520 57361 59934 gene locus_tag LOCUS_00530 gene secA 57361 59934 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_00530 59939 60580 gene locus_tag LOCUS_00540 59939 60580 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_00540 60766 62571 gene locus_tag LOCUS_00550 60766 62571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 62635 62871 gene locus_tag LOCUS_00560 62635 62871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 63168 64181 gene locus_tag LOCUS_00570 gene prfB 63168 64181 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 protein_id gnl|my_center|LOCUS_00570 64220 65491 gene locus_tag LOCUS_00580 64220 65491 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356656.1 protein_id gnl|my_center|LOCUS_00580 65507 66598 gene locus_tag LOCUS_00590 65507 66598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_00590 66595 67413 gene locus_tag LOCUS_00600 66595 67413 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379689.1 protein_id gnl|my_center|LOCUS_00600 67549 67980 gene locus_tag LOCUS_00610 67549 67980 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_00610 68006 69223 gene locus_tag LOCUS_00620 68006 69223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 69334 70533 gene locus_tag LOCUS_00630 69334 70533 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_00630 70600 71811 gene locus_tag LOCUS_00640 70600 71811 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_00640 72168 71977 gene locus_tag LOCUS_00650 72168 71977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 73147 72353 gene locus_tag LOCUS_00660 73147 72353 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986299.1 protein_id gnl|my_center|LOCUS_00660 73192 73620 gene locus_tag LOCUS_00670 73192 73620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 74552 73605 gene locus_tag LOCUS_00680 74552 73605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 74723 76864 gene locus_tag LOCUS_00690 74723 76864 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_00690 77040 77315 gene locus_tag LOCUS_00700 77040 77315 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_00700 77508 79442 gene locus_tag LOCUS_00710 77508 79442 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_00710 80984 79533 gene locus_tag LOCUS_00720 80984 79533 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_00720 81184 82065 gene locus_tag LOCUS_00730 81184 82065 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_00730 84649 82136 gene locus_tag LOCUS_00740 84649 82136 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_00740 84843 84604 gene locus_tag LOCUS_00750 84843 84604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 85005 85823 gene locus_tag LOCUS_00760 85005 85823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 85958 86158 gene locus_tag LOCUS_00770 85958 86158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 86133 86723 gene locus_tag LOCUS_00780 86133 86723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 87305 87075 gene locus_tag LOCUS_00790 87305 87075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87307 87690 gene locus_tag LOCUS_00800 87307 87690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 87701 88240 gene locus_tag LOCUS_00810 87701 88240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 88152 88775 gene locus_tag LOCUS_00820 88152 88775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 89391 88729 gene locus_tag LOCUS_00830 89391 88729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 91379 89658 gene locus_tag LOCUS_00840 91379 89658 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_00840 91576 92463 gene locus_tag LOCUS_00850 91576 92463 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102012.1 protein_id gnl|my_center|LOCUS_00850 92562 93728 gene locus_tag LOCUS_00860 92562 93728 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_00860 93745 94548 gene locus_tag LOCUS_00870 93745 94548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 94674 95525 gene locus_tag LOCUS_00880 94674 95525 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_00880 95618 96823 gene locus_tag LOCUS_00890 95618 96823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 96916 97200 gene locus_tag LOCUS_00900 96916 97200 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894809.1 protein_id gnl|my_center|LOCUS_00900 97187 98326 gene locus_tag LOCUS_00910 97187 98326 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_00910 99185 98313 gene locus_tag LOCUS_00920 99185 98313 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002023111.1 protein_id gnl|my_center|LOCUS_00920 99490 100002 gene locus_tag LOCUS_00930 99490 100002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 99968 101707 gene locus_tag LOCUS_00940 99968 101707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_00940 101722 103608 gene locus_tag LOCUS_00950 101722 103608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_00950 103718 105610 gene locus_tag LOCUS_00960 103718 105610 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 protein_id gnl|my_center|LOCUS_00960 105940 107490 gene locus_tag LOCUS_00970 105940 107490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 107757 108494 gene locus_tag LOCUS_00980 107757 108494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 108642 110537 gene locus_tag LOCUS_00990 108642 110537 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068161.1 protein_id gnl|my_center|LOCUS_00990 110771 112075 gene locus_tag LOCUS_01000 110771 112075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 113407 112250 gene locus_tag LOCUS_01010 113407 112250 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_01010 113768 113442 gene locus_tag LOCUS_01020 113768 113442 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_01020 114636 114779 gene locus_tag LOCUS_01030 114636 114779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 114934 115977 gene locus_tag LOCUS_01040 114934 115977 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_01040 115970 116557 gene locus_tag LOCUS_01050 115970 116557 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967488.1 protein_id gnl|my_center|LOCUS_01050 116662 117273 gene locus_tag LOCUS_01060 116662 117273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 117503 118372 gene locus_tag LOCUS_01070 117503 118372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_01070 >Feature sequence02 110 847 gene locus_tag LOCUS_01080 110 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 1324 851 gene locus_tag LOCUS_01090 gene rnhA 1324 851 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_01090 3011 1338 gene locus_tag LOCUS_01100 3011 1338 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966827.1 protein_id gnl|my_center|LOCUS_01100 4366 3059 gene locus_tag LOCUS_01110 gene hemL 4366 3059 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045295.1 protein_id gnl|my_center|LOCUS_01110 5331 4339 gene locus_tag LOCUS_01120 gene hemB 5331 4339 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_01120 6862 5345 gene locus_tag LOCUS_01130 gene cobA 6862 5345 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_01130 7746 6859 gene locus_tag LOCUS_01140 gene hemC 7746 6859 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 protein_id gnl|my_center|LOCUS_01140 8267 7764 gene locus_tag LOCUS_01150 8267 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 9486 8254 gene locus_tag LOCUS_01160 gene hemA 9486 8254 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_01160 9930 10676 gene locus_tag LOCUS_01170 9930 10676 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_01170 10678 10983 gene locus_tag LOCUS_01180 10678 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 11001 11777 gene locus_tag LOCUS_01190 gene cbiQ 11001 11777 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812266.1 protein_id gnl|my_center|LOCUS_01190 11774 13462 gene locus_tag LOCUS_01200 11774 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 14153 13530 gene locus_tag LOCUS_01210 14153 13530 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356705.1 protein_id gnl|my_center|LOCUS_01210 15233 14178 gene locus_tag LOCUS_01220 15233 14178 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_01220 15968 15306 gene locus_tag LOCUS_01230 15968 15306 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582678.1 protein_id gnl|my_center|LOCUS_01230 17295 15988 gene locus_tag LOCUS_01240 17295 15988 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_01240 17769 17329 gene locus_tag LOCUS_01250 17769 17329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 17997 17860 gene locus_tag LOCUS_01260 17997 17860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 19147 18011 gene locus_tag LOCUS_01270 19147 18011 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263229.1 protein_id gnl|my_center|LOCUS_01270 21200 20319 gene locus_tag LOCUS_01280 21200 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 22123 21311 gene locus_tag LOCUS_01290 22123 21311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 22918 22277 gene locus_tag LOCUS_01300 22918 22277 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_01300 24429 22915 gene locus_tag LOCUS_01310 24429 22915 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_01310 25478 24414 gene locus_tag LOCUS_01320 gene cobD 25478 24414 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_01320 26480 25500 gene locus_tag LOCUS_01330 gene cbiB 26480 25500 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_01330 27117 26473 gene locus_tag LOCUS_01340 27117 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 27497 27114 gene locus_tag LOCUS_01350 27497 27114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 28333 27569 gene locus_tag LOCUS_01360 gene cobS 28333 27569 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257084.1 protein_id gnl|my_center|LOCUS_01360 28881 28330 gene locus_tag LOCUS_01370 gene cobU 28881 28330 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680310.1 protein_id gnl|my_center|LOCUS_01370 29954 28905 gene locus_tag LOCUS_01380 gene cobT 29954 28905 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_01380 31336 29951 gene locus_tag LOCUS_01390 31336 29951 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_01390 33345 31333 gene locus_tag LOCUS_01400 33345 31333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 34069 33338 gene locus_tag LOCUS_01410 gene cobJ 34069 33338 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903755.1 protein_id gnl|my_center|LOCUS_01410 35114 34062 gene locus_tag LOCUS_01420 gene cbiG 35114 34062 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 protein_id gnl|my_center|LOCUS_01420 35907 35128 gene locus_tag LOCUS_01430 35907 35128 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_01430 36602 35904 gene locus_tag LOCUS_01440 gene cobI 36602 35904 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_01440 37780 36602 gene locus_tag LOCUS_01450 gene cbiD 37780 36602 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_01450 40306 38186 gene locus_tag LOCUS_01460 40306 38186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 42153 40684 gene locus_tag LOCUS_01470 gene spoIVA 42153 40684 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_01470 42721 42254 gene locus_tag LOCUS_01480 42721 42254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 43487 42711 gene locus_tag LOCUS_01490 gene trmD 43487 42711 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_01490 44093 43587 gene locus_tag LOCUS_01500 gene rimM 44093 43587 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_01500 44665 44435 gene locus_tag LOCUS_01510 44665 44435 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_01510 45018 44773 gene locus_tag LOCUS_01520 gene rpsP 45018 44773 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_01520 46408 45056 gene locus_tag LOCUS_01530 gene ffh 46408 45056 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_01530 46774 46412 gene locus_tag LOCUS_01540 46774 46412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 47791 46898 gene locus_tag LOCUS_01550 gene larE 47791 46898 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_01550 49047 47833 gene locus_tag LOCUS_01560 gene larC 49047 47833 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_01560 49832 49047 gene locus_tag LOCUS_01570 gene larB 49832 49047 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_01570 50756 50586 gene locus_tag LOCUS_01580 50756 50586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 52788 50947 gene locus_tag LOCUS_01590 gene glmS 52788 50947 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_01590 54292 53078 gene locus_tag LOCUS_01600 54292 53078 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_01600 55444 54671 gene locus_tag LOCUS_01610 55444 54671 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_01610 55618 55797 gene locus_tag LOCUS_01620 55618 55797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 55794 56138 gene locus_tag LOCUS_01630 55794 56138 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_01630 56925 56272 gene locus_tag LOCUS_01640 56925 56272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 57302 57003 gene locus_tag LOCUS_01650 57302 57003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 58475 57498 gene locus_tag LOCUS_01660 gene tnpB 58475 57498 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861238.1 protein_id gnl|my_center|LOCUS_01660 60345 58873 gene locus_tag LOCUS_01670 gene xylB 60345 58873 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_01670 61833 60367 gene locus_tag LOCUS_01680 61833 60367 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_01680 62153 62380 gene locus_tag LOCUS_01690 62153 62380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 62364 62777 gene locus_tag LOCUS_01700 62364 62777 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_01700 62990 64171 gene locus_tag LOCUS_01710 62990 64171 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891380.1 protein_id gnl|my_center|LOCUS_01710 64230 65339 gene locus_tag LOCUS_01720 64230 65339 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_01720 66339 65536 gene locus_tag LOCUS_01730 gene thiD 66339 65536 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_01730 67086 66427 gene locus_tag LOCUS_01740 67086 66427 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056362.1 protein_id gnl|my_center|LOCUS_01740 67724 67083 gene locus_tag LOCUS_01750 gene thiE 67724 67083 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_01750 68532 67711 gene locus_tag LOCUS_01760 gene thiM 68532 67711 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_01760 69483 68953 gene locus_tag LOCUS_01770 gene thiW 69483 68953 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842277.1 protein_id gnl|my_center|LOCUS_01770 70351 69701 gene locus_tag LOCUS_01780 70351 69701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 70941 70483 gene locus_tag LOCUS_01790 70941 70483 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_01790 71133 71504 gene locus_tag LOCUS_01800 71133 71504 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440040.1 protein_id gnl|my_center|LOCUS_01800 71551 72213 gene locus_tag LOCUS_01810 71551 72213 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_01810 72386 72225 gene locus_tag LOCUS_01820 72386 72225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 73329 72334 gene locus_tag LOCUS_01830 73329 72334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 73509 74858 gene locus_tag LOCUS_01840 73509 74858 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_01840 77041 76397 gene locus_tag LOCUS_01850 77041 76397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 77901 77038 gene locus_tag LOCUS_01860 77901 77038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_01860 78277 77903 gene locus_tag LOCUS_01870 78277 77903 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_01870 79786 78575 gene locus_tag LOCUS_01880 gene ilvA 79786 78575 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_01880 80777 79830 gene locus_tag LOCUS_01890 gene ftsY 80777 79830 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_01890 84373 80816 gene locus_tag LOCUS_01900 gene smc 84373 80816 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_01900 85065 84364 gene locus_tag LOCUS_01910 gene rncS 85065 84364 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_01910 85417 85187 gene locus_tag LOCUS_01920 gene acpP 85417 85187 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_01920 86443 85421 gene locus_tag LOCUS_01930 gene plsX 86443 85421 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_01930 87395 86595 gene locus_tag LOCUS_01940 87395 86595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 88839 87520 gene locus_tag LOCUS_01950 88839 87520 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_01950 89757 88969 gene locus_tag LOCUS_01960 89757 88969 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_01960 90747 89863 gene locus_tag LOCUS_01970 90747 89863 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_01970 91686 90811 gene locus_tag LOCUS_01980 91686 90811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 92630 91704 gene locus_tag LOCUS_01990 92630 91704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_01990 94792 92633 gene locus_tag LOCUS_02000 94792 92633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 95910 94789 gene locus_tag LOCUS_02010 95910 94789 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369660.1 protein_id gnl|my_center|LOCUS_02010 96601 95900 gene locus_tag LOCUS_02020 96601 95900 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929888.1 protein_id gnl|my_center|LOCUS_02020 98938 96803 gene locus_tag LOCUS_02030 98938 96803 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_02030 100498 98954 gene locus_tag LOCUS_02040 100498 98954 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_02040 101820 100495 gene locus_tag LOCUS_02050 101820 100495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_02050 103058 101928 gene locus_tag LOCUS_02060 gene pheA 103058 101928 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_02060 104507 103224 gene locus_tag LOCUS_02070 104507 103224 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_02070 104666 105586 gene locus_tag LOCUS_02080 gene pyrB 104666 105586 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_02080 105580 106017 gene locus_tag LOCUS_02090 105580 106017 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965941.1 protein_id gnl|my_center|LOCUS_02090 107694 106360 gene locus_tag LOCUS_02100 107694 106360 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_02100 110677 108383 gene locus_tag LOCUS_02110 110677 108383 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 protein_id gnl|my_center|LOCUS_02110 110900 111748 gene locus_tag LOCUS_02120 110900 111748 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775269.1 protein_id gnl|my_center|LOCUS_02120 112605 111703 gene locus_tag LOCUS_02130 112605 111703 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_02130 112718 114133 gene locus_tag LOCUS_02140 112718 114133 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 protein_id gnl|my_center|LOCUS_02140 115686 114367 gene locus_tag LOCUS_02150 gene melA 115686 114367 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_02150 116192 115848 gene locus_tag LOCUS_02160 116192 115848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 >Feature sequence03 1479 196 gene locus_tag LOCUS_02170 1479 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 2117 1500 gene locus_tag LOCUS_02180 gene hisB 2117 1500 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_02180 3417 2119 gene locus_tag LOCUS_02190 gene hisD 3417 2119 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_02190 4064 3414 gene locus_tag LOCUS_02200 gene hisG 4064 3414 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_02200 5337 4084 gene locus_tag LOCUS_02210 5337 4084 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_02210 5950 5417 gene locus_tag LOCUS_02220 gene recU 5950 5417 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_02220 6635 6018 gene locus_tag LOCUS_02230 gene lepB 6635 6018 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_02230 7688 6702 gene locus_tag LOCUS_02240 7688 6702 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_02240 8353 7700 gene locus_tag LOCUS_02250 8353 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 10314 8422 gene locus_tag LOCUS_02260 10314 8422 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_02260 10979 10314 gene locus_tag LOCUS_02270 10979 10314 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_02270 11723 10992 gene locus_tag LOCUS_02280 11723 10992 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837524.1 protein_id gnl|my_center|LOCUS_02280 13203 11836 gene locus_tag LOCUS_02290 gene rsmF 13203 11836 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_02290 14035 13217 gene locus_tag LOCUS_02300 14035 13217 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417310.1 protein_id gnl|my_center|LOCUS_02300 14981 14103 gene locus_tag LOCUS_02310 14981 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 15092 16066 gene locus_tag LOCUS_02320 gene ylbJ 15092 16066 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392455.1 protein_id gnl|my_center|LOCUS_02320 16648 16043 gene locus_tag LOCUS_02330 16648 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 17215 16733 gene locus_tag LOCUS_02340 gene coaD 17215 16733 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_02340 17775 17212 gene locus_tag LOCUS_02350 gene rsmD 17775 17212 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_02350 18199 17798 gene locus_tag LOCUS_02360 gene mgsA 18199 17798 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_02360 18428 18652 gene locus_tag LOCUS_02370 18428 18652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 19214 18840 gene locus_tag LOCUS_02380 19214 18840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 23091 19294 gene locus_tag LOCUS_02390 23091 19294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_02390 23815 23111 gene locus_tag LOCUS_02400 23815 23111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_02400 25962 23902 gene locus_tag LOCUS_02410 gene recG 25962 23902 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_02410 26151 25975 gene locus_tag LOCUS_02420 26151 25975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 27751 26090 gene locus_tag LOCUS_02430 27751 26090 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_02430 28131 27775 gene locus_tag LOCUS_02440 28131 27775 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_02440 28439 28624 gene locus_tag LOCUS_02450 gene rpmB 28439 28624 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775872.1 protein_id gnl|my_center|LOCUS_02450 28968 28807 gene locus_tag LOCUS_02460 28968 28807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 29645 29169 gene locus_tag LOCUS_02470 29645 29169 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_02470 30482 29730 gene locus_tag LOCUS_02480 30482 29730 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858645.1 protein_id gnl|my_center|LOCUS_02480 31875 30796 gene locus_tag LOCUS_02490 31875 30796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 34175 32160 gene locus_tag LOCUS_02500 34175 32160 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_02500 34935 34168 gene locus_tag LOCUS_02510 34935 34168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_02510 36067 35015 gene locus_tag LOCUS_02520 36067 35015 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_02520 36746 36075 gene locus_tag LOCUS_02530 36746 36075 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_02530 37715 36831 gene locus_tag LOCUS_02540 37715 36831 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_02540 38255 37815 gene locus_tag LOCUS_02550 38255 37815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 39275 38265 gene locus_tag LOCUS_02560 39275 38265 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 protein_id gnl|my_center|LOCUS_02560 39544 40923 gene locus_tag LOCUS_02570 39544 40923 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_02570 42562 41096 gene locus_tag LOCUS_02580 gene malQ 42562 41096 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028948.1 protein_id gnl|my_center|LOCUS_02580 44945 42756 gene locus_tag LOCUS_02590 gene topB 44945 42756 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047293.1 protein_id gnl|my_center|LOCUS_02590 46414 44942 gene locus_tag LOCUS_02600 46414 44942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 47687 46419 gene locus_tag LOCUS_02610 47687 46419 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971043.1 protein_id gnl|my_center|LOCUS_02610 47907 48341 gene locus_tag LOCUS_02620 47907 48341 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462052.1 protein_id gnl|my_center|LOCUS_02620 49531 48455 gene locus_tag LOCUS_02630 49531 48455 CDS product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209403.1 protein_id gnl|my_center|LOCUS_02630 49705 49779 gene locus_tag LOCUS_t00010 49705 49779 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 49884 51599 gene locus_tag LOCUS_02640 49884 51599 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_02640 52344 51712 gene locus_tag LOCUS_02650 52344 51712 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 protein_id gnl|my_center|LOCUS_02650 52524 52892 gene locus_tag LOCUS_02660 52524 52892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 56196 53029 gene locus_tag LOCUS_02670 56196 53029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 57399 56212 gene locus_tag LOCUS_02680 57399 56212 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052235.1 protein_id gnl|my_center|LOCUS_02680 58333 57479 gene locus_tag LOCUS_02690 gene mscS 58333 57479 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_02690 60715 58343 gene locus_tag LOCUS_02700 gene glgB 60715 58343 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_02700 61419 60934 gene locus_tag LOCUS_02710 61419 60934 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_02710 62598 61477 gene locus_tag LOCUS_02720 62598 61477 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435962.1 protein_id gnl|my_center|LOCUS_02720 63469 62606 gene locus_tag LOCUS_02730 gene aguB 63469 62606 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_02730 64845 63466 gene locus_tag LOCUS_02740 gene gabT 64845 63466 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_02740 65498 64884 gene locus_tag LOCUS_02750 65498 64884 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_02750 67019 65538 gene locus_tag LOCUS_02760 67019 65538 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_02760 68649 66994 gene locus_tag LOCUS_02770 68649 66994 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257624.1 protein_id gnl|my_center|LOCUS_02770 70042 68687 gene locus_tag LOCUS_02780 70042 68687 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 protein_id gnl|my_center|LOCUS_02780 71586 70216 gene locus_tag LOCUS_02790 gene ygjG 71586 70216 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633381.1 protein_id gnl|my_center|LOCUS_02790 71872 72636 gene locus_tag LOCUS_02800 71872 72636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 73717 72665 gene locus_tag LOCUS_02810 73717 72665 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_02810 74541 73741 gene locus_tag LOCUS_02820 74541 73741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02820 75405 74545 gene locus_tag LOCUS_02830 75405 74545 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_02830 76532 75417 gene locus_tag LOCUS_02840 gene potA 76532 75417 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948297.1 protein_id gnl|my_center|LOCUS_02840 76913 76554 gene locus_tag LOCUS_02850 76913 76554 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_02850 77747 77058 gene locus_tag LOCUS_02860 77747 77058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 79227 77980 gene locus_tag LOCUS_02870 79227 77980 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_02870 80585 79422 gene locus_tag LOCUS_02880 80585 79422 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_02880 81669 80587 gene locus_tag LOCUS_02890 gene serC 81669 80587 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_02890 83488 81809 gene locus_tag LOCUS_02900 gene ilvB 83488 81809 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_02900 85183 83513 gene locus_tag LOCUS_02910 gene ilvD 85183 83513 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_02910 86312 85227 gene locus_tag LOCUS_02920 gene leuB 86312 85227 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_02920 87327 86455 gene locus_tag LOCUS_02930 gene sdaAA 87327 86455 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963993.1 protein_id gnl|my_center|LOCUS_02930 88006 87317 gene locus_tag LOCUS_02940 gene sdaAB 88006 87317 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_02940 88438 88121 gene locus_tag LOCUS_02950 gene yajC 88438 88121 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398708.1 protein_id gnl|my_center|LOCUS_02950 89744 88596 gene locus_tag LOCUS_02960 gene tgt 89744 88596 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_02960 89948 94225 gene locus_tag LOCUS_02970 89948 94225 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_02970 96021 94402 gene locus_tag LOCUS_02980 96021 94402 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_02980 96788 96108 gene locus_tag LOCUS_02990 96788 96108 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 protein_id gnl|my_center|LOCUS_02990 97570 96794 gene locus_tag LOCUS_03000 gene hisF 97570 96794 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_03000 98195 97572 gene locus_tag LOCUS_03010 gene hisH 98195 97572 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_03010 99042 98260 gene locus_tag LOCUS_03020 99042 98260 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775202.1 protein_id gnl|my_center|LOCUS_03020 100260 99631 gene locus_tag LOCUS_03030 100260 99631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 101559 100384 gene locus_tag LOCUS_03040 101559 100384 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_03040 102730 101777 gene locus_tag LOCUS_03050 102730 101777 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_03050 104463 102832 gene locus_tag LOCUS_03060 104463 102832 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439500.1 protein_id gnl|my_center|LOCUS_03060 104695 105612 gene locus_tag LOCUS_03070 104695 105612 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_03070 107081 105567 gene locus_tag LOCUS_03080 107081 105567 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_03080 107758 107078 gene locus_tag LOCUS_03090 107758 107078 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_03090 108425 107817 gene locus_tag LOCUS_03100 108425 107817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 108838 108611 gene locus_tag LOCUS_03110 108838 108611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 109152 108841 gene locus_tag LOCUS_03120 109152 108841 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_03120 >Feature sequence04 919 158 gene locus_tag LOCUS_03130 919 158 CDS product DUF4111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100880.1 protein_id gnl|my_center|LOCUS_03130 1683 922 gene locus_tag LOCUS_03140 1683 922 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 protein_id gnl|my_center|LOCUS_03140 2135 1695 gene locus_tag LOCUS_03150 2135 1695 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_03150 3359 2688 gene locus_tag LOCUS_03160 3359 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3765 3364 gene locus_tag LOCUS_03170 3765 3364 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379393.1 protein_id gnl|my_center|LOCUS_03170 4974 4165 gene locus_tag LOCUS_03180 4974 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5564 4986 gene locus_tag LOCUS_03190 5564 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6101 5568 gene locus_tag LOCUS_03200 6101 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7333 6128 gene locus_tag LOCUS_03210 7333 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 7703 7317 gene locus_tag LOCUS_03220 gene spoIIIAD 7703 7317 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_03220 7914 7720 gene locus_tag LOCUS_03230 gene spoIIIAC 7914 7720 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_03230 8511 7993 gene locus_tag LOCUS_03240 8511 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 9470 8508 gene locus_tag LOCUS_03250 gene spoIIIAA 9470 8508 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_03250 10303 9614 gene locus_tag LOCUS_03260 10303 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 12134 10293 gene locus_tag LOCUS_03270 12134 10293 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_03270 13591 12131 gene locus_tag LOCUS_03280 gene gltX 13591 12131 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_03280 14378 13653 gene locus_tag LOCUS_03290 14378 13653 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_03290 14789 14556 gene locus_tag LOCUS_03300 gene acpP 14789 14556 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_03300 16072 14891 gene locus_tag LOCUS_03310 gene spoVE 16072 14891 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_03310 16370 16507 gene locus_tag LOCUS_03320 16370 16507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 16494 16757 gene locus_tag LOCUS_03330 16494 16757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 17529 17457 gene locus_tag LOCUS_t00020 17529 17457 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17723 17998 gene locus_tag LOCUS_03340 17723 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 17995 18288 gene locus_tag LOCUS_03350 gene cotJB 17995 18288 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_03350 18292 18927 gene locus_tag LOCUS_03360 18292 18927 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_03360 19700 18978 gene locus_tag LOCUS_03370 19700 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 19851 20873 gene locus_tag LOCUS_03380 19851 20873 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202433.1 protein_id gnl|my_center|LOCUS_03380 22479 20854 gene locus_tag LOCUS_03390 gene ptsP 22479 20854 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_03390 22652 23899 gene locus_tag LOCUS_03400 22652 23899 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054321935.1 protein_id gnl|my_center|LOCUS_03400 25918 24137 gene locus_tag LOCUS_03410 25918 24137 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_03410 26286 26086 gene locus_tag LOCUS_03420 26286 26086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 27362 26379 gene locus_tag LOCUS_03430 27362 26379 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_03430 27519 29087 gene locus_tag LOCUS_03440 27519 29087 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_03440 30355 29180 gene locus_tag LOCUS_03450 30355 29180 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_03450 30972 30352 gene locus_tag LOCUS_03460 30972 30352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 32836 30974 gene locus_tag LOCUS_03470 gene glgX 32836 30974 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_03470 33601 32849 gene locus_tag LOCUS_03480 33601 32849 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_03480 35134 33671 gene locus_tag LOCUS_03490 35134 33671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 36350 35286 gene locus_tag LOCUS_03500 36350 35286 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_03500 36578 36946 gene locus_tag LOCUS_03510 36578 36946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 37713 37060 gene locus_tag LOCUS_03520 gene phoU 37713 37060 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357304.1 protein_id gnl|my_center|LOCUS_03520 38493 37735 gene locus_tag LOCUS_03530 gene pstB 38493 37735 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_03530 39347 38490 gene locus_tag LOCUS_03540 gene pstA 39347 38490 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_03540 40219 39347 gene locus_tag LOCUS_03550 gene pstC 40219 39347 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_03550 41250 40312 gene locus_tag LOCUS_03560 41250 40312 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_03560 42203 41685 gene locus_tag LOCUS_03570 42203 41685 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939955.1 protein_id gnl|my_center|LOCUS_03570 42714 42226 gene locus_tag LOCUS_03580 gene nrdG 42714 42226 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_03580 44889 42793 gene locus_tag LOCUS_03590 gene pnp 44889 42793 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_03590 45364 45098 gene locus_tag LOCUS_03600 gene rpsO 45364 45098 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_03600 47219 45582 gene locus_tag LOCUS_03610 47219 45582 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_03610 48144 47224 gene locus_tag LOCUS_03620 48144 47224 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_03620 49144 48254 gene locus_tag LOCUS_03630 gene truB 49144 48254 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_03630 50102 49149 gene locus_tag LOCUS_03640 50102 49149 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_03640 50475 50095 gene locus_tag LOCUS_03650 gene rbfA 50475 50095 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_03650 53254 50492 gene locus_tag LOCUS_03660 gene infB 53254 50492 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460393.1 protein_id gnl|my_center|LOCUS_03660 53603 53295 gene locus_tag LOCUS_03670 53603 53295 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 protein_id gnl|my_center|LOCUS_03670 53868 53587 gene locus_tag LOCUS_03680 53868 53587 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_03680 55107 53884 gene locus_tag LOCUS_03690 gene nusA 55107 53884 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460395.1 protein_id gnl|my_center|LOCUS_03690 55591 55124 gene locus_tag LOCUS_03700 55591 55124 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_03700 55733 55596 gene locus_tag LOCUS_03710 55733 55596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 57175 55865 gene locus_tag LOCUS_03720 gene mocA 57175 55865 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393499.1 protein_id gnl|my_center|LOCUS_03720 57987 57172 gene locus_tag LOCUS_03730 gene yqeB 57987 57172 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047954.1 protein_id gnl|my_center|LOCUS_03730 58262 58026 gene locus_tag LOCUS_03740 58262 58026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 59436 58273 gene locus_tag LOCUS_03750 59436 58273 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811901.1 protein_id gnl|my_center|LOCUS_03750 60050 59433 gene locus_tag LOCUS_03760 gene yedF 60050 59433 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356602.1 protein_id gnl|my_center|LOCUS_03760 62312 60072 gene locus_tag LOCUS_03770 gene gyrA 62312 60072 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_03770 64280 62358 gene locus_tag LOCUS_03780 gene gyrB 64280 62358 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_03780 65131 64307 gene locus_tag LOCUS_03790 65131 64307 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287898.1 protein_id gnl|my_center|LOCUS_03790 65405 65560 gene locus_tag LOCUS_03800 65405 65560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 67333 65642 gene locus_tag LOCUS_03810 67333 65642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 68720 67392 gene locus_tag LOCUS_03820 68720 67392 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_03820 69042 68971 gene locus_tag LOCUS_t00030 69042 68971 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 70178 69276 gene locus_tag LOCUS_03830 70178 69276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 70920 70381 gene locus_tag LOCUS_03840 70920 70381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 71924 70989 gene locus_tag LOCUS_03850 71924 70989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 73061 71943 gene locus_tag LOCUS_03860 73061 71943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 73885 73058 gene locus_tag LOCUS_03870 gene phnX 73885 73058 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797923.1 protein_id gnl|my_center|LOCUS_03870 74972 74211 gene locus_tag LOCUS_03880 74972 74211 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476686.1 protein_id gnl|my_center|LOCUS_03880 76247 75060 gene locus_tag LOCUS_03890 gene metK 76247 75060 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_03890 78807 76762 gene locus_tag LOCUS_03900 78807 76762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 79781 78897 gene locus_tag LOCUS_03910 79781 78897 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_03910 80714 79782 gene locus_tag LOCUS_03920 80714 79782 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_03920 82245 80824 gene locus_tag LOCUS_03930 82245 80824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 83425 82346 gene locus_tag LOCUS_03940 gene cytR 83425 82346 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481416.1 protein_id gnl|my_center|LOCUS_03940 85068 83764 gene locus_tag LOCUS_03950 gene ltrA 85068 83764 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_03950 85637 87265 gene locus_tag LOCUS_03960 85637 87265 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 protein_id gnl|my_center|LOCUS_03960 87633 87561 gene locus_tag LOCUS_t00040 87633 87561 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 88584 87724 gene locus_tag LOCUS_03970 88584 87724 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930957.1 protein_id gnl|my_center|LOCUS_03970 88793 88721 gene locus_tag LOCUS_t00050 88793 88721 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 90397 89459 gene locus_tag LOCUS_03980 90397 89459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 92513 90429 gene locus_tag LOCUS_03990 92513 90429 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966944.1 protein_id gnl|my_center|LOCUS_03990 92896 93186 gene locus_tag LOCUS_04000 92896 93186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 93183 94649 gene locus_tag LOCUS_04010 93183 94649 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_04010 94696 95199 gene locus_tag LOCUS_04020 94696 95199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 95336 96865 gene locus_tag LOCUS_04030 gene istA 95336 96865 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083940014.1 protein_id gnl|my_center|LOCUS_04030 96858 97628 gene locus_tag LOCUS_04040 gene istB 96858 97628 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459339.1 protein_id gnl|my_center|LOCUS_04040 97621 97977 gene locus_tag LOCUS_04050 97621 97977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 99411 98419 gene locus_tag LOCUS_04060 99411 98419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 99651 99818 gene locus_tag LOCUS_04070 99651 99818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 99987 100346 gene locus_tag LOCUS_04080 99987 100346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence05 1758 385 gene locus_tag LOCUS_04090 gene radA 1758 385 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_04090 2335 1922 gene locus_tag LOCUS_04100 2335 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4910 2460 gene locus_tag LOCUS_04110 4910 2460 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_04110 5318 4929 gene locus_tag LOCUS_04120 5318 4929 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_04120 5541 5458 gene locus_tag LOCUS_t00060 5541 5458 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6990 5728 gene locus_tag LOCUS_04130 gene sleC 6990 5728 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_04130 8218 7040 gene locus_tag LOCUS_04140 8218 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 9612 8329 gene locus_tag LOCUS_04150 gene rseP 9612 8329 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_04150 10760 9609 gene locus_tag LOCUS_04160 10760 9609 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_04160 11606 10797 gene locus_tag LOCUS_04170 11606 10797 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_04170 12312 11608 gene locus_tag LOCUS_04180 12312 11608 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_04180 13148 12597 gene locus_tag LOCUS_04190 gene frr 13148 12597 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_04190 13829 13185 gene locus_tag LOCUS_04200 gene pyrH 13829 13185 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_04200 14335 14099 gene locus_tag LOCUS_04210 14335 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 15300 14461 gene locus_tag LOCUS_04220 15300 14461 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476577.1 protein_id gnl|my_center|LOCUS_04220 15498 16421 gene locus_tag LOCUS_04230 15498 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 16490 16981 gene locus_tag LOCUS_04240 16490 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 18441 17059 gene locus_tag LOCUS_04250 18441 17059 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965728.1 protein_id gnl|my_center|LOCUS_04250 18684 19163 gene locus_tag LOCUS_04260 18684 19163 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_04260 19992 19195 gene locus_tag LOCUS_04270 19992 19195 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_04270 20773 19979 gene locus_tag LOCUS_04280 gene truA 20773 19979 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986454.1 protein_id gnl|my_center|LOCUS_04280 21110 20757 gene locus_tag LOCUS_04290 21110 20757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 21325 22071 gene locus_tag LOCUS_04300 21325 22071 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_04300 23138 22218 gene locus_tag LOCUS_04310 gene metA 23138 22218 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_04310 24772 23162 gene locus_tag LOCUS_04320 gene cls 24772 23162 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_04320 26842 24881 gene locus_tag LOCUS_04330 gene ligA 26842 24881 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_04330 27655 26909 gene locus_tag LOCUS_04340 27655 26909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 28672 27740 gene locus_tag LOCUS_04350 28672 27740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 28820 28746 gene locus_tag LOCUS_t00070 28820 28746 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29813 28935 gene locus_tag LOCUS_04360 29813 28935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 30650 30093 gene locus_tag LOCUS_04370 gene efp 30650 30093 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_04370 31290 30733 gene locus_tag LOCUS_04380 31290 30733 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_04380 32213 31341 gene locus_tag LOCUS_04390 32213 31341 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_04390 33644 32283 gene locus_tag LOCUS_04400 33644 32283 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_04400 35226 33883 gene locus_tag LOCUS_04410 gene rhaA 35226 33883 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_04410 36639 35239 gene locus_tag LOCUS_04420 gene rhaB 36639 35239 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288250.1 protein_id gnl|my_center|LOCUS_04420 37653 36766 gene locus_tag LOCUS_04430 37653 36766 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793567.1 protein_id gnl|my_center|LOCUS_04430 37875 37675 gene locus_tag LOCUS_04440 37875 37675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 39856 38093 gene locus_tag LOCUS_04450 39856 38093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_04450 41592 39853 gene locus_tag LOCUS_04460 41592 39853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 protein_id gnl|my_center|LOCUS_04460 41740 42678 gene locus_tag LOCUS_04470 41740 42678 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_04470 42784 43221 gene locus_tag LOCUS_04480 42784 43221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 43274 43993 gene locus_tag LOCUS_04490 43274 43993 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172583.1 protein_id gnl|my_center|LOCUS_04490 44170 44607 gene locus_tag LOCUS_04500 44170 44607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 44712 45401 gene locus_tag LOCUS_04510 44712 45401 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_04510 46082 45549 gene locus_tag LOCUS_04520 46082 45549 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_04520 46797 46120 gene locus_tag LOCUS_04530 46797 46120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 47471 49402 gene locus_tag LOCUS_04540 gene thrS 47471 49402 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_04540 50050 50271 gene locus_tag LOCUS_04550 50050 50271 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381292.1 protein_id gnl|my_center|LOCUS_04550 50275 50625 gene locus_tag LOCUS_04560 50275 50625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 50765 51358 gene locus_tag LOCUS_04570 50765 51358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 51969 51349 gene locus_tag LOCUS_04580 51969 51349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 52877 52734 gene locus_tag LOCUS_04590 52877 52734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 53328 52930 gene locus_tag LOCUS_04600 53328 52930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 55239 53446 gene locus_tag LOCUS_04610 gene fucI 55239 53446 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_04610 55358 56209 gene locus_tag LOCUS_04620 55358 56209 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_04620 57944 56214 gene locus_tag LOCUS_04630 57944 56214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 59028 58222 gene locus_tag LOCUS_04640 gene rhaR 59028 58222 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_04640 59886 59104 gene locus_tag LOCUS_04650 59886 59104 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_04650 60187 61779 gene locus_tag LOCUS_04660 gene hcp 60187 61779 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_04660 63531 61912 gene locus_tag LOCUS_04670 63531 61912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 64539 63682 gene locus_tag LOCUS_04680 64539 63682 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_04680 65255 64563 gene locus_tag LOCUS_04690 65255 64563 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_04690 66475 65384 gene locus_tag LOCUS_04700 gene araR 66475 65384 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_04700 66743 69346 gene locus_tag LOCUS_04710 66743 69346 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_04710 70738 69473 gene locus_tag LOCUS_04720 70738 69473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 71864 71019 gene locus_tag LOCUS_04730 71864 71019 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_04730 72187 73482 gene locus_tag LOCUS_04740 72187 73482 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_04740 74836 74294 gene locus_tag LOCUS_04750 74836 74294 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361699.1 protein_id gnl|my_center|LOCUS_04750 76521 74923 gene locus_tag LOCUS_04760 76521 74923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_04760 78146 76518 gene locus_tag LOCUS_04770 78146 76518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235856733.1 protein_id gnl|my_center|LOCUS_04770 79175 78183 gene locus_tag LOCUS_04780 79175 78183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 80090 79215 gene locus_tag LOCUS_04790 80090 79215 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 protein_id gnl|my_center|LOCUS_04790 81303 80203 gene locus_tag LOCUS_04800 81303 80203 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_04800 82411 81341 gene locus_tag LOCUS_04810 82411 81341 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_04810 83723 82452 gene locus_tag LOCUS_04820 83723 82452 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence06 1839 541 gene locus_tag LOCUS_04830 1839 541 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167732.1 protein_id gnl|my_center|LOCUS_04830 3247 1820 gene locus_tag LOCUS_04840 3247 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4302 3244 gene locus_tag LOCUS_04850 4302 3244 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816707.1 protein_id gnl|my_center|LOCUS_04850 5299 4304 gene locus_tag LOCUS_04860 5299 4304 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_04860 6386 5316 gene locus_tag LOCUS_04870 6386 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 7452 6391 gene locus_tag LOCUS_04880 7452 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 8563 7466 gene locus_tag LOCUS_04890 gene glf 8563 7466 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_04890 9771 8560 gene locus_tag LOCUS_04900 9771 8560 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_04900 11224 10376 gene locus_tag LOCUS_04910 11224 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 12236 11283 gene locus_tag LOCUS_04920 12236 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 15371 12579 gene locus_tag LOCUS_04930 15371 12579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 15717 16499 gene locus_tag LOCUS_04940 15717 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 16638 16967 gene locus_tag LOCUS_04950 16638 16967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 17062 17385 gene locus_tag LOCUS_04960 17062 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 18692 17562 gene locus_tag LOCUS_04970 18692 17562 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_04970 19388 18693 gene locus_tag LOCUS_04980 gene modB 19388 18693 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360415.1 protein_id gnl|my_center|LOCUS_04980 20314 19394 gene locus_tag LOCUS_04990 gene modA 20314 19394 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_04990 22615 20414 gene locus_tag LOCUS_05000 22615 20414 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 protein_id gnl|my_center|LOCUS_05000 24228 22618 gene locus_tag LOCUS_05010 24228 22618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 25958 24450 gene locus_tag LOCUS_05020 25958 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 26870 25968 gene locus_tag LOCUS_05030 26870 25968 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_05030 27812 26889 gene locus_tag LOCUS_05040 27812 26889 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_05040 29452 27932 gene locus_tag LOCUS_05050 29452 27932 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906003.1 protein_id gnl|my_center|LOCUS_05050 30640 29792 gene locus_tag LOCUS_05060 30640 29792 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669815.1 protein_id gnl|my_center|LOCUS_05060 32270 30750 gene locus_tag LOCUS_05070 gene gatB 32270 30750 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_05070 33799 32330 gene locus_tag LOCUS_05080 gene gatA 33799 32330 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_05080 34109 33816 gene locus_tag LOCUS_05090 gene gatC 34109 33816 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_05090 35517 34177 gene locus_tag LOCUS_05100 gene aspS 35517 34177 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966262.1 protein_id gnl|my_center|LOCUS_05100 37003 35789 gene locus_tag LOCUS_05110 37003 35789 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_05110 37566 37015 gene locus_tag LOCUS_05120 37566 37015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 38917 37586 gene locus_tag LOCUS_05130 gene glnA 38917 37586 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_05130 40617 39133 gene locus_tag LOCUS_05140 40617 39133 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_05140 45163 40631 gene locus_tag LOCUS_05150 gene gltB 45163 40631 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_05150 46830 45163 gene locus_tag LOCUS_05160 46830 45163 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_05160 47186 46959 gene locus_tag LOCUS_05170 47186 46959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 47747 49846 gene locus_tag LOCUS_05180 47747 49846 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_05180 49895 51343 gene locus_tag LOCUS_05190 gene purF 49895 51343 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_05190 51822 51577 gene locus_tag LOCUS_05200 51822 51577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 53349 52075 gene locus_tag LOCUS_05210 53349 52075 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205044.1 protein_id gnl|my_center|LOCUS_05210 55148 53715 gene locus_tag LOCUS_05220 gene purB 55148 53715 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_05220 55869 55159 gene locus_tag LOCUS_05230 55869 55159 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_05230 56831 56073 gene locus_tag LOCUS_05240 gene yecC 56831 56073 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816586.1 protein_id gnl|my_center|LOCUS_05240 57494 56844 gene locus_tag LOCUS_05250 57494 56844 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_05250 58434 57544 gene locus_tag LOCUS_05260 58434 57544 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_05260 59459 58605 gene locus_tag LOCUS_05270 59459 58605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 60791 59535 gene locus_tag LOCUS_05280 60791 59535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 64390 60845 gene locus_tag LOCUS_05290 64390 60845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 64554 65654 gene locus_tag LOCUS_05300 64554 65654 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 protein_id gnl|my_center|LOCUS_05300 68656 65825 gene locus_tag LOCUS_05310 68656 65825 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226436.1 protein_id gnl|my_center|LOCUS_05310 69287 68844 gene locus_tag LOCUS_05320 69287 68844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 69933 69424 gene locus_tag LOCUS_05330 69933 69424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 70977 69937 gene locus_tag LOCUS_05340 70977 69937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 74381 71778 gene locus_tag LOCUS_05350 74381 71778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence07 367 188 gene locus_tag LOCUS_05360 367 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 892 473 gene locus_tag LOCUS_05370 892 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 1573 1049 gene locus_tag LOCUS_05380 1573 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 1841 1590 gene locus_tag LOCUS_05390 1841 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05390 2749 1838 gene locus_tag LOCUS_05400 2749 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05400 2960 2739 gene locus_tag LOCUS_05410 2960 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3601 3083 gene locus_tag LOCUS_05420 3601 3083 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681344.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05420 3824 3627 gene locus_tag LOCUS_05430 3824 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4818 3805 gene locus_tag LOCUS_05440 4818 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 5137 5391 gene locus_tag LOCUS_05450 5137 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5443 5820 gene locus_tag LOCUS_05460 5443 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6181 7632 gene locus_tag LOCUS_05470 gene miaB 6181 7632 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_05470 7652 10312 gene locus_tag LOCUS_05480 gene mutS 7652 10312 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_05480 10370 12799 gene locus_tag LOCUS_05490 10370 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 12809 13753 gene locus_tag LOCUS_05500 gene miaA 12809 13753 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965140.1 protein_id gnl|my_center|LOCUS_05500 13773 15086 gene locus_tag LOCUS_05510 13773 15086 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_05510 15110 16303 gene locus_tag LOCUS_05520 15110 16303 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_05520 16300 17916 gene locus_tag LOCUS_05530 16300 17916 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_05530 18007 18741 gene locus_tag LOCUS_05540 gene radC 18007 18741 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 protein_id gnl|my_center|LOCUS_05540 18761 19774 gene locus_tag LOCUS_05550 18761 19774 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_05550 19787 20653 gene locus_tag LOCUS_05560 gene mreC 19787 20653 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_05560 20654 21175 gene locus_tag LOCUS_05570 20654 21175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 21172 24084 gene locus_tag LOCUS_05580 21172 24084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 24160 24939 gene locus_tag LOCUS_05590 gene minD 24160 24939 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_05590 24951 25202 gene locus_tag LOCUS_05600 gene minE 24951 25202 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 protein_id gnl|my_center|LOCUS_05600 25254 26402 gene locus_tag LOCUS_05610 gene rodA 25254 26402 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_05610 26377 26772 gene locus_tag LOCUS_05620 gene mgsA 26377 26772 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_05620 26747 27778 gene locus_tag LOCUS_05630 26747 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 27896 28315 gene locus_tag LOCUS_05640 27896 28315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_05640 28622 28413 gene locus_tag LOCUS_05650 28622 28413 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964294.1 protein_id gnl|my_center|LOCUS_05650 28857 30248 gene locus_tag LOCUS_05660 28857 30248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 30309 31010 gene locus_tag LOCUS_05670 30309 31010 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_05670 31024 31620 gene locus_tag LOCUS_05680 31024 31620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 31628 32389 gene locus_tag LOCUS_05690 31628 32389 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476135.1 protein_id gnl|my_center|LOCUS_05690 32426 33532 gene locus_tag LOCUS_05700 gene aroB 32426 33532 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480443.1 protein_id gnl|my_center|LOCUS_05700 33522 34064 gene locus_tag LOCUS_05710 gene lspA 33522 34064 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775073.1 protein_id gnl|my_center|LOCUS_05710 34045 34962 gene locus_tag LOCUS_05720 34045 34962 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_05720 35034 35678 gene locus_tag LOCUS_05730 35034 35678 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_05730 36468 35743 gene locus_tag LOCUS_05740 36468 35743 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_05740 36749 37198 gene locus_tag LOCUS_05750 gene dtd 36749 37198 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266358.1 protein_id gnl|my_center|LOCUS_05750 37216 39195 gene locus_tag LOCUS_05760 37216 39195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 39346 39717 gene locus_tag LOCUS_05770 39346 39717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 39908 40759 gene locus_tag LOCUS_05780 39908 40759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 40786 41010 gene locus_tag LOCUS_05790 40786 41010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 41788 41027 gene locus_tag LOCUS_05800 41788 41027 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458912.1 protein_id gnl|my_center|LOCUS_05800 41894 42682 gene locus_tag LOCUS_05810 41894 42682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 42866 43858 gene locus_tag LOCUS_05820 42866 43858 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_05820 44758 43937 gene locus_tag LOCUS_05830 gene aph(3')-IIIa 44758 43937 CDS product aminoglycoside O-phosphotransferase APH(3')-IIIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096887.1 protein_id gnl|my_center|LOCUS_05830 45844 44786 gene locus_tag LOCUS_05840 45844 44786 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_05840 46778 46422 gene locus_tag LOCUS_05850 46778 46422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 47674 46937 gene locus_tag LOCUS_05860 gene kdsB 47674 46937 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030749.1 protein_id gnl|my_center|LOCUS_05860 48601 47798 gene locus_tag LOCUS_05870 48601 47798 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975445.1 protein_id gnl|my_center|LOCUS_05870 49462 48692 gene locus_tag LOCUS_05880 49462 48692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 51060 49459 gene locus_tag LOCUS_05890 51060 49459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 53753 51057 gene locus_tag LOCUS_05900 53753 51057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 54288 53770 gene locus_tag LOCUS_05910 54288 53770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 55868 54285 gene locus_tag LOCUS_05920 55868 54285 CDS product aldolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461003.1 protein_id gnl|my_center|LOCUS_05920 58021 56024 gene locus_tag LOCUS_05930 58021 56024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 58785 58018 gene locus_tag LOCUS_05940 58785 58018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_05940 59550 58798 gene locus_tag LOCUS_05950 59550 58798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_05950 60853 59573 gene locus_tag LOCUS_05960 60853 59573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 61680 60799 gene locus_tag LOCUS_05970 61680 60799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 62878 61637 gene locus_tag LOCUS_05980 62878 61637 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_05980 63011 63187 gene locus_tag LOCUS_05990 63011 63187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 64660 63377 gene locus_tag LOCUS_06000 64660 63377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 65730 64693 gene locus_tag LOCUS_06010 65730 64693 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200459.1 protein_id gnl|my_center|LOCUS_06010 66119 65727 gene locus_tag LOCUS_06020 66119 65727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 67465 66239 gene locus_tag LOCUS_06030 67465 66239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 67831 68451 gene locus_tag LOCUS_06040 gene lexA 67831 68451 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_06040 69239 68583 gene locus_tag LOCUS_06050 69239 68583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 70093 69236 gene locus_tag LOCUS_06060 70093 69236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_06060 70465 70094 gene locus_tag LOCUS_06070 70465 70094 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_06070 71126 70776 gene locus_tag LOCUS_06080 gene rsfS 71126 70776 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_06080 72492 71224 gene locus_tag LOCUS_06090 72492 71224 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_06090 72797 72507 gene locus_tag LOCUS_06100 gene yhbY 72797 72507 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 protein_id gnl|my_center|LOCUS_06100 74100 72808 gene locus_tag LOCUS_06110 gene obgE 74100 72808 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_06110 74451 74167 gene locus_tag LOCUS_06120 gene rpmA 74451 74167 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 protein_id gnl|my_center|LOCUS_06120 74788 74456 gene locus_tag LOCUS_06130 74788 74456 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476071.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence08 1165 2 gene locus_tag LOCUS_06140 1165 2 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_06140 1468 2091 gene locus_tag LOCUS_06150 1468 2091 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_06150 3284 2199 gene locus_tag LOCUS_06160 gene ytvI 3284 2199 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_06160 4296 3370 gene locus_tag LOCUS_06170 4296 3370 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_06170 5036 4299 gene locus_tag LOCUS_06180 5036 4299 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_06180 5354 8449 gene locus_tag LOCUS_06190 gene ebgA 5354 8449 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482309.1 protein_id gnl|my_center|LOCUS_06190 8594 8962 gene locus_tag LOCUS_06200 8594 8962 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_06200 10299 9079 gene locus_tag LOCUS_06210 10299 9079 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812931.1 protein_id gnl|my_center|LOCUS_06210 11603 10296 gene locus_tag LOCUS_06220 11603 10296 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_06220 12677 11880 gene locus_tag LOCUS_06230 12677 11880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_06230 13597 12680 gene locus_tag LOCUS_06240 13597 12680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_06240 14860 13778 gene locus_tag LOCUS_06250 14860 13778 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_06250 15412 14963 gene locus_tag LOCUS_06260 gene nrdR 15412 14963 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_06260 15679 15933 gene locus_tag LOCUS_06270 15679 15933 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181832.1 protein_id gnl|my_center|LOCUS_06270 16807 16028 gene locus_tag LOCUS_06280 gene sigG 16807 16028 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_06280 19495 17045 gene locus_tag LOCUS_06290 19495 17045 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 protein_id gnl|my_center|LOCUS_06290 20970 19561 gene locus_tag LOCUS_06300 20970 19561 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_06300 22224 21022 gene locus_tag LOCUS_06310 22224 21022 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_06310 23133 22396 gene locus_tag LOCUS_06320 gene sigE 23133 22396 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_06320 24000 23146 gene locus_tag LOCUS_06330 24000 23146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 24966 24211 gene locus_tag LOCUS_06340 gene aroD 24966 24211 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703249.1 protein_id gnl|my_center|LOCUS_06340 26014 26889 gene locus_tag LOCUS_06350 26014 26889 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_06350 28136 26982 gene locus_tag LOCUS_06360 gene ftsZ 28136 26982 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_06360 29550 28288 gene locus_tag LOCUS_06370 29550 28288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 30922 29669 gene locus_tag LOCUS_06380 gene murA 30922 29669 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_06380 32109 31012 gene locus_tag LOCUS_06390 gene ftsW 32109 31012 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_06390 32501 32187 gene locus_tag LOCUS_06400 32501 32187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 32629 32507 gene locus_tag LOCUS_06410 32629 32507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 32851 33399 gene locus_tag LOCUS_06420 32851 33399 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_06420 33451 34554 gene locus_tag LOCUS_06430 33451 34554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 35516 34569 gene locus_tag LOCUS_06440 35516 34569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 37144 35771 gene locus_tag LOCUS_06450 gene murD 37144 35771 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_06450 38113 37157 gene locus_tag LOCUS_06460 gene mraY 38113 37157 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_06460 40078 38333 gene locus_tag LOCUS_06470 40078 38333 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_06470 42553 40184 gene locus_tag LOCUS_06480 42553 40184 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_06480 43113 42625 gene locus_tag LOCUS_06490 43113 42625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 44091 43126 gene locus_tag LOCUS_06500 gene rsmH 44091 43126 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_06500 44554 44123 gene locus_tag LOCUS_06510 gene mraZ 44554 44123 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358778.1 protein_id gnl|my_center|LOCUS_06510 46037 44940 gene locus_tag LOCUS_06520 gene ychF 46037 44940 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_06520 46733 46083 gene locus_tag LOCUS_06530 46733 46083 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_06530 47395 46730 gene locus_tag LOCUS_06540 gene rpe 47395 46730 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264901.1 protein_id gnl|my_center|LOCUS_06540 48282 47398 gene locus_tag LOCUS_06550 gene rsgA 48282 47398 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_06550 50493 48292 gene locus_tag LOCUS_06560 gene pknB 50493 48292 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_06560 51233 50487 gene locus_tag LOCUS_06570 51233 50487 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_06570 52279 51230 gene locus_tag LOCUS_06580 gene rlmN 52279 51230 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_06580 53636 52281 gene locus_tag LOCUS_06590 gene rsmB 53636 52281 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_06590 54339 53629 gene locus_tag LOCUS_06600 54339 53629 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_06600 55297 54344 gene locus_tag LOCUS_06610 gene fmt 55297 54344 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_06610 55774 55298 gene locus_tag LOCUS_06620 gene def 55774 55298 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_06620 58016 55791 gene locus_tag LOCUS_06630 gene priA 58016 55791 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965028.1 protein_id gnl|my_center|LOCUS_06630 59483 58020 gene locus_tag LOCUS_06640 59483 58020 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_06640 60609 59686 gene locus_tag LOCUS_06650 60609 59686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 62036 60606 gene locus_tag LOCUS_06660 62036 60606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 63449 62052 gene locus_tag LOCUS_06670 63449 62052 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_06670 65834 63462 gene locus_tag LOCUS_06680 65834 63462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 67128 66196 gene locus_tag LOCUS_06690 gene arcC 67128 66196 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367131.1 protein_id gnl|my_center|LOCUS_06690 68083 67184 gene locus_tag LOCUS_06700 68083 67184 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_06700 71578 68381 gene locus_tag LOCUS_06710 gene carB 71578 68381 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_06710 72654 71578 gene locus_tag LOCUS_06720 72654 71578 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723080.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence09 1503 886 gene locus_tag LOCUS_06730 1503 886 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_06730 1745 2803 gene locus_tag LOCUS_06740 1745 2803 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989516.1 protein_id gnl|my_center|LOCUS_06740 4065 2968 gene locus_tag LOCUS_06750 gene aroC 4065 2968 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_06750 4371 5312 gene locus_tag LOCUS_06760 4371 5312 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 protein_id gnl|my_center|LOCUS_06760 5328 6161 gene locus_tag LOCUS_06770 5328 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 6178 7449 gene locus_tag LOCUS_06780 6178 7449 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_06780 7620 8564 gene locus_tag LOCUS_06790 7620 8564 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_06790 8607 9740 gene locus_tag LOCUS_06800 8607 9740 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_06800 9965 10489 gene locus_tag LOCUS_06810 9965 10489 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_06810 10554 12857 gene locus_tag LOCUS_06820 10554 12857 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_06820 12869 13498 gene locus_tag LOCUS_06830 12869 13498 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881398.1 protein_id gnl|my_center|LOCUS_06830 13491 14960 gene locus_tag LOCUS_06840 13491 14960 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_06840 14977 15567 gene locus_tag LOCUS_06850 14977 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 15596 16852 gene locus_tag LOCUS_06860 gene hisS 15596 16852 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_06860 16868 18679 gene locus_tag LOCUS_06870 gene aspS 16868 18679 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_06870 20119 18812 gene locus_tag LOCUS_06880 20119 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 20382 21767 gene locus_tag LOCUS_06890 20382 21767 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775008.1 protein_id gnl|my_center|LOCUS_06890 21764 22441 gene locus_tag LOCUS_06900 21764 22441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631603.1 protein_id gnl|my_center|LOCUS_06900 22438 24687 gene locus_tag LOCUS_06910 22438 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 24700 25971 gene locus_tag LOCUS_06920 24700 25971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_06920 26789 26154 gene locus_tag LOCUS_06930 26789 26154 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_06930 27035 27475 gene locus_tag LOCUS_06940 27035 27475 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_06940 27604 29370 gene locus_tag LOCUS_06950 gene argS 27604 29370 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_06950 29423 30595 gene locus_tag LOCUS_06960 29423 30595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 30691 32475 gene locus_tag LOCUS_06970 30691 32475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 32776 33474 gene locus_tag LOCUS_06980 32776 33474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 33495 33998 gene locus_tag LOCUS_06990 33495 33998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 34017 35180 gene locus_tag LOCUS_07000 34017 35180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 35161 35664 gene locus_tag LOCUS_07010 35161 35664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 35651 37861 gene locus_tag LOCUS_07020 35651 37861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 38083 38823 gene locus_tag LOCUS_07030 gene rpsB 38083 38823 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_07030 38855 39787 gene locus_tag LOCUS_07040 gene tsf 38855 39787 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_07040 39880 40527 gene locus_tag LOCUS_07050 39880 40527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 40559 42415 gene locus_tag LOCUS_07060 40559 42415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 42429 44492 gene locus_tag LOCUS_07070 42429 44492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 44621 45133 gene locus_tag LOCUS_07080 44621 45133 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771878.1 protein_id gnl|my_center|LOCUS_07080 45130 45720 gene locus_tag LOCUS_07090 45130 45720 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809618.1 protein_id gnl|my_center|LOCUS_07090 45820 47178 gene locus_tag LOCUS_07100 45820 47178 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_07100 47340 47519 gene locus_tag LOCUS_07110 47340 47519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 48231 48776 gene locus_tag LOCUS_07120 48231 48776 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_07120 48935 50323 gene locus_tag LOCUS_07130 48935 50323 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_07130 50429 51853 gene locus_tag LOCUS_07140 gene pyk 50429 51853 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_07140 51999 52613 gene locus_tag LOCUS_07150 51999 52613 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_07150 52740 55958 gene locus_tag LOCUS_07160 gene carB 52740 55958 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_07160 56055 56666 gene locus_tag LOCUS_07170 56055 56666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 56668 57522 gene locus_tag LOCUS_07180 56668 57522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 57529 58242 gene locus_tag LOCUS_07190 57529 58242 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_07190 58895 60166 gene locus_tag LOCUS_07200 58895 60166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 61098 61562 gene locus_tag LOCUS_07210 61098 61562 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_07210 61580 62077 gene locus_tag LOCUS_07220 61580 62077 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_07220 62097 62309 gene locus_tag LOCUS_07230 62097 62309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 62315 62665 gene locus_tag LOCUS_07240 62315 62665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 62821 63924 gene locus_tag LOCUS_07250 62821 63924 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_07250 64010 64957 gene locus_tag LOCUS_07260 64010 64957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 65281 66123 gene locus_tag LOCUS_07270 65281 66123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 66089 67174 gene locus_tag LOCUS_07280 66089 67174 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969513.1 protein_id gnl|my_center|LOCUS_07280 67312 67473 gene locus_tag LOCUS_07290 67312 67473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 67425 67814 gene locus_tag LOCUS_07300 67425 67814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 67845 69248 gene locus_tag LOCUS_07310 67845 69248 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_07310 69253 70380 gene locus_tag LOCUS_07320 69253 70380 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766018.1 protein_id gnl|my_center|LOCUS_07320 70692 71657 gene locus_tag LOCUS_07330 70692 71657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 71839 72186 gene locus_tag LOCUS_07340 71839 72186 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence10 575 105 gene locus_tag LOCUS_07350 575 105 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_07350 970 1644 gene locus_tag LOCUS_07360 970 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1702 2649 gene locus_tag LOCUS_07370 1702 2649 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 protein_id gnl|my_center|LOCUS_07370 2749 3834 gene locus_tag LOCUS_07380 2749 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3845 6202 gene locus_tag LOCUS_07390 3845 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 6257 7162 gene locus_tag LOCUS_07400 gene spoIID 6257 7162 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_07400 7243 8073 gene locus_tag LOCUS_07410 7243 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 8799 9449 gene locus_tag LOCUS_07420 8799 9449 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_07420 12314 9618 gene locus_tag LOCUS_07430 12314 9618 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_07430 14084 13122 gene locus_tag LOCUS_07440 14084 13122 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681076.1 protein_id gnl|my_center|LOCUS_07440 16242 15127 gene locus_tag LOCUS_07450 gene alr 16242 15127 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462255.1 protein_id gnl|my_center|LOCUS_07450 17568 16366 gene locus_tag LOCUS_07460 17568 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 19127 17565 gene locus_tag LOCUS_07470 19127 17565 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948337.1 protein_id gnl|my_center|LOCUS_07470 19836 19102 gene locus_tag LOCUS_07480 gene walR 19836 19102 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_07480 20087 20260 gene locus_tag LOCUS_07490 20087 20260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 20292 20540 gene locus_tag LOCUS_07500 20292 20540 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_07500 20561 21124 gene locus_tag LOCUS_07510 20561 21124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 22369 21254 gene locus_tag LOCUS_07520 gene glgD 22369 21254 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_07520 23507 22371 gene locus_tag LOCUS_07530 23507 22371 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922500.1 protein_id gnl|my_center|LOCUS_07530 24408 23749 gene locus_tag LOCUS_07540 24408 23749 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_07540 25604 24669 gene locus_tag LOCUS_07550 25604 24669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 25809 27455 gene locus_tag LOCUS_07560 25809 27455 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_07560 27478 28107 gene locus_tag LOCUS_07570 27478 28107 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_07570 28352 29686 gene locus_tag LOCUS_07580 gene gdhA 28352 29686 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_07580 31055 29853 gene locus_tag LOCUS_07590 31055 29853 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_07590 31275 31766 gene locus_tag LOCUS_07600 31275 31766 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_07600 31926 33221 gene locus_tag LOCUS_07610 31926 33221 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_07610 33509 36823 gene locus_tag LOCUS_07620 33509 36823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 36961 37854 gene locus_tag LOCUS_07630 gene rsmA 36961 37854 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_07630 38243 39160 gene locus_tag LOCUS_07640 38243 39160 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 protein_id gnl|my_center|LOCUS_07640 39687 40856 gene locus_tag LOCUS_07650 39687 40856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 40871 42772 gene locus_tag LOCUS_07660 40871 42772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 42917 45079 gene locus_tag LOCUS_07670 42917 45079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 45617 45174 gene locus_tag LOCUS_07680 45617 45174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 46654 45680 gene locus_tag LOCUS_07690 46654 45680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 47972 46647 gene locus_tag LOCUS_07700 47972 46647 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_07700 48957 48061 gene locus_tag LOCUS_07710 48957 48061 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355307.1 protein_id gnl|my_center|LOCUS_07710 49650 49000 gene locus_tag LOCUS_07720 49650 49000 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_07720 50234 49701 gene locus_tag LOCUS_07730 gene cobO 50234 49701 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081762.1 protein_id gnl|my_center|LOCUS_07730 50958 50422 gene locus_tag LOCUS_07740 50958 50422 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_07740 51745 51200 gene locus_tag LOCUS_07750 51745 51200 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_07750 52259 51855 gene locus_tag LOCUS_07760 52259 51855 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_07760 52454 53704 gene locus_tag LOCUS_07770 52454 53704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 53968 55296 gene locus_tag LOCUS_07780 53968 55296 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_07780 56247 55321 gene locus_tag LOCUS_07790 56247 55321 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_07790 56590 58638 gene locus_tag LOCUS_07800 56590 58638 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_07800 59618 60688 gene locus_tag LOCUS_07810 59618 60688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 60606 60869 gene locus_tag LOCUS_07820 60606 60869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 60950 61534 gene locus_tag LOCUS_07830 60950 61534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 61573 63588 gene locus_tag LOCUS_07840 61573 63588 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_07840 65072 63678 gene locus_tag LOCUS_07850 65072 63678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 65166 65774 gene locus_tag LOCUS_07860 65166 65774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 66575 65991 gene locus_tag LOCUS_07870 66575 65991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 67144 68433 gene locus_tag LOCUS_07880 67144 68433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 68452 69771 gene locus_tag LOCUS_07890 68452 69771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence11 758 486 gene locus_tag LOCUS_07900 758 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1106 771 gene locus_tag LOCUS_07910 1106 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2012 1140 gene locus_tag LOCUS_07920 2012 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2850 2110 gene locus_tag LOCUS_07930 2850 2110 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_07930 4525 2897 gene locus_tag LOCUS_07940 4525 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6031 4547 gene locus_tag LOCUS_07950 6031 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7477 6134 gene locus_tag LOCUS_07960 7477 6134 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_07960 8226 7867 gene locus_tag LOCUS_07970 8226 7867 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_07970 8686 8348 gene locus_tag LOCUS_07980 8686 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 9281 8706 gene locus_tag LOCUS_07990 9281 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9639 9292 gene locus_tag LOCUS_08000 9639 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 10740 9682 gene locus_tag LOCUS_08010 10740 9682 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966740.1 protein_id gnl|my_center|LOCUS_08010 11015 12370 gene locus_tag LOCUS_08020 gene brnQ 11015 12370 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_08020 12787 12428 gene locus_tag LOCUS_08030 gene crcB 12787 12428 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_08030 14015 12789 gene locus_tag LOCUS_08040 14015 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 17319 14002 gene locus_tag LOCUS_08050 17319 14002 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_08050 17969 17316 gene locus_tag LOCUS_08060 17969 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 19378 17966 gene locus_tag LOCUS_08070 19378 17966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 20832 19426 gene locus_tag LOCUS_08080 20832 19426 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987111.1 protein_id gnl|my_center|LOCUS_08080 21782 20901 gene locus_tag LOCUS_08090 21782 20901 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679543.1 protein_id gnl|my_center|LOCUS_08090 22149 21799 gene locus_tag LOCUS_08100 22149 21799 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816008.1 protein_id gnl|my_center|LOCUS_08100 22592 22146 gene locus_tag LOCUS_08110 22592 22146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 24338 23403 gene locus_tag LOCUS_08120 24338 23403 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108052.1 protein_id gnl|my_center|LOCUS_08120 27555 24355 gene locus_tag LOCUS_08130 27555 24355 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480361.1 protein_id gnl|my_center|LOCUS_08130 28706 27552 gene locus_tag LOCUS_08140 28706 27552 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765153.1 protein_id gnl|my_center|LOCUS_08140 29039 28842 gene locus_tag LOCUS_08150 29039 28842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 29294 29773 gene locus_tag LOCUS_08160 gene cynS 29294 29773 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082956.1 protein_id gnl|my_center|LOCUS_08160 30251 29832 gene locus_tag LOCUS_08170 30251 29832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 30468 30238 gene locus_tag LOCUS_08180 30468 30238 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423177.1 protein_id gnl|my_center|LOCUS_08180 30819 31982 gene locus_tag LOCUS_08190 30819 31982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 33742 32000 gene locus_tag LOCUS_08200 33742 32000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_08200 35583 33739 gene locus_tag LOCUS_08210 35583 33739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460630.1 protein_id gnl|my_center|LOCUS_08210 36389 35772 gene locus_tag LOCUS_08220 36389 35772 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_08220 36429 36737 gene locus_tag LOCUS_08230 36429 36737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 36898 36758 gene locus_tag LOCUS_08240 36898 36758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 38298 36970 gene locus_tag LOCUS_08250 38298 36970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 38940 38425 gene locus_tag LOCUS_08260 38940 38425 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_08260 40418 39072 gene locus_tag LOCUS_08270 40418 39072 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_08270 41001 40540 gene locus_tag LOCUS_08280 41001 40540 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_08280 41441 41109 gene locus_tag LOCUS_08290 41441 41109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 41619 41500 gene locus_tag LOCUS_08300 41619 41500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 42206 43537 gene locus_tag LOCUS_08310 42206 43537 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 protein_id gnl|my_center|LOCUS_08310 43618 44046 gene locus_tag LOCUS_08320 43618 44046 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461083.1 protein_id gnl|my_center|LOCUS_08320 44043 44330 gene locus_tag LOCUS_08330 44043 44330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 45735 44551 gene locus_tag LOCUS_08340 45735 44551 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_08340 46296 45865 gene locus_tag LOCUS_08350 46296 45865 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_08350 46458 46976 gene locus_tag LOCUS_08360 46458 46976 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034532906.1 protein_id gnl|my_center|LOCUS_08360 46969 47433 gene locus_tag LOCUS_08370 46969 47433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 47804 47427 gene locus_tag LOCUS_08380 47804 47427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 49395 47821 gene locus_tag LOCUS_08390 49395 47821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 50799 49489 gene locus_tag LOCUS_08400 50799 49489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 54007 50909 gene locus_tag LOCUS_08410 54007 50909 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_08410 55519 54164 gene locus_tag LOCUS_08420 55519 54164 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061331.1 protein_id gnl|my_center|LOCUS_08420 56467 55523 gene locus_tag LOCUS_08430 56467 55523 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_08430 57624 56704 gene locus_tag LOCUS_08440 57624 56704 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830948.1 protein_id gnl|my_center|LOCUS_08440 59468 57738 gene locus_tag LOCUS_08450 59468 57738 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831225.1 protein_id gnl|my_center|LOCUS_08450 60458 59505 gene locus_tag LOCUS_08460 60458 59505 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831280.1 protein_id gnl|my_center|LOCUS_08460 61450 60689 gene locus_tag LOCUS_08470 61450 60689 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_08470 62388 61453 gene locus_tag LOCUS_08480 62388 61453 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_08480 63330 62419 gene locus_tag LOCUS_08490 63330 62419 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_08490 63517 63984 gene locus_tag LOCUS_08500 63517 63984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 64011 64919 gene locus_tag LOCUS_08510 64011 64919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence12 393 1016 gene locus_tag LOCUS_08520 393 1016 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_08520 1045 1269 gene locus_tag LOCUS_08530 1045 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1303 1803 gene locus_tag LOCUS_08540 gene atpF 1303 1803 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892033.1 protein_id gnl|my_center|LOCUS_08540 1784 2293 gene locus_tag LOCUS_08550 gene atpH 1784 2293 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056289.1 protein_id gnl|my_center|LOCUS_08550 2298 3809 gene locus_tag LOCUS_08560 gene atpA 2298 3809 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_08560 3836 4744 gene locus_tag LOCUS_08570 gene atpG 3836 4744 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_08570 4840 6228 gene locus_tag LOCUS_08580 gene atpD 4840 6228 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_08580 6234 6650 gene locus_tag LOCUS_08590 6234 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 6643 7020 gene locus_tag LOCUS_08600 6643 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 7082 7474 gene locus_tag LOCUS_08610 7082 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 8048 7563 gene locus_tag LOCUS_08620 gene ybaK 8048 7563 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_08620 8352 8864 gene locus_tag LOCUS_08630 8352 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 8861 9949 gene locus_tag LOCUS_08640 8861 9949 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963366.1 protein_id gnl|my_center|LOCUS_08640 9910 11103 gene locus_tag LOCUS_08650 9910 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 11304 11876 gene locus_tag LOCUS_08660 11304 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 11904 13277 gene locus_tag LOCUS_08670 11904 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 13321 13488 gene locus_tag LOCUS_08680 13321 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 13589 15070 gene locus_tag LOCUS_08690 13589 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 15127 15972 gene locus_tag LOCUS_08700 15127 15972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 15976 16392 gene locus_tag LOCUS_08710 15976 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 16389 16817 gene locus_tag LOCUS_08720 16389 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 16822 18297 gene locus_tag LOCUS_08730 16822 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 18361 18996 gene locus_tag LOCUS_08740 18361 18996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 19738 18953 gene locus_tag LOCUS_08750 19738 18953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 19897 20310 gene locus_tag LOCUS_08760 19897 20310 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 protein_id gnl|my_center|LOCUS_08760 21480 20416 gene locus_tag LOCUS_08770 21480 20416 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_08770 21630 23231 gene locus_tag LOCUS_08780 21630 23231 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_08780 24447 23242 gene locus_tag LOCUS_08790 24447 23242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 24620 26413 gene locus_tag LOCUS_08800 24620 26413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 27074 26469 gene locus_tag LOCUS_08810 27074 26469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 27514 27275 gene locus_tag LOCUS_08820 27514 27275 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_08820 28945 27731 gene locus_tag LOCUS_08830 28945 27731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681920.1 protein_id gnl|my_center|LOCUS_08830 30059 28932 gene locus_tag LOCUS_08840 30059 28932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389793.1 protein_id gnl|my_center|LOCUS_08840 31014 30085 gene locus_tag LOCUS_08850 31014 30085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389792.1 protein_id gnl|my_center|LOCUS_08850 31196 32299 gene locus_tag LOCUS_08860 31196 32299 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389791.1 protein_id gnl|my_center|LOCUS_08860 32303 32950 gene locus_tag LOCUS_08870 32303 32950 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666641.1 protein_id gnl|my_center|LOCUS_08870 32971 33669 gene locus_tag LOCUS_08880 32971 33669 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_08880 33841 34518 gene locus_tag LOCUS_08890 33841 34518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 34616 35962 gene locus_tag LOCUS_08900 34616 35962 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_08900 35967 36923 gene locus_tag LOCUS_08910 35967 36923 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_08910 37157 37339 gene locus_tag LOCUS_08920 37157 37339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 37441 38091 gene locus_tag LOCUS_08930 37441 38091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 38433 38167 gene locus_tag LOCUS_08940 38433 38167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 38671 39387 gene locus_tag LOCUS_08950 38671 39387 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_08950 39411 41816 gene locus_tag LOCUS_08960 39411 41816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 42736 41903 gene locus_tag LOCUS_08970 42736 41903 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_08970 43093 44196 gene locus_tag LOCUS_08980 gene ugpC 43093 44196 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_08980 44401 45486 gene locus_tag LOCUS_08990 44401 45486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 45527 47791 gene locus_tag LOCUS_09000 45527 47791 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_09000 49135 49857 gene locus_tag LOCUS_09010 49135 49857 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_09010 49904 50965 gene locus_tag LOCUS_09020 gene ytvI 49904 50965 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198961.1 protein_id gnl|my_center|LOCUS_09020 51092 52315 gene locus_tag LOCUS_09030 51092 52315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 52506 52835 gene locus_tag LOCUS_09040 52506 52835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 52839 55025 gene locus_tag LOCUS_09050 52839 55025 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_09050 55022 55492 gene locus_tag LOCUS_09060 55022 55492 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_09060 55513 56118 gene locus_tag LOCUS_09070 55513 56118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 56111 57097 gene locus_tag LOCUS_09080 56111 57097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 57097 57417 gene locus_tag LOCUS_09090 57097 57417 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_09090 57469 59244 gene locus_tag LOCUS_09100 57469 59244 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_09100 59248 60717 gene locus_tag LOCUS_09110 59248 60717 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_09110 60635 61252 gene locus_tag LOCUS_09120 60635 61252 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_09120 61359 61742 gene locus_tag LOCUS_09130 61359 61742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 61918 62976 gene locus_tag LOCUS_09140 61918 62976 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_09140 62992 63477 gene locus_tag LOCUS_09150 62992 63477 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence13 1205 1996 gene locus_tag LOCUS_09160 1205 1996 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439844.1 protein_id gnl|my_center|LOCUS_09160 2019 2969 gene locus_tag LOCUS_09170 2019 2969 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027390.1 protein_id gnl|my_center|LOCUS_09170 3102 3722 gene locus_tag LOCUS_09180 3102 3722 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082560.1 protein_id gnl|my_center|LOCUS_09180 3832 4980 gene locus_tag LOCUS_09190 gene dgoD 3832 4980 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267367.1 protein_id gnl|my_center|LOCUS_09190 5526 5071 gene locus_tag LOCUS_09200 5526 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 5720 7705 gene locus_tag LOCUS_09210 5720 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 9068 7710 gene locus_tag LOCUS_09220 9068 7710 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_09220 10907 9093 gene locus_tag LOCUS_09230 gene ftsH 10907 9093 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_09230 11357 10911 gene locus_tag LOCUS_09240 11357 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 12194 11649 gene locus_tag LOCUS_09250 12194 11649 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 protein_id gnl|my_center|LOCUS_09250 13567 12503 gene locus_tag LOCUS_09260 13567 12503 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_09260 14564 13641 gene locus_tag LOCUS_09270 14564 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 16125 14653 gene locus_tag LOCUS_09280 gene xylB 16125 14653 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_09280 16772 16563 gene locus_tag LOCUS_09290 16772 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 17097 16834 gene locus_tag LOCUS_09300 17097 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 18122 17310 gene locus_tag LOCUS_09310 18122 17310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 18896 18228 gene locus_tag LOCUS_09320 18896 18228 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459567.1 protein_id gnl|my_center|LOCUS_09320 19925 18999 gene locus_tag LOCUS_09330 19925 18999 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108643.1 protein_id gnl|my_center|LOCUS_09330 20433 19951 gene locus_tag LOCUS_09340 20433 19951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 21254 20457 gene locus_tag LOCUS_09350 21254 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 21774 21247 gene locus_tag LOCUS_09360 21774 21247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 22440 21922 gene locus_tag LOCUS_09370 22440 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 22608 23459 gene locus_tag LOCUS_09380 22608 23459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 24123 24049 gene locus_tag LOCUS_t00080 24123 24049 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26613 25294 gene locus_tag LOCUS_09390 26613 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 28284 26896 gene locus_tag LOCUS_09400 28284 26896 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_09400 28789 28556 gene locus_tag LOCUS_09410 gene spoVG 28789 28556 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_09410 30047 28929 gene locus_tag LOCUS_09420 gene glgD 30047 28929 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_09420 31321 30050 gene locus_tag LOCUS_09430 31321 30050 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_09430 31732 33111 gene locus_tag LOCUS_09440 gene murC 31732 33111 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_09440 33864 35054 gene locus_tag LOCUS_09450 33864 35054 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_09450 35074 36063 gene locus_tag LOCUS_09460 35074 36063 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048435.1 protein_id gnl|my_center|LOCUS_09460 36065 37249 gene locus_tag LOCUS_09470 36065 37249 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_09470 38891 37428 gene locus_tag LOCUS_09480 38891 37428 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243920.1 protein_id gnl|my_center|LOCUS_09480 40459 38948 gene locus_tag LOCUS_09490 40459 38948 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112254.1 protein_id gnl|my_center|LOCUS_09490 41396 40440 gene locus_tag LOCUS_09500 41396 40440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 42390 41560 gene locus_tag LOCUS_09510 42390 41560 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_09510 43305 42406 gene locus_tag LOCUS_09520 43305 42406 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_09520 44727 43405 gene locus_tag LOCUS_09530 44727 43405 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_09530 45121 45765 gene locus_tag LOCUS_09540 45121 45765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 46677 45889 gene locus_tag LOCUS_09550 46677 45889 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_09550 48489 46789 gene locus_tag LOCUS_09560 48489 46789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 49529 48486 gene locus_tag LOCUS_09570 49529 48486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 50975 49584 gene locus_tag LOCUS_09580 gene asnS 50975 49584 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_09580 51690 51094 gene locus_tag LOCUS_09590 gene recR 51690 51094 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_09590 52042 51692 gene locus_tag LOCUS_09600 52042 51692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 53665 52055 gene locus_tag LOCUS_09610 gene dnaX 53665 52055 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963452.1 protein_id gnl|my_center|LOCUS_09610 55008 53929 gene locus_tag LOCUS_09620 55008 53929 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence14 1045 425 gene locus_tag LOCUS_09630 1045 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1936 1685 gene locus_tag LOCUS_09640 1936 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2115 1936 gene locus_tag LOCUS_09650 2115 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3405 2173 gene locus_tag LOCUS_09660 3405 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027738.1 protein_id gnl|my_center|LOCUS_09660 3814 5136 gene locus_tag LOCUS_09670 3814 5136 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 protein_id gnl|my_center|LOCUS_09670 5172 6497 gene locus_tag LOCUS_09680 5172 6497 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966105.1 protein_id gnl|my_center|LOCUS_09680 6574 8349 gene locus_tag LOCUS_09690 gene ade 6574 8349 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_09690 9070 8444 gene locus_tag LOCUS_09700 9070 8444 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_09700 10893 9127 gene locus_tag LOCUS_09710 10893 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 11769 10900 gene locus_tag LOCUS_09720 11769 10900 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_09720 13079 11856 gene locus_tag LOCUS_09730 13079 11856 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_09730 14155 13238 gene locus_tag LOCUS_09740 gene ftsX 14155 13238 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_09740 14828 14145 gene locus_tag LOCUS_09750 gene ftsE 14828 14145 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_09750 15885 14851 gene locus_tag LOCUS_09760 15885 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 17859 16105 gene locus_tag LOCUS_09770 17859 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_09770 18810 17890 gene locus_tag LOCUS_09780 18810 17890 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_09780 21301 19187 gene locus_tag LOCUS_09790 21301 19187 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_09790 22375 21512 gene locus_tag LOCUS_09800 gene fba 22375 21512 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_09800 23432 22512 gene locus_tag LOCUS_09810 23432 22512 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722230.1 protein_id gnl|my_center|LOCUS_09810 23723 24034 gene locus_tag LOCUS_09820 gene trxA 23723 24034 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460330.1 protein_id gnl|my_center|LOCUS_09820 24837 24166 gene locus_tag LOCUS_09830 24837 24166 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_09830 27139 24863 gene locus_tag LOCUS_09840 gene yicI 27139 24863 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702873.1 protein_id gnl|my_center|LOCUS_09840 27784 27248 gene locus_tag LOCUS_09850 gene rplQ 27784 27248 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_09850 28910 27951 gene locus_tag LOCUS_09860 28910 27951 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_09860 29673 29080 gene locus_tag LOCUS_09870 gene rpsD 29673 29080 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_09870 30085 29693 gene locus_tag LOCUS_09880 gene rpsK 30085 29693 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_09880 30543 30175 gene locus_tag LOCUS_09890 gene rpsM 30543 30175 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421125.1 protein_id gnl|my_center|LOCUS_09890 32299 31838 gene locus_tag LOCUS_09900 32299 31838 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706874.1 protein_id gnl|my_center|LOCUS_09900 32703 32329 gene locus_tag LOCUS_09910 32703 32329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 32934 32722 gene locus_tag LOCUS_09920 32934 32722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 33012 34190 gene locus_tag LOCUS_09930 33012 34190 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_09930 34450 35346 gene locus_tag LOCUS_09940 gene rfbA 34450 35346 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_09940 35476 36495 gene locus_tag LOCUS_09950 gene rfbB 35476 36495 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_09950 36525 37475 gene locus_tag LOCUS_09960 gene rfbD 36525 37475 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261974.1 protein_id gnl|my_center|LOCUS_09960 39087 37612 gene locus_tag LOCUS_09970 gene cps4A 39087 37612 CDS product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 protein_id gnl|my_center|LOCUS_09970 39761 39291 gene locus_tag LOCUS_09980 39761 39291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 41383 40007 gene locus_tag LOCUS_09990 41383 40007 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_09990 41820 41380 gene locus_tag LOCUS_10000 41820 41380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 42257 42039 gene locus_tag LOCUS_10010 gene infA 42257 42039 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_10010 42534 42259 gene locus_tag LOCUS_10020 42534 42259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 43300 42545 gene locus_tag LOCUS_10030 gene map 43300 42545 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_10030 43949 43305 gene locus_tag LOCUS_10040 43949 43305 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_10040 45387 44071 gene locus_tag LOCUS_10050 gene secY 45387 44071 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_10050 45833 45399 gene locus_tag LOCUS_10060 gene rplO 45833 45399 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_10060 46024 45851 gene locus_tag LOCUS_10070 gene rpmD 46024 45851 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_10070 46547 46038 gene locus_tag LOCUS_10080 gene rpsE 46547 46038 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_10080 46936 46568 gene locus_tag LOCUS_10090 gene rplR 46936 46568 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_10090 47493 46954 gene locus_tag LOCUS_10100 gene rplF 47493 46954 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_10100 48143 47742 gene locus_tag LOCUS_10110 gene rpsH 48143 47742 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_10110 48354 48169 gene locus_tag LOCUS_10120 48354 48169 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_10120 48915 48376 gene locus_tag LOCUS_10130 gene rplE 48915 48376 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_10130 49243 48938 gene locus_tag LOCUS_10140 gene rplX 49243 48938 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_10140 49624 49256 gene locus_tag LOCUS_10150 gene rplN 49624 49256 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_10150 49912 49658 gene locus_tag LOCUS_10160 gene rpsQ 49912 49658 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_10160 50149 49934 gene locus_tag LOCUS_10170 gene rpmC 50149 49934 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 protein_id gnl|my_center|LOCUS_10170 50567 50130 gene locus_tag LOCUS_10180 gene rplP 50567 50130 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_10180 51226 50570 gene locus_tag LOCUS_10190 gene rpsC 51226 50570 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_10190 51628 51242 gene locus_tag LOCUS_10200 gene rplV 51628 51242 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_10200 51941 51660 gene locus_tag LOCUS_10210 gene rpsS 51941 51660 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966408.1 protein_id gnl|my_center|LOCUS_10210 52801 51956 gene locus_tag LOCUS_10220 gene rplB 52801 51956 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_10220 53229 52930 gene locus_tag LOCUS_10230 gene rplW 53229 52930 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_10230 53843 53229 gene locus_tag LOCUS_10240 gene rplD 53843 53229 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_10240 54529 53894 gene locus_tag LOCUS_10250 gene rplC 54529 53894 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence15 1679 945 gene locus_tag LOCUS_10260 1679 945 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582999.1 protein_id gnl|my_center|LOCUS_10260 2624 1791 gene locus_tag LOCUS_10270 2624 1791 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_10270 3502 2675 gene locus_tag LOCUS_10280 3502 2675 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027046.1 protein_id gnl|my_center|LOCUS_10280 4383 3502 gene locus_tag LOCUS_10290 4383 3502 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_10290 5894 4563 gene locus_tag LOCUS_10300 5894 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 7053 6049 gene locus_tag LOCUS_10310 7053 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7485 8690 gene locus_tag LOCUS_10320 7485 8690 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114978.1 protein_id gnl|my_center|LOCUS_10320 8802 10007 gene locus_tag LOCUS_10330 8802 10007 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_10330 10049 11119 gene locus_tag LOCUS_10340 10049 11119 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_10340 12079 11177 gene locus_tag LOCUS_10350 12079 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_10350 14134 12083 gene locus_tag LOCUS_10360 14134 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 14746 14156 gene locus_tag LOCUS_10370 14746 14156 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_10370 15065 14751 gene locus_tag LOCUS_10380 15065 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 15522 15049 gene locus_tag LOCUS_10390 15522 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 15836 15675 gene locus_tag LOCUS_10400 15836 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 16565 15891 gene locus_tag LOCUS_10410 gene pyrE 16565 15891 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_10410 16761 16552 gene locus_tag LOCUS_10420 16761 16552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 17791 16877 gene locus_tag LOCUS_10430 17791 16877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 20237 18507 gene locus_tag LOCUS_10440 20237 18507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453764.1 protein_id gnl|my_center|LOCUS_10440 21229 20633 gene locus_tag LOCUS_10450 21229 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 21339 21178 gene locus_tag LOCUS_10460 21339 21178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 23075 21978 gene locus_tag LOCUS_10470 23075 21978 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_10470 24111 23206 gene locus_tag LOCUS_10480 24111 23206 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_10480 24893 24111 gene locus_tag LOCUS_10490 gene pyrK 24893 24111 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_10490 25845 24916 gene locus_tag LOCUS_10500 gene pyrF 25845 24916 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_10500 27162 25885 gene locus_tag LOCUS_10510 27162 25885 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_10510 27455 27655 gene locus_tag LOCUS_10520 27455 27655 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_10520 29205 28033 gene locus_tag LOCUS_10530 29205 28033 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_10530 30183 29233 gene locus_tag LOCUS_10540 30183 29233 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_10540 30641 30459 gene locus_tag LOCUS_10550 gene rpmF 30641 30459 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_10550 31172 30645 gene locus_tag LOCUS_10560 31172 30645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 32536 31343 gene locus_tag LOCUS_10570 gene ackA 32536 31343 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_10570 33558 32563 gene locus_tag LOCUS_10580 gene pta 33558 32563 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_10580 33803 35038 gene locus_tag LOCUS_10590 33803 35038 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_10590 35766 35098 gene locus_tag LOCUS_10600 35766 35098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 35765 36682 gene locus_tag LOCUS_10610 35765 36682 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_10610 38142 36778 gene locus_tag LOCUS_10620 38142 36778 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_10620 38438 38166 gene locus_tag LOCUS_10630 38438 38166 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_10630 39338 38541 gene locus_tag LOCUS_10640 39338 38541 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_10640 39924 39325 gene locus_tag LOCUS_10650 gene coaE 39924 39325 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_10650 42567 39937 gene locus_tag LOCUS_10660 gene polA 42567 39937 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_10660 42990 42640 gene locus_tag LOCUS_10670 42990 42640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 44505 43120 gene locus_tag LOCUS_10680 44505 43120 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035938.1 protein_id gnl|my_center|LOCUS_10680 49100 44664 gene locus_tag LOCUS_10690 49100 44664 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 protein_id gnl|my_center|LOCUS_10690 49717 50664 gene locus_tag LOCUS_10700 49717 50664 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682246.1 protein_id gnl|my_center|LOCUS_10700 51702 50818 gene locus_tag LOCUS_10710 51702 50818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 52339 51749 gene locus_tag LOCUS_10720 52339 51749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 53335 52346 gene locus_tag LOCUS_10730 53335 52346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence16 230 1588 gene locus_tag LOCUS_10740 230 1588 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966626.1 protein_id gnl|my_center|LOCUS_10740 1632 1997 gene locus_tag LOCUS_10750 1632 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10750 1994 3181 gene locus_tag LOCUS_10760 1994 3181 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869718.1 protein_id gnl|my_center|LOCUS_10760 3171 3680 gene locus_tag LOCUS_10770 3171 3680 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867435.1 protein_id gnl|my_center|LOCUS_10770 3692 3964 gene locus_tag LOCUS_10780 3692 3964 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869716.1 protein_id gnl|my_center|LOCUS_10780 3957 5189 gene locus_tag LOCUS_10790 3957 5189 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215235.1 protein_id gnl|my_center|LOCUS_10790 5182 6603 gene locus_tag LOCUS_10800 5182 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 6666 7595 gene locus_tag LOCUS_10810 gene cysK 6666 7595 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_10810 7638 8075 gene locus_tag LOCUS_10820 7638 8075 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475872.1 protein_id gnl|my_center|LOCUS_10820 8345 9865 gene locus_tag LOCUS_10830 8345 9865 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_10830 9862 11070 gene locus_tag LOCUS_10840 9862 11070 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_10840 11093 11323 gene locus_tag LOCUS_10850 11093 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 11327 12835 gene locus_tag LOCUS_10860 11327 12835 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_10860 12822 13799 gene locus_tag LOCUS_10870 12822 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 13904 14431 gene locus_tag LOCUS_10880 13904 14431 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_10880 15040 14663 gene locus_tag LOCUS_10890 15040 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 15266 18361 gene locus_tag LOCUS_10900 15266 18361 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_10900 18565 19923 gene locus_tag LOCUS_10910 18565 19923 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_10910 19985 23524 gene locus_tag LOCUS_10920 19985 23524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 23604 23855 gene locus_tag LOCUS_10930 23604 23855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 23905 24660 gene locus_tag LOCUS_10940 23905 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 24943 26919 gene locus_tag LOCUS_10950 24943 26919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 26983 27882 gene locus_tag LOCUS_10960 26983 27882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964050.1 protein_id gnl|my_center|LOCUS_10960 27879 29714 gene locus_tag LOCUS_10970 27879 29714 CDS product DUF2194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964051.1 protein_id gnl|my_center|LOCUS_10970 29746 31638 gene locus_tag LOCUS_10980 29746 31638 CDS product DUF2194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964051.1 protein_id gnl|my_center|LOCUS_10980 31635 33065 gene locus_tag LOCUS_10990 gene pelF 31635 33065 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_10990 33041 36304 gene locus_tag LOCUS_11000 33041 36304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 36324 38081 gene locus_tag LOCUS_11010 36324 38081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 38087 38839 gene locus_tag LOCUS_11020 38087 38839 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_11020 38836 39519 gene locus_tag LOCUS_11030 38836 39519 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_11030 39528 40937 gene locus_tag LOCUS_11040 39528 40937 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_11040 40930 41793 gene locus_tag LOCUS_11050 40930 41793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 42244 43851 gene locus_tag LOCUS_11060 42244 43851 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_11060 43855 44715 gene locus_tag LOCUS_11070 gene speE 43855 44715 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366713.1 protein_id gnl|my_center|LOCUS_11070 44712 45971 gene locus_tag LOCUS_11080 44712 45971 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_11080 45976 47115 gene locus_tag LOCUS_11090 gene nspC 45976 47115 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_11090 47173 48237 gene locus_tag LOCUS_11100 gene aguA 47173 48237 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969442.1 protein_id gnl|my_center|LOCUS_11100 48252 49205 gene locus_tag LOCUS_11110 gene aguB 48252 49205 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_11110 49782 49219 gene locus_tag LOCUS_11120 49782 49219 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_11120 49905 50216 gene locus_tag LOCUS_11130 49905 50216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 51786 50521 gene locus_tag LOCUS_11140 51786 50521 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298157.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence17 698 168 gene locus_tag LOCUS_11150 698 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1378 686 gene locus_tag LOCUS_11160 1378 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3094 1592 gene locus_tag LOCUS_11170 3094 1592 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_11170 3507 3262 gene locus_tag LOCUS_11180 3507 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4633 3629 gene locus_tag LOCUS_11190 gene ansA 4633 3629 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_11190 5063 4635 gene locus_tag LOCUS_11200 5063 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461799.1 protein_id gnl|my_center|LOCUS_11200 5566 5066 gene locus_tag LOCUS_11210 5566 5066 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_11210 6271 5801 gene locus_tag LOCUS_11220 6271 5801 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974088.1 protein_id gnl|my_center|LOCUS_11220 7606 6356 gene locus_tag LOCUS_11230 7606 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 8517 7603 gene locus_tag LOCUS_11240 8517 7603 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058115.1 protein_id gnl|my_center|LOCUS_11240 10751 8619 gene locus_tag LOCUS_11250 10751 8619 CDS product DUF6449 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110941629.1 protein_id gnl|my_center|LOCUS_11250 11625 10726 gene locus_tag LOCUS_11260 11625 10726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657068.1 protein_id gnl|my_center|LOCUS_11260 11990 11622 gene locus_tag LOCUS_11270 11990 11622 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_11270 12932 12168 gene locus_tag LOCUS_11280 12932 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 13539 13033 gene locus_tag LOCUS_11290 13539 13033 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_11290 14093 13956 gene locus_tag LOCUS_11300 14093 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 14679 14203 gene locus_tag LOCUS_11310 14679 14203 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_11310 15524 14736 gene locus_tag LOCUS_11320 15524 14736 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_11320 16310 15615 gene locus_tag LOCUS_11330 16310 15615 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_11330 17994 16624 gene locus_tag LOCUS_11340 17994 16624 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_11340 18377 18165 gene locus_tag LOCUS_11350 18377 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 19145 18513 gene locus_tag LOCUS_11360 19145 18513 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_11360 19973 19149 gene locus_tag LOCUS_11370 19973 19149 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_11370 20388 19990 gene locus_tag LOCUS_11380 20388 19990 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_11380 20891 20385 gene locus_tag LOCUS_11390 20891 20385 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_11390 21383 21054 gene locus_tag LOCUS_11400 21383 21054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 21621 21869 gene locus_tag LOCUS_11410 21621 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 21862 22467 gene locus_tag LOCUS_11420 21862 22467 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_11420 22469 22903 gene locus_tag LOCUS_11430 22469 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 23200 23463 gene locus_tag LOCUS_11440 23200 23463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 25375 23591 gene locus_tag LOCUS_11450 25375 23591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611218.1 protein_id gnl|my_center|LOCUS_11450 27145 25385 gene locus_tag LOCUS_11460 27145 25385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_11460 27618 27965 gene locus_tag LOCUS_11470 27618 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 28553 28861 gene locus_tag LOCUS_11480 28553 28861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 29118 28918 gene locus_tag LOCUS_11490 29118 28918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 29146 30150 gene locus_tag LOCUS_11500 29146 30150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 30614 30252 gene locus_tag LOCUS_11510 30614 30252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 32794 30773 gene locus_tag LOCUS_11520 32794 30773 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_11520 38128 33365 gene locus_tag LOCUS_11530 gene polC 38128 33365 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_11530 39198 38125 gene locus_tag LOCUS_11540 gene ispG 39198 38125 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_11540 40400 39273 gene locus_tag LOCUS_11550 40400 39273 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_11550 41710 40400 gene locus_tag LOCUS_11560 41710 40400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 42226 41735 gene locus_tag LOCUS_11570 42226 41735 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_11570 43089 42241 gene locus_tag LOCUS_11580 43089 42241 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_11580 43319 43849 gene locus_tag LOCUS_11590 43319 43849 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_11590 45599 44019 gene locus_tag LOCUS_11600 gene malQ 45599 44019 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_11600 45765 45839 gene locus_tag LOCUS_t00090 45765 45839 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 46906 45923 gene locus_tag LOCUS_11610 46906 45923 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613409.1 protein_id gnl|my_center|LOCUS_11610 48586 47120 gene locus_tag LOCUS_11620 48586 47120 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582926.1 protein_id gnl|my_center|LOCUS_11620 50282 48609 gene locus_tag LOCUS_11630 50282 48609 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_11630 51190 50294 gene locus_tag LOCUS_11640 51190 50294 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence18 746 492 gene locus_tag LOCUS_11650 746 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1050 748 gene locus_tag LOCUS_11660 1050 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1234 1040 gene locus_tag LOCUS_11670 1234 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1458 1231 gene locus_tag LOCUS_11680 1458 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1607 1455 gene locus_tag LOCUS_11690 1607 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1657 1809 gene locus_tag LOCUS_11700 1657 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2075 1806 gene locus_tag LOCUS_11710 2075 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2318 2479 gene locus_tag LOCUS_11720 2318 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2758 3126 gene locus_tag LOCUS_11730 2758 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 3340 4440 gene locus_tag LOCUS_11740 3340 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4617 5789 gene locus_tag LOCUS_11750 4617 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6092 5934 gene locus_tag LOCUS_11760 6092 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6791 6207 gene locus_tag LOCUS_11770 6791 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 8529 6970 gene locus_tag LOCUS_11780 8529 6970 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_11780 9103 8543 gene locus_tag LOCUS_11790 9103 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9296 9003 gene locus_tag LOCUS_11800 9296 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 9567 9289 gene locus_tag LOCUS_11810 9567 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 10921 9911 gene locus_tag LOCUS_11820 10921 9911 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_11820 11632 10940 gene locus_tag LOCUS_11830 11632 10940 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_11830 12064 12786 gene locus_tag LOCUS_11840 12064 12786 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 protein_id gnl|my_center|LOCUS_11840 14397 12823 gene locus_tag LOCUS_11850 14397 12823 CDS product putative ABC exporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048139.1 protein_id gnl|my_center|LOCUS_11850 15207 14401 gene locus_tag LOCUS_11860 15207 14401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048140.1 protein_id gnl|my_center|LOCUS_11860 16055 15369 gene locus_tag LOCUS_11870 16055 15369 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_11870 18116 16056 gene locus_tag LOCUS_11880 18116 16056 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_11880 19102 18119 gene locus_tag LOCUS_11890 gene moaA 19102 18119 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_11890 20163 19105 gene locus_tag LOCUS_11900 gene selD 20163 19105 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_11900 20344 20156 gene locus_tag LOCUS_11910 20344 20156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 21522 20437 gene locus_tag LOCUS_11920 gene asd 21522 20437 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_11920 23088 21715 gene locus_tag LOCUS_11930 gene argH 23088 21715 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_11930 23898 23230 gene locus_tag LOCUS_11940 23898 23230 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_11940 24800 23922 gene locus_tag LOCUS_11950 24800 23922 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_11950 25486 24863 gene locus_tag LOCUS_11960 25486 24863 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_11960 26520 25477 gene locus_tag LOCUS_11970 26520 25477 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_11970 26972 27739 gene locus_tag LOCUS_11980 26972 27739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_11980 27732 28532 gene locus_tag LOCUS_11990 27732 28532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_11990 28798 28601 gene locus_tag LOCUS_12000 28798 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 30304 28913 gene locus_tag LOCUS_12010 30304 28913 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_12010 31319 30420 gene locus_tag LOCUS_12020 31319 30420 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_12020 31477 32253 gene locus_tag LOCUS_12030 31477 32253 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476110.1 protein_id gnl|my_center|LOCUS_12030 32499 32693 gene locus_tag LOCUS_12040 32499 32693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 34401 32806 gene locus_tag LOCUS_12050 34401 32806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 35547 34471 gene locus_tag LOCUS_12060 35547 34471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 37426 35816 gene locus_tag LOCUS_12070 37426 35816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 38873 37446 gene locus_tag LOCUS_12080 38873 37446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 40579 38876 gene locus_tag LOCUS_12090 gene dnaK 40579 38876 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083187.1 protein_id gnl|my_center|LOCUS_12090 41287 40637 gene locus_tag LOCUS_12100 41287 40637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 43130 41427 gene locus_tag LOCUS_12110 43130 41427 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_12110 43749 43246 gene locus_tag LOCUS_12120 43749 43246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 45513 43813 gene locus_tag LOCUS_12130 45513 43813 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_12130 47501 45801 gene locus_tag LOCUS_12140 47501 45801 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_12140 48444 47848 gene locus_tag LOCUS_12150 48444 47848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 48902 48441 gene locus_tag LOCUS_12160 48902 48441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 50104 49127 gene locus_tag LOCUS_12170 50104 49127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence19 220 1617 gene locus_tag LOCUS_12180 220 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5349 1726 gene locus_tag LOCUS_12190 5349 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 5516 6379 gene locus_tag LOCUS_12200 5516 6379 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_12200 6387 7394 gene locus_tag LOCUS_12210 6387 7394 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775198.1 protein_id gnl|my_center|LOCUS_12210 7396 8628 gene locus_tag LOCUS_12220 7396 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8643 9431 gene locus_tag LOCUS_12230 8643 9431 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027227.1 protein_id gnl|my_center|LOCUS_12230 9448 10149 gene locus_tag LOCUS_12240 9448 10149 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_12240 10146 10505 gene locus_tag LOCUS_12250 10146 10505 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985167.1 protein_id gnl|my_center|LOCUS_12250 10502 12469 gene locus_tag LOCUS_12260 10502 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 12641 13204 gene locus_tag LOCUS_12270 gene rfbC 12641 13204 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_12270 13215 14606 gene locus_tag LOCUS_12280 13215 14606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 14621 15934 gene locus_tag LOCUS_12290 14621 15934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_12290 15950 16879 gene locus_tag LOCUS_12300 15950 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 16876 18252 gene locus_tag LOCUS_12310 16876 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 18249 20735 gene locus_tag LOCUS_12320 18249 20735 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_12320 20748 23198 gene locus_tag LOCUS_12330 20748 23198 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_12330 23219 24643 gene locus_tag LOCUS_12340 23219 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 24806 26053 gene locus_tag LOCUS_12350 24806 26053 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_12350 26272 28470 gene locus_tag LOCUS_12360 26272 28470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 28467 28835 gene locus_tag LOCUS_12370 28467 28835 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805125.1 protein_id gnl|my_center|LOCUS_12370 28828 29178 gene locus_tag LOCUS_12380 28828 29178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 29200 30210 gene locus_tag LOCUS_12390 29200 30210 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_12390 32046 30283 gene locus_tag LOCUS_12400 32046 30283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 32215 33795 gene locus_tag LOCUS_12410 32215 33795 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_12410 33792 34175 gene locus_tag LOCUS_12420 33792 34175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 34211 35347 gene locus_tag LOCUS_12430 gene rffA 34211 35347 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_12430 35362 37176 gene locus_tag LOCUS_12440 35362 37176 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_12440 37194 38147 gene locus_tag LOCUS_12450 37194 38147 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_12450 38468 39874 gene locus_tag LOCUS_12460 38468 39874 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_12460 39890 41074 gene locus_tag LOCUS_12470 39890 41074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 41313 42251 gene locus_tag LOCUS_12480 gene rfbN 41313 42251 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_12480 42408 44201 gene locus_tag LOCUS_12490 42408 44201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 44533 45969 gene locus_tag LOCUS_12500 gene clpX 44533 45969 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880858.1 protein_id gnl|my_center|LOCUS_12500 46075 46677 gene locus_tag LOCUS_12510 46075 46677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 46691 47152 gene locus_tag LOCUS_12520 46691 47152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 47310 48149 gene locus_tag LOCUS_12530 47310 48149 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723600.1 protein_id gnl|my_center|LOCUS_12530 48294 49961 gene locus_tag LOCUS_12540 gene malL 48294 49961 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence20 <1 1781 gene locus_tag LOCUS_12550 <1 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391795.1:excinuclease ABC subunit UvrB 2173 3207 gene locus_tag LOCUS_12560 gene hrcA 2173 3207 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_12560 3334 3999 gene locus_tag LOCUS_12570 3334 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4122 6002 gene locus_tag LOCUS_12580 gene dnaK 4122 6002 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_12580 6230 7411 gene locus_tag LOCUS_12590 gene dnaJ 6230 7411 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_12590 7565 8488 gene locus_tag LOCUS_12600 7565 8488 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881641.1 protein_id gnl|my_center|LOCUS_12600 8518 9507 gene locus_tag LOCUS_12610 gene prmA 8518 9507 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872101.1 protein_id gnl|my_center|LOCUS_12610 9515 10330 gene locus_tag LOCUS_12620 9515 10330 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_12620 10311 11465 gene locus_tag LOCUS_12630 10311 11465 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_12630 11476 12654 gene locus_tag LOCUS_12640 gene thiI 11476 12654 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_12640 13103 12870 gene locus_tag LOCUS_12650 13103 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 13256 14581 gene locus_tag LOCUS_12660 gene mtaB 13256 14581 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_12660 14662 14934 gene locus_tag LOCUS_12670 14662 14934 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_12670 14931 15380 gene locus_tag LOCUS_12680 gene ruvX 14931 15380 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_12680 15380 15637 gene locus_tag LOCUS_12690 15380 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 15729 17393 gene locus_tag LOCUS_12700 15729 17393 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_12700 17400 17738 gene locus_tag LOCUS_12710 17400 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 17763 18278 gene locus_tag LOCUS_12720 17763 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 18275 18931 gene locus_tag LOCUS_12730 18275 18931 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989211.1 protein_id gnl|my_center|LOCUS_12730 18928 20166 gene locus_tag LOCUS_12740 18928 20166 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_12740 20760 20134 gene locus_tag LOCUS_12750 gene sigK 20760 20134 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_12750 20860 22392 gene locus_tag LOCUS_12760 20860 22392 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_12760 22389 23339 gene locus_tag LOCUS_12770 gene dprA 22389 23339 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_12770 23394 25475 gene locus_tag LOCUS_12780 gene topA 23394 25475 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_12780 25711 26514 gene locus_tag LOCUS_12790 gene codY 25711 26514 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438268.1 protein_id gnl|my_center|LOCUS_12790 26956 27240 gene locus_tag LOCUS_12800 26956 27240 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_12800 27329 28948 gene locus_tag LOCUS_12810 gene groL 27329 28948 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_12810 29084 29749 gene locus_tag LOCUS_12820 29084 29749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 29742 30251 gene locus_tag LOCUS_12830 29742 30251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 30407 31861 gene locus_tag LOCUS_12840 gene guaB 30407 31861 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048242.1 protein_id gnl|my_center|LOCUS_12840 32053 32736 gene locus_tag LOCUS_12850 32053 32736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 32823 34625 gene locus_tag LOCUS_12860 gene pepF 32823 34625 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_12860 34761 35525 gene locus_tag LOCUS_12870 34761 35525 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091542811.1 protein_id gnl|my_center|LOCUS_12870 35667 35738 gene locus_tag LOCUS_t00100 35667 35738 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37262 35922 gene locus_tag LOCUS_12880 37262 35922 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682090.1 protein_id gnl|my_center|LOCUS_12880 37426 37737 gene locus_tag LOCUS_12890 37426 37737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 37839 38768 gene locus_tag LOCUS_12900 37839 38768 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_12900 38924 40687 gene locus_tag LOCUS_12910 38924 40687 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_12910 40802 41476 gene locus_tag LOCUS_12920 40802 41476 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_12920 41473 43152 gene locus_tag LOCUS_12930 41473 43152 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_12930 43850 43278 gene locus_tag LOCUS_12940 43850 43278 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424276.1 protein_id gnl|my_center|LOCUS_12940 44055 45278 gene locus_tag LOCUS_12950 44055 45278 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_12950 45300 45764 gene locus_tag LOCUS_12960 45300 45764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 46100 47740 gene locus_tag LOCUS_12970 46100 47740 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_12970 47842 48126 gene locus_tag LOCUS_12980 47842 48126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence21 269 898 gene locus_tag LOCUS_12990 269 898 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_12990 916 1767 gene locus_tag LOCUS_13000 916 1767 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_13000 1853 2803 gene locus_tag LOCUS_13010 1853 2803 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_13010 2805 3929 gene locus_tag LOCUS_13020 2805 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3926 5164 gene locus_tag LOCUS_13030 3926 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 6566 5187 gene locus_tag LOCUS_13040 6566 5187 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_13040 6725 7702 gene locus_tag LOCUS_13050 6725 7702 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_13050 7720 8451 gene locus_tag LOCUS_13060 7720 8451 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_13060 8557 9582 gene locus_tag LOCUS_13070 gene queA 8557 9582 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_13070 9995 11956 gene locus_tag LOCUS_13080 9995 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 11958 12581 gene locus_tag LOCUS_13090 11958 12581 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_13090 12647 13525 gene locus_tag LOCUS_13100 12647 13525 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_13100 14722 13721 gene locus_tag LOCUS_13110 14722 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 14947 15444 gene locus_tag LOCUS_13120 gene vanZ1 14947 15444 CDS product glycopeptide resistance protein VanZ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_13120 15561 16055 gene locus_tag LOCUS_13130 15561 16055 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_13130 16961 16062 gene locus_tag LOCUS_13140 16961 16062 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966017.1 protein_id gnl|my_center|LOCUS_13140 17832 16978 gene locus_tag LOCUS_13150 17832 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 18742 17825 gene locus_tag LOCUS_13160 18742 17825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986750.1 protein_id gnl|my_center|LOCUS_13160 19519 18821 gene locus_tag LOCUS_13170 19519 18821 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964178.1 protein_id gnl|my_center|LOCUS_13170 19879 20160 gene locus_tag LOCUS_13180 19879 20160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 20160 20747 gene locus_tag LOCUS_13190 20160 20747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 20744 21823 gene locus_tag LOCUS_13200 20744 21823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 21841 24066 gene locus_tag LOCUS_13210 21841 24066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 24142 25101 gene locus_tag LOCUS_13220 24142 25101 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_13220 25085 25477 gene locus_tag LOCUS_13230 25085 25477 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_13230 25537 26382 gene locus_tag LOCUS_13240 25537 26382 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131820.1 protein_id gnl|my_center|LOCUS_13240 26467 27264 gene locus_tag LOCUS_13250 26467 27264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 27274 30630 gene locus_tag LOCUS_13260 27274 30630 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_13260 30681 31298 gene locus_tag LOCUS_13270 30681 31298 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946962.1 protein_id gnl|my_center|LOCUS_13270 31404 31967 gene locus_tag LOCUS_13280 31404 31967 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_13280 31967 32449 gene locus_tag LOCUS_13290 31967 32449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 33405 32440 gene locus_tag LOCUS_13300 gene asrC 33405 32440 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433832.1 protein_id gnl|my_center|LOCUS_13300 34207 33416 gene locus_tag LOCUS_13310 gene asrB 34207 33416 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964822.1 protein_id gnl|my_center|LOCUS_13310 35235 34207 gene locus_tag LOCUS_13320 gene asrA 35235 34207 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964821.1 protein_id gnl|my_center|LOCUS_13320 36015 35326 gene locus_tag LOCUS_13330 36015 35326 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964819.1 protein_id gnl|my_center|LOCUS_13330 36652 37599 gene locus_tag LOCUS_13340 36652 37599 CDS product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082755.1 protein_id gnl|my_center|LOCUS_13340 37815 38585 gene locus_tag LOCUS_13350 37815 38585 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964820.1 protein_id gnl|my_center|LOCUS_13350 38769 39233 gene locus_tag LOCUS_13360 38769 39233 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_13360 39233 40984 gene locus_tag LOCUS_13370 39233 40984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_13370 40984 42885 gene locus_tag LOCUS_13380 40984 42885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_13380 42882 43655 gene locus_tag LOCUS_13390 gene yaaA 42882 43655 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_13390 43764 44129 gene locus_tag LOCUS_13400 43764 44129 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_13400 44133 44702 gene locus_tag LOCUS_13410 44133 44702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 44712 45071 gene locus_tag LOCUS_13420 44712 45071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 45511 45167 gene locus_tag LOCUS_13430 45511 45167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 45697 46578 gene locus_tag LOCUS_13440 45697 46578 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764673.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence22 58 252 gene locus_tag LOCUS_13450 58 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 191 1663 gene locus_tag LOCUS_13460 191 1663 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994768.1 protein_id gnl|my_center|LOCUS_13460 2078 3331 gene locus_tag LOCUS_13470 gene uraA 2078 3331 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667891.1 protein_id gnl|my_center|LOCUS_13470 3381 4058 gene locus_tag LOCUS_13480 3381 4058 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_13480 4046 5386 gene locus_tag LOCUS_13490 4046 5386 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_13490 5594 6481 gene locus_tag LOCUS_13500 5594 6481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 protein_id gnl|my_center|LOCUS_13500 6472 7719 gene locus_tag LOCUS_13510 6472 7719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861862.1 protein_id gnl|my_center|LOCUS_13510 7679 8302 gene locus_tag LOCUS_13520 7679 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 8629 9210 gene locus_tag LOCUS_13530 8629 9210 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_13530 9437 11536 gene locus_tag LOCUS_13540 9437 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 11809 12195 gene locus_tag LOCUS_13550 11809 12195 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869552.1 protein_id gnl|my_center|LOCUS_13550 13163 12270 gene locus_tag LOCUS_13560 13163 12270 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453971.1 protein_id gnl|my_center|LOCUS_13560 13306 13884 gene locus_tag LOCUS_13570 13306 13884 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_13570 14873 14016 gene locus_tag LOCUS_13580 14873 14016 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_13580 15310 16593 gene locus_tag LOCUS_13590 15310 16593 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_13590 16807 18213 gene locus_tag LOCUS_13600 16807 18213 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_13600 18356 19414 gene locus_tag LOCUS_13610 18356 19414 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_13610 19411 20772 gene locus_tag LOCUS_13620 19411 20772 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_13620 21613 20873 gene locus_tag LOCUS_13630 21613 20873 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_13630 21763 22173 gene locus_tag LOCUS_13640 21763 22173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 22262 23833 gene locus_tag LOCUS_13650 22262 23833 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_13650 23903 24781 gene locus_tag LOCUS_13660 gene ispE 23903 24781 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_13660 24771 25487 gene locus_tag LOCUS_13670 24771 25487 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_13670 25681 27252 gene locus_tag LOCUS_13680 25681 27252 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_13680 27239 28303 gene locus_tag LOCUS_13690 27239 28303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 28296 28949 gene locus_tag LOCUS_13700 28296 28949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 28995 29621 gene locus_tag LOCUS_13710 gene spoIIR 28995 29621 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_13710 29900 30724 gene locus_tag LOCUS_13720 gene murI 29900 30724 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_13720 30729 31184 gene locus_tag LOCUS_13730 30729 31184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 31840 31322 gene locus_tag LOCUS_13740 31840 31322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 32786 31962 gene locus_tag LOCUS_13750 32786 31962 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 protein_id gnl|my_center|LOCUS_13750 33582 32788 gene locus_tag LOCUS_13760 33582 32788 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295567.1 protein_id gnl|my_center|LOCUS_13760 34476 33610 gene locus_tag LOCUS_13770 34476 33610 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398630.1 protein_id gnl|my_center|LOCUS_13770 35342 34476 gene locus_tag LOCUS_13780 35342 34476 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968010.1 protein_id gnl|my_center|LOCUS_13780 36805 35426 gene locus_tag LOCUS_13790 36805 35426 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398680.1 protein_id gnl|my_center|LOCUS_13790 36936 38711 gene locus_tag LOCUS_13800 36936 38711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 38689 40290 gene locus_tag LOCUS_13810 38689 40290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 40407 41891 gene locus_tag LOCUS_13820 40407 41891 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296829.1 protein_id gnl|my_center|LOCUS_13820 42142 43416 gene locus_tag LOCUS_13830 42142 43416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 43566 44780 gene locus_tag LOCUS_13840 43566 44780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence23 195 269 gene locus_tag LOCUS_t00110 195 269 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1802 333 gene locus_tag LOCUS_13850 1802 333 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_13850 2235 1810 gene locus_tag LOCUS_13860 2235 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2564 2857 gene locus_tag LOCUS_13870 2564 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 6783 3028 gene locus_tag LOCUS_13880 6783 3028 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_13880 7014 7898 gene locus_tag LOCUS_13890 7014 7898 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_13890 7914 8234 gene locus_tag LOCUS_13900 7914 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 8753 8247 gene locus_tag LOCUS_13910 8753 8247 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027905.1 protein_id gnl|my_center|LOCUS_13910 9217 8768 gene locus_tag LOCUS_13920 9217 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9472 9329 gene locus_tag LOCUS_13930 9472 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9885 9499 gene locus_tag LOCUS_13940 9885 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 11717 10392 gene locus_tag LOCUS_13950 gene thiC 11717 10392 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_13950 14529 12163 gene locus_tag LOCUS_13960 14529 12163 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948260.1 protein_id gnl|my_center|LOCUS_13960 15025 14789 gene locus_tag LOCUS_13970 15025 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 15948 15124 gene locus_tag LOCUS_13980 15948 15124 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_13980 17237 15945 gene locus_tag LOCUS_13990 17237 15945 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_13990 17704 17955 gene locus_tag LOCUS_14000 17704 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_14000 18901 18074 gene locus_tag LOCUS_14010 18901 18074 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_14010 19343 18924 gene locus_tag LOCUS_14020 19343 18924 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_14020 19598 19371 gene locus_tag LOCUS_14030 19598 19371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 19806 20384 gene locus_tag LOCUS_14040 19806 20384 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_14040 20904 20389 gene locus_tag LOCUS_14050 20904 20389 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_14050 21140 20904 gene locus_tag LOCUS_14060 21140 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 21352 22758 gene locus_tag LOCUS_14070 21352 22758 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_14070 23726 22830 gene locus_tag LOCUS_14080 23726 22830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 24100 24519 gene locus_tag LOCUS_14090 24100 24519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 24910 24599 gene locus_tag LOCUS_14100 24910 24599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 25617 24907 gene locus_tag LOCUS_14110 25617 24907 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_14110 27118 25934 gene locus_tag LOCUS_14120 27118 25934 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_14120 27850 27137 gene locus_tag LOCUS_14130 27850 27137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 28725 28108 gene locus_tag LOCUS_14140 28725 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 29855 28722 gene locus_tag LOCUS_14150 29855 28722 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_14150 30769 30038 gene locus_tag LOCUS_14160 30769 30038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 31661 30771 gene locus_tag LOCUS_14170 31661 30771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 33259 31658 gene locus_tag LOCUS_14180 33259 31658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 34907 33276 gene locus_tag LOCUS_14190 34907 33276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 35677 34925 gene locus_tag LOCUS_14200 35677 34925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 37422 35716 gene locus_tag LOCUS_14210 37422 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 38704 37379 gene locus_tag LOCUS_14220 38704 37379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 40053 38692 gene locus_tag LOCUS_14230 40053 38692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 40748 40089 gene locus_tag LOCUS_14240 40748 40089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 42529 41171 gene locus_tag LOCUS_14250 42529 41171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 <44345 42571 gene locus_tag LOCUS_14260 <44345 42571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000443951.1:5-methylcytosine-specific restriction endonuclease subunit McrB >Feature sequence24 413 64 gene locus_tag LOCUS_tm00010 413 64 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 994 524 gene locus_tag LOCUS_14270 gene smpB 994 524 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_14270 3242 957 gene locus_tag LOCUS_14280 gene rnr 3242 957 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964034.1 protein_id gnl|my_center|LOCUS_14280 3571 3335 gene locus_tag LOCUS_14290 gene secG 3571 3335 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556760.1 protein_id gnl|my_center|LOCUS_14290 4987 3665 gene locus_tag LOCUS_14300 gene eno 4987 3665 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 protein_id gnl|my_center|LOCUS_14300 6713 5172 gene locus_tag LOCUS_14310 gene gpmI 6713 5172 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_14310 7010 8518 gene locus_tag LOCUS_14320 7010 8518 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_14320 8783 8643 gene locus_tag LOCUS_14330 8783 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 9191 8796 gene locus_tag LOCUS_14340 9191 8796 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_14340 10267 9194 gene locus_tag LOCUS_14350 10267 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 10613 10269 gene locus_tag LOCUS_14360 10613 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 12136 10619 gene locus_tag LOCUS_14370 gene pap 12136 10619 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_14370 12675 12229 gene locus_tag LOCUS_14380 12675 12229 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_14380 14197 12812 gene locus_tag LOCUS_14390 14197 12812 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_14390 15665 14205 gene locus_tag LOCUS_14400 15665 14205 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_14400 18118 15749 gene locus_tag LOCUS_14410 18118 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 18724 18314 gene locus_tag LOCUS_14420 18724 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 20190 19204 gene locus_tag LOCUS_14430 gene ruvB 20190 19204 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_14430 20862 20254 gene locus_tag LOCUS_14440 gene ruvA 20862 20254 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_14440 21469 20939 gene locus_tag LOCUS_14450 21469 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 21898 21521 gene locus_tag LOCUS_14460 21898 21521 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_14460 22834 22037 gene locus_tag LOCUS_14470 22834 22037 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_14470 23437 22850 gene locus_tag LOCUS_14480 gene rsxA 23437 22850 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_14480 24135 23440 gene locus_tag LOCUS_14490 24135 23440 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_14490 24807 24199 gene locus_tag LOCUS_14500 24807 24199 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_14500 25759 24797 gene locus_tag LOCUS_14510 25759 24797 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_14510 27096 25756 gene locus_tag LOCUS_14520 gene rsxC 27096 25756 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_14520 28060 27146 gene locus_tag LOCUS_14530 28060 27146 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_14530 28207 29283 gene locus_tag LOCUS_14540 28207 29283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 30596 29511 gene locus_tag LOCUS_14550 gene rpsA 30596 29511 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_14550 31434 30577 gene locus_tag LOCUS_14560 31434 30577 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_14560 32099 31431 gene locus_tag LOCUS_14570 gene cmk 32099 31431 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_14570 33378 32119 gene locus_tag LOCUS_14580 33378 32119 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_14580 34298 33375 gene locus_tag LOCUS_14590 34298 33375 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_14590 35355 34435 gene locus_tag LOCUS_14600 35355 34435 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368532.1 protein_id gnl|my_center|LOCUS_14600 36255 35422 gene locus_tag LOCUS_14610 gene iolI 36255 35422 CDS product 2-keto-myo-inositol isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244546.1 protein_id gnl|my_center|LOCUS_14610 37375 36371 gene locus_tag LOCUS_14620 gene iolG 37375 36371 CDS product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 protein_id gnl|my_center|LOCUS_14620 38516 37491 gene locus_tag LOCUS_14630 38516 37491 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973889.1 protein_id gnl|my_center|LOCUS_14630 39702 38572 gene locus_tag LOCUS_14640 39702 38572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 40505 39702 gene locus_tag LOCUS_14650 40505 39702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210674.1 protein_id gnl|my_center|LOCUS_14650 41748 40498 gene locus_tag LOCUS_14660 41748 40498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 42847 41741 gene locus_tag LOCUS_14670 42847 41741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence25 3540 1069 gene locus_tag LOCUS_14680 3540 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 4721 3537 gene locus_tag LOCUS_14690 4721 3537 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_14690 6922 5015 gene locus_tag LOCUS_14700 gene glgB 6922 5015 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_14700 8361 6985 gene locus_tag LOCUS_14710 8361 6985 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_14710 8973 8392 gene locus_tag LOCUS_14720 8973 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 9198 9701 gene locus_tag LOCUS_14730 9198 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 9698 11050 gene locus_tag LOCUS_14740 9698 11050 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864507.1 protein_id gnl|my_center|LOCUS_14740 12624 11239 gene locus_tag LOCUS_14750 12624 11239 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993891.1 protein_id gnl|my_center|LOCUS_14750 13378 12614 gene locus_tag LOCUS_14760 13378 12614 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_14760 15379 13418 gene locus_tag LOCUS_14770 gene metG 15379 13418 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_14770 16036 16623 gene locus_tag LOCUS_14780 16036 16623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 16620 16805 gene locus_tag LOCUS_14790 16620 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 17417 16896 gene locus_tag LOCUS_14800 17417 16896 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287575.1 protein_id gnl|my_center|LOCUS_14800 17849 17586 gene locus_tag LOCUS_14810 17849 17586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 17739 18311 gene locus_tag LOCUS_14820 17739 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 19764 18478 gene locus_tag LOCUS_14830 19764 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 20352 20933 gene locus_tag LOCUS_14840 20352 20933 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_14840 20930 21478 gene locus_tag LOCUS_14850 20930 21478 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879824.1 protein_id gnl|my_center|LOCUS_14850 22085 21444 gene locus_tag LOCUS_14860 22085 21444 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_14860 22280 22801 gene locus_tag LOCUS_14870 22280 22801 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_14870 23350 22805 gene locus_tag LOCUS_14880 23350 22805 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304258.1 protein_id gnl|my_center|LOCUS_14880 23685 24185 gene locus_tag LOCUS_14890 23685 24185 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_14890 24160 24630 gene locus_tag LOCUS_14900 24160 24630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 24738 25727 gene locus_tag LOCUS_14910 24738 25727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 29534 26841 gene locus_tag LOCUS_14920 29534 26841 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861400.1 protein_id gnl|my_center|LOCUS_14920 30379 29531 gene locus_tag LOCUS_14930 30379 29531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435313.1 protein_id gnl|my_center|LOCUS_14930 31358 30426 gene locus_tag LOCUS_14940 31358 30426 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897088.1 protein_id gnl|my_center|LOCUS_14940 32032 31355 gene locus_tag LOCUS_14950 32032 31355 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897090.1 protein_id gnl|my_center|LOCUS_14950 33645 32029 gene locus_tag LOCUS_14960 gene araB 33645 32029 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_14960 35037 33655 gene locus_tag LOCUS_14970 35037 33655 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_14970 35276 35803 gene locus_tag LOCUS_14980 35276 35803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 36052 36483 gene locus_tag LOCUS_14990 36052 36483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 36610 37839 gene locus_tag LOCUS_15000 36610 37839 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461501.1 protein_id gnl|my_center|LOCUS_15000 38218 37988 gene locus_tag LOCUS_15010 38218 37988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 40565 38400 gene locus_tag LOCUS_15020 gene gnpA 40565 38400 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_15020 40794 41684 gene locus_tag LOCUS_15030 40794 41684 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284798.1 protein_id gnl|my_center|LOCUS_15030 41650 41886 gene locus_tag LOCUS_15040 41650 41886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 42800 41907 gene locus_tag LOCUS_15050 42800 41907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence26 588 764 gene locus_tag LOCUS_15060 588 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1328 864 gene locus_tag LOCUS_15070 gene bcp 1328 864 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_15070 1811 1368 gene locus_tag LOCUS_15080 1811 1368 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583010.1 protein_id gnl|my_center|LOCUS_15080 3753 1900 gene locus_tag LOCUS_15090 3753 1900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_15090 5495 3753 gene locus_tag LOCUS_15100 5495 3753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_15100 6438 5623 gene locus_tag LOCUS_15110 6438 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7218 6532 gene locus_tag LOCUS_15120 7218 6532 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716356.1 protein_id gnl|my_center|LOCUS_15120 7486 7202 gene locus_tag LOCUS_15130 7486 7202 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 protein_id gnl|my_center|LOCUS_15130 8452 7661 gene locus_tag LOCUS_15140 8452 7661 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_15140 9826 8465 gene locus_tag LOCUS_15150 9826 8465 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_15150 10702 9830 gene locus_tag LOCUS_15160 10702 9830 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364431.1 protein_id gnl|my_center|LOCUS_15160 11359 10715 gene locus_tag LOCUS_15170 gene deoC 11359 10715 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_15170 12620 11433 gene locus_tag LOCUS_15180 gene deoB 12620 11433 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_15180 13427 12648 gene locus_tag LOCUS_15190 gene udp 13427 12648 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_15190 14182 13469 gene locus_tag LOCUS_15200 gene tsaA 14182 13469 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_15200 14873 14298 gene locus_tag LOCUS_15210 14873 14298 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_15210 15478 14870 gene locus_tag LOCUS_15220 15478 14870 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_15220 17593 15668 gene locus_tag LOCUS_15230 17593 15668 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095164.1 protein_id gnl|my_center|LOCUS_15230 18732 18343 gene locus_tag LOCUS_15240 18732 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 19730 18846 gene locus_tag LOCUS_15250 gene rbsK 19730 18846 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_15250 19825 20460 gene locus_tag LOCUS_15260 19825 20460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 21024 20518 gene locus_tag LOCUS_15270 21024 20518 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458839.1 protein_id gnl|my_center|LOCUS_15270 21975 21124 gene locus_tag LOCUS_15280 21975 21124 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262299.1 protein_id gnl|my_center|LOCUS_15280 22091 21972 gene locus_tag LOCUS_15290 22091 21972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 23567 22401 gene locus_tag LOCUS_15300 gene rlmD 23567 22401 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233644.1 protein_id gnl|my_center|LOCUS_15300 23698 24732 gene locus_tag LOCUS_15310 23698 24732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 25089 24826 gene locus_tag LOCUS_15320 25089 24826 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949584.1 protein_id gnl|my_center|LOCUS_15320 26397 25102 gene locus_tag LOCUS_15330 26397 25102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 27274 26375 gene locus_tag LOCUS_15340 gene cdaA 27274 26375 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_15340 28490 27357 gene locus_tag LOCUS_15350 28490 27357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 28939 28487 gene locus_tag LOCUS_15360 28939 28487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 29765 29034 gene locus_tag LOCUS_15370 29765 29034 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_15370 31996 29762 gene locus_tag LOCUS_15380 31996 29762 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_15380 33025 32030 gene locus_tag LOCUS_15390 33025 32030 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_15390 35979 33142 gene locus_tag LOCUS_15400 gene uvrA 35979 33142 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_15400 37185 36061 gene locus_tag LOCUS_15410 gene hemW 37185 36061 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_15410 37369 38364 gene locus_tag LOCUS_15420 37369 38364 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_15420 38381 38554 gene locus_tag LOCUS_15430 38381 38554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 39365 38637 gene locus_tag LOCUS_15440 39365 38637 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_15440 39552 39370 gene locus_tag LOCUS_15450 39552 39370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 40349 39603 gene locus_tag LOCUS_15460 40349 39603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 41196 40372 gene locus_tag LOCUS_15470 41196 40372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence27 1999 158 gene locus_tag LOCUS_15480 1999 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2106 5843 gene locus_tag LOCUS_15490 2106 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5819 6370 gene locus_tag LOCUS_15500 5819 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 7996 6482 gene locus_tag LOCUS_15510 7996 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 9780 7999 gene locus_tag LOCUS_15520 9780 7999 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289136.1 protein_id gnl|my_center|LOCUS_15520 9999 11396 gene locus_tag LOCUS_15530 9999 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 11469 12350 gene locus_tag LOCUS_15540 11469 12350 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_15540 12347 13195 gene locus_tag LOCUS_15550 12347 13195 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974399.1 protein_id gnl|my_center|LOCUS_15550 13221 14315 gene locus_tag LOCUS_15560 13221 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 14337 15437 gene locus_tag LOCUS_15570 14337 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 15940 16914 gene locus_tag LOCUS_15580 15940 16914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 16968 18509 gene locus_tag LOCUS_15590 16968 18509 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_15590 18607 19404 gene locus_tag LOCUS_15600 gene cwlC 18607 19404 CDS product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244862.1 protein_id gnl|my_center|LOCUS_15600 19441 20052 gene locus_tag LOCUS_15610 19441 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 21440 20148 gene locus_tag LOCUS_15620 21440 20148 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_15620 21690 24146 gene locus_tag LOCUS_15630 21690 24146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 24194 24568 gene locus_tag LOCUS_15640 24194 24568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 24641 24784 gene locus_tag LOCUS_15650 gene scfA 24641 24784 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_15650 25007 26365 gene locus_tag LOCUS_15660 gene scfB 25007 26365 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_15660 26387 28540 gene locus_tag LOCUS_15670 26387 28540 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_15670 28667 30379 gene locus_tag LOCUS_15680 gene recJ 28667 30379 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_15680 30730 32226 gene locus_tag LOCUS_15690 gene glpK 30730 32226 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_15690 32424 33875 gene locus_tag LOCUS_15700 32424 33875 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_15700 33875 35164 gene locus_tag LOCUS_15710 33875 35164 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_15710 35177 35542 gene locus_tag LOCUS_15720 35177 35542 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_15720 35716 37077 gene locus_tag LOCUS_15730 35716 37077 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_15730 37352 37519 gene locus_tag LOCUS_15740 37352 37519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 37494 38690 gene locus_tag LOCUS_15750 37494 38690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 38702 39562 gene locus_tag LOCUS_15760 38702 39562 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963984.1 protein_id gnl|my_center|LOCUS_15760 39567 40418 gene locus_tag LOCUS_15770 39567 40418 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963985.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence28 1602 190 gene locus_tag LOCUS_15780 1602 190 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_15780 2785 1628 gene locus_tag LOCUS_15790 2785 1628 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_15790 3056 2931 gene locus_tag LOCUS_15800 3056 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 3149 3337 gene locus_tag LOCUS_15810 3149 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4170 3373 gene locus_tag LOCUS_15820 4170 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5621 4188 gene locus_tag LOCUS_15830 5621 4188 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_15830 6981 5758 gene locus_tag LOCUS_15840 6981 5758 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_15840 9000 7162 gene locus_tag LOCUS_15850 9000 7162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_15850 10576 8990 gene locus_tag LOCUS_15860 10576 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15860 11155 10580 gene locus_tag LOCUS_15870 11155 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15870 11634 11152 gene locus_tag LOCUS_15880 11634 11152 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861494.1 protein_id gnl|my_center|LOCUS_15880 11900 13270 gene locus_tag LOCUS_15890 11900 13270 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108266.1 protein_id gnl|my_center|LOCUS_15890 14251 13331 gene locus_tag LOCUS_15900 14251 13331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 15969 14341 gene locus_tag LOCUS_15910 15969 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 16622 16059 gene locus_tag LOCUS_15920 16622 16059 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130278.1 protein_id gnl|my_center|LOCUS_15920 17858 16656 gene locus_tag LOCUS_15930 17858 16656 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_15930 18489 17926 gene locus_tag LOCUS_15940 gene scpB 18489 17926 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_15940 19249 18476 gene locus_tag LOCUS_15950 19249 18476 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_15950 20122 19322 gene locus_tag LOCUS_15960 20122 19322 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_15960 21802 20237 gene locus_tag LOCUS_15970 gene rny 21802 20237 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_15970 22734 22126 gene locus_tag LOCUS_15980 22734 22126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 23780 22731 gene locus_tag LOCUS_15990 gene recA 23780 22731 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_15990 25594 24149 gene locus_tag LOCUS_16000 gene glgA 25594 24149 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_16000 26481 25684 gene locus_tag LOCUS_16010 gene spo0A 26481 25684 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_16010 27890 26679 gene locus_tag LOCUS_16020 gene spoIVB 27890 26679 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_16020 29692 28001 gene locus_tag LOCUS_16030 gene recN 29692 28001 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_16030 30177 29719 gene locus_tag LOCUS_16040 30177 29719 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_16040 31058 30195 gene locus_tag LOCUS_16050 31058 30195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 31884 31063 gene locus_tag LOCUS_16060 31884 31063 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_16060 33770 31881 gene locus_tag LOCUS_16070 gene dxs 33770 31881 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_16070 34670 33783 gene locus_tag LOCUS_16080 34670 33783 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_16080 34869 34660 gene locus_tag LOCUS_16090 34869 34660 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355878.1 protein_id gnl|my_center|LOCUS_16090 36073 34820 gene locus_tag LOCUS_16100 gene xseA 36073 34820 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_16100 36473 36066 gene locus_tag LOCUS_16110 gene nusB 36473 36066 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_16110 37163 36771 gene locus_tag LOCUS_16120 37163 36771 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_16120 38855 37263 gene locus_tag LOCUS_16130 38855 37263 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_16130 39742 39260 gene locus_tag LOCUS_16140 39742 39260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence29 829 170 gene locus_tag LOCUS_16150 829 170 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_16150 1478 810 gene locus_tag LOCUS_16160 1478 810 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_16160 1729 2400 gene locus_tag LOCUS_16170 1729 2400 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434705.1 protein_id gnl|my_center|LOCUS_16170 2397 3584 gene locus_tag LOCUS_16180 2397 3584 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860822.1 protein_id gnl|my_center|LOCUS_16180 3699 4379 gene locus_tag LOCUS_16190 3699 4379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888282.1 protein_id gnl|my_center|LOCUS_16190 4384 6582 gene locus_tag LOCUS_16200 4384 6582 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860821.1 protein_id gnl|my_center|LOCUS_16200 7865 6654 gene locus_tag LOCUS_16210 7865 6654 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_16210 8533 7862 gene locus_tag LOCUS_16220 8533 7862 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_16220 9945 8539 gene locus_tag LOCUS_16230 9945 8539 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_16230 10943 10092 gene locus_tag LOCUS_16240 10943 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 11056 12762 gene locus_tag LOCUS_16250 11056 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 12889 13128 gene locus_tag LOCUS_16260 12889 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 13331 13173 gene locus_tag LOCUS_16270 13331 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 13485 13844 gene locus_tag LOCUS_16280 13485 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 13845 14120 gene locus_tag LOCUS_16290 13845 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 15454 14192 gene locus_tag LOCUS_16300 15454 14192 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_16300 16076 15531 gene locus_tag LOCUS_16310 gene pgsA 16076 15531 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_16310 17400 16051 gene locus_tag LOCUS_16320 gene rimO 17400 16051 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_16320 18070 17693 gene locus_tag LOCUS_16330 18070 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 18804 18172 gene locus_tag LOCUS_16340 gene gmk 18804 18172 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774981.1 protein_id gnl|my_center|LOCUS_16340 19075 18797 gene locus_tag LOCUS_16350 19075 18797 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_16350 19965 19087 gene locus_tag LOCUS_16360 19965 19087 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_16360 20241 21977 gene locus_tag LOCUS_16370 20241 21977 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_16370 21994 24411 gene locus_tag LOCUS_16380 21994 24411 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384650.1 protein_id gnl|my_center|LOCUS_16380 24386 25018 gene locus_tag LOCUS_16390 24386 25018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 25782 25267 gene locus_tag LOCUS_16400 25782 25267 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_16400 28314 25900 gene locus_tag LOCUS_16410 gene leuS 28314 25900 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_16410 29482 28661 gene locus_tag LOCUS_16420 gene folK 29482 28661 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_16420 30349 29534 gene locus_tag LOCUS_16430 gene folP 30349 29534 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_16430 30866 30375 gene locus_tag LOCUS_16440 30866 30375 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_16440 31421 30870 gene locus_tag LOCUS_16450 gene folE 31421 30870 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 protein_id gnl|my_center|LOCUS_16450 33460 31862 gene locus_tag LOCUS_16460 33460 31862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_16460 35748 33658 gene locus_tag LOCUS_16470 gene fusA 35748 33658 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_16470 36076 37095 gene locus_tag LOCUS_16480 gene aroF 36076 37095 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_16480 37092 38198 gene locus_tag LOCUS_16490 37092 38198 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230615.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence30 1108 14 gene locus_tag LOCUS_16500 1108 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1409 1080 gene locus_tag LOCUS_16510 1409 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1965 1564 gene locus_tag LOCUS_16520 1965 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 4140 2473 gene locus_tag LOCUS_16530 4140 2473 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_16530 4938 4231 gene locus_tag LOCUS_16540 4938 4231 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_16540 6047 4938 gene locus_tag LOCUS_16550 gene rpoD 6047 4938 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_16550 7889 6081 gene locus_tag LOCUS_16560 gene dnaG 7889 6081 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_16560 9051 8044 gene locus_tag LOCUS_16570 9051 8044 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_16570 10051 11130 gene locus_tag LOCUS_16580 10051 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 11192 11620 gene locus_tag LOCUS_16590 11192 11620 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759735.1 protein_id gnl|my_center|LOCUS_16590 11623 12387 gene locus_tag LOCUS_16600 11623 12387 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810589.1 protein_id gnl|my_center|LOCUS_16600 13742 12471 gene locus_tag LOCUS_16610 gene purD 13742 12471 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_16610 14391 13768 gene locus_tag LOCUS_16620 gene purN 14391 13768 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_16620 15410 14385 gene locus_tag LOCUS_16630 gene purM 15410 14385 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_16630 16088 15582 gene locus_tag LOCUS_16640 gene purE 16088 15582 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_16640 18355 16205 gene locus_tag LOCUS_16650 18355 16205 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_16650 20842 18566 gene locus_tag LOCUS_16660 gene lon 20842 18566 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963778.1 protein_id gnl|my_center|LOCUS_16660 21804 21046 gene locus_tag LOCUS_16670 21804 21046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16670 22587 21805 gene locus_tag LOCUS_16680 22587 21805 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016906.1 protein_id gnl|my_center|LOCUS_16680 24189 22609 gene locus_tag LOCUS_16690 24189 22609 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901104.1 protein_id gnl|my_center|LOCUS_16690 25076 24210 gene locus_tag LOCUS_16700 25076 24210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_16700 26017 25073 gene locus_tag LOCUS_16710 26017 25073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_16710 27842 26121 gene locus_tag LOCUS_16720 27842 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 28621 27839 gene locus_tag LOCUS_16730 28621 27839 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_16730 29312 28752 gene locus_tag LOCUS_16740 29312 28752 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_16740 30362 29448 gene locus_tag LOCUS_16750 30362 29448 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_16750 30571 32226 gene locus_tag LOCUS_16760 gene malL 30571 32226 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_16760 33806 32478 gene locus_tag LOCUS_16770 33806 32478 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_16770 34145 35071 gene locus_tag LOCUS_16780 34145 35071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 35252 36610 gene locus_tag LOCUS_16790 35252 36610 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_16790 37843 36689 gene locus_tag LOCUS_16800 37843 36689 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964083.1 protein_id gnl|my_center|LOCUS_16800 38277 37987 gene locus_tag LOCUS_16810 38277 37987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 38823 38380 gene locus_tag LOCUS_16820 38823 38380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence31 750 460 gene locus_tag LOCUS_16830 750 460 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_16830 1307 1966 gene locus_tag LOCUS_16840 1307 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2116 3063 gene locus_tag LOCUS_16850 2116 3063 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_16850 3056 3571 gene locus_tag LOCUS_16860 3056 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4896 3577 gene locus_tag LOCUS_16870 4896 3577 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_16870 5563 4916 gene locus_tag LOCUS_16880 5563 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 6100 5744 gene locus_tag LOCUS_16890 gene rplT 6100 5744 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_16890 6329 6132 gene locus_tag LOCUS_16900 gene rpmI 6329 6132 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_16900 6856 6362 gene locus_tag LOCUS_16910 gene infC 6856 6362 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_16910 7223 7065 gene locus_tag LOCUS_16920 7223 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 7335 7991 gene locus_tag LOCUS_16930 7335 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 8031 9230 gene locus_tag LOCUS_16940 8031 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 9693 9379 gene locus_tag LOCUS_16950 9693 9379 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422812.1 protein_id gnl|my_center|LOCUS_16950 11750 9792 gene locus_tag LOCUS_16960 gene thrS 11750 9792 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_16960 11935 11747 gene locus_tag LOCUS_16970 11935 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 12186 12377 gene locus_tag LOCUS_16980 12186 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 12406 13284 gene locus_tag LOCUS_16990 12406 13284 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_16990 14204 13341 gene locus_tag LOCUS_17000 14204 13341 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966614.1 protein_id gnl|my_center|LOCUS_17000 15427 14237 gene locus_tag LOCUS_17010 15427 14237 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_17010 16307 15414 gene locus_tag LOCUS_17020 gene argB 16307 15414 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_17020 17552 16329 gene locus_tag LOCUS_17030 gene argJ 17552 16329 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 protein_id gnl|my_center|LOCUS_17030 18625 17585 gene locus_tag LOCUS_17040 gene argC 18625 17585 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_17040 18959 20191 gene locus_tag LOCUS_17050 18959 20191 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_17050 20382 23564 gene locus_tag LOCUS_17060 20382 23564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 26030 23649 gene locus_tag LOCUS_17070 26030 23649 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_17070 27651 26416 gene locus_tag LOCUS_17080 gene hflX 27651 26416 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_17080 28703 27666 gene locus_tag LOCUS_17090 28703 27666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 30067 28721 gene locus_tag LOCUS_17100 gene glmM 30067 28721 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_17100 31116 30193 gene locus_tag LOCUS_17110 31116 30193 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_17110 32278 31202 gene locus_tag LOCUS_17120 gene prfA 32278 31202 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_17120 33183 32293 gene locus_tag LOCUS_17130 gene prmC 33183 32293 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_17130 34166 33180 gene locus_tag LOCUS_17140 34166 33180 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_17140 34478 34275 gene locus_tag LOCUS_17150 gene rpmE 34478 34275 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_17150 35923 34616 gene locus_tag LOCUS_17160 35923 34616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 37017 36037 gene locus_tag LOCUS_17170 gene add 37017 36037 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 protein_id gnl|my_center|LOCUS_17170 37496 37044 gene locus_tag LOCUS_17180 37496 37044 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 protein_id gnl|my_center|LOCUS_17180 38288 38443 gene locus_tag LOCUS_17190 38288 38443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence32 1023 145 gene locus_tag LOCUS_17200 1023 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2449 1016 gene locus_tag LOCUS_17210 2449 1016 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_17210 2670 2512 gene locus_tag LOCUS_17220 2670 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3215 2733 gene locus_tag LOCUS_17230 3215 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_17230 3392 3580 gene locus_tag LOCUS_17240 3392 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3577 4554 gene locus_tag LOCUS_17250 3577 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 5885 4551 gene locus_tag LOCUS_17260 5885 4551 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_17260 6379 5936 gene locus_tag LOCUS_17270 6379 5936 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_17270 6613 7239 gene locus_tag LOCUS_17280 6613 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 7243 8124 gene locus_tag LOCUS_17290 7243 8124 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_17290 8121 8906 gene locus_tag LOCUS_17300 8121 8906 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 protein_id gnl|my_center|LOCUS_17300 8936 9055 gene locus_tag LOCUS_17310 8936 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 9547 9119 gene locus_tag LOCUS_17320 9547 9119 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203320.1 protein_id gnl|my_center|LOCUS_17320 9916 9710 gene locus_tag LOCUS_17330 9916 9710 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_17330 10265 9930 gene locus_tag LOCUS_17340 10265 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 11629 10733 gene locus_tag LOCUS_17350 11629 10733 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 protein_id gnl|my_center|LOCUS_17350 12040 11684 gene locus_tag LOCUS_17360 12040 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 12390 12058 gene locus_tag LOCUS_17370 12390 12058 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_17370 12996 12421 gene locus_tag LOCUS_17380 12996 12421 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905072.1 protein_id gnl|my_center|LOCUS_17380 13524 13150 gene locus_tag LOCUS_17390 13524 13150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 14005 13589 gene locus_tag LOCUS_17400 14005 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 14438 14154 gene locus_tag LOCUS_17410 14438 14154 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808731.1 protein_id gnl|my_center|LOCUS_17410 15144 14665 gene locus_tag LOCUS_17420 gene rlmH 15144 14665 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_17420 15599 15153 gene locus_tag LOCUS_17430 15599 15153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837153.1 protein_id gnl|my_center|LOCUS_17430 16284 15559 gene locus_tag LOCUS_17440 16284 15559 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_17440 17859 16465 gene locus_tag LOCUS_17450 gene gltA 17859 16465 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_17450 18746 17859 gene locus_tag LOCUS_17460 18746 17859 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_17460 20000 18858 gene locus_tag LOCUS_17470 20000 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 22474 20051 gene locus_tag LOCUS_17480 22474 20051 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965118.1 protein_id gnl|my_center|LOCUS_17480 23585 22704 gene locus_tag LOCUS_17490 gene uppP 23585 22704 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_17490 24454 23801 gene locus_tag LOCUS_17500 24454 23801 CDS product ClpP family protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965117.1 protein_id gnl|my_center|LOCUS_17500 24621 25091 gene locus_tag LOCUS_17510 24621 25091 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_17510 25911 25183 gene locus_tag LOCUS_17520 25911 25183 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_17520 26354 25998 gene locus_tag LOCUS_17530 gene ndoA 26354 25998 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_17530 27623 26469 gene locus_tag LOCUS_17540 gene alr 27623 26469 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_17540 29194 27641 gene locus_tag LOCUS_17550 29194 27641 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_17550 29939 29277 gene locus_tag LOCUS_17560 29939 29277 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357537.1 protein_id gnl|my_center|LOCUS_17560 30396 30061 gene locus_tag LOCUS_17570 30396 30061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 31126 30386 gene locus_tag LOCUS_17580 31126 30386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 32764 31442 gene locus_tag LOCUS_17590 gene yrkQ 32764 31442 CDS product two-component system sensor histidine kinase YrkQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246194.1 protein_id gnl|my_center|LOCUS_17590 33464 32742 gene locus_tag LOCUS_17600 gene yrkP 33464 32742 CDS product two-component response regulator YrkP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229895.1 protein_id gnl|my_center|LOCUS_17600 34594 33617 gene locus_tag LOCUS_17610 34594 33617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 36167 34581 gene locus_tag LOCUS_17620 36167 34581 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_17620 36397 36170 gene locus_tag LOCUS_17630 36397 36170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence33 173 100 gene locus_tag LOCUS_t00120 173 100 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 364 1431 gene locus_tag LOCUS_17640 364 1431 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681843.1 protein_id gnl|my_center|LOCUS_17640 1584 2774 gene locus_tag LOCUS_17650 1584 2774 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_17650 3888 2899 gene locus_tag LOCUS_17660 3888 2899 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_17660 4678 3980 gene locus_tag LOCUS_17670 4678 3980 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_17670 5253 4675 gene locus_tag LOCUS_17680 5253 4675 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_17680 5974 5282 gene locus_tag LOCUS_17690 5974 5282 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_17690 6321 5971 gene locus_tag LOCUS_17700 6321 5971 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921846.1 protein_id gnl|my_center|LOCUS_17700 7417 6395 gene locus_tag LOCUS_17710 7417 6395 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_17710 8061 7423 gene locus_tag LOCUS_17720 8061 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 8338 8727 gene locus_tag LOCUS_17730 8338 8727 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021349.1 protein_id gnl|my_center|LOCUS_17730 8731 10146 gene locus_tag LOCUS_17740 8731 10146 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387654.1 protein_id gnl|my_center|LOCUS_17740 11305 10148 gene locus_tag LOCUS_17750 11305 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 11720 11298 gene locus_tag LOCUS_17760 11720 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 13016 11919 gene locus_tag LOCUS_17770 13016 11919 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986532.1 protein_id gnl|my_center|LOCUS_17770 13630 13292 gene locus_tag LOCUS_17780 13630 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 13808 13557 gene locus_tag LOCUS_17790 13808 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 14667 13858 gene locus_tag LOCUS_17800 14667 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 15211 14672 gene locus_tag LOCUS_17810 15211 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 15559 15488 gene locus_tag LOCUS_t00130 15559 15488 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 15732 17201 gene locus_tag LOCUS_17820 15732 17201 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17820 17404 18036 gene locus_tag LOCUS_17830 17404 18036 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 protein_id gnl|my_center|LOCUS_17830 20326 18170 gene locus_tag LOCUS_17840 20326 18170 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_17840 22943 20388 gene locus_tag LOCUS_17850 22943 20388 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860737.1 protein_id gnl|my_center|LOCUS_17850 23617 22940 gene locus_tag LOCUS_17860 23617 22940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_17860 24729 23812 gene locus_tag LOCUS_17870 24729 23812 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943877.1 protein_id gnl|my_center|LOCUS_17870 25414 24734 gene locus_tag LOCUS_17880 25414 24734 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459494.1 protein_id gnl|my_center|LOCUS_17880 25611 25985 gene locus_tag LOCUS_17890 25611 25985 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_17890 27391 26057 gene locus_tag LOCUS_17900 27391 26057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871908.1 protein_id gnl|my_center|LOCUS_17900 28231 27395 gene locus_tag LOCUS_17910 28231 27395 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_17910 29080 28253 gene locus_tag LOCUS_17920 29080 28253 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775658.1 protein_id gnl|my_center|LOCUS_17920 29982 29095 gene locus_tag LOCUS_17930 29982 29095 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917288.1 protein_id gnl|my_center|LOCUS_17930 31434 30139 gene locus_tag LOCUS_17940 31434 30139 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836857.1 protein_id gnl|my_center|LOCUS_17940 31664 33499 gene locus_tag LOCUS_17950 31664 33499 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356857.1 protein_id gnl|my_center|LOCUS_17950 33511 35097 gene locus_tag LOCUS_17960 33511 35097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 35398 35168 gene locus_tag LOCUS_17970 35398 35168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 35508 35690 gene locus_tag LOCUS_17980 35508 35690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 35845 35774 gene locus_tag LOCUS_t00140 35845 35774 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 35971 35900 gene locus_tag LOCUS_t00150 35971 35900 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 36081 36008 gene locus_tag LOCUS_t00160 36081 36008 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence34 378 617 gene locus_tag LOCUS_17990 378 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 967 1230 gene locus_tag LOCUS_18000 967 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1243 1716 gene locus_tag LOCUS_18010 1243 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1703 2068 gene locus_tag LOCUS_18020 1703 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3243 2173 gene locus_tag LOCUS_18030 3243 2173 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_18030 3915 3310 gene locus_tag LOCUS_18040 3915 3310 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_18040 6658 4124 gene locus_tag LOCUS_18050 6658 4124 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 protein_id gnl|my_center|LOCUS_18050 7258 6854 gene locus_tag LOCUS_18060 7258 6854 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087637.1 protein_id gnl|my_center|LOCUS_18060 7458 7294 gene locus_tag LOCUS_18070 7458 7294 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_18070 7653 8294 gene locus_tag LOCUS_18080 7653 8294 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787429.1 protein_id gnl|my_center|LOCUS_18080 8406 9767 gene locus_tag LOCUS_18090 8406 9767 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_18090 10037 10561 gene locus_tag LOCUS_18100 10037 10561 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_18100 11637 10606 gene locus_tag LOCUS_18110 11637 10606 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_18110 13223 11658 gene locus_tag LOCUS_18120 13223 11658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 22673 13350 gene locus_tag LOCUS_18130 22673 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 23154 22648 gene locus_tag LOCUS_18140 23154 22648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 23660 23160 gene locus_tag LOCUS_18150 23660 23160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 25443 23635 gene locus_tag LOCUS_18160 25443 23635 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963726.1 protein_id gnl|my_center|LOCUS_18160 26221 25454 gene locus_tag LOCUS_18170 26221 25454 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_18170 27785 26226 gene locus_tag LOCUS_18180 27785 26226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 28026 29426 gene locus_tag LOCUS_18190 28026 29426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 29678 30295 gene locus_tag LOCUS_18200 29678 30295 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213184.1 protein_id gnl|my_center|LOCUS_18200 30898 30368 gene locus_tag LOCUS_18210 30898 30368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 31186 30929 gene locus_tag LOCUS_18220 31186 30929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 31707 33002 gene locus_tag LOCUS_18230 31707 33002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 33004 33990 gene locus_tag LOCUS_18240 33004 33990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 34178 35527 gene locus_tag LOCUS_18250 34178 35527 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356594.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence35 1412 4042 gene locus_tag LOCUS_18260 gene ppdK 1412 4042 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_18260 4150 3974 gene locus_tag LOCUS_18270 4150 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4276 4722 gene locus_tag LOCUS_18280 4276 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 4741 7362 gene locus_tag LOCUS_18290 4741 7362 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_18290 9350 7527 gene locus_tag LOCUS_18300 9350 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 9560 10507 gene locus_tag LOCUS_18310 9560 10507 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263651.1 protein_id gnl|my_center|LOCUS_18310 10523 11866 gene locus_tag LOCUS_18320 10523 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 11949 12827 gene locus_tag LOCUS_18330 11949 12827 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548142.1 protein_id gnl|my_center|LOCUS_18330 12824 13663 gene locus_tag LOCUS_18340 12824 13663 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775658.1 protein_id gnl|my_center|LOCUS_18340 13721 15241 gene locus_tag LOCUS_18350 13721 15241 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_18350 15261 16574 gene locus_tag LOCUS_18360 15261 16574 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_18360 16631 17959 gene locus_tag LOCUS_18370 gene pepV 16631 17959 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016277.1 protein_id gnl|my_center|LOCUS_18370 17974 18894 gene locus_tag LOCUS_18380 17974 18894 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_18380 19955 20327 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcaccttccgcgaggaaggtgtggattgaaat 20637 20990 gene locus_tag LOCUS_18390 20637 20990 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_18390 21031 21357 gene locus_tag LOCUS_18400 21031 21357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 21416 23992 gene locus_tag LOCUS_18410 21416 23992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 23989 25023 gene locus_tag LOCUS_18420 gene mcrC 23989 25023 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_18420 25093 25632 gene locus_tag LOCUS_18430 25093 25632 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_18430 25645 28629 gene locus_tag LOCUS_18440 25645 28629 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203068.1 protein_id gnl|my_center|LOCUS_18440 29212 28631 gene locus_tag LOCUS_18450 29212 28631 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808295.1 protein_id gnl|my_center|LOCUS_18450 29397 30281 gene locus_tag LOCUS_18460 29397 30281 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_18460 30622 32244 gene locus_tag LOCUS_18470 30622 32244 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_18470 32308 32937 gene locus_tag LOCUS_18480 32308 32937 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_18480 33153 33887 gene locus_tag LOCUS_18490 gene azlC 33153 33887 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_18490 33940 34266 gene locus_tag LOCUS_18500 gene azlD 33940 34266 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence36 1058 183 gene locus_tag LOCUS_18510 1058 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2525 1236 gene locus_tag LOCUS_18520 gene serS 2525 1236 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_18520 3467 2958 gene locus_tag LOCUS_18530 3467 2958 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398925.1 protein_id gnl|my_center|LOCUS_18530 4414 3482 gene locus_tag LOCUS_18540 4414 3482 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_18540 5190 4405 gene locus_tag LOCUS_18550 5190 4405 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_18550 5602 6555 gene locus_tag LOCUS_18560 5602 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 7495 8838 gene locus_tag LOCUS_18570 7495 8838 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_18570 8854 10191 gene locus_tag LOCUS_18580 8854 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 11856 10276 gene locus_tag LOCUS_18590 11856 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 13340 11856 gene locus_tag LOCUS_18600 13340 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 14215 13352 gene locus_tag LOCUS_18610 14215 13352 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679924.1 protein_id gnl|my_center|LOCUS_18610 15353 14199 gene locus_tag LOCUS_18620 15353 14199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_18620 16161 15847 gene locus_tag LOCUS_18630 16161 15847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 16499 16158 gene locus_tag LOCUS_18640 16499 16158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 17245 16520 gene locus_tag LOCUS_18650 gene rsmG 17245 16520 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722161.1 protein_id gnl|my_center|LOCUS_18650 19196 17265 gene locus_tag LOCUS_18660 gene mnmG 19196 17265 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_18660 20588 19212 gene locus_tag LOCUS_18670 gene mnmE 20588 19212 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 protein_id gnl|my_center|LOCUS_18670 21632 20700 gene locus_tag LOCUS_18680 21632 20700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 22938 21646 gene locus_tag LOCUS_18690 22938 21646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 23606 23259 gene locus_tag LOCUS_18700 gene rnpA 23606 23259 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_18700 24464 25810 gene locus_tag LOCUS_18710 gene dnaA 24464 25810 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_18710 26103 27212 gene locus_tag LOCUS_18720 gene dnaN 26103 27212 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_18720 27244 27453 gene locus_tag LOCUS_18730 27244 27453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 27540 28634 gene locus_tag LOCUS_18740 gene recF 27540 28634 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_18740 28677 30590 gene locus_tag LOCUS_18750 gene gyrB 28677 30590 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_18750 30644 33127 gene locus_tag LOCUS_18760 gene gyrA 30644 33127 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_18760 33276 34127 gene locus_tag LOCUS_18770 33276 34127 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_18770 34171 34725 gene locus_tag LOCUS_18780 34171 34725 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_18780 34722 35441 gene locus_tag LOCUS_18790 34722 35441 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_18790 35614 35702 gene locus_tag LOCUS_t00170 35614 35702 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence37 83 2725 gene locus_tag LOCUS_18800 83 2725 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808183.1 protein_id gnl|my_center|LOCUS_18800 3772 2828 gene locus_tag LOCUS_18810 3772 2828 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_18810 4708 3776 gene locus_tag LOCUS_18820 gene hprK 4708 3776 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_18820 6734 4869 gene locus_tag LOCUS_18830 gene uvrC 6734 4869 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_18830 8849 6858 gene locus_tag LOCUS_18840 gene ftsH 8849 6858 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_18840 9046 10527 gene locus_tag LOCUS_18850 9046 10527 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_18850 11717 10695 gene locus_tag LOCUS_18860 gene galE 11717 10695 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_18860 13450 11882 gene locus_tag LOCUS_18870 13450 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990774.1 protein_id gnl|my_center|LOCUS_18870 14150 13443 gene locus_tag LOCUS_18880 14150 13443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021134.1 protein_id gnl|my_center|LOCUS_18880 14601 14242 gene locus_tag LOCUS_18890 14601 14242 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288776.1 protein_id gnl|my_center|LOCUS_18890 15082 14666 gene locus_tag LOCUS_18900 15082 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 16478 15483 gene locus_tag LOCUS_18910 16478 15483 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_18910 17430 16618 gene locus_tag LOCUS_18920 17430 16618 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893097.1 protein_id gnl|my_center|LOCUS_18920 17824 18477 gene locus_tag LOCUS_18930 17824 18477 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_18930 19004 18576 gene locus_tag LOCUS_18940 19004 18576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943965.1 protein_id gnl|my_center|LOCUS_18940 19925 19275 gene locus_tag LOCUS_18950 gene lacA 19925 19275 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301800.1 protein_id gnl|my_center|LOCUS_18950 21046 20066 gene locus_tag LOCUS_18960 21046 20066 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723973.1 protein_id gnl|my_center|LOCUS_18960 21592 21089 gene locus_tag LOCUS_18970 gene greA 21592 21089 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 protein_id gnl|my_center|LOCUS_18970 22636 21620 gene locus_tag LOCUS_18980 22636 21620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 24096 22747 gene locus_tag LOCUS_18990 24096 22747 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_18990 24942 24112 gene locus_tag LOCUS_19000 24942 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 26606 25119 gene locus_tag LOCUS_19010 26606 25119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 29390 26610 gene locus_tag LOCUS_19020 29390 26610 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_19020 32079 29794 gene locus_tag LOCUS_19030 32079 29794 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438236.1 protein_id gnl|my_center|LOCUS_19030 32282 32076 gene locus_tag LOCUS_19040 32282 32076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 33021 32407 gene locus_tag LOCUS_19050 33021 32407 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence38 111 824 gene locus_tag LOCUS_19060 111 824 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_19060 921 1340 gene locus_tag LOCUS_19070 921 1340 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642574.1 protein_id gnl|my_center|LOCUS_19070 1318 2217 gene locus_tag LOCUS_19080 1318 2217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948845.1 protein_id gnl|my_center|LOCUS_19080 2214 2948 gene locus_tag LOCUS_19090 2214 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3260 3051 gene locus_tag LOCUS_19100 3260 3051 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_19100 3880 3257 gene locus_tag LOCUS_19110 3880 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3933 4109 gene locus_tag LOCUS_19120 3933 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4578 7178 gene locus_tag LOCUS_19130 gene clpB 4578 7178 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_19130 7314 7487 gene locus_tag LOCUS_19140 7314 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 7674 8249 gene locus_tag LOCUS_19150 7674 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 8443 8877 gene locus_tag LOCUS_19160 8443 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 8963 10168 gene locus_tag LOCUS_19170 8963 10168 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_19170 10183 10356 gene locus_tag LOCUS_19180 10183 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 10371 11051 gene locus_tag LOCUS_19190 10371 11051 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_19190 11117 12322 gene locus_tag LOCUS_19200 11117 12322 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419704.1 protein_id gnl|my_center|LOCUS_19200 12341 13072 gene locus_tag LOCUS_19210 gene pxpB 12341 13072 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_19210 13249 13992 gene locus_tag LOCUS_19220 13249 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_19220 14033 15046 gene locus_tag LOCUS_19230 14033 15046 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_19230 15245 15673 gene locus_tag LOCUS_19240 15245 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 15686 17032 gene locus_tag LOCUS_19250 15686 17032 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_19250 17058 17828 gene locus_tag LOCUS_19260 17058 17828 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896287.1 protein_id gnl|my_center|LOCUS_19260 18228 19517 gene locus_tag LOCUS_19270 18228 19517 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431480.1 protein_id gnl|my_center|LOCUS_19270 19534 20592 gene locus_tag LOCUS_19280 19534 20592 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094661859.1 protein_id gnl|my_center|LOCUS_19280 20689 22554 gene locus_tag LOCUS_19290 20689 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 22551 24080 gene locus_tag LOCUS_19300 22551 24080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 24077 25318 gene locus_tag LOCUS_19310 24077 25318 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383844.1 protein_id gnl|my_center|LOCUS_19310 25513 26955 gene locus_tag LOCUS_19320 25513 26955 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805138.1 protein_id gnl|my_center|LOCUS_19320 27067 27969 gene locus_tag LOCUS_19330 27067 27969 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_19330 27986 28807 gene locus_tag LOCUS_19340 27986 28807 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973570.1 protein_id gnl|my_center|LOCUS_19340 28989 32132 gene locus_tag LOCUS_19350 28989 32132 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_19350 32329 32460 gene locus_tag LOCUS_19360 32329 32460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence39 4240 1199 gene locus_tag LOCUS_19370 4240 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 5528 4689 gene locus_tag LOCUS_19380 gene xerD 5528 4689 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_19380 7647 5833 gene locus_tag LOCUS_19390 gene lepA 7647 5833 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_19390 9212 7731 gene locus_tag LOCUS_19400 9212 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 10377 9454 gene locus_tag LOCUS_19410 gene gpr 10377 9454 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_19410 10644 10438 gene locus_tag LOCUS_19420 10644 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 11572 11835 gene locus_tag LOCUS_19430 gene rpsT 11572 11835 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_19430 13052 12069 gene locus_tag LOCUS_19440 gene holA 13052 12069 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_19440 15586 13265 gene locus_tag LOCUS_19450 15586 13265 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888489.1 protein_id gnl|my_center|LOCUS_19450 16494 15583 gene locus_tag LOCUS_19460 16494 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 17999 16569 gene locus_tag LOCUS_19470 17999 16569 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172635924.1 protein_id gnl|my_center|LOCUS_19470 18707 18018 gene locus_tag LOCUS_19480 gene yycF 18707 18018 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_19480 19504 18719 gene locus_tag LOCUS_19490 19504 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 20062 19616 gene locus_tag LOCUS_19500 20062 19616 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_19500 20850 20227 gene locus_tag LOCUS_19510 20850 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 22082 20877 gene locus_tag LOCUS_19520 22082 20877 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_19520 23482 22262 gene locus_tag LOCUS_19530 23482 22262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 24366 23497 gene locus_tag LOCUS_19540 24366 23497 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_19540 24829 24386 gene locus_tag LOCUS_19550 24829 24386 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_19550 25642 24863 gene locus_tag LOCUS_19560 25642 24863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 26530 25853 gene locus_tag LOCUS_19570 26530 25853 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_19570 26630 27304 gene locus_tag LOCUS_19580 26630 27304 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_19580 29053 27440 gene locus_tag LOCUS_19590 29053 27440 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_19590 29204 29007 gene locus_tag LOCUS_19600 29204 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 29994 29254 gene locus_tag LOCUS_19610 29994 29254 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_19610 30878 29994 gene locus_tag LOCUS_19620 30878 29994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence40 1061 171 gene locus_tag LOCUS_19630 1061 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2455 1208 gene locus_tag LOCUS_19640 2455 1208 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385467.1 protein_id gnl|my_center|LOCUS_19640 3117 2566 gene locus_tag LOCUS_19650 3117 2566 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437817.1 protein_id gnl|my_center|LOCUS_19650 3316 3095 gene locus_tag LOCUS_19660 3316 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4185 3337 gene locus_tag LOCUS_19670 gene proB 4185 3337 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_19670 4605 4291 gene locus_tag LOCUS_19680 4605 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5895 4669 gene locus_tag LOCUS_19690 5895 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 6403 5909 gene locus_tag LOCUS_19700 gene ybeY 6403 5909 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_19700 7422 6400 gene locus_tag LOCUS_19710 7422 6400 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_19710 8201 7611 gene locus_tag LOCUS_19720 8201 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 8912 8226 gene locus_tag LOCUS_19730 8912 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 10472 9030 gene locus_tag LOCUS_19740 10472 9030 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972982.1 protein_id gnl|my_center|LOCUS_19740 11329 10553 gene locus_tag LOCUS_19750 11329 10553 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_19750 12098 11313 gene locus_tag LOCUS_19760 12098 11313 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_19760 13082 12117 gene locus_tag LOCUS_19770 13082 12117 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837379.1 protein_id gnl|my_center|LOCUS_19770 14468 13233 gene locus_tag LOCUS_19780 14468 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 14811 14530 gene locus_tag LOCUS_19790 14811 14530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 14968 16317 gene locus_tag LOCUS_19800 14968 16317 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_19800 16898 16359 gene locus_tag LOCUS_19810 16898 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 17450 16905 gene locus_tag LOCUS_19820 17450 16905 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143549.1 protein_id gnl|my_center|LOCUS_19820 18004 17534 gene locus_tag LOCUS_19830 18004 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 19546 18050 gene locus_tag LOCUS_19840 19546 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 21096 19543 gene locus_tag LOCUS_19850 21096 19543 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461578.1 protein_id gnl|my_center|LOCUS_19850 23057 21303 gene locus_tag LOCUS_19860 23057 21303 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_19860 24889 23051 gene locus_tag LOCUS_19870 24889 23051 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_19870 25242 25916 gene locus_tag LOCUS_19880 25242 25916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 27143 25959 gene locus_tag LOCUS_19890 27143 25959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 27843 27136 gene locus_tag LOCUS_19900 27843 27136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 28568 27834 gene locus_tag LOCUS_19910 28568 27834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810595.1 protein_id gnl|my_center|LOCUS_19910 29071 28565 gene locus_tag LOCUS_19920 29071 28565 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_19920 29180 29689 gene locus_tag LOCUS_19930 29180 29689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 29873 30688 gene locus_tag LOCUS_19940 gene pdaA 29873 30688 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence41 930 82 gene locus_tag LOCUS_19950 930 82 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_19950 1811 930 gene locus_tag LOCUS_19960 1811 930 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_19960 3128 1830 gene locus_tag LOCUS_19970 3128 1830 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776454.1 protein_id gnl|my_center|LOCUS_19970 4526 3510 gene locus_tag LOCUS_19980 4526 3510 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_19980 6038 4722 gene locus_tag LOCUS_19990 gene hydF 6038 4722 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925770.1 protein_id gnl|my_center|LOCUS_19990 7471 6053 gene locus_tag LOCUS_20000 gene hydG 7471 6053 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_20000 8624 7563 gene locus_tag LOCUS_20010 gene hydE 8624 7563 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_20010 8893 8621 gene locus_tag LOCUS_20020 8893 8621 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_20020 9777 10694 gene locus_tag LOCUS_20030 9777 10694 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674458.1 protein_id gnl|my_center|LOCUS_20030 12070 10700 gene locus_tag LOCUS_20040 12070 10700 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_20040 13302 12109 gene locus_tag LOCUS_20050 13302 12109 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_20050 13898 13299 gene locus_tag LOCUS_20060 13898 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 14164 13901 gene locus_tag LOCUS_20070 14164 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 15691 14204 gene locus_tag LOCUS_20080 15691 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 15920 16282 gene locus_tag LOCUS_20090 15920 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 17748 16342 gene locus_tag LOCUS_20100 17748 16342 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_20100 19483 17813 gene locus_tag LOCUS_20110 19483 17813 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_20110 21497 19674 gene locus_tag LOCUS_20120 gene ftsH 21497 19674 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_20120 22262 21696 gene locus_tag LOCUS_20130 22262 21696 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902004.1 protein_id gnl|my_center|LOCUS_20130 22599 23519 gene locus_tag LOCUS_20140 gene nadA 22599 23519 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 protein_id gnl|my_center|LOCUS_20140 23522 24979 gene locus_tag LOCUS_20150 23522 24979 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_20150 24861 25718 gene locus_tag LOCUS_20160 gene nadC 24861 25718 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454666.1 protein_id gnl|my_center|LOCUS_20160 25739 26251 gene locus_tag LOCUS_20170 25739 26251 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_20170 27721 26354 gene locus_tag LOCUS_20180 27721 26354 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_20180 28898 27669 gene locus_tag LOCUS_20190 28898 27669 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_20190 29848 28973 gene locus_tag LOCUS_20200 29848 28973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence42 929 336 gene locus_tag LOCUS_20210 929 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1529 5230 gene locus_tag LOCUS_20220 gene addA 1529 5230 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_20220 6276 6692 gene locus_tag LOCUS_20230 6276 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 6696 7709 gene locus_tag LOCUS_20240 6696 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 7706 8560 gene locus_tag LOCUS_20250 7706 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 8575 8757 gene locus_tag LOCUS_20260 8575 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 8819 9007 gene locus_tag LOCUS_20270 8819 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 9661 9047 gene locus_tag LOCUS_20280 9661 9047 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_20280 9779 10180 gene locus_tag LOCUS_20290 9779 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 11291 10143 gene locus_tag LOCUS_20300 11291 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674815.1 protein_id gnl|my_center|LOCUS_20300 11493 11326 gene locus_tag LOCUS_20310 11493 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 13598 11895 gene locus_tag LOCUS_20320 13598 11895 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_20320 13871 14338 gene locus_tag LOCUS_20330 13871 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 14504 14740 gene locus_tag LOCUS_20340 14504 14740 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816044.1 protein_id gnl|my_center|LOCUS_20340 15937 14855 gene locus_tag LOCUS_20350 15937 14855 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_20350 16289 17209 gene locus_tag LOCUS_20360 gene proC 16289 17209 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041291.1 protein_id gnl|my_center|LOCUS_20360 17649 17338 gene locus_tag LOCUS_20370 17649 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 17823 18380 gene locus_tag LOCUS_20380 17823 18380 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_20380 18485 19777 gene locus_tag LOCUS_20390 gene tig 18485 19777 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_20390 19862 20443 gene locus_tag LOCUS_20400 gene clpP 19862 20443 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_20400 20566 21858 gene locus_tag LOCUS_20410 gene clpX 20566 21858 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_20410 21876 24191 gene locus_tag LOCUS_20420 gene lon 21876 24191 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_20420 24342 24974 gene locus_tag LOCUS_20430 gene yihA 24342 24974 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_20430 25273 27081 gene locus_tag LOCUS_20440 25273 27081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_20440 27075 27878 gene locus_tag LOCUS_20450 27075 27878 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_20450 27933 28751 gene locus_tag LOCUS_20460 gene truA 27933 28751 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_20460 28894 29322 gene locus_tag LOCUS_20470 gene rplM 28894 29322 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence43 1369 398 gene locus_tag LOCUS_20480 1369 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1595 2350 gene locus_tag LOCUS_20490 1595 2350 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532200.1 protein_id gnl|my_center|LOCUS_20490 2675 2421 gene locus_tag LOCUS_20500 2675 2421 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250307.1 protein_id gnl|my_center|LOCUS_20500 3633 2668 gene locus_tag LOCUS_20510 gene whiA 3633 2668 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_20510 4529 3645 gene locus_tag LOCUS_20520 gene rapZ 4529 3645 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_20520 5562 4651 gene locus_tag LOCUS_20530 gene murB 5562 4651 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_20530 6303 5575 gene locus_tag LOCUS_20540 6303 5575 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_20540 6731 6375 gene locus_tag LOCUS_20550 gene spoVAE 6731 6375 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418423.1 protein_id gnl|my_center|LOCUS_20550 7771 6731 gene locus_tag LOCUS_20560 gene spoVAD 7771 6731 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_20560 8232 7768 gene locus_tag LOCUS_20570 gene spoVAC 8232 7768 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_20570 8661 8233 gene locus_tag LOCUS_20580 8661 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 9301 8681 gene locus_tag LOCUS_20590 9301 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 9446 9294 gene locus_tag LOCUS_20600 9446 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 10302 9589 gene locus_tag LOCUS_20610 gene sigF 10302 9589 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_20610 10793 10350 gene locus_tag LOCUS_20620 gene spoIIAB 10793 10350 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_20620 11141 10809 gene locus_tag LOCUS_20630 gene spoIIAA 11141 10809 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_20630 12900 11263 gene locus_tag LOCUS_20640 12900 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 13069 12920 gene locus_tag LOCUS_20650 13069 12920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 14412 13102 gene locus_tag LOCUS_20660 14412 13102 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_20660 14563 14402 gene locus_tag LOCUS_20670 14563 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 17051 14850 gene locus_tag LOCUS_20680 17051 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 19788 17128 gene locus_tag LOCUS_20690 19788 17128 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_20690 23800 20237 gene locus_tag LOCUS_20700 23800 20237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 26921 23844 gene locus_tag LOCUS_20710 26921 23844 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_20710 <29245 27029 gene locus_tag LOCUS_20720 <29245 27029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971690.1:glycoside hydrolase family 2 protein >Feature sequence44 13 3153 gene locus_tag LOCUS_20730 gene ileS 13 3153 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_20730 3274 5733 gene locus_tag LOCUS_20740 3274 5733 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_20740 6381 7118 gene locus_tag LOCUS_20750 gene cas6 6381 7118 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016969.1 protein_id gnl|my_center|LOCUS_20750 7138 8514 gene locus_tag LOCUS_20760 gene cas8a1 7138 8514 CDS product type I CRISPR-associated protein Cas8a1/Csx8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016968.1 protein_id gnl|my_center|LOCUS_20760 8517 9401 gene locus_tag LOCUS_20770 gene cas7i 8517 9401 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016967.1 protein_id gnl|my_center|LOCUS_20770 9423 10499 gene locus_tag LOCUS_20780 gene cas5 9423 10499 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779469.1 protein_id gnl|my_center|LOCUS_20780 10566 12815 gene locus_tag LOCUS_20790 10566 12815 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016965.1 protein_id gnl|my_center|LOCUS_20790 12836 13330 gene locus_tag LOCUS_20800 gene cas4 12836 13330 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_20800 13376 14368 gene locus_tag LOCUS_20810 gene cas1b 13376 14368 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_20810 14381 14659 gene locus_tag LOCUS_20820 gene cas2 14381 14659 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_20820 14835 15517 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttaagtagaagcatattggaatgtaaag 16203 17390 gene locus_tag LOCUS_20830 gene metK 16203 17390 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_20830 17669 19162 gene locus_tag LOCUS_20840 17669 19162 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_20840 19155 19844 gene locus_tag LOCUS_20850 19155 19844 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_20850 19935 20525 gene locus_tag LOCUS_20860 19935 20525 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_20860 20581 21570 gene locus_tag LOCUS_20870 20581 21570 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_20870 21572 22438 gene locus_tag LOCUS_20880 21572 22438 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_20880 22431 23177 gene locus_tag LOCUS_20890 22431 23177 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_20890 23288 24148 gene locus_tag LOCUS_20900 gene rsmI 23288 24148 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_20900 26112 24202 gene locus_tag LOCUS_20910 26112 24202 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251419.1 protein_id gnl|my_center|LOCUS_20910 26342 27532 gene locus_tag LOCUS_20920 26342 27532 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_20920 27570 28142 gene locus_tag LOCUS_20930 27570 28142 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963355.1 protein_id gnl|my_center|LOCUS_20930 28524 28327 gene locus_tag LOCUS_20940 28524 28327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence45 17 805 gene locus_tag LOCUS_20950 17 805 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965836.1 protein_id gnl|my_center|LOCUS_20950 819 2009 gene locus_tag LOCUS_20960 819 2009 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 protein_id gnl|my_center|LOCUS_20960 2014 3432 gene locus_tag LOCUS_20970 2014 3432 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 protein_id gnl|my_center|LOCUS_20970 3457 4635 gene locus_tag LOCUS_20980 3457 4635 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048234.1 protein_id gnl|my_center|LOCUS_20980 4833 4906 gene locus_tag LOCUS_t00180 4833 4906 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4986 5714 gene locus_tag LOCUS_20990 4986 5714 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_20990 5777 6616 gene locus_tag LOCUS_21000 5777 6616 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_21000 6896 7492 gene locus_tag LOCUS_21010 6896 7492 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071613.1 protein_id gnl|my_center|LOCUS_21010 7687 11163 gene locus_tag LOCUS_21020 7687 11163 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_21020 11232 12218 gene locus_tag LOCUS_21030 gene pfkA 11232 12218 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_21030 12413 13195 gene locus_tag LOCUS_21040 12413 13195 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_21040 13424 14899 gene locus_tag LOCUS_21050 13424 14899 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296829.1 protein_id gnl|my_center|LOCUS_21050 15184 16191 gene locus_tag LOCUS_21060 15184 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 16470 16898 gene locus_tag LOCUS_21070 16470 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 16909 17832 gene locus_tag LOCUS_21080 16909 17832 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_21080 17993 19159 gene locus_tag LOCUS_21090 17993 19159 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_21090 19213 20202 gene locus_tag LOCUS_21100 gene argF 19213 20202 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_21100 20206 21195 gene locus_tag LOCUS_21110 20206 21195 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_21110 21207 21557 gene locus_tag LOCUS_21120 21207 21557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 21554 22513 gene locus_tag LOCUS_21130 gene dusB 21554 22513 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_21130 22765 23247 gene locus_tag LOCUS_21140 gene greA 22765 23247 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_21140 23276 25249 gene locus_tag LOCUS_21150 23276 25249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 25512 25742 gene locus_tag LOCUS_21160 25512 25742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 25862 26059 gene locus_tag LOCUS_21170 25862 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 26077 26616 gene locus_tag LOCUS_21180 26077 26616 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_21180 26656 26892 gene locus_tag LOCUS_21190 26656 26892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 26928 27794 gene locus_tag LOCUS_21200 26928 27794 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_21200 27988 28146 gene locus_tag LOCUS_21210 27988 28146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence46 710 2005 gene locus_tag LOCUS_21220 710 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2133 3014 gene locus_tag LOCUS_21230 2133 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3033 3953 gene locus_tag LOCUS_21240 3033 3953 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975882.1 protein_id gnl|my_center|LOCUS_21240 4178 4336 gene locus_tag LOCUS_21250 4178 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4359 5774 gene locus_tag LOCUS_21260 4359 5774 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975884.1 protein_id gnl|my_center|LOCUS_21260 5862 6749 gene locus_tag LOCUS_21270 5862 6749 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971641.1 protein_id gnl|my_center|LOCUS_21270 6750 7574 gene locus_tag LOCUS_21280 6750 7574 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_21280 7579 8601 gene locus_tag LOCUS_21290 7579 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 8731 10530 gene locus_tag LOCUS_21300 8731 10530 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_21300 10627 11022 gene locus_tag LOCUS_21310 10627 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 11072 11395 gene locus_tag LOCUS_21320 11072 11395 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723189.1 protein_id gnl|my_center|LOCUS_21320 11430 12332 gene locus_tag LOCUS_21330 11430 12332 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201948.1 protein_id gnl|my_center|LOCUS_21330 12348 13718 gene locus_tag LOCUS_21340 12348 13718 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_21340 13730 14365 gene locus_tag LOCUS_21350 13730 14365 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986661.1 protein_id gnl|my_center|LOCUS_21350 14434 14658 gene locus_tag LOCUS_21360 14434 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 14556 16478 gene locus_tag LOCUS_21370 14556 16478 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_21370 16560 18581 gene locus_tag LOCUS_21380 16560 18581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 18899 19771 gene locus_tag LOCUS_21390 18899 19771 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837152.1 protein_id gnl|my_center|LOCUS_21390 21854 20187 gene locus_tag LOCUS_21400 gene cydC 21854 20187 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_21400 23655 21847 gene locus_tag LOCUS_21410 23655 21847 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_21410 24405 23725 gene locus_tag LOCUS_21420 24405 23725 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906063.1 protein_id gnl|my_center|LOCUS_21420 25377 24493 gene locus_tag LOCUS_21430 25377 24493 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_21430 25484 26776 gene locus_tag LOCUS_21440 gene galK 25484 26776 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence47 79 606 gene locus_tag LOCUS_21450 79 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1810 680 gene locus_tag LOCUS_21460 1810 680 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_21460 2742 2047 gene locus_tag LOCUS_21470 2742 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4005 2761 gene locus_tag LOCUS_21480 4005 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5570 4113 gene locus_tag LOCUS_21490 5570 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 6303 6169 gene locus_tag LOCUS_21500 6303 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 7115 6372 gene locus_tag LOCUS_21510 7115 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 8108 7167 gene locus_tag LOCUS_21520 8108 7167 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_21520 9097 8096 gene locus_tag LOCUS_21530 9097 8096 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_21530 9892 9239 gene locus_tag LOCUS_21540 gene fsa 9892 9239 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_21540 11326 10223 gene locus_tag LOCUS_21550 gene degA 11326 10223 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_21550 11500 12132 gene locus_tag LOCUS_21560 11500 12132 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861580.1 protein_id gnl|my_center|LOCUS_21560 14312 12252 gene locus_tag LOCUS_21570 14312 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 14800 14309 gene locus_tag LOCUS_21580 14800 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 15695 15477 gene locus_tag LOCUS_21590 15695 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 16919 15795 gene locus_tag LOCUS_21600 16919 15795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 17989 17024 gene locus_tag LOCUS_21610 17989 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 19418 18294 gene locus_tag LOCUS_21620 19418 18294 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_21620 20290 19445 gene locus_tag LOCUS_21630 20290 19445 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128442.1 protein_id gnl|my_center|LOCUS_21630 21462 20293 gene locus_tag LOCUS_21640 21462 20293 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272496.1 protein_id gnl|my_center|LOCUS_21640 24280 21467 gene locus_tag LOCUS_21650 24280 21467 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_21650 24975 24277 gene locus_tag LOCUS_21660 24975 24277 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 protein_id gnl|my_center|LOCUS_21660 26535 25201 gene locus_tag LOCUS_21670 26535 25201 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence48 606 229 gene locus_tag LOCUS_21680 606 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 1594 599 gene locus_tag LOCUS_21690 1594 599 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_21690 2619 1591 gene locus_tag LOCUS_21700 2619 1591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966892.1 protein_id gnl|my_center|LOCUS_21700 3628 2654 gene locus_tag LOCUS_21710 3628 2654 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048146.1 protein_id gnl|my_center|LOCUS_21710 4606 3647 gene locus_tag LOCUS_21720 4606 3647 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566243.1 protein_id gnl|my_center|LOCUS_21720 6456 4708 gene locus_tag LOCUS_21730 6456 4708 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595071.1 protein_id gnl|my_center|LOCUS_21730 6928 8202 gene locus_tag LOCUS_21740 6928 8202 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_21740 8293 8919 gene locus_tag LOCUS_21750 8293 8919 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680289.1 protein_id gnl|my_center|LOCUS_21750 10380 9133 gene locus_tag LOCUS_21760 10380 9133 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_21760 12651 10459 gene locus_tag LOCUS_21770 12651 10459 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019639497.1 protein_id gnl|my_center|LOCUS_21770 13074 12652 gene locus_tag LOCUS_21780 13074 12652 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_21780 13729 13049 gene locus_tag LOCUS_21790 13729 13049 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_21790 15624 14464 gene locus_tag LOCUS_21800 15624 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 16437 15667 gene locus_tag LOCUS_21810 16437 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 16898 16470 gene locus_tag LOCUS_21820 16898 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 17616 16900 gene locus_tag LOCUS_21830 17616 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 19510 17639 gene locus_tag LOCUS_21840 19510 17639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 20283 19531 gene locus_tag LOCUS_21850 20283 19531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 22274 20307 gene locus_tag LOCUS_21860 22274 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 23014 22280 gene locus_tag LOCUS_21870 23014 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 24438 23140 gene locus_tag LOCUS_21880 24438 23140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 25705 24503 gene locus_tag LOCUS_21890 25705 24503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 26414 25806 gene locus_tag LOCUS_21900 26414 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence49 1578 2525 gene locus_tag LOCUS_21910 1578 2525 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898522.1 protein_id gnl|my_center|LOCUS_21910 2764 3177 gene locus_tag LOCUS_21920 2764 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 3322 4302 gene locus_tag LOCUS_21930 gene bsh 3322 4302 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_21930 4465 5478 gene locus_tag LOCUS_21940 gene iolG 4465 5478 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102250.1 protein_id gnl|my_center|LOCUS_21940 6027 6380 gene locus_tag LOCUS_21950 6027 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 6478 7485 gene locus_tag LOCUS_21960 6478 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 8493 8612 gene locus_tag LOCUS_21970 8493 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 8924 9946 gene locus_tag LOCUS_21980 8924 9946 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948809.1 protein_id gnl|my_center|LOCUS_21980 9970 10881 gene locus_tag LOCUS_21990 9970 10881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_21990 10874 11647 gene locus_tag LOCUS_22000 10874 11647 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_22000 12631 11738 gene locus_tag LOCUS_22010 12631 11738 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_22010 13112 14266 gene locus_tag LOCUS_22020 13112 14266 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_22020 14299 16380 gene locus_tag LOCUS_22030 14299 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 16469 17992 gene locus_tag LOCUS_22040 16469 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 18062 18754 gene locus_tag LOCUS_22050 18062 18754 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_22050 19340 18819 gene locus_tag LOCUS_22060 19340 18819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 19840 20307 gene locus_tag LOCUS_22070 19840 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 20520 20669 gene locus_tag LOCUS_22080 20520 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 20721 21221 gene locus_tag LOCUS_22090 gene tadA 20721 21221 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_22090 21277 22419 gene locus_tag LOCUS_22100 21277 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 22662 22752 gene locus_tag LOCUS_t00190 22662 22752 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23013 23198 gene locus_tag LOCUS_22110 23013 23198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 23156 23566 gene locus_tag LOCUS_22120 23156 23566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 23672 26023 gene locus_tag LOCUS_22130 23672 26023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence50 167 613 gene locus_tag LOCUS_22140 167 613 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_22140 731 1639 gene locus_tag LOCUS_22150 731 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1887 3779 gene locus_tag LOCUS_22160 gene cooS 1887 3779 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860935.1 protein_id gnl|my_center|LOCUS_22160 4840 3815 gene locus_tag LOCUS_22170 4840 3815 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_22170 5710 5009 gene locus_tag LOCUS_22180 5710 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 5893 6273 gene locus_tag LOCUS_22190 5893 6273 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379711.1 protein_id gnl|my_center|LOCUS_22190 7291 6437 gene locus_tag LOCUS_22200 7291 6437 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889099.1 protein_id gnl|my_center|LOCUS_22200 7460 7720 gene locus_tag LOCUS_22210 7460 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 7743 9146 gene locus_tag LOCUS_22220 7743 9146 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_22220 9282 11180 gene locus_tag LOCUS_22230 9282 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 11202 13574 gene locus_tag LOCUS_22240 11202 13574 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_22240 13783 16332 gene locus_tag LOCUS_22250 13783 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 16477 18108 gene locus_tag LOCUS_22260 16477 18108 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_22260 18256 19074 gene locus_tag LOCUS_22270 18256 19074 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462031.1 protein_id gnl|my_center|LOCUS_22270 19839 19186 gene locus_tag LOCUS_22280 gene catA 19839 19186 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668557.1 protein_id gnl|my_center|LOCUS_22280 20582 19857 gene locus_tag LOCUS_22290 gene nagB 20582 19857 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_22290 21517 20630 gene locus_tag LOCUS_22300 21517 20630 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_22300 21516 21701 gene locus_tag LOCUS_22310 21516 21701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 21796 22716 gene locus_tag LOCUS_22320 21796 22716 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_22320 22707 23831 gene locus_tag LOCUS_22330 22707 23831 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence51 264 626 gene locus_tag LOCUS_22340 264 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 566 958 gene locus_tag LOCUS_22350 566 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1155 2309 gene locus_tag LOCUS_22360 1155 2309 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964083.1 protein_id gnl|my_center|LOCUS_22360 2319 2762 gene locus_tag LOCUS_22370 2319 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3371 2823 gene locus_tag LOCUS_22380 3371 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 3685 3368 gene locus_tag LOCUS_22390 3685 3368 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920200.1 protein_id gnl|my_center|LOCUS_22390 4638 3802 gene locus_tag LOCUS_22400 4638 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 4827 5894 gene locus_tag LOCUS_22410 4827 5894 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_22410 5909 7291 gene locus_tag LOCUS_22420 5909 7291 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527981.1 protein_id gnl|my_center|LOCUS_22420 7476 8324 gene locus_tag LOCUS_22430 7476 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 8694 9365 gene locus_tag LOCUS_22440 8694 9365 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_22440 9538 10146 gene locus_tag LOCUS_22450 9538 10146 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889720.1 protein_id gnl|my_center|LOCUS_22450 10204 11940 gene locus_tag LOCUS_22460 10204 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 12033 13763 gene locus_tag LOCUS_22470 12033 13763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_22470 13789 14859 gene locus_tag LOCUS_22480 gene hisC 13789 14859 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_22480 14940 15662 gene locus_tag LOCUS_22490 14940 15662 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812013.1 protein_id gnl|my_center|LOCUS_22490 15759 16598 gene locus_tag LOCUS_22500 gene dapF 15759 16598 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_22500 17714 16704 gene locus_tag LOCUS_22510 gene asnA 17714 16704 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_22510 17961 18920 gene locus_tag LOCUS_22520 17961 18920 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_22520 18979 20349 gene locus_tag LOCUS_22530 18979 20349 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_22530 20504 22648 gene locus_tag LOCUS_22540 gene nrdD 20504 22648 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560899.1 protein_id gnl|my_center|LOCUS_22540 22883 24268 gene locus_tag LOCUS_22550 22883 24268 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_22550 24299 25243 gene locus_tag LOCUS_22560 24299 25243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence52 208 1488 gene locus_tag LOCUS_22570 208 1488 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047742.1 protein_id gnl|my_center|LOCUS_22570 1482 3155 gene locus_tag LOCUS_22580 1482 3155 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047743.1 protein_id gnl|my_center|LOCUS_22580 4504 3152 gene locus_tag LOCUS_22590 4504 3152 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_22590 4747 5109 gene locus_tag LOCUS_22600 4747 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 5113 6180 gene locus_tag LOCUS_22610 5113 6180 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_22610 8735 6201 gene locus_tag LOCUS_22620 8735 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 9024 9173 gene locus_tag LOCUS_22630 gene rpmG 9024 9173 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_22630 9197 9403 gene locus_tag LOCUS_22640 9197 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 9420 9935 gene locus_tag LOCUS_22650 gene nusG 9420 9935 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_22650 10012 10437 gene locus_tag LOCUS_22660 gene rplK 10012 10437 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_22660 10568 11260 gene locus_tag LOCUS_22670 gene rplA 10568 11260 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_22670 11562 12050 gene locus_tag LOCUS_22680 gene rplJ 11562 12050 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_22680 12137 12511 gene locus_tag LOCUS_22690 gene rplL 12137 12511 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_22690 12751 12909 gene locus_tag LOCUS_22700 12751 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 12872 16624 gene locus_tag LOCUS_22710 gene rpoB 12872 16624 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_22710 16744 20460 gene locus_tag LOCUS_22720 gene rpoC 16744 20460 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_22720 20787 21200 gene locus_tag LOCUS_22730 gene rpsL 20787 21200 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_22730 21375 21845 gene locus_tag LOCUS_22740 gene rpsG 21375 21845 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_22740 21866 23983 gene locus_tag LOCUS_22750 gene fusA 21866 23983 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence53 157 1380 gene locus_tag LOCUS_22760 157 1380 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860963.1 protein_id gnl|my_center|LOCUS_22760 1677 1471 gene locus_tag LOCUS_22770 1677 1471 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_22770 2276 1731 gene locus_tag LOCUS_22780 2276 1731 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_22780 2692 3864 gene locus_tag LOCUS_22790 2692 3864 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_22790 4099 4983 gene locus_tag LOCUS_22800 4099 4983 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_22800 4984 6093 gene locus_tag LOCUS_22810 4984 6093 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_22810 6097 6858 gene locus_tag LOCUS_22820 6097 6858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_22820 6871 7581 gene locus_tag LOCUS_22830 6871 7581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_22830 7594 8214 gene locus_tag LOCUS_22840 7594 8214 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_22840 8447 9490 gene locus_tag LOCUS_22850 8447 9490 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_22850 9524 10933 gene locus_tag LOCUS_22860 gene uxaC 9524 10933 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_22860 13128 11041 gene locus_tag LOCUS_22870 13128 11041 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_22870 13847 13569 gene locus_tag LOCUS_22880 13847 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 14114 15859 gene locus_tag LOCUS_22890 14114 15859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129119821.1 protein_id gnl|my_center|LOCUS_22890 17568 15901 gene locus_tag LOCUS_22900 17568 15901 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_22900 18638 17565 gene locus_tag LOCUS_22910 gene uxuA 18638 17565 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_22910 19020 19901 gene locus_tag LOCUS_22920 19020 19901 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_22920 19885 20604 gene locus_tag LOCUS_22930 19885 20604 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_22930 20718 22994 gene locus_tag LOCUS_22940 20718 22994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 23069 23932 gene locus_tag LOCUS_22950 23069 23932 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence54 963 115 gene locus_tag LOCUS_22960 963 115 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974125.1 protein_id gnl|my_center|LOCUS_22960 2097 1018 gene locus_tag LOCUS_22970 2097 1018 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_22970 2840 2094 gene locus_tag LOCUS_22980 2840 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3135 4046 gene locus_tag LOCUS_22990 3135 4046 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_22990 4157 5065 gene locus_tag LOCUS_23000 gene dapA 4157 5065 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081879.1 protein_id gnl|my_center|LOCUS_23000 5220 5903 gene locus_tag LOCUS_23010 5220 5903 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 protein_id gnl|my_center|LOCUS_23010 5915 6754 gene locus_tag LOCUS_23020 5915 6754 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_23020 8012 6849 gene locus_tag LOCUS_23030 8012 6849 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776693.1 protein_id gnl|my_center|LOCUS_23030 8544 9350 gene locus_tag LOCUS_23040 8544 9350 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809725.1 protein_id gnl|my_center|LOCUS_23040 9355 10335 gene locus_tag LOCUS_23050 9355 10335 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_23050 10361 12154 gene locus_tag LOCUS_23060 gene fucI 10361 12154 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_23060 12314 13240 gene locus_tag LOCUS_23070 gene trxB 12314 13240 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272302.1 protein_id gnl|my_center|LOCUS_23070 14692 14072 gene locus_tag LOCUS_23080 14692 14072 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_23080 16132 14705 gene locus_tag LOCUS_23090 16132 14705 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_23090 17911 16145 gene locus_tag LOCUS_23100 17911 16145 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_23100 18491 17904 gene locus_tag LOCUS_23110 18491 17904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 18855 18547 gene locus_tag LOCUS_23120 18855 18547 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_23120 19305 18871 gene locus_tag LOCUS_23130 19305 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 21265 19334 gene locus_tag LOCUS_23140 21265 19334 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_23140 22328 21288 gene locus_tag LOCUS_23150 22328 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 22647 22336 gene locus_tag LOCUS_23160 22647 22336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 22862 23506 gene locus_tag LOCUS_23170 gene trmB 22862 23506 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132468.1 protein_id gnl|my_center|LOCUS_23170 23672 23839 gene locus_tag LOCUS_23180 23672 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence55 1531 890 gene locus_tag LOCUS_23190 1531 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1887 1663 gene locus_tag LOCUS_23200 1887 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3473 1884 gene locus_tag LOCUS_23210 3473 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4936 3470 gene locus_tag LOCUS_23220 4936 3470 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989955.1 protein_id gnl|my_center|LOCUS_23220 6264 4948 gene locus_tag LOCUS_23230 6264 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 6733 6227 gene locus_tag LOCUS_23240 6733 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 7343 6822 gene locus_tag LOCUS_23250 7343 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 7601 7347 gene locus_tag LOCUS_23260 7601 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 8401 7985 gene locus_tag LOCUS_23270 8401 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 9091 8543 gene locus_tag LOCUS_23280 9091 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 9270 9091 gene locus_tag LOCUS_23290 9270 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 9530 9267 gene locus_tag LOCUS_23300 9530 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 9708 9523 gene locus_tag LOCUS_23310 9708 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 10174 9701 gene locus_tag LOCUS_23320 10174 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 10885 10688 gene locus_tag LOCUS_23330 10885 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 11280 10885 gene locus_tag LOCUS_23340 11280 10885 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_23340 11620 11372 gene locus_tag LOCUS_23350 11620 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 13799 11559 gene locus_tag LOCUS_23360 13799 11559 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922066.1 protein_id gnl|my_center|LOCUS_23360 15385 13802 gene locus_tag LOCUS_23370 15385 13802 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_23370 15831 15388 gene locus_tag LOCUS_23380 15831 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 16983 15847 gene locus_tag LOCUS_23390 16983 15847 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_23390 18272 16983 gene locus_tag LOCUS_23400 18272 16983 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_23400 18581 18345 gene locus_tag LOCUS_23410 18581 18345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 18835 18587 gene locus_tag LOCUS_23420 18835 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 19042 18836 gene locus_tag LOCUS_23430 19042 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 19252 19632 gene locus_tag LOCUS_23440 19252 19632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 19616 20005 gene locus_tag LOCUS_23450 19616 20005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 20129 20311 gene locus_tag LOCUS_23460 20129 20311 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669524.1 protein_id gnl|my_center|LOCUS_23460 20339 20749 gene locus_tag LOCUS_23470 20339 20749 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669522.1 protein_id gnl|my_center|LOCUS_23470 20821 21786 gene locus_tag LOCUS_23480 20821 21786 CDS product DUF3644 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263485.1 protein_id gnl|my_center|LOCUS_23480 22125 23210 gene locus_tag LOCUS_23490 22125 23210 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861579.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence56 521 1006 gene locus_tag LOCUS_23500 gene ispF 521 1006 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_23500 1423 2697 gene locus_tag LOCUS_23510 1423 2697 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454961.1 protein_id gnl|my_center|LOCUS_23510 2796 3680 gene locus_tag LOCUS_23520 2796 3680 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861597.1 protein_id gnl|my_center|LOCUS_23520 3683 4516 gene locus_tag LOCUS_23530 3683 4516 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454862.1 protein_id gnl|my_center|LOCUS_23530 4687 6339 gene locus_tag LOCUS_23540 4687 6339 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_23540 7288 6368 gene locus_tag LOCUS_23550 7288 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 7834 8514 gene locus_tag LOCUS_23560 gene cysE 7834 8514 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_23560 8592 9998 gene locus_tag LOCUS_23570 gene cysS 8592 9998 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_23570 9983 10414 gene locus_tag LOCUS_23580 9983 10414 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_23580 10401 11147 gene locus_tag LOCUS_23590 gene rlmB 10401 11147 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_23590 11184 11783 gene locus_tag LOCUS_23600 11184 11783 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_23600 12028 13347 gene locus_tag LOCUS_23610 12028 13347 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_23610 13542 13470 gene locus_tag LOCUS_t00200 13542 13470 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15891 13666 gene locus_tag LOCUS_23620 15891 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 16556 15912 gene locus_tag LOCUS_23630 16556 15912 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_23630 16711 16562 gene locus_tag LOCUS_23640 16711 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 16744 17997 gene locus_tag LOCUS_23650 16744 17997 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198760.1 protein_id gnl|my_center|LOCUS_23650 19125 18112 gene locus_tag LOCUS_23660 19125 18112 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_23660 20202 19420 gene locus_tag LOCUS_23670 20202 19420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 20241 20540 gene locus_tag LOCUS_23680 20241 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 20437 21945 gene locus_tag LOCUS_23690 gene abfA 20437 21945 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_23690 22891 22022 gene locus_tag LOCUS_23700 22891 22022 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453971.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence57 <1 666 gene locus_tag LOCUS_23710 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965086.1:nicotinate phosphoribosyltransferase 3076 875 gene locus_tag LOCUS_23720 3076 875 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_23720 3416 4045 gene locus_tag LOCUS_23730 3416 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 4658 4110 gene locus_tag LOCUS_23740 gene spoVT 4658 4110 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458938.1 protein_id gnl|my_center|LOCUS_23740 6492 4855 gene locus_tag LOCUS_23750 6492 4855 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642763.1 protein_id gnl|my_center|LOCUS_23750 7965 6610 gene locus_tag LOCUS_23760 7965 6610 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945002.1 protein_id gnl|my_center|LOCUS_23760 9097 8459 gene locus_tag LOCUS_23770 gene nth 9097 8459 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198142832.1 protein_id gnl|my_center|LOCUS_23770 9460 9236 gene locus_tag LOCUS_23780 9460 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 10784 9555 gene locus_tag LOCUS_23790 10784 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 12615 10777 gene locus_tag LOCUS_23800 gene recQ 12615 10777 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_23800 13261 12899 gene locus_tag LOCUS_23810 13261 12899 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058130.1 protein_id gnl|my_center|LOCUS_23810 14232 14804 gene locus_tag LOCUS_23820 14232 14804 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_23820 15043 14879 gene locus_tag LOCUS_23830 15043 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 15956 15057 gene locus_tag LOCUS_23840 15956 15057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 16516 16112 gene locus_tag LOCUS_23850 16516 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23850 17178 16501 gene locus_tag LOCUS_23860 17178 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 18445 17186 gene locus_tag LOCUS_23870 18445 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 19176 18463 gene locus_tag LOCUS_23880 19176 18463 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399975.1 protein_id gnl|my_center|LOCUS_23880 20272 19514 gene locus_tag LOCUS_23890 20272 19514 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_23890 21121 20390 gene locus_tag LOCUS_23900 21121 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence58 1742 93 gene locus_tag LOCUS_23910 gene dnaX 1742 93 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_23910 2861 1782 gene locus_tag LOCUS_23920 2861 1782 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_23920 3306 3809 gene locus_tag LOCUS_23930 3306 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 4658 3804 gene locus_tag LOCUS_23940 4658 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 5149 4661 gene locus_tag LOCUS_23950 gene tadA 5149 4661 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_23950 5469 5380 gene locus_tag LOCUS_t00210 5469 5380 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5525 5752 gene locus_tag LOCUS_23960 5525 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6820 5885 gene locus_tag LOCUS_23970 6820 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 7110 6817 gene locus_tag LOCUS_23980 7110 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 7441 7127 gene locus_tag LOCUS_23990 7441 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 7962 7492 gene locus_tag LOCUS_24000 7962 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 8488 7973 gene locus_tag LOCUS_24010 8488 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 9155 8502 gene locus_tag LOCUS_24020 9155 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 9817 9170 gene locus_tag LOCUS_24030 9817 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 12852 9838 gene locus_tag LOCUS_24040 12852 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 14324 12852 gene locus_tag LOCUS_24050 14324 12852 CDS product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905387.1 protein_id gnl|my_center|LOCUS_24050 18016 14321 gene locus_tag LOCUS_24060 18016 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 18638 17997 gene locus_tag LOCUS_24070 18638 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 19009 18635 gene locus_tag LOCUS_24080 19009 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 19532 19026 gene locus_tag LOCUS_24090 19532 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 19936 19547 gene locus_tag LOCUS_24100 19936 19547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 20351 19938 gene locus_tag LOCUS_24110 20351 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 20688 20341 gene locus_tag LOCUS_24120 20688 20341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 21069 20695 gene locus_tag LOCUS_24130 21069 20695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence59 995 90 gene locus_tag LOCUS_24140 995 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2118 1930 gene locus_tag LOCUS_24150 2118 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2228 3118 gene locus_tag LOCUS_24160 2228 3118 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_24160 3138 3608 gene locus_tag LOCUS_24170 3138 3608 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_24170 3581 4264 gene locus_tag LOCUS_24180 3581 4264 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_24180 5187 4339 gene locus_tag LOCUS_24190 5187 4339 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948612.1 protein_id gnl|my_center|LOCUS_24190 5893 5342 gene locus_tag LOCUS_24200 5893 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 6452 5907 gene locus_tag LOCUS_24210 6452 5907 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_24210 6600 6932 gene locus_tag LOCUS_24220 6600 6932 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_24220 7264 6917 gene locus_tag LOCUS_24230 7264 6917 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_24230 7618 7292 gene locus_tag LOCUS_24240 7618 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 8194 7727 gene locus_tag LOCUS_24250 8194 7727 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861860.1 protein_id gnl|my_center|LOCUS_24250 8762 8205 gene locus_tag LOCUS_24260 8762 8205 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_24260 9168 8809 gene locus_tag LOCUS_24270 9168 8809 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_24270 9778 9242 gene locus_tag LOCUS_24280 9778 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 10329 9898 gene locus_tag LOCUS_24290 10329 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 11282 10650 gene locus_tag LOCUS_24300 11282 10650 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 protein_id gnl|my_center|LOCUS_24300 12022 11375 gene locus_tag LOCUS_24310 12022 11375 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_24310 12896 12036 gene locus_tag LOCUS_24320 12896 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460106.1 protein_id gnl|my_center|LOCUS_24320 13677 12907 gene locus_tag LOCUS_24330 13677 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 14815 13718 gene locus_tag LOCUS_24340 14815 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 16223 14946 gene locus_tag LOCUS_24350 16223 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 16923 16204 gene locus_tag LOCUS_24360 16923 16204 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_24360 17273 17049 gene locus_tag LOCUS_24370 17273 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 17266 18156 gene locus_tag LOCUS_24380 17266 18156 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_24380 18244 18831 gene locus_tag LOCUS_24390 18244 18831 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028021.1 protein_id gnl|my_center|LOCUS_24390 18833 20029 gene locus_tag LOCUS_24400 18833 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence60 677 2404 gene locus_tag LOCUS_24410 677 2404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_24410 2388 4244 gene locus_tag LOCUS_24420 2388 4244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_24420 4276 4428 gene locus_tag LOCUS_24430 4276 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4674 6008 gene locus_tag LOCUS_24440 4674 6008 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 protein_id gnl|my_center|LOCUS_24440 6546 6749 gene locus_tag LOCUS_24450 6546 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 6752 7201 gene locus_tag LOCUS_24460 6752 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 7236 8333 gene locus_tag LOCUS_24470 7236 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 8352 8966 gene locus_tag LOCUS_24480 8352 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 8984 10618 gene locus_tag LOCUS_24490 8984 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 10739 11653 gene locus_tag LOCUS_24500 10739 11653 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235901447.1 protein_id gnl|my_center|LOCUS_24500 11753 13072 gene locus_tag LOCUS_24510 11753 13072 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_24510 13315 13749 gene locus_tag LOCUS_24520 13315 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 13888 15621 gene locus_tag LOCUS_24530 13888 15621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_24530 15614 17506 gene locus_tag LOCUS_24540 15614 17506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_24540 17841 18620 gene locus_tag LOCUS_24550 17841 18620 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_24550 18686 19129 gene locus_tag LOCUS_24560 18686 19129 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_24560 19428 19198 gene locus_tag LOCUS_24570 19428 19198 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676650.1 protein_id gnl|my_center|LOCUS_24570 19749 19477 gene locus_tag LOCUS_24580 19749 19477 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_24580 20043 20339 gene locus_tag LOCUS_24590 20043 20339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence61 169 537 gene locus_tag LOCUS_24600 169 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1166 606 gene locus_tag LOCUS_24610 1166 606 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_24610 2129 1188 gene locus_tag LOCUS_24620 2129 1188 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_24620 2331 3002 gene locus_tag LOCUS_24630 2331 3002 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_24630 2999 4078 gene locus_tag LOCUS_24640 gene hitS 2999 4078 CDS product envelope stress sensor histidine kinase HitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231621.1 protein_id gnl|my_center|LOCUS_24640 4095 4655 gene locus_tag LOCUS_24650 4095 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228994.1 protein_id gnl|my_center|LOCUS_24650 5628 4756 gene locus_tag LOCUS_24660 5628 4756 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_24660 5758 7155 gene locus_tag LOCUS_24670 5758 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 7771 7133 gene locus_tag LOCUS_24680 7771 7133 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563965.1 protein_id gnl|my_center|LOCUS_24680 8074 9459 gene locus_tag LOCUS_24690 8074 9459 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_24690 9513 10493 gene locus_tag LOCUS_24700 9513 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 11776 10595 gene locus_tag LOCUS_24710 11776 10595 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_24710 12159 11878 gene locus_tag LOCUS_24720 12159 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 12948 12181 gene locus_tag LOCUS_24730 12948 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 13673 12945 gene locus_tag LOCUS_24740 13673 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 14428 13670 gene locus_tag LOCUS_24750 14428 13670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138603.1 protein_id gnl|my_center|LOCUS_24750 14719 15426 gene locus_tag LOCUS_24760 14719 15426 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_24760 15423 16808 gene locus_tag LOCUS_24770 15423 16808 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399787.1 protein_id gnl|my_center|LOCUS_24770 18386 16884 gene locus_tag LOCUS_24780 18386 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 18583 19671 gene locus_tag LOCUS_24790 gene trpS 18583 19671 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_24790 19867 20067 gene locus_tag LOCUS_24800 19867 20067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence62 1696 449 gene locus_tag LOCUS_24810 1696 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3411 1789 gene locus_tag LOCUS_24820 3411 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 5141 3408 gene locus_tag LOCUS_24830 5141 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 6501 5503 gene locus_tag LOCUS_24840 6501 5503 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613410.1 protein_id gnl|my_center|LOCUS_24840 6806 7069 gene locus_tag LOCUS_24850 6806 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 7378 8715 gene locus_tag LOCUS_24860 7378 8715 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 protein_id gnl|my_center|LOCUS_24860 8913 9959 gene locus_tag LOCUS_24870 gene vanG 8913 9959 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_24870 9956 10594 gene locus_tag LOCUS_24880 9956 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 10591 11706 gene locus_tag LOCUS_24890 10591 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 11907 11677 gene locus_tag LOCUS_24900 11907 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 11824 12993 gene locus_tag LOCUS_24910 11824 12993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 13861 13088 gene locus_tag LOCUS_24920 gene trpA 13861 13088 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_24920 15038 13854 gene locus_tag LOCUS_24930 gene trpB 15038 13854 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_24930 15748 15107 gene locus_tag LOCUS_24940 15748 15107 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101491.1 protein_id gnl|my_center|LOCUS_24940 16544 15732 gene locus_tag LOCUS_24950 gene trpC 16544 15732 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_24950 17570 16557 gene locus_tag LOCUS_24960 gene trpD 17570 16557 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_24960 18272 17637 gene locus_tag LOCUS_24970 18272 17637 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_24970 19756 18269 gene locus_tag LOCUS_24980 gene trpE 19756 18269 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence63 743 141 gene locus_tag LOCUS_24990 743 141 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_24990 957 1565 gene locus_tag LOCUS_25000 957 1565 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642400.1 protein_id gnl|my_center|LOCUS_25000 2169 1720 gene locus_tag LOCUS_25010 2169 1720 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_25010 2588 3787 gene locus_tag LOCUS_25020 2588 3787 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460662.1 protein_id gnl|my_center|LOCUS_25020 5267 3867 gene locus_tag LOCUS_25030 5267 3867 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_25030 5474 6157 gene locus_tag LOCUS_25040 5474 6157 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_25040 6852 6238 gene locus_tag LOCUS_25050 6852 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 7193 6849 gene locus_tag LOCUS_25060 7193 6849 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393829.1 protein_id gnl|my_center|LOCUS_25060 8883 7495 gene locus_tag LOCUS_25070 8883 7495 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_25070 9733 8954 gene locus_tag LOCUS_25080 9733 8954 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_25080 10664 9789 gene locus_tag LOCUS_25090 10664 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 12315 10885 gene locus_tag LOCUS_25100 12315 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 12856 12248 gene locus_tag LOCUS_25110 12856 12248 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_25110 14775 13147 gene locus_tag LOCUS_25120 gene ptsP 14775 13147 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_25120 15759 14851 gene locus_tag LOCUS_25130 15759 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 15986 16615 gene locus_tag LOCUS_25140 15986 16615 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965980.1 protein_id gnl|my_center|LOCUS_25140 16720 18048 gene locus_tag LOCUS_25150 16720 18048 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_25150 18514 18218 gene locus_tag LOCUS_25160 18514 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 18742 18587 gene locus_tag LOCUS_25170 18742 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence64 565 179 gene locus_tag LOCUS_25180 565 179 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_25180 761 690 gene locus_tag LOCUS_t00220 761 690 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 840 770 gene locus_tag LOCUS_t00230 840 770 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1025 953 gene locus_tag LOCUS_t00240 1025 953 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1188 2426 gene locus_tag LOCUS_25190 1188 2426 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_25190 2740 3684 gene locus_tag LOCUS_25200 2740 3684 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_25200 3681 5420 gene locus_tag LOCUS_25210 3681 5420 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_25210 5605 6351 gene locus_tag LOCUS_25220 5605 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 6654 8153 gene locus_tag LOCUS_25230 6654 8153 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_25230 8240 9226 gene locus_tag LOCUS_25240 8240 9226 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_25240 9263 9760 gene locus_tag LOCUS_25250 9263 9760 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_25250 11294 9879 gene locus_tag LOCUS_25260 11294 9879 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_25260 11996 11298 gene locus_tag LOCUS_25270 11996 11298 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_25270 14448 12070 gene locus_tag LOCUS_25280 14448 12070 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_25280 14685 15989 gene locus_tag LOCUS_25290 14685 15989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 16087 17031 gene locus_tag LOCUS_25300 16087 17031 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence65 65 1027 gene locus_tag LOCUS_25310 65 1027 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974651.1 protein_id gnl|my_center|LOCUS_25310 1045 1773 gene locus_tag LOCUS_25320 gene fabG 1045 1773 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_25320 2855 1893 gene locus_tag LOCUS_25330 2855 1893 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974651.1 protein_id gnl|my_center|LOCUS_25330 3103 3303 gene locus_tag LOCUS_25340 3103 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 3307 3537 gene locus_tag LOCUS_25350 3307 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 4633 3746 gene locus_tag LOCUS_25360 4633 3746 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085515.1 protein_id gnl|my_center|LOCUS_25360 6104 4740 gene locus_tag LOCUS_25370 6104 4740 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331252.1 protein_id gnl|my_center|LOCUS_25370 6494 8248 gene locus_tag LOCUS_25380 6494 8248 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_25380 9185 8337 gene locus_tag LOCUS_25390 9185 8337 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_25390 12075 9361 gene locus_tag LOCUS_25400 12075 9361 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_25400 12804 12352 gene locus_tag LOCUS_25410 12804 12352 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_25410 13048 14973 gene locus_tag LOCUS_25420 13048 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 15031 15654 gene locus_tag LOCUS_25430 15031 15654 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_25430 16903 15782 gene locus_tag LOCUS_25440 gene nagA 16903 15782 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_25440 17471 17115 gene locus_tag LOCUS_25450 17471 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence66 1133 951 gene locus_tag LOCUS_25460 1133 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1521 1138 gene locus_tag LOCUS_25470 1521 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1868 2689 gene locus_tag LOCUS_25480 1868 2689 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547992.1 protein_id gnl|my_center|LOCUS_25480 3849 2803 gene locus_tag LOCUS_25490 3849 2803 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_25490 4506 3862 gene locus_tag LOCUS_25500 gene plsY 4506 3862 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_25500 5862 4537 gene locus_tag LOCUS_25510 gene der 5862 4537 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_25510 7207 5816 gene locus_tag LOCUS_25520 7207 5816 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_25520 8841 7327 gene locus_tag LOCUS_25530 8841 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 9124 10302 gene locus_tag LOCUS_25540 9124 10302 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_25540 11234 10377 gene locus_tag LOCUS_25550 gene pgeF 11234 10377 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_25550 11615 11250 gene locus_tag LOCUS_25560 11615 11250 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_25560 12381 11608 gene locus_tag LOCUS_25570 12381 11608 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_25570 13261 12365 gene locus_tag LOCUS_25580 gene ylqF 13261 12365 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_25580 13847 13272 gene locus_tag LOCUS_25590 gene lepB 13847 13272 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460443.1 protein_id gnl|my_center|LOCUS_25590 14291 13944 gene locus_tag LOCUS_25600 gene rplS 14291 13944 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_25600 14515 14664 gene locus_tag LOCUS_25610 14515 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 16064 14703 gene locus_tag LOCUS_25620 16064 14703 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_25620 16769 16101 gene locus_tag LOCUS_25630 16769 16101 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_25630 17519 16788 gene locus_tag LOCUS_25640 17519 16788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence67 44 1147 gene locus_tag LOCUS_25650 44 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1184 2116 gene locus_tag LOCUS_25660 1184 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2113 5067 gene locus_tag LOCUS_25670 2113 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 6082 5336 gene locus_tag LOCUS_25680 gene fabG 6082 5336 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_25680 6750 6166 gene locus_tag LOCUS_25690 6750 6166 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_25690 6953 6747 gene locus_tag LOCUS_25700 6953 6747 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418105.1 protein_id gnl|my_center|LOCUS_25700 7174 9039 gene locus_tag LOCUS_25710 7174 9039 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_25710 9023 9727 gene locus_tag LOCUS_25720 9023 9727 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_25720 9728 10924 gene locus_tag LOCUS_25730 gene rng 9728 10924 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 protein_id gnl|my_center|LOCUS_25730 10945 11925 gene locus_tag LOCUS_25740 10945 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 11948 12928 gene locus_tag LOCUS_25750 11948 12928 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613410.1 protein_id gnl|my_center|LOCUS_25750 13188 15845 gene locus_tag LOCUS_25760 13188 15845 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_25760 15961 16842 gene locus_tag LOCUS_25770 15961 16842 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence68 274 346 gene locus_tag LOCUS_t00250 274 346 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 707 1237 gene locus_tag LOCUS_25780 707 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1304 2050 gene locus_tag LOCUS_25790 1304 2050 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643522.1 protein_id gnl|my_center|LOCUS_25790 2063 2518 gene locus_tag LOCUS_25800 2063 2518 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701235.1 protein_id gnl|my_center|LOCUS_25800 2642 4096 gene locus_tag LOCUS_25810 2642 4096 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_25810 4799 4182 gene locus_tag LOCUS_25820 4799 4182 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965791.1 protein_id gnl|my_center|LOCUS_25820 4971 5666 gene locus_tag LOCUS_25830 gene sfsA 4971 5666 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_25830 5668 6762 gene locus_tag LOCUS_25840 gene mutY 5668 6762 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_25840 6759 7775 gene locus_tag LOCUS_25850 6759 7775 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_25850 8504 7791 gene locus_tag LOCUS_25860 8504 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 8711 10960 gene locus_tag LOCUS_25870 8711 10960 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_25870 10957 11937 gene locus_tag LOCUS_25880 10957 11937 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830022.1 protein_id gnl|my_center|LOCUS_25880 12088 14211 gene locus_tag LOCUS_25890 gene htpG 12088 14211 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_25890 14392 16002 gene locus_tag LOCUS_25900 14392 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 16111 16605 gene locus_tag LOCUS_25910 16111 16605 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815953.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence69 1451 300 gene locus_tag LOCUS_25920 1451 300 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_25920 2353 1547 gene locus_tag LOCUS_25930 2353 1547 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966631.1 protein_id gnl|my_center|LOCUS_25930 3880 2369 gene locus_tag LOCUS_25940 3880 2369 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 protein_id gnl|my_center|LOCUS_25940 5955 3898 gene locus_tag LOCUS_25950 5955 3898 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460617.1 protein_id gnl|my_center|LOCUS_25950 6892 5945 gene locus_tag LOCUS_25960 6892 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 7416 7117 gene locus_tag LOCUS_25970 7416 7117 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_25970 7592 9028 gene locus_tag LOCUS_25980 7592 9028 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081360963.1 protein_id gnl|my_center|LOCUS_25980 9044 10039 gene locus_tag LOCUS_25990 9044 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 10114 10785 gene locus_tag LOCUS_26000 10114 10785 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_26000 11167 10793 gene locus_tag LOCUS_26010 11167 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 12029 11280 gene locus_tag LOCUS_26020 12029 11280 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_26020 13492 12134 gene locus_tag LOCUS_26030 13492 12134 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_26030 13816 13553 gene locus_tag LOCUS_26040 13816 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 14852 14223 gene locus_tag LOCUS_26050 14852 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 15978 14938 gene locus_tag LOCUS_26060 15978 14938 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109299.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence70 1144 77 gene locus_tag LOCUS_26070 1144 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_26070 1295 2053 gene locus_tag LOCUS_26080 1295 2053 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861262.1 protein_id gnl|my_center|LOCUS_26080 3429 2251 gene locus_tag LOCUS_26090 3429 2251 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_26090 4257 3478 gene locus_tag LOCUS_26100 4257 3478 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_26100 4650 4339 gene locus_tag LOCUS_26110 gene rhaM 4650 4339 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379067.1 protein_id gnl|my_center|LOCUS_26110 7140 6070 gene locus_tag LOCUS_26120 7140 6070 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966843.1 protein_id gnl|my_center|LOCUS_26120 8970 7189 gene locus_tag LOCUS_26130 8970 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 10350 9010 gene locus_tag LOCUS_26140 10350 9010 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_26140 10843 10415 gene locus_tag LOCUS_26150 gene fabZ 10843 10415 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_26150 11327 10884 gene locus_tag LOCUS_26160 gene accB 11327 10884 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_26160 12603 11368 gene locus_tag LOCUS_26170 gene fabF 12603 11368 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_26170 13361 12624 gene locus_tag LOCUS_26180 gene fabG 13361 12624 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_26180 14312 13395 gene locus_tag LOCUS_26190 gene fabD 14312 13395 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_26190 15342 14410 gene locus_tag LOCUS_26200 gene fabK 15342 14410 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048429.1 protein_id gnl|my_center|LOCUS_26200 15646 15413 gene locus_tag LOCUS_26210 gene acpP 15646 15413 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_26210 16574 15744 gene locus_tag LOCUS_26220 16574 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence71 2179 1949 gene locus_tag LOCUS_26230 2179 1949 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_26230 4068 2641 gene locus_tag LOCUS_26240 4068 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 5524 4121 gene locus_tag LOCUS_26250 gene rlmD 5524 4121 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_26250 5878 5639 gene locus_tag LOCUS_26260 5878 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 8170 5957 gene locus_tag LOCUS_26270 gene pcrA 8170 5957 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_26270 8750 9349 gene locus_tag LOCUS_26280 8750 9349 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427879.1 protein_id gnl|my_center|LOCUS_26280 12540 9427 gene locus_tag LOCUS_26290 12540 9427 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_26290 15201 12556 gene locus_tag LOCUS_26300 15201 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 15788 15366 gene locus_tag LOCUS_26310 15788 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence72 <1 1952 gene locus_tag LOCUS_26320 <1 1952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987043.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 2267 2914 gene locus_tag LOCUS_26330 2267 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3436 4239 gene locus_tag LOCUS_26340 3436 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 4288 7209 gene locus_tag LOCUS_26350 4288 7209 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_26350 7379 8284 gene locus_tag LOCUS_26360 gene era 7379 8284 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_26360 8290 9036 gene locus_tag LOCUS_26370 8290 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 9137 9757 gene locus_tag LOCUS_26380 9137 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 9880 11304 gene locus_tag LOCUS_26390 9880 11304 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_26390 11715 13823 gene locus_tag LOCUS_26400 11715 13823 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_26400 14763 13990 gene locus_tag LOCUS_26410 14763 13990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence73 90 653 gene locus_tag LOCUS_26420 90 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 684 1748 gene locus_tag LOCUS_26430 684 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1750 2532 gene locus_tag LOCUS_26440 1750 2532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905199.1 protein_id gnl|my_center|LOCUS_26440 2532 3263 gene locus_tag LOCUS_26450 2532 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3756 5627 gene locus_tag LOCUS_26460 3756 5627 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_26460 5704 7311 gene locus_tag LOCUS_26470 5704 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 7315 8577 gene locus_tag LOCUS_26480 7315 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 8737 9138 gene locus_tag LOCUS_26490 gene tagD 8737 9138 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_26490 9131 10513 gene locus_tag LOCUS_26500 9131 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 10482 13823 gene locus_tag LOCUS_26510 10482 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 13964 15208 gene locus_tag LOCUS_26520 13964 15208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 15336 15611 gene locus_tag LOCUS_26530 15336 15611 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence74 <1 802 gene locus_tag LOCUS_26540 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109306.1:PDDEXK nuclease domain-containing protein 1124 861 gene locus_tag LOCUS_26550 1124 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 4583 1161 gene locus_tag LOCUS_26560 gene addB 4583 1161 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_26560 5670 4702 gene locus_tag LOCUS_26570 5670 4702 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_26570 7775 6807 gene locus_tag LOCUS_26580 7775 6807 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_26580 7993 7772 gene locus_tag LOCUS_26590 7993 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 8246 7998 gene locus_tag LOCUS_26600 8246 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 8648 9109 gene locus_tag LOCUS_26610 8648 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 10102 9209 gene locus_tag LOCUS_26620 10102 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 12081 10171 gene locus_tag LOCUS_26630 12081 10171 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_26630 13003 12122 gene locus_tag LOCUS_26640 gene hslO 13003 12122 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_26640 13649 12996 gene locus_tag LOCUS_26650 13649 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 14507 13734 gene locus_tag LOCUS_26660 14507 13734 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence75 576 421 gene locus_tag LOCUS_26670 576 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2045 720 gene locus_tag LOCUS_26680 2045 720 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_26680 3296 2271 gene locus_tag LOCUS_26690 3296 2271 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255246.1 protein_id gnl|my_center|LOCUS_26690 4285 3386 gene locus_tag LOCUS_26700 gene iolE 4285 3386 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_26700 5134 4343 gene locus_tag LOCUS_26710 5134 4343 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_26710 7069 5138 gene locus_tag LOCUS_26720 gene iolD 7069 5138 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_26720 8126 7086 gene locus_tag LOCUS_26730 gene iolC 8126 7086 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243753.1 protein_id gnl|my_center|LOCUS_26730 8476 9471 gene locus_tag LOCUS_26740 8476 9471 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963413.1 protein_id gnl|my_center|LOCUS_26740 9593 11104 gene locus_tag LOCUS_26750 gene iolA 9593 11104 CDS product methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243682.1 protein_id gnl|my_center|LOCUS_26750 11196 11957 gene locus_tag LOCUS_26760 11196 11957 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067850802.1 protein_id gnl|my_center|LOCUS_26760 12304 12005 gene locus_tag LOCUS_26770 12304 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 12717 13226 gene locus_tag LOCUS_26780 12717 13226 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897047.1 protein_id gnl|my_center|LOCUS_26780 13351 14328 gene locus_tag LOCUS_26790 13351 14328 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_26790 14745 14407 gene locus_tag LOCUS_26800 14745 14407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence76 265 1635 gene locus_tag LOCUS_26810 265 1635 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_26810 1696 2649 gene locus_tag LOCUS_26820 1696 2649 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_26820 2646 3452 gene locus_tag LOCUS_26830 2646 3452 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_26830 3580 6618 gene locus_tag LOCUS_26840 3580 6618 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_26840 6870 8897 gene locus_tag LOCUS_26850 6870 8897 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 protein_id gnl|my_center|LOCUS_26850 8962 10485 gene locus_tag LOCUS_26860 gene galT 8962 10485 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_26860 12296 10644 gene locus_tag LOCUS_26870 12296 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 12523 13617 gene locus_tag LOCUS_26880 12523 13617 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 protein_id gnl|my_center|LOCUS_26880 13699 14745 gene locus_tag LOCUS_26890 13699 14745 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence77 873 661 gene locus_tag LOCUS_26900 873 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1515 922 gene locus_tag LOCUS_26910 1515 922 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861294.1 protein_id gnl|my_center|LOCUS_26910 3478 1568 gene locus_tag LOCUS_26920 3478 1568 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_26920 3826 4662 gene locus_tag LOCUS_26930 3826 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 4685 6379 gene locus_tag LOCUS_26940 4685 6379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776847.1 protein_id gnl|my_center|LOCUS_26940 6381 7217 gene locus_tag LOCUS_26950 6381 7217 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776846.1 protein_id gnl|my_center|LOCUS_26950 7302 8093 gene locus_tag LOCUS_26960 7302 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 8197 9033 gene locus_tag LOCUS_26970 8197 9033 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080814535.1 protein_id gnl|my_center|LOCUS_26970 9146 10519 gene locus_tag LOCUS_26980 9146 10519 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948237.1 protein_id gnl|my_center|LOCUS_26980 10542 11204 gene locus_tag LOCUS_26990 10542 11204 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_26990 11277 12524 gene locus_tag LOCUS_27000 11277 12524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_27000 13332 12712 gene locus_tag LOCUS_27010 13332 12712 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_27010 14352 13450 gene locus_tag LOCUS_27020 14352 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence78 2316 199 gene locus_tag LOCUS_27030 2316 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 4524 2677 gene locus_tag LOCUS_27040 gene ftsH 4524 2677 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_27040 5073 4546 gene locus_tag LOCUS_27050 gene hpt 5073 4546 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_27050 6475 5066 gene locus_tag LOCUS_27060 gene tilS 6475 5066 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_27060 8000 6495 gene locus_tag LOCUS_27070 8000 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 8360 8103 gene locus_tag LOCUS_27080 8360 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 8886 8245 gene locus_tag LOCUS_27090 8886 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 9193 8915 gene locus_tag LOCUS_27100 9193 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 9526 9287 gene locus_tag LOCUS_27110 9526 9287 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048379.1 protein_id gnl|my_center|LOCUS_27110 9805 9530 gene locus_tag LOCUS_27120 9805 9530 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359333.1 protein_id gnl|my_center|LOCUS_27120 10567 9875 gene locus_tag LOCUS_27130 10567 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 12305 10569 gene locus_tag LOCUS_27140 12305 10569 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_27140 13429 12458 gene locus_tag LOCUS_27150 13429 12458 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966189.1 protein_id gnl|my_center|LOCUS_27150 13736 13548 gene locus_tag LOCUS_27160 13736 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 14088 13684 gene locus_tag LOCUS_27170 14088 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence79 688 1590 gene locus_tag LOCUS_27180 688 1590 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502284.1 protein_id gnl|my_center|LOCUS_27180 2035 1568 gene locus_tag LOCUS_27190 2035 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3084 2032 gene locus_tag LOCUS_27200 3084 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 3881 3090 gene locus_tag LOCUS_27210 3881 3090 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 protein_id gnl|my_center|LOCUS_27210 4316 4104 gene locus_tag LOCUS_27220 4316 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 6313 4499 gene locus_tag LOCUS_27230 6313 4499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_27230 8118 6310 gene locus_tag LOCUS_27240 8118 6310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_27240 8369 8238 gene locus_tag LOCUS_27250 8369 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 9195 8452 gene locus_tag LOCUS_27260 gene pflA 9195 8452 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860950.1 protein_id gnl|my_center|LOCUS_27260 9439 9197 gene locus_tag LOCUS_27270 9439 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 11596 9512 gene locus_tag LOCUS_27280 gene pflB 11596 9512 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_27280 12992 11949 gene locus_tag LOCUS_27290 12992 11949 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_27290 13346 13047 gene locus_tag LOCUS_27300 13346 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 13899 13429 gene locus_tag LOCUS_27310 13899 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence80 683 36 gene locus_tag LOCUS_27320 683 36 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 protein_id gnl|my_center|LOCUS_27320 3236 819 gene locus_tag LOCUS_27330 gene pheT 3236 819 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_27330 4282 3251 gene locus_tag LOCUS_27340 gene pheS 4282 3251 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_27340 5617 4685 gene locus_tag LOCUS_27350 5617 4685 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_27350 6016 5819 gene locus_tag LOCUS_27360 6016 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 7557 6016 gene locus_tag LOCUS_27370 7557 6016 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393198.1 protein_id gnl|my_center|LOCUS_27370 8682 7633 gene locus_tag LOCUS_27380 8682 7633 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_27380 10699 9206 gene locus_tag LOCUS_27390 gene thrC 10699 9206 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836325.1 protein_id gnl|my_center|LOCUS_27390 11642 10800 gene locus_tag LOCUS_27400 11642 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 <13207 12063 gene locus_tag LOCUS_27410 <13207 12063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791971.1:phosphoenolpyruvate carboxykinase (ATP) >Feature sequence81 1725 73 gene locus_tag LOCUS_27420 1725 73 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_27420 4455 2167 gene locus_tag LOCUS_27430 4455 2167 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_27430 4937 4452 gene locus_tag LOCUS_27440 4937 4452 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 protein_id gnl|my_center|LOCUS_27440 5727 4939 gene locus_tag LOCUS_27450 5727 4939 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_27450 6199 6126 gene locus_tag LOCUS_t00260 6199 6126 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7004 6510 gene locus_tag LOCUS_27460 gene leuD 7004 6510 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_27460 8286 7018 gene locus_tag LOCUS_27470 gene leuC 8286 7018 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_27470 8411 9298 gene locus_tag LOCUS_27480 8411 9298 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_27480 10416 9403 gene locus_tag LOCUS_27490 gene ilvC 10416 9403 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_27490 11016 10516 gene locus_tag LOCUS_27500 gene ilvN 11016 10516 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388986.1 protein_id gnl|my_center|LOCUS_27500 12437 11112 gene locus_tag LOCUS_27510 12437 11112 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_27510 12810 12529 gene locus_tag LOCUS_27520 12810 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence82 1281 907 gene locus_tag LOCUS_27530 1281 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3398 1398 gene locus_tag LOCUS_27540 gene feoB 3398 1398 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903695.1 protein_id gnl|my_center|LOCUS_27540 3698 3486 gene locus_tag LOCUS_27550 3698 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 5890 3821 gene locus_tag LOCUS_27560 5890 3821 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_27560 6359 6054 gene locus_tag LOCUS_27570 6359 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 7096 6677 gene locus_tag LOCUS_27580 7096 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 7490 7128 gene locus_tag LOCUS_27590 7490 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 8165 7743 gene locus_tag LOCUS_27600 8165 7743 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_27600 8783 8229 gene locus_tag LOCUS_27610 8783 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 9070 8786 gene locus_tag LOCUS_27620 9070 8786 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_27620 10761 9322 gene locus_tag LOCUS_27630 10761 9322 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_27630 12133 10775 gene locus_tag LOCUS_27640 gene trkA 12133 10775 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence83 115 1212 gene locus_tag LOCUS_27650 115 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1838 1209 gene locus_tag LOCUS_27660 1838 1209 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_27660 2121 2894 gene locus_tag LOCUS_27670 2121 2894 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_27670 2930 4294 gene locus_tag LOCUS_27680 gene pepV 2930 4294 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_27680 4943 4359 gene locus_tag LOCUS_27690 4943 4359 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_27690 5473 6462 gene locus_tag LOCUS_27700 5473 6462 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_27700 6688 8406 gene locus_tag LOCUS_27710 6688 8406 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_27710 8489 9628 gene locus_tag LOCUS_27720 8489 9628 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_27720 9853 10899 gene locus_tag LOCUS_27730 9853 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence84 80 1213 gene locus_tag LOCUS_27740 80 1213 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_27740 1240 2334 gene locus_tag LOCUS_27750 1240 2334 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_27750 2857 4173 gene locus_tag LOCUS_27760 2857 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 4176 5126 gene locus_tag LOCUS_27770 4176 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 5151 5744 gene locus_tag LOCUS_27780 gene pth 5151 5744 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_27780 5829 9353 gene locus_tag LOCUS_27790 gene mfd 5829 9353 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence85 555 1067 gene locus_tag LOCUS_27800 gene moaC 555 1067 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965292.1 protein_id gnl|my_center|LOCUS_27800 1060 1257 gene locus_tag LOCUS_27810 1060 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1478 2902 gene locus_tag LOCUS_27820 1478 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2986 3555 gene locus_tag LOCUS_27830 2986 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3555 4229 gene locus_tag LOCUS_27840 3555 4229 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_27840 4217 5395 gene locus_tag LOCUS_27850 4217 5395 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_27850 5522 6625 gene locus_tag LOCUS_27860 5522 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 6759 7484 gene locus_tag LOCUS_27870 6759 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 7474 8352 gene locus_tag LOCUS_27880 7474 8352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485364.1 protein_id gnl|my_center|LOCUS_27880 8741 9790 gene locus_tag LOCUS_27890 8741 9790 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051638.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence86 79 756 gene locus_tag LOCUS_27900 79 756 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424455.1 protein_id gnl|my_center|LOCUS_27900 740 2140 gene locus_tag LOCUS_27910 740 2140 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986504.1 protein_id gnl|my_center|LOCUS_27910 2249 3718 gene locus_tag LOCUS_27920 2249 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 3740 4405 gene locus_tag LOCUS_27930 gene vex2 3740 4405 CDS product ABC transporter ATP-binding subunit Vex2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173746.1 protein_id gnl|my_center|LOCUS_27930 5053 4535 gene locus_tag LOCUS_27940 5053 4535 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021182.1 protein_id gnl|my_center|LOCUS_27940 5845 5069 gene locus_tag LOCUS_27950 5845 5069 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence87 474 211 gene locus_tag LOCUS_27960 474 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 751 419 gene locus_tag LOCUS_27970 751 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27970 930 649 gene locus_tag LOCUS_27980 930 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27980 1894 1034 gene locus_tag LOCUS_27990 1894 1034 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814137.1 protein_id gnl|my_center|LOCUS_27990 3324 2119 gene locus_tag LOCUS_28000 3324 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 4198 3311 gene locus_tag LOCUS_28010 4198 3311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_28010 4943 4179 gene locus_tag LOCUS_28020 4943 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 5473 4940 gene locus_tag LOCUS_28030 5473 4940 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_28030 7005 5944 gene locus_tag LOCUS_28040 7005 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 7922 7125 gene locus_tag LOCUS_28050 7922 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence88 1761 436 gene locus_tag LOCUS_28060 1761 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2773 2012 gene locus_tag LOCUS_28070 2773 2012 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890775.1 protein_id gnl|my_center|LOCUS_28070 4395 2986 gene locus_tag LOCUS_28080 4395 2986 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861185.1 protein_id gnl|my_center|LOCUS_28080 5071 4400 gene locus_tag LOCUS_28090 5071 4400 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_28090 5829 5068 gene locus_tag LOCUS_28100 5829 5068 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405369.1 protein_id gnl|my_center|LOCUS_28100 6605 5826 gene locus_tag LOCUS_28110 6605 5826 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896246.1 protein_id gnl|my_center|LOCUS_28110 7321 6602 gene locus_tag LOCUS_28120 7321 6602 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986262.1 protein_id gnl|my_center|LOCUS_28120 7743 7818 gene locus_tag LOCUS_t00270 7743 7818 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence89 153 887 gene locus_tag LOCUS_28130 153 887 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_28130 1549 1031 gene locus_tag LOCUS_28140 1549 1031 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_28140 1969 2409 gene locus_tag LOCUS_28150 gene tsaE 1969 2409 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_28150 2500 3222 gene locus_tag LOCUS_28160 gene tsaB 2500 3222 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_28160 3209 3673 gene locus_tag LOCUS_28170 gene rimI 3209 3673 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367197.1 protein_id gnl|my_center|LOCUS_28170 3737 3985 gene locus_tag LOCUS_28180 3737 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 4008 4922 gene locus_tag LOCUS_28190 4008 4922 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_28190 4922 5950 gene locus_tag LOCUS_28200 gene tsaD 4922 5950 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_28200 5950 6657 gene locus_tag LOCUS_28210 gene ispD 5950 6657 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence90 90 632 gene locus_tag LOCUS_28220 90 632 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_28220 743 955 gene locus_tag LOCUS_28230 743 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1295 1621 gene locus_tag LOCUS_28240 1295 1621 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_28240 2366 1758 gene locus_tag LOCUS_28250 2366 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2566 4080 gene locus_tag LOCUS_28260 2566 4080 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence91 229 1038 gene locus_tag LOCUS_28270 229 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1019 1513 gene locus_tag LOCUS_28280 1019 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1526 2938 gene locus_tag LOCUS_28290 1526 2938 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_28290 2987 4585 gene locus_tag LOCUS_28300 2987 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence92 18 1292 gene locus_tag LOCUS_28310 18 1292 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_28310 1319 1579 gene locus_tag LOCUS_28320 1319 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1778 2371 gene locus_tag LOCUS_28330 1778 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2636 2758 gene locus_tag LOCUS_28340 2636 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2825 3382 gene locus_tag LOCUS_28350 2825 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3859 4245 gene locus_tag LOCUS_28360 gene ndoA 3859 4245 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635963.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence93 1685 492 gene locus_tag LOCUS_28370 1685 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1899 2408 gene locus_tag LOCUS_28380 1899 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2508 3236 gene locus_tag LOCUS_28390 2508 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3284 3742 gene locus_tag LOCUS_28400 3284 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence94 702 217 gene locus_tag LOCUS_28410 702 217 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645445.1 protein_id gnl|my_center|LOCUS_28410 1310 699 gene locus_tag LOCUS_28420 1310 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2467 1307 gene locus_tag LOCUS_28430 2467 1307 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_28430 3018 2467 gene locus_tag LOCUS_28440 gene yfcE 3018 2467 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_28440 3486 3178 gene locus_tag LOCUS_28450 3486 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3800 3636 gene locus_tag LOCUS_28460 3800 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460