>Feature sequence01 61 552 gene locus_tag LOCUS_00010 61 552 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166592.1 protein_id gnl|my_center|LOCUS_00010 3708 577 gene locus_tag LOCUS_00020 3708 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4259 3714 gene locus_tag LOCUS_00030 gene pth 4259 3714 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722742.1 protein_id gnl|my_center|LOCUS_00030 5095 4256 gene locus_tag LOCUS_00040 gene rsmI 5095 4256 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 protein_id gnl|my_center|LOCUS_00040 5826 5098 gene locus_tag LOCUS_00050 5826 5098 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390767.1 protein_id gnl|my_center|LOCUS_00050 6613 5804 gene locus_tag LOCUS_00060 6613 5804 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_00060 7432 6614 gene locus_tag LOCUS_00070 gene holB 7432 6614 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700662.1 protein_id gnl|my_center|LOCUS_00070 7629 7447 gene locus_tag LOCUS_00080 7629 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8266 7667 gene locus_tag LOCUS_00090 gene recR 8266 7667 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966735.1 protein_id gnl|my_center|LOCUS_00090 8564 8271 gene locus_tag LOCUS_00100 8564 8271 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460082.1 protein_id gnl|my_center|LOCUS_00100 10334 8574 gene locus_tag LOCUS_00110 gene dnaX 10334 8574 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829412.1 protein_id gnl|my_center|LOCUS_00110 10830 10420 gene locus_tag LOCUS_00120 10830 10420 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421624.1 protein_id gnl|my_center|LOCUS_00120 14627 12021 gene locus_tag LOCUS_00130 gene gyrA 14627 12021 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_00130 16562 14640 gene locus_tag LOCUS_00140 gene gyrB 16562 14640 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_00140 17643 16552 gene locus_tag LOCUS_00150 gene recF 17643 16552 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288363.1 protein_id gnl|my_center|LOCUS_00150 18202 17747 gene locus_tag LOCUS_00160 18202 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19454 18333 gene locus_tag LOCUS_00170 gene dnaN 19454 18333 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_00170 20963 19584 gene locus_tag LOCUS_00180 gene dnaA 20963 19584 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420483.1 protein_id gnl|my_center|LOCUS_00180 21135 20989 gene locus_tag LOCUS_00190 21135 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21270 21392 gene locus_tag LOCUS_00200 21270 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21445 21765 gene locus_tag LOCUS_00210 gene rnpA 21445 21765 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167186.1 protein_id gnl|my_center|LOCUS_00210 21765 22667 gene locus_tag LOCUS_00220 21765 22667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22695 23315 gene locus_tag LOCUS_00230 22695 23315 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889751.1 protein_id gnl|my_center|LOCUS_00230 23426 24781 gene locus_tag LOCUS_00240 gene mnmE 23426 24781 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028893.1 protein_id gnl|my_center|LOCUS_00240 24794 26659 gene locus_tag LOCUS_00250 gene mnmG 24794 26659 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_00250 26646 27353 gene locus_tag LOCUS_00260 gene rsmG 26646 27353 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_00260 27448 28605 gene locus_tag LOCUS_00270 27448 28605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30561 28627 gene locus_tag LOCUS_00280 30561 28627 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 protein_id gnl|my_center|LOCUS_00280 30721 31155 gene locus_tag LOCUS_00290 30721 31155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31202 32266 gene locus_tag LOCUS_00300 gene prfA 31202 32266 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356619.1 protein_id gnl|my_center|LOCUS_00300 32256 32978 gene locus_tag LOCUS_00310 gene prmC 32256 32978 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475835.1 protein_id gnl|my_center|LOCUS_00310 33025 33561 gene locus_tag LOCUS_00320 33025 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33597 34130 gene locus_tag LOCUS_00330 33597 34130 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_00330 34202 35449 gene locus_tag LOCUS_00340 34202 35449 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732525.1 protein_id gnl|my_center|LOCUS_00340 35488 36207 gene locus_tag LOCUS_00350 35488 36207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37121 36204 gene locus_tag LOCUS_00360 gene prfB 37121 36204 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_00360 37853 37284 gene locus_tag LOCUS_00370 37853 37284 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392695.1 protein_id gnl|my_center|LOCUS_00370 37936 38265 gene locus_tag LOCUS_00380 37936 38265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38802 40019 gene locus_tag LOCUS_00390 38802 40019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40259 40014 gene locus_tag LOCUS_00400 40259 40014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40358 40600 gene locus_tag LOCUS_00410 40358 40600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40606 42918 gene locus_tag LOCUS_00420 40606 42918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 42994 43437 gene locus_tag LOCUS_00430 gene rplI 42994 43437 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700898.1 protein_id gnl|my_center|LOCUS_00430 43437 44789 gene locus_tag LOCUS_00440 gene dnaB 43437 44789 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721677.1 protein_id gnl|my_center|LOCUS_00440 44782 46263 gene locus_tag LOCUS_00450 44782 46263 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813688.1 protein_id gnl|my_center|LOCUS_00450 46241 46999 gene locus_tag LOCUS_00460 46241 46999 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985641.1 protein_id gnl|my_center|LOCUS_00460 46996 47433 gene locus_tag LOCUS_00470 gene rlmH 46996 47433 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 protein_id gnl|my_center|LOCUS_00470 47656 48528 gene locus_tag LOCUS_00480 47656 48528 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963753.1 protein_id gnl|my_center|LOCUS_00480 48554 49240 gene locus_tag LOCUS_00490 gene ftsE 48554 49240 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_00490 49240 50139 gene locus_tag LOCUS_00500 gene ftsX 49240 50139 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_00500 50139 51329 gene locus_tag LOCUS_00510 50139 51329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51340 52266 gene locus_tag LOCUS_00520 gene whiA 51340 52266 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358736.1 protein_id gnl|my_center|LOCUS_00520 52972 55191 gene locus_tag LOCUS_00530 52972 55191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 55333 55830 gene locus_tag LOCUS_00540 55333 55830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 55908 57578 gene locus_tag LOCUS_00550 55908 57578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57706 58266 gene locus_tag LOCUS_00560 57706 58266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58401 58973 gene locus_tag LOCUS_00570 58401 58973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58982 59575 gene locus_tag LOCUS_00580 58982 59575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 59726 60631 gene locus_tag LOCUS_00590 59726 60631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 61211 60645 gene locus_tag LOCUS_00600 gene clpP 61211 60645 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 protein_id gnl|my_center|LOCUS_00600 61311 62960 gene locus_tag LOCUS_00610 61311 62960 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_00610 62973 63977 gene locus_tag LOCUS_00620 gene gap 62973 63977 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 protein_id gnl|my_center|LOCUS_00620 64263 64844 gene locus_tag LOCUS_00630 64263 64844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 64975 66108 gene locus_tag LOCUS_00640 64975 66108 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902043.1 protein_id gnl|my_center|LOCUS_00640 66108 66794 gene locus_tag LOCUS_00650 66108 66794 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160988.1 protein_id gnl|my_center|LOCUS_00650 66908 67666 gene locus_tag LOCUS_00660 gene spo0A 66908 67666 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293867.1 protein_id gnl|my_center|LOCUS_00660 67756 69264 gene locus_tag LOCUS_00670 gene gpmI 67756 69264 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829591.1 protein_id gnl|my_center|LOCUS_00670 70057 69281 gene locus_tag LOCUS_00680 70057 69281 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_00680 70375 72138 gene locus_tag LOCUS_00690 gene thrS 70375 72138 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830850.1 protein_id gnl|my_center|LOCUS_00690 72292 74103 gene locus_tag LOCUS_00700 72292 74103 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_00700 74171 76390 gene locus_tag LOCUS_00710 74171 76390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 76682 76990 gene locus_tag LOCUS_00720 gene rpsJ 76682 76990 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040596.1 protein_id gnl|my_center|LOCUS_00720 77013 77801 gene locus_tag LOCUS_00730 gene rplC 77013 77801 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_00730 77801 78424 gene locus_tag LOCUS_00740 gene rplD 77801 78424 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024827.1 protein_id gnl|my_center|LOCUS_00740 78424 78693 gene locus_tag LOCUS_00750 78424 78693 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140091.1 protein_id gnl|my_center|LOCUS_00750 78706 79536 gene locus_tag LOCUS_00760 gene rplB 78706 79536 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829788.1 protein_id gnl|my_center|LOCUS_00760 79552 79818 gene locus_tag LOCUS_00770 gene rpsS 79552 79818 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_00770 79830 80171 gene locus_tag LOCUS_00780 gene rplV 79830 80171 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986651.1 protein_id gnl|my_center|LOCUS_00780 80175 80852 gene locus_tag LOCUS_00790 gene rpsC 80175 80852 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_00790 80830 81264 gene locus_tag LOCUS_00800 gene rplP 80830 81264 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166906.1 protein_id gnl|my_center|LOCUS_00800 81254 81448 gene locus_tag LOCUS_00810 gene rpmC 81254 81448 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919135.1 protein_id gnl|my_center|LOCUS_00810 81457 81714 gene locus_tag LOCUS_00820 gene rpsQ 81457 81714 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004105.1 protein_id gnl|my_center|LOCUS_00820 81734 82102 gene locus_tag LOCUS_00830 gene rplN 81734 82102 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_00830 82115 82375 gene locus_tag LOCUS_00840 82115 82375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 82387 82926 gene locus_tag LOCUS_00850 gene rplE 82387 82926 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_00850 82939 83124 gene locus_tag LOCUS_00860 82939 83124 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_00860 83141 83533 gene locus_tag LOCUS_00870 gene rpsH 83141 83533 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_00870 83543 84079 gene locus_tag LOCUS_00880 gene rplF 83543 84079 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379228.1 protein_id gnl|my_center|LOCUS_00880 84093 84446 gene locus_tag LOCUS_00890 gene rplR 84093 84446 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_00890 84464 85006 gene locus_tag LOCUS_00900 gene rpsE 84464 85006 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129922.1 protein_id gnl|my_center|LOCUS_00900 85006 85449 gene locus_tag LOCUS_00910 gene rplO 85006 85449 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_00910 85450 86706 gene locus_tag LOCUS_00920 gene secY 85450 86706 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_00920 86712 87371 gene locus_tag LOCUS_00930 86712 87371 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 protein_id gnl|my_center|LOCUS_00930 87364 88110 gene locus_tag LOCUS_00940 gene map 87364 88110 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225828.1 protein_id gnl|my_center|LOCUS_00940 88114 88329 gene locus_tag LOCUS_00950 gene infA 88114 88329 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_00950 88466 88831 gene locus_tag LOCUS_00960 gene rpsM 88466 88831 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090796.1 protein_id gnl|my_center|LOCUS_00960 88843 89226 gene locus_tag LOCUS_00970 gene rpsK 88843 89226 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921788.1 protein_id gnl|my_center|LOCUS_00970 89242 90192 gene locus_tag LOCUS_00980 89242 90192 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774253.1 protein_id gnl|my_center|LOCUS_00980 90202 90546 gene locus_tag LOCUS_00990 gene rplQ 90202 90546 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_00990 90706 91905 gene locus_tag LOCUS_01000 90706 91905 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037436.1 protein_id gnl|my_center|LOCUS_01000 91992 92516 gene locus_tag LOCUS_01010 gene bph 91992 92516 CDS product biofilm phosphatase Bph inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355538.1 protein_id gnl|my_center|LOCUS_01010 93002 94569 gene locus_tag LOCUS_r00010 93002 94569 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 94847 97756 gene locus_tag LOCUS_r00020 94847 97756 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 97831 97905 gene locus_tag LOCUS_r00030 97831 97905 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 63 percent of the 5S ribosomal RNA 98004 98079 gene locus_tag LOCUS_t00010 98004 98079 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 98184 98504 gene locus_tag LOCUS_01020 98184 98504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 98501 99187 gene locus_tag LOCUS_01030 98501 99187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 100062 99193 gene locus_tag LOCUS_01040 100062 99193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 100191 100973 gene locus_tag LOCUS_01050 100191 100973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 100954 103281 gene locus_tag LOCUS_01060 100954 103281 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_01060 103504 103782 gene locus_tag LOCUS_01070 103504 103782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 103864 105618 gene locus_tag LOCUS_01080 103864 105618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 105715 108360 gene locus_tag LOCUS_01090 105715 108360 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_01090 108357 109316 gene locus_tag LOCUS_01100 108357 109316 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_01100 109392 110018 gene locus_tag LOCUS_01110 109392 110018 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_01110 110063 111100 gene locus_tag LOCUS_01120 110063 111100 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_01120 111097 112380 gene locus_tag LOCUS_01130 111097 112380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 112367 113629 gene locus_tag LOCUS_01140 112367 113629 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_01140 113663 114439 gene locus_tag LOCUS_01150 113663 114439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_01150 114449 115192 gene locus_tag LOCUS_01160 114449 115192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_01160 115248 116684 gene locus_tag LOCUS_01170 115248 116684 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_01170 116662 117060 gene locus_tag LOCUS_01180 116662 117060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 117141 118412 gene locus_tag LOCUS_01190 117141 118412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 118505 119236 gene locus_tag LOCUS_01200 118505 119236 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360559.1 protein_id gnl|my_center|LOCUS_01200 119677 120714 gene locus_tag LOCUS_01210 119677 120714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 120803 122248 gene locus_tag LOCUS_01220 gene cps4A 120803 122248 CDS product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 protein_id gnl|my_center|LOCUS_01220 122250 123359 gene locus_tag LOCUS_01230 122250 123359 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_01230 123362 124402 gene locus_tag LOCUS_01240 123362 124402 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101653.1 protein_id gnl|my_center|LOCUS_01240 124517 125449 gene locus_tag LOCUS_01250 124517 125449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 125457 126530 gene locus_tag LOCUS_01260 125457 126530 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120712.1 protein_id gnl|my_center|LOCUS_01260 126724 127635 gene locus_tag LOCUS_01270 126724 127635 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_01270 127632 129629 gene locus_tag LOCUS_01280 127632 129629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 129616 131121 gene locus_tag LOCUS_01290 129616 131121 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_01290 131111 132472 gene locus_tag LOCUS_01300 131111 132472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 132536 133612 gene locus_tag LOCUS_01310 132536 133612 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_01310 133609 134568 gene locus_tag LOCUS_01320 133609 134568 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_01320 134622 135788 gene locus_tag LOCUS_01330 134622 135788 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706681.1 protein_id gnl|my_center|LOCUS_01330 135824 136846 gene locus_tag LOCUS_01340 135824 136846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 137657 137148 gene locus_tag LOCUS_01350 137657 137148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 138666 137626 gene locus_tag LOCUS_01360 138666 137626 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_01360 138822 139844 gene locus_tag LOCUS_01370 gene galE 138822 139844 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_01370 139879 140988 gene locus_tag LOCUS_01380 gene wecB 139879 140988 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 protein_id gnl|my_center|LOCUS_01380 141051 141386 gene locus_tag LOCUS_01390 141051 141386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 141505 144909 gene locus_tag LOCUS_01400 gene nifJ 141505 144909 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 protein_id gnl|my_center|LOCUS_01400 145151 147148 gene locus_tag LOCUS_01410 gene recG 145151 147148 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989820.1 protein_id gnl|my_center|LOCUS_01410 147164 147880 gene locus_tag LOCUS_01420 147164 147880 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_01420 147926 148777 gene locus_tag LOCUS_01430 147926 148777 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01430 148761 149429 gene locus_tag LOCUS_01440 148761 149429 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_01440 150128 149442 gene locus_tag LOCUS_01450 150128 149442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 152198 150624 gene locus_tag LOCUS_01460 152198 150624 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_01460 152376 152191 gene locus_tag LOCUS_01470 152376 152191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 154131 153085 gene locus_tag LOCUS_01480 154131 153085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 155932 154121 gene locus_tag LOCUS_01490 155932 154121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 156150 155929 gene locus_tag LOCUS_01500 156150 155929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 157966 156323 gene locus_tag LOCUS_01510 157966 156323 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476430.1 protein_id gnl|my_center|LOCUS_01510 159966 157951 gene locus_tag LOCUS_01520 159966 157951 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963675.1 protein_id gnl|my_center|LOCUS_01520 160471 160178 gene locus_tag LOCUS_01530 160471 160178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 160887 160693 gene locus_tag LOCUS_01540 160887 160693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 162344 160929 gene locus_tag LOCUS_01550 162344 160929 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429109.1 protein_id gnl|my_center|LOCUS_01550 162809 162387 gene locus_tag LOCUS_01560 162809 162387 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128411.1 protein_id gnl|my_center|LOCUS_01560 162897 162970 gene locus_tag LOCUS_t00020 162897 162970 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 163099 163317 gene locus_tag LOCUS_01570 163099 163317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 163455 163525 gene locus_tag LOCUS_t00030 163455 163525 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 46 966 gene locus_tag LOCUS_01580 gene ylqF 46 966 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829495.1 protein_id gnl|my_center|LOCUS_01580 1036 1617 gene locus_tag LOCUS_01590 1036 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 2123 1620 gene locus_tag LOCUS_01600 2123 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2734 2186 gene locus_tag LOCUS_01610 gene def 2734 2186 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957048.1 protein_id gnl|my_center|LOCUS_01610 2863 3945 gene locus_tag LOCUS_01620 2863 3945 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966285.1 protein_id gnl|my_center|LOCUS_01620 3948 4427 gene locus_tag LOCUS_01630 3948 4427 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_01630 4624 4442 gene locus_tag LOCUS_01640 4624 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 5357 6259 gene locus_tag LOCUS_01650 5357 6259 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990041.1 protein_id gnl|my_center|LOCUS_01650 6333 6881 gene locus_tag LOCUS_01660 gene ruvA 6333 6881 CDS product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464511.1 protein_id gnl|my_center|LOCUS_01660 6896 7882 gene locus_tag LOCUS_01670 gene ruvB 6896 7882 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_01670 8742 7888 gene locus_tag LOCUS_01680 8742 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 8960 8739 gene locus_tag LOCUS_01690 gene yidD 8960 8739 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_01690 9078 9725 gene locus_tag LOCUS_01700 gene rncS 9078 9725 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_01700 9728 12667 gene locus_tag LOCUS_01710 9728 12667 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_01710 12737 14590 gene locus_tag LOCUS_01720 gene dxs 12737 14590 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366447.1 protein_id gnl|my_center|LOCUS_01720 14571 15206 gene locus_tag LOCUS_01730 14571 15206 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201105.1 protein_id gnl|my_center|LOCUS_01730 15230 16201 gene locus_tag LOCUS_01740 gene prsA 15230 16201 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 protein_id gnl|my_center|LOCUS_01740 16238 16402 gene locus_tag LOCUS_01750 16238 16402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 16447 16689 gene locus_tag LOCUS_01760 16447 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 16695 19187 gene locus_tag LOCUS_01770 16695 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 20724 19372 gene locus_tag LOCUS_01780 20724 19372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 20971 21333 gene locus_tag LOCUS_01790 20971 21333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 21320 22195 gene locus_tag LOCUS_01800 gene xerC 21320 22195 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456225.1 protein_id gnl|my_center|LOCUS_01800 22195 22779 gene locus_tag LOCUS_01810 22195 22779 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_01810 22783 25407 gene locus_tag LOCUS_01820 gene ppdK 22783 25407 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_01820 25599 26060 gene locus_tag LOCUS_01830 25599 26060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 26053 26310 gene locus_tag LOCUS_01840 26053 26310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 26455 26721 gene locus_tag LOCUS_01850 26455 26721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 27226 27696 gene locus_tag LOCUS_01860 27226 27696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 27848 29149 gene locus_tag LOCUS_01870 gene dnaB 27848 29149 CDS product replication initiation membrane attachment protein DnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229464.1 protein_id gnl|my_center|LOCUS_01870 29146 30054 gene locus_tag LOCUS_01880 gene dnaI 29146 30054 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830772.1 protein_id gnl|my_center|LOCUS_01880 30060 30257 gene locus_tag LOCUS_01890 30060 30257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 30427 31320 gene locus_tag LOCUS_01900 gene rbsK 30427 31320 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183538.1 protein_id gnl|my_center|LOCUS_01900 31304 31573 gene locus_tag LOCUS_01910 31304 31573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 31576 32073 gene locus_tag LOCUS_01920 31576 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 32122 32610 gene locus_tag LOCUS_01930 32122 32610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 33395 32664 gene locus_tag LOCUS_01940 33395 32664 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002912099.1 protein_id gnl|my_center|LOCUS_01940 34725 33388 gene locus_tag LOCUS_01950 34725 33388 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948178.1 protein_id gnl|my_center|LOCUS_01950 34882 35088 gene locus_tag LOCUS_01960 34882 35088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 35285 36784 gene locus_tag LOCUS_01970 35285 36784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 36894 39479 gene locus_tag LOCUS_01980 gene polA 36894 39479 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_01980 39488 40333 gene locus_tag LOCUS_01990 39488 40333 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_01990 41480 40353 gene locus_tag LOCUS_02000 41480 40353 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_02000 42959 41529 gene locus_tag LOCUS_02010 42959 41529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 43097 44890 gene locus_tag LOCUS_02020 43097 44890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 44902 45639 gene locus_tag LOCUS_02030 44902 45639 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_02030 45929 47410 gene locus_tag LOCUS_02040 45929 47410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 47568 49469 gene locus_tag LOCUS_02050 gene parE 47568 49469 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557340.1 protein_id gnl|my_center|LOCUS_02050 49472 52063 gene locus_tag LOCUS_02060 gene parC 49472 52063 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831210.1 protein_id gnl|my_center|LOCUS_02060 52363 52184 gene locus_tag LOCUS_02070 52363 52184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 52884 53186 gene locus_tag LOCUS_02080 gene rplU 52884 53186 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183340.1 protein_id gnl|my_center|LOCUS_02080 53188 53493 gene locus_tag LOCUS_02090 53188 53493 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830797.1 protein_id gnl|my_center|LOCUS_02090 53497 53784 gene locus_tag LOCUS_02100 gene rpmA 53497 53784 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_02100 53822 54226 gene locus_tag LOCUS_02110 53822 54226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 54344 54535 gene locus_tag LOCUS_02120 54344 54535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 54525 55172 gene locus_tag LOCUS_02130 54525 55172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 55169 56551 gene locus_tag LOCUS_02140 gene asnS 55169 56551 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_02140 56571 56963 gene locus_tag LOCUS_02150 56571 56963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 57182 58810 gene locus_tag LOCUS_02160 57182 58810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 58954 59961 gene locus_tag LOCUS_02170 gene hrcA 58954 59961 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_02170 59954 60466 gene locus_tag LOCUS_02180 gene grpE 59954 60466 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_02180 60466 60750 gene locus_tag LOCUS_02190 60466 60750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 60754 61041 gene locus_tag LOCUS_02200 60754 61041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 61044 62876 gene locus_tag LOCUS_02210 gene dnaK 61044 62876 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 protein_id gnl|my_center|LOCUS_02210 62939 64069 gene locus_tag LOCUS_02220 gene dnaJ 62939 64069 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990134.1 protein_id gnl|my_center|LOCUS_02220 64220 68500 gene locus_tag LOCUS_02230 64220 68500 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060005.1 protein_id gnl|my_center|LOCUS_02230 68674 69609 gene locus_tag LOCUS_02240 gene holA 68674 69609 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_02240 69717 72068 gene locus_tag LOCUS_02250 gene lon 69717 72068 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_02250 72037 72267 gene locus_tag LOCUS_02260 72037 72267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 72319 73014 gene locus_tag LOCUS_02270 72319 73014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 73001 73882 gene locus_tag LOCUS_02280 73001 73882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 74127 74291 gene locus_tag LOCUS_02290 74127 74291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 74284 74736 gene locus_tag LOCUS_02300 74284 74736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 74736 75176 gene locus_tag LOCUS_02310 74736 75176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 76063 75173 gene locus_tag LOCUS_02320 gene ylbJ 76063 75173 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273100.1 protein_id gnl|my_center|LOCUS_02320 76094 77104 gene locus_tag LOCUS_02330 76094 77104 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295493.1 protein_id gnl|my_center|LOCUS_02330 77129 77434 gene locus_tag LOCUS_02340 77129 77434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 77447 77857 gene locus_tag LOCUS_02350 gene nusB 77447 77857 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_02350 77850 79097 gene locus_tag LOCUS_02360 gene xseA 77850 79097 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_02360 79108 79326 gene locus_tag LOCUS_02370 79108 79326 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721552.1 protein_id gnl|my_center|LOCUS_02370 79347 79727 gene locus_tag LOCUS_02380 79347 79727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 79801 80772 gene locus_tag LOCUS_02390 79801 80772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 80877 81155 gene locus_tag LOCUS_02400 80877 81155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 81163 81465 gene locus_tag LOCUS_02410 81163 81465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 81522 83648 gene locus_tag LOCUS_02420 81522 83648 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832739.1 protein_id gnl|my_center|LOCUS_02420 83651 84358 gene locus_tag LOCUS_02430 83651 84358 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_02430 84428 85012 gene locus_tag LOCUS_02440 84428 85012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 85027 85431 gene locus_tag LOCUS_02450 85027 85431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 85478 86008 gene locus_tag LOCUS_02460 85478 86008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 86468 86854 gene locus_tag LOCUS_02470 86468 86854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 87153 87635 gene locus_tag LOCUS_02480 87153 87635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 87680 88771 gene locus_tag LOCUS_02490 gene mnmA 87680 88771 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183311.1 protein_id gnl|my_center|LOCUS_02490 88943 89731 gene locus_tag LOCUS_02500 88943 89731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 90039 90296 gene locus_tag LOCUS_02510 90039 90296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 90297 90560 gene locus_tag LOCUS_02520 90297 90560 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_02520 91472 90714 gene locus_tag LOCUS_02530 gene zupT 91472 90714 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811500.1 protein_id gnl|my_center|LOCUS_02530 92701 91499 gene locus_tag LOCUS_02540 92701 91499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 92828 92959 gene locus_tag LOCUS_02550 92828 92959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 94149 92992 gene locus_tag LOCUS_02560 gene deoB 94149 92992 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_02560 95027 94155 gene locus_tag LOCUS_02570 gene xerD 95027 94155 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_02570 97609 95102 gene locus_tag LOCUS_02580 97609 95102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 97741 97983 gene locus_tag LOCUS_02590 97741 97983 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_02590 97991 99187 gene locus_tag LOCUS_02600 97991 99187 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812946.1 protein_id gnl|my_center|LOCUS_02600 100530 99199 gene locus_tag LOCUS_02610 100530 99199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 101643 100711 gene locus_tag LOCUS_02620 101643 100711 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_02620 102354 101683 gene locus_tag LOCUS_02630 102354 101683 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_02630 103039 102554 gene locus_tag LOCUS_02640 103039 102554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 103817 103029 gene locus_tag LOCUS_02650 103817 103029 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_02650 105332 103818 gene locus_tag LOCUS_02660 105332 103818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 106601 105351 gene locus_tag LOCUS_02670 gene hisS 106601 105351 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830876.1 protein_id gnl|my_center|LOCUS_02670 108286 106784 gene locus_tag LOCUS_02680 108286 106784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 109826 108507 gene locus_tag LOCUS_02690 gene hisS 109826 108507 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_02690 111132 109885 gene locus_tag LOCUS_02700 gene tig 111132 109885 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105215.1 protein_id gnl|my_center|LOCUS_02700 111622 111149 gene locus_tag LOCUS_02710 gene greA 111622 111149 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475971.1 protein_id gnl|my_center|LOCUS_02710 112843 111677 gene locus_tag LOCUS_02720 112843 111677 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830748.1 protein_id gnl|my_center|LOCUS_02720 113625 112840 gene locus_tag LOCUS_02730 113625 112840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 114205 113627 gene locus_tag LOCUS_02740 114205 113627 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389102.1 protein_id gnl|my_center|LOCUS_02740 115274 114192 gene locus_tag LOCUS_02750 gene mltG 115274 114192 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475970.1 protein_id gnl|my_center|LOCUS_02750 115519 115277 gene locus_tag LOCUS_02760 115519 115277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 115928 115509 gene locus_tag LOCUS_02770 gene ruvX 115928 115509 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 protein_id gnl|my_center|LOCUS_02770 116164 115925 gene locus_tag LOCUS_02780 116164 115925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 116265 116340 gene locus_tag LOCUS_t00040 116265 116340 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 117653 116403 gene locus_tag LOCUS_02790 117653 116403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 118224 117655 gene locus_tag LOCUS_02800 118224 117655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 118812 118237 gene locus_tag LOCUS_02810 118812 118237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 119632 118886 gene locus_tag LOCUS_02820 119632 118886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 120152 119652 gene locus_tag LOCUS_02830 120152 119652 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_02830 120298 120477 gene locus_tag LOCUS_02840 120298 120477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 121323 120586 gene locus_tag LOCUS_02850 121323 120586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 121888 121316 gene locus_tag LOCUS_02860 121888 121316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 121967 122320 gene locus_tag LOCUS_02870 121967 122320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 122734 122405 gene locus_tag LOCUS_02880 122734 122405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 123653 122727 gene locus_tag LOCUS_02890 123653 122727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence03 566 1099 gene locus_tag LOCUS_02900 566 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 1284 1739 gene locus_tag LOCUS_02910 1284 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 1850 2437 gene locus_tag LOCUS_02920 1850 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2546 3571 gene locus_tag LOCUS_02930 gene bdhA 2546 3571 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645827.1 protein_id gnl|my_center|LOCUS_02930 4264 3698 gene locus_tag LOCUS_02940 4264 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459317.1 protein_id gnl|my_center|LOCUS_02940 4315 5388 gene locus_tag LOCUS_02950 4315 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5588 6859 gene locus_tag LOCUS_02960 5588 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 6870 7277 gene locus_tag LOCUS_02970 6870 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 7274 7930 gene locus_tag LOCUS_02980 gene sigF 7274 7930 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403644.1 protein_id gnl|my_center|LOCUS_02980 7971 8405 gene locus_tag LOCUS_02990 gene spoVAC 7971 8405 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 protein_id gnl|my_center|LOCUS_02990 8402 9364 gene locus_tag LOCUS_03000 gene spoVAD 8402 9364 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_03000 9361 9711 gene locus_tag LOCUS_03010 gene spoVAE 9361 9711 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345915.1 protein_id gnl|my_center|LOCUS_03010 9783 11129 gene locus_tag LOCUS_03020 9783 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 11122 11841 gene locus_tag LOCUS_03030 gene scpA 11122 11841 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199753.1 protein_id gnl|my_center|LOCUS_03030 11844 12410 gene locus_tag LOCUS_03040 gene scpB 11844 12410 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723597.1 protein_id gnl|my_center|LOCUS_03040 12525 12441 gene locus_tag LOCUS_t00050 12525 12441 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13679 12810 gene locus_tag LOCUS_03050 13679 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 13813 15438 gene locus_tag LOCUS_03060 13813 15438 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_03060 15482 15557 gene locus_tag LOCUS_t00060 15482 15557 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15618 15995 gene locus_tag LOCUS_03070 15618 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 16042 17616 gene locus_tag LOCUS_03080 gene metG 16042 17616 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226758.1 protein_id gnl|my_center|LOCUS_03080 17710 18897 gene locus_tag LOCUS_03090 17710 18897 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_03090 20072 18969 gene locus_tag LOCUS_03100 20072 18969 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426064.1 protein_id gnl|my_center|LOCUS_03100 21049 20117 gene locus_tag LOCUS_03110 21049 20117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 21169 21408 gene locus_tag LOCUS_03120 21169 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 21485 21643 gene locus_tag LOCUS_03130 21485 21643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 21895 22137 gene locus_tag LOCUS_03140 21895 22137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 22140 25781 gene locus_tag LOCUS_03150 22140 25781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 25897 26541 gene locus_tag LOCUS_03160 25897 26541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 26677 27309 gene locus_tag LOCUS_03170 26677 27309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 27302 30979 gene locus_tag LOCUS_03180 27302 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 30983 32689 gene locus_tag LOCUS_03190 30983 32689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 32770 33570 gene locus_tag LOCUS_03200 32770 33570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 33603 34700 gene locus_tag LOCUS_03210 33603 34700 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094374099.1 protein_id gnl|my_center|LOCUS_03210 34717 35616 gene locus_tag LOCUS_03220 34717 35616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 35613 36413 gene locus_tag LOCUS_03230 35613 36413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 36606 36857 gene locus_tag LOCUS_03240 36606 36857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 36877 37338 gene locus_tag LOCUS_03250 36877 37338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 37350 38333 gene locus_tag LOCUS_03260 37350 38333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 38407 38769 gene locus_tag LOCUS_03270 38407 38769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 38845 40263 gene locus_tag LOCUS_03280 38845 40263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 40276 42267 gene locus_tag LOCUS_03290 40276 42267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 42290 42607 gene locus_tag LOCUS_03300 42290 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 42579 43139 gene locus_tag LOCUS_03310 42579 43139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 43136 44911 gene locus_tag LOCUS_03320 43136 44911 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239784.1 protein_id gnl|my_center|LOCUS_03320 44926 47565 gene locus_tag LOCUS_03330 44926 47565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 47574 48344 gene locus_tag LOCUS_03340 47574 48344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 48448 49293 gene locus_tag LOCUS_03350 48448 49293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 49363 50073 gene locus_tag LOCUS_03360 49363 50073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 50075 51226 gene locus_tag LOCUS_03370 50075 51226 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467821.1 protein_id gnl|my_center|LOCUS_03370 51329 52342 gene locus_tag LOCUS_03380 51329 52342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 52393 52656 gene locus_tag LOCUS_03390 gene spoVS 52393 52656 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459952.1 protein_id gnl|my_center|LOCUS_03390 52880 55690 gene locus_tag LOCUS_03400 gene uvrA 52880 55690 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_03400 55875 56258 gene locus_tag LOCUS_03410 55875 56258 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_03410 56262 57086 gene locus_tag LOCUS_03420 gene lgt 56262 57086 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_03420 57102 57980 gene locus_tag LOCUS_03430 gene trxB 57102 57980 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288072.1 protein_id gnl|my_center|LOCUS_03430 57977 58675 gene locus_tag LOCUS_03440 gene rlmB 57977 58675 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_03440 58672 59232 gene locus_tag LOCUS_03450 58672 59232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 59384 61033 gene locus_tag LOCUS_03460 59384 61033 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823087.1 protein_id gnl|my_center|LOCUS_03460 61035 62159 gene locus_tag LOCUS_03470 61035 62159 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358363.1 protein_id gnl|my_center|LOCUS_03470 62164 63333 gene locus_tag LOCUS_03480 gene thiI 62164 63333 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_03480 63437 63976 gene locus_tag LOCUS_03490 63437 63976 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262552.1 protein_id gnl|my_center|LOCUS_03490 64085 66106 gene locus_tag LOCUS_03500 gene topA 64085 66106 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_03500 66170 66610 gene locus_tag LOCUS_03510 66170 66610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 66610 66936 gene locus_tag LOCUS_03520 66610 66936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 67066 67974 gene locus_tag LOCUS_03530 67066 67974 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_03530 68161 68694 gene locus_tag LOCUS_03540 gene cotE 68161 68694 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288800.1 protein_id gnl|my_center|LOCUS_03540 68763 69347 gene locus_tag LOCUS_03550 gene yihA 68763 69347 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732571.1 protein_id gnl|my_center|LOCUS_03550 69364 70839 gene locus_tag LOCUS_03560 69364 70839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 70849 71331 gene locus_tag LOCUS_03570 70849 71331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 71408 71623 gene locus_tag LOCUS_03580 71408 71623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 71883 72518 gene locus_tag LOCUS_03590 71883 72518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 72587 73888 gene locus_tag LOCUS_03600 gene der 72587 73888 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_03600 74408 74677 gene locus_tag LOCUS_03610 gene rpsO 74408 74677 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 protein_id gnl|my_center|LOCUS_03610 74723 76879 gene locus_tag LOCUS_03620 gene pnp 74723 76879 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378800.1 protein_id gnl|my_center|LOCUS_03620 76904 77419 gene locus_tag LOCUS_03630 gene trmL 76904 77419 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_03630 77668 78849 gene locus_tag LOCUS_03640 gene tyrS 77668 78849 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_03640 78925 79602 gene locus_tag LOCUS_03650 78925 79602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 79604 80446 gene locus_tag LOCUS_03660 79604 80446 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 protein_id gnl|my_center|LOCUS_03660 80479 80643 gene locus_tag LOCUS_03670 80479 80643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 81845 80640 gene locus_tag LOCUS_03680 gene kinB 81845 80640 CDS product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228853.1 protein_id gnl|my_center|LOCUS_03680 82254 81931 gene locus_tag LOCUS_03690 82254 81931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 82390 82869 gene locus_tag LOCUS_03700 82390 82869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 83211 82882 gene locus_tag LOCUS_03710 83211 82882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 83855 84082 gene locus_tag LOCUS_03720 83855 84082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 84132 84605 gene locus_tag LOCUS_03730 gene lspA 84132 84605 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460664.1 protein_id gnl|my_center|LOCUS_03730 84586 85479 gene locus_tag LOCUS_03740 84586 85479 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_03740 85921 85466 gene locus_tag LOCUS_03750 85921 85466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 85982 87112 gene locus_tag LOCUS_03760 85982 87112 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948167.1 protein_id gnl|my_center|LOCUS_03760 87173 87664 gene locus_tag LOCUS_03770 87173 87664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 87721 87927 gene locus_tag LOCUS_03780 87721 87927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 88017 88784 gene locus_tag LOCUS_03790 88017 88784 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948839.1 protein_id gnl|my_center|LOCUS_03790 88775 89617 gene locus_tag LOCUS_03800 88775 89617 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485386.1 protein_id gnl|my_center|LOCUS_03800 89607 90362 gene locus_tag LOCUS_03810 89607 90362 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837717.1 protein_id gnl|my_center|LOCUS_03810 90359 91090 gene locus_tag LOCUS_03820 gene truA 90359 91090 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_03820 91077 91727 gene locus_tag LOCUS_03830 91077 91727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 91771 92616 gene locus_tag LOCUS_03840 91771 92616 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_03840 92669 93280 gene locus_tag LOCUS_03850 92669 93280 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_03850 93341 93919 gene locus_tag LOCUS_03860 93341 93919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 93921 94292 gene locus_tag LOCUS_03870 93921 94292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 94382 95062 gene locus_tag LOCUS_03880 94382 95062 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_03880 95059 95850 gene locus_tag LOCUS_03890 95059 95850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 96068 96742 gene locus_tag LOCUS_03900 96068 96742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438655.1 protein_id gnl|my_center|LOCUS_03900 96739 99327 gene locus_tag LOCUS_03910 96739 99327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861226.1 protein_id gnl|my_center|LOCUS_03910 99438 100076 gene locus_tag LOCUS_03920 99438 100076 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434705.1 protein_id gnl|my_center|LOCUS_03920 100069 101262 gene locus_tag LOCUS_03930 100069 101262 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861225.1 protein_id gnl|my_center|LOCUS_03930 101319 102995 gene locus_tag LOCUS_03940 gene argS 101319 102995 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_03940 103040 103594 gene locus_tag LOCUS_03950 103040 103594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 103689 105452 gene locus_tag LOCUS_03960 103689 105452 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_03960 105514 107340 gene locus_tag LOCUS_03970 105514 107340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 107343 108074 gene locus_tag LOCUS_03980 107343 108074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 108162 110297 gene locus_tag LOCUS_03990 108162 110297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 110552 110794 gene locus_tag LOCUS_04000 110552 110794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 110800 113274 gene locus_tag LOCUS_04010 110800 113274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence04 61 933 gene locus_tag LOCUS_04020 61 933 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_04020 926 1666 gene locus_tag LOCUS_04030 926 1666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_04030 1659 2441 gene locus_tag LOCUS_04040 1659 2441 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_04040 4527 2596 gene locus_tag LOCUS_04050 4527 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5077 4622 gene locus_tag LOCUS_04060 5077 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5829 5152 gene locus_tag LOCUS_04070 5829 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 6627 6025 gene locus_tag LOCUS_04080 6627 6025 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_04080 8448 6634 gene locus_tag LOCUS_04090 gene typA 8448 6634 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722695.1 protein_id gnl|my_center|LOCUS_04090 10031 8622 gene locus_tag LOCUS_04100 10031 8622 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_04100 10635 10105 gene locus_tag LOCUS_04110 10635 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 11756 10632 gene locus_tag LOCUS_04120 11756 10632 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_04120 12825 11857 gene locus_tag LOCUS_04130 12825 11857 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831154.1 protein_id gnl|my_center|LOCUS_04130 13862 12822 gene locus_tag LOCUS_04140 13862 12822 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_04140 15953 14121 gene locus_tag LOCUS_04150 15953 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 17368 15989 gene locus_tag LOCUS_04160 17368 15989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 19633 17384 gene locus_tag LOCUS_04170 19633 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 20536 19745 gene locus_tag LOCUS_04180 20536 19745 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_04180 21318 20605 gene locus_tag LOCUS_04190 21318 20605 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721422.1 protein_id gnl|my_center|LOCUS_04190 21514 21918 gene locus_tag LOCUS_04200 21514 21918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 22520 21930 gene locus_tag LOCUS_04210 22520 21930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 23680 22517 gene locus_tag LOCUS_04220 23680 22517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 23787 25895 gene locus_tag LOCUS_04230 gene rnr 23787 25895 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081010.1 protein_id gnl|my_center|LOCUS_04230 25904 26581 gene locus_tag LOCUS_04240 25904 26581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 26578 27732 gene locus_tag LOCUS_04250 26578 27732 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115768.1 protein_id gnl|my_center|LOCUS_04250 28780 27920 gene locus_tag LOCUS_04260 28780 27920 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_04260 29728 28790 gene locus_tag LOCUS_04270 29728 28790 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_04270 31136 30057 gene locus_tag LOCUS_04280 gene htrC 31136 30057 CDS product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 protein_id gnl|my_center|LOCUS_04280 32085 31150 gene locus_tag LOCUS_04290 32085 31150 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_04290 32362 32156 gene locus_tag LOCUS_04300 32362 32156 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_04300 32483 32352 gene locus_tag LOCUS_04310 32483 32352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 33250 32852 gene locus_tag LOCUS_04320 gene rpsI 33250 32852 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183390.1 protein_id gnl|my_center|LOCUS_04320 33687 33259 gene locus_tag LOCUS_04330 gene rplM 33687 33259 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_04330 33957 35060 gene locus_tag LOCUS_04340 33957 35060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 35189 35317 gene locus_tag LOCUS_04350 35189 35317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 35487 36467 gene locus_tag LOCUS_04360 gene dusB 35487 36467 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023223.1 protein_id gnl|my_center|LOCUS_04360 36542 37150 gene locus_tag LOCUS_04370 36542 37150 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_04370 37782 39278 gene locus_tag LOCUS_04380 gene lysS 37782 39278 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905307.1 protein_id gnl|my_center|LOCUS_04380 39387 40835 gene locus_tag LOCUS_04390 39387 40835 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659870.1 protein_id gnl|my_center|LOCUS_04390 40922 43030 gene locus_tag LOCUS_04400 40922 43030 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 protein_id gnl|my_center|LOCUS_04400 43057 43722 gene locus_tag LOCUS_04410 43057 43722 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109966.1 protein_id gnl|my_center|LOCUS_04410 43972 43757 gene locus_tag LOCUS_04420 43972 43757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 44469 43990 gene locus_tag LOCUS_04430 gene ssb 44469 43990 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981967.1 protein_id gnl|my_center|LOCUS_04430 44761 44474 gene locus_tag LOCUS_04440 gene rpsF 44761 44474 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_04440 47639 44958 gene locus_tag LOCUS_04450 47639 44958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 47788 47985 gene locus_tag LOCUS_04460 47788 47985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 48872 48150 gene locus_tag LOCUS_04470 48872 48150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 49982 48882 gene locus_tag LOCUS_04480 gene ychF 49982 48882 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524669.1 protein_id gnl|my_center|LOCUS_04480 51522 49996 gene locus_tag LOCUS_04490 51522 49996 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_04490 51697 51512 gene locus_tag LOCUS_04500 51697 51512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 52584 51700 gene locus_tag LOCUS_04510 gene spo0J 52584 51700 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051839.1 protein_id gnl|my_center|LOCUS_04510 53359 52535 gene locus_tag LOCUS_04520 53359 52535 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_04520 54516 53533 gene locus_tag LOCUS_04530 54516 53533 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399688.1 protein_id gnl|my_center|LOCUS_04530 56433 54556 gene locus_tag LOCUS_04540 gene ftsH 56433 54556 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 protein_id gnl|my_center|LOCUS_04540 57774 56449 gene locus_tag LOCUS_04550 gene tilS 57774 56449 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655473.1 protein_id gnl|my_center|LOCUS_04550 58408 57776 gene locus_tag LOCUS_04560 58408 57776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 60363 58405 gene locus_tag LOCUS_04570 60363 58405 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964743.1 protein_id gnl|my_center|LOCUS_04570 61340 60459 gene locus_tag LOCUS_04580 61340 60459 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226530.1 protein_id gnl|my_center|LOCUS_04580 63340 61343 gene locus_tag LOCUS_04590 63340 61343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 63814 63350 gene locus_tag LOCUS_04600 63814 63350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 64271 63903 gene locus_tag LOCUS_04610 64271 63903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 66243 64264 gene locus_tag LOCUS_04620 gene ligA 66243 64264 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 protein_id gnl|my_center|LOCUS_04620 68542 66461 gene locus_tag LOCUS_04630 gene pcrA 68542 66461 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989805.1 protein_id gnl|my_center|LOCUS_04630 68898 68605 gene locus_tag LOCUS_04640 68898 68605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 69179 68901 gene locus_tag LOCUS_04650 69179 68901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 69536 69216 gene locus_tag LOCUS_04660 69536 69216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 69823 69533 gene locus_tag LOCUS_04670 gene yabP 69823 69533 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059104.1 protein_id gnl|my_center|LOCUS_04670 70144 69869 gene locus_tag LOCUS_04680 gene spoVG 70144 69869 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_04680 70452 70234 gene locus_tag LOCUS_04690 70452 70234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 71201 70449 gene locus_tag LOCUS_04700 gene yabG 71201 70449 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458914.1 protein_id gnl|my_center|LOCUS_04700 72058 71276 gene locus_tag LOCUS_04710 gene rsmA 72058 71276 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_04710 72678 72058 gene locus_tag LOCUS_04720 72678 72058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 73460 72717 gene locus_tag LOCUS_04730 73460 72717 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_04730 73700 73473 gene locus_tag LOCUS_04740 73700 73473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 74572 74078 gene locus_tag LOCUS_04750 74572 74078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 74875 74684 gene locus_tag LOCUS_04760 74875 74684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 74972 75643 gene locus_tag LOCUS_04770 74972 75643 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 protein_id gnl|my_center|LOCUS_04770 76194 75640 gene locus_tag LOCUS_04780 76194 75640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 76970 76263 gene locus_tag LOCUS_04790 76970 76263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 77803 76961 gene locus_tag LOCUS_04800 77803 76961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 78652 77822 gene locus_tag LOCUS_04810 78652 77822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 79205 78726 gene locus_tag LOCUS_04820 79205 78726 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546719.1 protein_id gnl|my_center|LOCUS_04820 81396 79198 gene locus_tag LOCUS_04830 81396 79198 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830636.1 protein_id gnl|my_center|LOCUS_04830 81973 81494 gene locus_tag LOCUS_04840 81973 81494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 82598 82032 gene locus_tag LOCUS_04850 82598 82032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 83276 83581 gene locus_tag LOCUS_04860 83276 83581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 83699 83959 gene locus_tag LOCUS_04870 83699 83959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 85178 83925 gene locus_tag LOCUS_04880 85178 83925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167098.1 protein_id gnl|my_center|LOCUS_04880 85307 87091 gene locus_tag LOCUS_04890 85307 87091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 87385 87711 gene locus_tag LOCUS_04900 87385 87711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 87916 88041 gene locus_tag LOCUS_04910 87916 88041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 88992 88408 gene locus_tag LOCUS_04920 88992 88408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence05 1806 2573 gene locus_tag LOCUS_04930 gene ucpA 1806 2573 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517444.1 protein_id gnl|my_center|LOCUS_04930 2842 5925 gene locus_tag LOCUS_04940 gene ileS 2842 5925 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_04940 6082 8415 gene locus_tag LOCUS_04950 6082 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8412 11543 gene locus_tag LOCUS_04960 gene addA 8412 11543 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_04960 11693 12094 gene locus_tag LOCUS_04970 11693 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 12811 12119 gene locus_tag LOCUS_04980 gene sigK 12811 12119 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_04980 12904 13710 gene locus_tag LOCUS_04990 12904 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 13864 14826 gene locus_tag LOCUS_05000 13864 14826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 14841 17462 gene locus_tag LOCUS_05010 14841 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 17539 18372 gene locus_tag LOCUS_05020 17539 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 18444 18614 gene locus_tag LOCUS_05030 gene rpmG 18444 18614 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100510685.1 protein_id gnl|my_center|LOCUS_05030 18617 19174 gene locus_tag LOCUS_05040 gene efp 18617 19174 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_05040 19399 21045 gene locus_tag LOCUS_05050 19399 21045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 21211 21068 gene locus_tag LOCUS_05060 21211 21068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 21426 21265 gene locus_tag LOCUS_05070 21426 21265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 21523 22413 gene locus_tag LOCUS_05080 21523 22413 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166314.1 protein_id gnl|my_center|LOCUS_05080 22654 22406 gene locus_tag LOCUS_05090 22654 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 23225 22788 gene locus_tag LOCUS_05100 23225 22788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 23382 23292 gene locus_tag LOCUS_t00070 23382 23292 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23502 25286 gene locus_tag LOCUS_05110 gene lepA 23502 25286 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_05110 25484 26044 gene locus_tag LOCUS_05120 25484 26044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 26187 27137 gene locus_tag LOCUS_05130 26187 27137 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_05130 27134 27691 gene locus_tag LOCUS_05140 27134 27691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 27821 27985 gene locus_tag LOCUS_05150 27821 27985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 28222 28818 gene locus_tag LOCUS_05160 28222 28818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 28881 29573 gene locus_tag LOCUS_05170 gene rplA 28881 29573 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_05170 29724 30227 gene locus_tag LOCUS_05180 gene rplJ 29724 30227 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_05180 30227 30595 gene locus_tag LOCUS_05190 gene rplL 30227 30595 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156436.1 protein_id gnl|my_center|LOCUS_05190 30660 31250 gene locus_tag LOCUS_05200 30660 31250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 protein_id gnl|my_center|LOCUS_05200 31367 34978 gene locus_tag LOCUS_05210 gene rpoB 31367 34978 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_05210 34981 38691 gene locus_tag LOCUS_05220 gene rpoC 34981 38691 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 protein_id gnl|my_center|LOCUS_05220 38781 38948 gene locus_tag LOCUS_05230 38781 38948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 39182 40477 gene locus_tag LOCUS_05240 39182 40477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 40583 41869 gene locus_tag LOCUS_05250 gene obgE 40583 41869 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_05250 41879 42403 gene locus_tag LOCUS_05260 41879 42403 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765311.1 protein_id gnl|my_center|LOCUS_05260 42396 43391 gene locus_tag LOCUS_05270 gene yqeH 42396 43391 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832784.1 protein_id gnl|my_center|LOCUS_05270 43400 45175 gene locus_tag LOCUS_05280 gene mutL 43400 45175 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_05280 46266 45364 gene locus_tag LOCUS_05290 46266 45364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 46400 47410 gene locus_tag LOCUS_05300 gene miaA 46400 47410 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_05300 48274 47387 gene locus_tag LOCUS_05310 48274 47387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 48386 49081 gene locus_tag LOCUS_05320 48386 49081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 49096 49755 gene locus_tag LOCUS_05330 49096 49755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 50061 51542 gene locus_tag LOCUS_05340 50061 51542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 52434 51571 gene locus_tag LOCUS_05350 52434 51571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 52703 52900 gene locus_tag LOCUS_05360 52703 52900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 52984 53649 gene locus_tag LOCUS_05370 52984 53649 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190120.1 protein_id gnl|my_center|LOCUS_05370 53653 54270 gene locus_tag LOCUS_05380 53653 54270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 54267 55523 gene locus_tag LOCUS_05390 gene mtaB 54267 55523 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108668.1 protein_id gnl|my_center|LOCUS_05390 55577 56656 gene locus_tag LOCUS_05400 55577 56656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 57206 58069 gene locus_tag LOCUS_05410 57206 58069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 58184 58432 gene locus_tag LOCUS_05420 58184 58432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 58425 59483 gene locus_tag LOCUS_05430 gene nusA 58425 59483 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_05430 59506 59757 gene locus_tag LOCUS_05440 59506 59757 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071128.1 protein_id gnl|my_center|LOCUS_05440 59763 61865 gene locus_tag LOCUS_05450 gene infB 59763 61865 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 protein_id gnl|my_center|LOCUS_05450 61862 62206 gene locus_tag LOCUS_05460 gene rbfA 61862 62206 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948461.1 protein_id gnl|my_center|LOCUS_05460 62298 63077 gene locus_tag LOCUS_05470 62298 63077 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963408.1 protein_id gnl|my_center|LOCUS_05470 63180 63917 gene locus_tag LOCUS_05480 63180 63917 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_05480 63920 65659 gene locus_tag LOCUS_05490 gene pknB 63920 65659 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_05490 65649 66491 gene locus_tag LOCUS_05500 gene rsgA 65649 66491 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113932.1 protein_id gnl|my_center|LOCUS_05500 66475 67110 gene locus_tag LOCUS_05510 gene rpe 66475 67110 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_05510 67113 67511 gene locus_tag LOCUS_05520 67113 67511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 67668 68684 gene locus_tag LOCUS_05530 67668 68684 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_05530 68720 69010 gene locus_tag LOCUS_05540 68720 69010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 69058 69903 gene locus_tag LOCUS_05550 69058 69903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 69965 71143 gene locus_tag LOCUS_05560 69965 71143 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 protein_id gnl|my_center|LOCUS_05560 71155 72117 gene locus_tag LOCUS_05570 71155 72117 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545136.1 protein_id gnl|my_center|LOCUS_05570 72227 73270 gene locus_tag LOCUS_05580 72227 73270 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_05580 73331 73867 gene locus_tag LOCUS_05590 73331 73867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 73952 74797 gene locus_tag LOCUS_05600 gene cdaA 73952 74797 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115697.1 protein_id gnl|my_center|LOCUS_05600 74775 76148 gene locus_tag LOCUS_05610 74775 76148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence06 668 99 gene locus_tag LOCUS_05620 668 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2586 658 gene locus_tag LOCUS_05630 2586 658 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016920.1 protein_id gnl|my_center|LOCUS_05630 3179 2628 gene locus_tag LOCUS_05640 3179 2628 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 protein_id gnl|my_center|LOCUS_05640 5586 3229 gene locus_tag LOCUS_05650 gene pheT 5586 3229 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 protein_id gnl|my_center|LOCUS_05650 6629 5586 gene locus_tag LOCUS_05660 gene pheS 6629 5586 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_05660 8479 6896 gene locus_tag LOCUS_05670 8479 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 10925 8541 gene locus_tag LOCUS_05680 10925 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 11129 11395 gene locus_tag LOCUS_05690 11129 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 12917 11733 gene locus_tag LOCUS_05700 gene tuf 12917 11733 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290442.1 protein_id gnl|my_center|LOCUS_05700 15082 13010 gene locus_tag LOCUS_05710 gene fusA 15082 13010 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235056.1 protein_id gnl|my_center|LOCUS_05710 15576 15109 gene locus_tag LOCUS_05720 gene rpsG 15576 15109 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183520.1 protein_id gnl|my_center|LOCUS_05720 16015 15599 gene locus_tag LOCUS_05730 gene rpsL 16015 15599 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142341.1 protein_id gnl|my_center|LOCUS_05730 16787 16305 gene locus_tag LOCUS_05740 16787 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 17263 16787 gene locus_tag LOCUS_05750 17263 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 17690 17256 gene locus_tag LOCUS_05760 17690 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 18286 18077 gene locus_tag LOCUS_05770 18286 18077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 18847 18344 gene locus_tag LOCUS_05780 18847 18344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19346 18924 gene locus_tag LOCUS_05790 19346 18924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 21537 19378 gene locus_tag LOCUS_05800 gene pbpB 21537 19378 CDS product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 protein_id gnl|my_center|LOCUS_05800 21839 21549 gene locus_tag LOCUS_05810 21839 21549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 22762 21857 gene locus_tag LOCUS_05820 gene rsmH 22762 21857 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 protein_id gnl|my_center|LOCUS_05820 23186 22752 gene locus_tag LOCUS_05830 gene mraZ 23186 22752 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_05830 24917 23325 gene locus_tag LOCUS_05840 24917 23325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 25590 24985 gene locus_tag LOCUS_05850 25590 24985 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724076.1 protein_id gnl|my_center|LOCUS_05850 26726 25593 gene locus_tag LOCUS_05860 26726 25593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 26955 26716 gene locus_tag LOCUS_05870 26955 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 27406 26990 gene locus_tag LOCUS_05880 27406 26990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 29292 27439 gene locus_tag LOCUS_05890 gene abc-f 29292 27439 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602057.1 protein_id gnl|my_center|LOCUS_05890 29871 29332 gene locus_tag LOCUS_05900 gene frr 29871 29332 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_05900 32306 29913 gene locus_tag LOCUS_05910 32306 29913 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948591.1 protein_id gnl|my_center|LOCUS_05910 34483 32309 gene locus_tag LOCUS_05920 34483 32309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 35484 34543 gene locus_tag LOCUS_05930 35484 34543 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_05930 36431 35481 gene locus_tag LOCUS_05940 36431 35481 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_05940 36917 36453 gene locus_tag LOCUS_05950 36917 36453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 37612 36914 gene locus_tag LOCUS_05960 37612 36914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 38980 38192 gene locus_tag LOCUS_05970 38980 38192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 40692 38980 gene locus_tag LOCUS_05980 gene uvrC 40692 38980 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732777.1 protein_id gnl|my_center|LOCUS_05980 42533 40824 gene locus_tag LOCUS_05990 42533 40824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 43195 42749 gene locus_tag LOCUS_06000 43195 42749 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266965.1 protein_id gnl|my_center|LOCUS_06000 45336 43195 gene locus_tag LOCUS_06010 45336 43195 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_06010 47531 45336 gene locus_tag LOCUS_06020 gene secDF 47531 45336 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749795.1 protein_id gnl|my_center|LOCUS_06020 47809 47528 gene locus_tag LOCUS_06030 gene comN 47809 47528 CDS product post-transcriptional regulator ComN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398498.1 protein_id gnl|my_center|LOCUS_06030 48451 47930 gene locus_tag LOCUS_06040 48451 47930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 50716 48941 gene locus_tag LOCUS_06050 50716 48941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_06050 52683 50716 gene locus_tag LOCUS_06060 52683 50716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 53987 52974 gene locus_tag LOCUS_06070 gene hemW 53987 52974 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132086.1 protein_id gnl|my_center|LOCUS_06070 54461 54386 gene locus_tag LOCUS_t00080 54461 54386 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 54545 54469 gene locus_tag LOCUS_t00090 54545 54469 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 55891 54644 gene locus_tag LOCUS_06080 55891 54644 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476181.1 protein_id gnl|my_center|LOCUS_06080 57140 55878 gene locus_tag LOCUS_06090 57140 55878 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence07 700 2196 gene locus_tag LOCUS_06100 700 2196 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_06100 2193 3353 gene locus_tag LOCUS_06110 2193 3353 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_06110 3355 3585 gene locus_tag LOCUS_06120 3355 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3588 5153 gene locus_tag LOCUS_06130 3588 5153 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_06130 5166 6089 gene locus_tag LOCUS_06140 5166 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 6429 6082 gene locus_tag LOCUS_06150 gene acpS 6429 6082 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017085.1 protein_id gnl|my_center|LOCUS_06150 8401 6419 gene locus_tag LOCUS_06160 8401 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 8784 8467 gene locus_tag LOCUS_06170 8784 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 8898 10142 gene locus_tag LOCUS_06180 8898 10142 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272568.1 protein_id gnl|my_center|LOCUS_06180 10153 10458 gene locus_tag LOCUS_06190 10153 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10972 10451 gene locus_tag LOCUS_06200 10972 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11315 11007 gene locus_tag LOCUS_06210 11315 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 11436 13445 gene locus_tag LOCUS_06220 11436 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 13526 13602 gene locus_tag LOCUS_t00100 13526 13602 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13710 14930 gene locus_tag LOCUS_06230 gene pepT 13710 14930 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437954.1 protein_id gnl|my_center|LOCUS_06230 15914 14970 gene locus_tag LOCUS_06240 gene mgfK 15914 14970 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_06240 16868 15915 gene locus_tag LOCUS_06250 16868 15915 CDS product D-Ala-D-Ala carboxypeptidase VanY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948708.1 protein_id gnl|my_center|LOCUS_06250 17667 16939 gene locus_tag LOCUS_06260 17667 16939 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626384.1 protein_id gnl|my_center|LOCUS_06260 19070 17649 gene locus_tag LOCUS_06270 gene proS 19070 17649 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_06270 20066 19302 gene locus_tag LOCUS_06280 20066 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 20571 20059 gene locus_tag LOCUS_06290 20571 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 21470 20706 gene locus_tag LOCUS_06300 21470 20706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 21635 21559 gene locus_tag LOCUS_t00110 21635 21559 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21717 21641 gene locus_tag LOCUS_t00120 21717 21641 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21837 21762 gene locus_tag LOCUS_t00130 21837 21762 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 21917 21842 gene locus_tag LOCUS_t00140 21917 21842 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22001 21925 gene locus_tag LOCUS_t00150 22001 21925 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22112 22020 gene locus_tag LOCUS_t00160 22112 22020 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22208 22120 gene locus_tag LOCUS_t00170 22208 22120 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22309 22234 gene locus_tag LOCUS_t00180 22309 22234 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22397 22322 gene locus_tag LOCUS_t00190 22397 22322 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22488 22405 gene locus_tag LOCUS_t00200 22488 22405 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 22571 22496 gene locus_tag LOCUS_t00210 22571 22496 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22654 22578 gene locus_tag LOCUS_t00220 22654 22578 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23076 22714 gene locus_tag LOCUS_06310 gene yugI 23076 22714 CDS product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722395.1 protein_id gnl|my_center|LOCUS_06310 24021 23119 gene locus_tag LOCUS_06320 gene cotNH 24021 23119 CDS product spore coat-associated protein CotNH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242649.1 protein_id gnl|my_center|LOCUS_06320 25041 24058 gene locus_tag LOCUS_06330 25041 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 25379 25110 gene locus_tag LOCUS_06340 25379 25110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 26116 25418 gene locus_tag LOCUS_06350 26116 25418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 27080 26181 gene locus_tag LOCUS_06360 27080 26181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 27183 27380 gene locus_tag LOCUS_06370 27183 27380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 28120 27410 gene locus_tag LOCUS_06380 28120 27410 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294391.1 protein_id gnl|my_center|LOCUS_06380 29200 28145 gene locus_tag LOCUS_06390 gene dacB 29200 28145 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252638.1 protein_id gnl|my_center|LOCUS_06390 29781 29236 gene locus_tag LOCUS_06400 29781 29236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 30459 29827 gene locus_tag LOCUS_06410 30459 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 30662 30462 gene locus_tag LOCUS_06420 30662 30462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 30732 31535 gene locus_tag LOCUS_06430 30732 31535 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 protein_id gnl|my_center|LOCUS_06430 31926 31561 gene locus_tag LOCUS_06440 31926 31561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 33704 31950 gene locus_tag LOCUS_06450 gene pepF 33704 31950 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 protein_id gnl|my_center|LOCUS_06450 35320 33785 gene locus_tag LOCUS_06460 35320 33785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 36659 35325 gene locus_tag LOCUS_06470 36659 35325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 37793 36795 gene locus_tag LOCUS_06480 37793 36795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 38538 37786 gene locus_tag LOCUS_06490 38538 37786 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404464.1 protein_id gnl|my_center|LOCUS_06490 39574 38573 gene locus_tag LOCUS_06500 39574 38573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 40648 39575 gene locus_tag LOCUS_06510 40648 39575 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_06510 42903 41377 gene locus_tag LOCUS_06520 42903 41377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence08 1857 85 gene locus_tag LOCUS_06530 1857 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3131 1875 gene locus_tag LOCUS_06540 3131 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4290 3466 gene locus_tag LOCUS_06550 4290 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4570 4334 gene locus_tag LOCUS_06560 4570 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 5873 4590 gene locus_tag LOCUS_06570 gene serS 5873 4590 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_06570 6106 5870 gene locus_tag LOCUS_06580 6106 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 6581 6333 gene locus_tag LOCUS_06590 6581 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7541 6591 gene locus_tag LOCUS_06600 7541 6591 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_06600 8423 7713 gene locus_tag LOCUS_06610 gene deoD 8423 7713 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183561.1 protein_id gnl|my_center|LOCUS_06610 10621 8420 gene locus_tag LOCUS_06620 10621 8420 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990110.1 protein_id gnl|my_center|LOCUS_06620 12352 10634 gene locus_tag LOCUS_06630 gene ezrA 12352 10634 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989755.1 protein_id gnl|my_center|LOCUS_06630 12908 12429 gene locus_tag LOCUS_06640 12908 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 13156 13755 gene locus_tag LOCUS_06650 gene rpsD 13156 13755 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135311.1 protein_id gnl|my_center|LOCUS_06650 15175 14114 gene locus_tag LOCUS_06660 gene ftsZ 15175 14114 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888984.1 protein_id gnl|my_center|LOCUS_06660 16425 15187 gene locus_tag LOCUS_06670 gene ftsA 16425 15187 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731981.1 protein_id gnl|my_center|LOCUS_06670 17124 16489 gene locus_tag LOCUS_06680 gene nth 17124 16489 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933025.1 protein_id gnl|my_center|LOCUS_06680 17698 17108 gene locus_tag LOCUS_06690 17698 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 18779 17691 gene locus_tag LOCUS_06700 18779 17691 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 protein_id gnl|my_center|LOCUS_06700 19094 18822 gene locus_tag LOCUS_06710 gene hupB 19094 18822 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_06710 19651 19241 gene locus_tag LOCUS_06720 19651 19241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 21163 19691 gene locus_tag LOCUS_06730 gene spoIVA 21163 19691 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_06730 21348 21620 gene locus_tag LOCUS_06740 21348 21620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 23721 21625 gene locus_tag LOCUS_06750 gene clpB 23721 21625 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723824.1 protein_id gnl|my_center|LOCUS_06750 25012 23984 gene locus_tag LOCUS_06760 25012 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 25371 25015 gene locus_tag LOCUS_06770 25371 25015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 26524 25445 gene locus_tag LOCUS_06780 gene spoVE 26524 25445 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_06780 28236 26593 gene locus_tag LOCUS_06790 28236 26593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 29100 28468 gene locus_tag LOCUS_06800 29100 28468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 30117 29125 gene locus_tag LOCUS_06810 gene mraY 30117 29125 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_06810 32101 30191 gene locus_tag LOCUS_06820 32101 30191 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_06820 32784 32269 gene locus_tag LOCUS_06830 32784 32269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 34756 32843 gene locus_tag LOCUS_06840 gene tkt 34756 32843 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263527.1 protein_id gnl|my_center|LOCUS_06840 34971 34816 gene locus_tag LOCUS_06850 34971 34816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 35096 35713 gene locus_tag LOCUS_06860 gene lexA 35096 35713 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_06860 36298 35759 gene locus_tag LOCUS_06870 gene nusG 36298 35759 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288302.1 protein_id gnl|my_center|LOCUS_06870 36481 36302 gene locus_tag LOCUS_06880 36481 36302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 37247 36561 gene locus_tag LOCUS_06890 gene sigE 37247 36561 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_06890 38037 37249 gene locus_tag LOCUS_06900 38037 37249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 38903 38097 gene locus_tag LOCUS_06910 38903 38097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence09 2644 2339 gene locus_tag LOCUS_06920 2644 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 2725 3342 gene locus_tag LOCUS_06930 gene trmB 2725 3342 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_06930 3435 4052 gene locus_tag LOCUS_06940 3435 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4068 4970 gene locus_tag LOCUS_06950 4068 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 4973 5254 gene locus_tag LOCUS_06960 4973 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5247 5696 gene locus_tag LOCUS_06970 5247 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 5744 5983 gene locus_tag LOCUS_06980 gene spoVIF 5744 5983 CDS product sporulation-specific transcription regulator SopVIF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232870.1 protein_id gnl|my_center|LOCUS_06980 7513 6008 gene locus_tag LOCUS_06990 7513 6008 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_06990 7639 8688 gene locus_tag LOCUS_07000 gene murG 7639 8688 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181833.1 protein_id gnl|my_center|LOCUS_07000 8710 9123 gene locus_tag LOCUS_07010 8710 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 9140 9814 gene locus_tag LOCUS_07020 9140 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 9863 10636 gene locus_tag LOCUS_07030 gene sigG 9863 10636 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_07030 10713 12326 gene locus_tag LOCUS_07040 10713 12326 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434813.1 protein_id gnl|my_center|LOCUS_07040 12535 12777 gene locus_tag LOCUS_07050 12535 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 12783 15275 gene locus_tag LOCUS_07060 12783 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 15341 15607 gene locus_tag LOCUS_07070 gene rpsP 15341 15607 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_07070 15607 15849 gene locus_tag LOCUS_07080 15607 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 16164 18332 gene locus_tag LOCUS_07090 16164 18332 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398511.1 protein_id gnl|my_center|LOCUS_07090 18378 18518 gene locus_tag LOCUS_07100 18378 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 18616 19791 gene locus_tag LOCUS_07110 18616 19791 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355540.1 protein_id gnl|my_center|LOCUS_07110 19963 20601 gene locus_tag LOCUS_07120 19963 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 20666 21202 gene locus_tag LOCUS_07130 20666 21202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 21192 21413 gene locus_tag LOCUS_07140 21192 21413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 21443 23185 gene locus_tag LOCUS_07150 21443 23185 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_07150 23178 24197 gene locus_tag LOCUS_07160 gene rlmN 23178 24197 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124990.1 protein_id gnl|my_center|LOCUS_07160 24211 24402 gene locus_tag LOCUS_07170 24211 24402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 24492 25412 gene locus_tag LOCUS_07180 24492 25412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 25529 25453 gene locus_tag LOCUS_t00230 25529 25453 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25607 26833 gene locus_tag LOCUS_07190 25607 26833 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475459.1 protein_id gnl|my_center|LOCUS_07190 26939 28972 gene locus_tag LOCUS_07200 26939 28972 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_07200 28965 29111 gene locus_tag LOCUS_07210 28965 29111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 29121 29279 gene locus_tag LOCUS_07220 29121 29279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 29374 30567 gene locus_tag LOCUS_07230 29374 30567 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387163.1 protein_id gnl|my_center|LOCUS_07230 30572 31897 gene locus_tag LOCUS_07240 30572 31897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 31911 33239 gene locus_tag LOCUS_07250 31911 33239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 33356 33868 gene locus_tag LOCUS_07260 33356 33868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 33880 35595 gene locus_tag LOCUS_07270 gene dnaG 33880 35595 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_07270 35589 36899 gene locus_tag LOCUS_07280 gene rpoD 35589 36899 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_07280 36892 37506 gene locus_tag LOCUS_07290 36892 37506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 37842 37576 gene locus_tag LOCUS_07300 37842 37576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 37953 38639 gene locus_tag LOCUS_07310 37953 38639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 38934 39176 gene locus_tag LOCUS_07320 38934 39176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence10 321 109 gene locus_tag LOCUS_07330 321 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1574 348 gene locus_tag LOCUS_07340 gene eno 1574 348 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880276.1 protein_id gnl|my_center|LOCUS_07340 1685 1990 gene locus_tag LOCUS_07350 1685 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2050 3303 gene locus_tag LOCUS_07360 2050 3303 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387163.1 protein_id gnl|my_center|LOCUS_07360 3862 3317 gene locus_tag LOCUS_07370 3862 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 4506 4003 gene locus_tag LOCUS_07380 4506 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5091 4591 gene locus_tag LOCUS_07390 5091 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5293 5105 gene locus_tag LOCUS_07400 5293 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 5856 5314 gene locus_tag LOCUS_07410 gene infC 5856 5314 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_07410 7299 6073 gene locus_tag LOCUS_07420 7299 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 7735 7301 gene locus_tag LOCUS_07430 7735 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 8406 7744 gene locus_tag LOCUS_07440 gene trmD 8406 7744 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183438.1 protein_id gnl|my_center|LOCUS_07440 8882 8403 gene locus_tag LOCUS_07450 gene rimM 8882 8403 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232013.1 protein_id gnl|my_center|LOCUS_07450 9607 8888 gene locus_tag LOCUS_07460 9607 8888 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166692.1 protein_id gnl|my_center|LOCUS_07460 10248 9610 gene locus_tag LOCUS_07470 10248 9610 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436655.1 protein_id gnl|my_center|LOCUS_07470 10613 11131 gene locus_tag LOCUS_07480 10613 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 11953 11228 gene locus_tag LOCUS_07490 gene recO 11953 11228 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_07490 12964 12083 gene locus_tag LOCUS_07500 gene era 12964 12083 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_07500 13341 12961 gene locus_tag LOCUS_07510 gene cdd 13341 12961 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240361.1 protein_id gnl|my_center|LOCUS_07510 13781 13344 gene locus_tag LOCUS_07520 gene ybeY 13781 13344 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230039.1 protein_id gnl|my_center|LOCUS_07520 14456 13860 gene locus_tag LOCUS_07530 14456 13860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 15327 14449 gene locus_tag LOCUS_07540 gene tsf 15327 14449 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699817.1 protein_id gnl|my_center|LOCUS_07540 16257 15343 gene locus_tag LOCUS_07550 gene rpsB 16257 15343 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832557.1 protein_id gnl|my_center|LOCUS_07550 17311 16394 gene locus_tag LOCUS_07560 gene dinD 17311 16394 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_07560 19762 17663 gene locus_tag LOCUS_07570 19762 17663 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_07570 20492 19728 gene locus_tag LOCUS_07580 20492 19728 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990138.1 protein_id gnl|my_center|LOCUS_07580 23628 20722 gene locus_tag LOCUS_07590 23628 20722 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226919.1 protein_id gnl|my_center|LOCUS_07590 24204 23701 gene locus_tag LOCUS_07600 24204 23701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 24554 24333 gene locus_tag LOCUS_07610 24554 24333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 24928 24554 gene locus_tag LOCUS_07620 24928 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 25631 24948 gene locus_tag LOCUS_07630 gene radC 25631 24948 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888913.1 protein_id gnl|my_center|LOCUS_07630 26109 25672 gene locus_tag LOCUS_07640 26109 25672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 26381 26172 gene locus_tag LOCUS_07650 gene rpmF 26381 26172 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_07650 26866 26378 gene locus_tag LOCUS_07660 26866 26378 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082655.1 protein_id gnl|my_center|LOCUS_07660 27613 26915 gene locus_tag LOCUS_07670 27613 26915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 28856 27651 gene locus_tag LOCUS_07680 28856 27651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 29307 28888 gene locus_tag LOCUS_07690 gene mscL 29307 28888 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728855.1 protein_id gnl|my_center|LOCUS_07690 29789 29307 gene locus_tag LOCUS_07700 29789 29307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 30682 29906 gene locus_tag LOCUS_07710 30682 29906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 31004 30920 gene locus_tag LOCUS_t00240 31004 30920 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31085 31009 gene locus_tag LOCUS_t00250 31085 31009 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31590 31168 gene locus_tag LOCUS_07720 31590 31168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 32207 31899 gene locus_tag LOCUS_07730 32207 31899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 32738 32316 gene locus_tag LOCUS_07740 gene nifU 32738 32316 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_07740 33916 32741 gene locus_tag LOCUS_07750 gene nifS 33916 32741 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_07750 34202 33921 gene locus_tag LOCUS_07760 34202 33921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 34932 34399 gene locus_tag LOCUS_07770 34932 34399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 35737 34991 gene locus_tag LOCUS_07780 35737 34991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence11 <1 671 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttaataccatttaatatgacatagatctaaaac 1421 744 gene locus_tag LOCUS_07790 1421 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1723 1418 gene locus_tag LOCUS_07800 gene cas2 1723 1418 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_07800 2600 1728 gene locus_tag LOCUS_07810 gene cas1 2600 1728 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_07810 6609 2590 gene locus_tag LOCUS_07820 gene cas9 6609 2590 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040087.1 protein_id gnl|my_center|LOCUS_07820 10039 6863 gene locus_tag LOCUS_07830 10039 6863 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373559.1 protein_id gnl|my_center|LOCUS_07830 11753 10248 gene locus_tag LOCUS_07840 11753 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 11889 12080 gene locus_tag LOCUS_07850 11889 12080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 14500 12089 gene locus_tag LOCUS_07860 gene leuS 14500 12089 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_07860 14861 14493 gene locus_tag LOCUS_07870 14861 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 17615 15219 gene locus_tag LOCUS_07880 17615 15219 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688713.1 protein_id gnl|my_center|LOCUS_07880 18783 17659 gene locus_tag LOCUS_07890 18783 17659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 19174 18776 gene locus_tag LOCUS_07900 19174 18776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 19907 19233 gene locus_tag LOCUS_07910 19907 19233 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 protein_id gnl|my_center|LOCUS_07910 20814 20377 gene locus_tag LOCUS_07920 20814 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 21185 20811 gene locus_tag LOCUS_07930 21185 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 21268 21789 gene locus_tag LOCUS_07940 21268 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 22867 21791 gene locus_tag LOCUS_07950 22867 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 24660 22927 gene locus_tag LOCUS_07960 24660 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 26380 24668 gene locus_tag LOCUS_07970 26380 24668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 28361 26712 gene locus_tag LOCUS_07980 28361 26712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 30045 28366 gene locus_tag LOCUS_07990 30045 28366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 30449 30093 gene locus_tag LOCUS_08000 30449 30093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 30974 30486 gene locus_tag LOCUS_08010 30974 30486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence12 2584 1547 gene locus_tag LOCUS_08020 gene recA 2584 1547 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_08020 3345 2752 gene locus_tag LOCUS_08030 gene pgsA 3345 2752 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183559.1 protein_id gnl|my_center|LOCUS_08030 3829 3329 gene locus_tag LOCUS_08040 3829 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 4503 4189 gene locus_tag LOCUS_08050 gene gpsB 4503 4189 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622431.1 protein_id gnl|my_center|LOCUS_08050 5445 4753 gene locus_tag LOCUS_08060 5445 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6371 5442 gene locus_tag LOCUS_08070 gene fmt 6371 5442 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_08070 8584 6413 gene locus_tag LOCUS_08080 8584 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 9102 8581 gene locus_tag LOCUS_08090 9102 8581 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048078.1 protein_id gnl|my_center|LOCUS_08090 9593 9099 gene locus_tag LOCUS_08100 9593 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9806 10288 gene locus_tag LOCUS_08110 9806 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 10962 10294 gene locus_tag LOCUS_08120 10962 10294 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_08120 13381 11030 gene locus_tag LOCUS_08130 13381 11030 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_08130 15017 13488 gene locus_tag LOCUS_08140 15017 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 15548 15072 gene locus_tag LOCUS_08150 15548 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 15627 15902 gene locus_tag LOCUS_08160 15627 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 18153 16621 gene locus_tag LOCUS_08170 18153 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 18274 19473 gene locus_tag LOCUS_08180 18274 19473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 19993 19511 gene locus_tag LOCUS_08190 19993 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 20559 20077 gene locus_tag LOCUS_08200 20559 20077 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775250.1 protein_id gnl|my_center|LOCUS_08200 21649 20540 gene locus_tag LOCUS_08210 21649 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 22060 21749 gene locus_tag LOCUS_08220 22060 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 22634 22122 gene locus_tag LOCUS_08230 22634 22122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 23950 22643 gene locus_tag LOCUS_08240 gene ffh 23950 22643 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_08240 24219 24356 gene locus_tag LOCUS_08250 24219 24356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 25497 24634 gene locus_tag LOCUS_08260 25497 24634 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_08260 26087 25566 gene locus_tag LOCUS_08270 26087 25566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 26782 27744 gene locus_tag LOCUS_08280 gene prsA 26782 27744 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence13 1663 1088 gene locus_tag LOCUS_08290 1663 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1791 2576 gene locus_tag LOCUS_08300 1791 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3498 2671 gene locus_tag LOCUS_08310 3498 2671 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_08310 4909 3488 gene locus_tag LOCUS_08320 4909 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5595 6998 gene locus_tag LOCUS_08330 gene cysS 5595 6998 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 protein_id gnl|my_center|LOCUS_08330 8034 7312 gene locus_tag LOCUS_08340 8034 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 8561 8271 gene locus_tag LOCUS_08350 8561 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10842 8530 gene locus_tag LOCUS_08360 10842 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262810.1 protein_id gnl|my_center|LOCUS_08360 11209 11087 gene locus_tag LOCUS_08370 11209 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 12038 11310 gene locus_tag LOCUS_08380 12038 11310 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_08380 13787 12042 gene locus_tag LOCUS_08390 gene glmS 13787 12042 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_08390 14286 14038 gene locus_tag LOCUS_08400 14286 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15043 14273 gene locus_tag LOCUS_08410 15043 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15182 15256 gene locus_tag LOCUS_t00260 15182 15256 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16324 15521 gene locus_tag LOCUS_08420 16324 15521 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_08420 16630 16998 gene locus_tag LOCUS_08430 16630 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 17011 17895 gene locus_tag LOCUS_08440 17011 17895 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_08440 18955 17921 gene locus_tag LOCUS_08450 18955 17921 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_08450 20161 19001 gene locus_tag LOCUS_08460 20161 19001 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_08460 21213 20248 gene locus_tag LOCUS_08470 21213 20248 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942094.1 protein_id gnl|my_center|LOCUS_08470 21376 21858 gene locus_tag LOCUS_08480 21376 21858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 21861 22847 gene locus_tag LOCUS_08490 21861 22847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 22887 23774 gene locus_tag LOCUS_08500 22887 23774 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_08500 23810 24325 gene locus_tag LOCUS_08510 23810 24325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 24329 24964 gene locus_tag LOCUS_08520 24329 24964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 25717 25016 gene locus_tag LOCUS_08530 25717 25016 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296505.1 protein_id gnl|my_center|LOCUS_08530 25990 26436 gene locus_tag LOCUS_08540 25990 26436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 26636 27133 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttaataccatttaatatgacatagatctaaaac >Feature sequence14 1462 3759 gene locus_tag LOCUS_08550 1462 3759 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436320.1 protein_id gnl|my_center|LOCUS_08550 3782 3976 gene locus_tag LOCUS_08560 3782 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3954 4460 gene locus_tag LOCUS_08570 gene nrdG 3954 4460 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432598.1 protein_id gnl|my_center|LOCUS_08570 4503 5147 gene locus_tag LOCUS_08580 4503 5147 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429111.1 protein_id gnl|my_center|LOCUS_08580 5459 6469 gene locus_tag LOCUS_08590 5459 6469 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836428.1 protein_id gnl|my_center|LOCUS_08590 6569 7498 gene locus_tag LOCUS_08600 6569 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 7834 9078 gene locus_tag LOCUS_08610 gene arcA 7834 9078 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681549.1 protein_id gnl|my_center|LOCUS_08610 9078 10070 gene locus_tag LOCUS_08620 gene argF 9078 10070 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_08620 10070 11005 gene locus_tag LOCUS_08630 gene arcC 10070 11005 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074342.1 protein_id gnl|my_center|LOCUS_08630 11007 12449 gene locus_tag LOCUS_08640 11007 12449 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356134.1 protein_id gnl|my_center|LOCUS_08640 12687 14192 gene locus_tag LOCUS_08650 12687 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 14569 15477 gene locus_tag LOCUS_08660 14569 15477 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_08660 15488 15970 gene locus_tag LOCUS_08670 15488 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 16534 15971 gene locus_tag LOCUS_08680 16534 15971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 16713 20432 gene locus_tag LOCUS_08690 16713 20432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence15 1169 1585 gene locus_tag LOCUS_08700 1169 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1488 2390 gene locus_tag LOCUS_08710 1488 2390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963464.1 protein_id gnl|my_center|LOCUS_08710 2387 3325 gene locus_tag LOCUS_08720 2387 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3925 3368 gene locus_tag LOCUS_08730 3925 3368 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948863.1 protein_id gnl|my_center|LOCUS_08730 4449 3925 gene locus_tag LOCUS_08740 4449 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 4589 5044 gene locus_tag LOCUS_08750 gene tsaE 4589 5044 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049629.1 protein_id gnl|my_center|LOCUS_08750 5101 5643 gene locus_tag LOCUS_08760 5101 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5636 5965 gene locus_tag LOCUS_08770 5636 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5968 6984 gene locus_tag LOCUS_08780 gene tsaD 5968 6984 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159041.1 protein_id gnl|my_center|LOCUS_08780 8006 7440 gene locus_tag LOCUS_08790 8006 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 8121 9731 gene locus_tag LOCUS_08800 8121 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 9960 12533 gene locus_tag LOCUS_08810 9960 12533 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068264.1 protein_id gnl|my_center|LOCUS_08810 12982 12545 gene locus_tag LOCUS_08820 12982 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 13077 13469 gene locus_tag LOCUS_08830 13077 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 13527 13988 gene locus_tag LOCUS_08840 13527 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 14024 15055 gene locus_tag LOCUS_08850 14024 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 15105 15428 gene locus_tag LOCUS_08860 15105 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 15439 15780 gene locus_tag LOCUS_08870 15439 15780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 15783 16322 gene locus_tag LOCUS_08880 15783 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence16 349 2127 gene locus_tag LOCUS_08890 349 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2421 2209 gene locus_tag LOCUS_08900 2421 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5419 2903 gene locus_tag LOCUS_08910 gene valS 5419 2903 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072238.1 protein_id gnl|my_center|LOCUS_08910 7242 5791 gene locus_tag LOCUS_08920 7242 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 7968 7342 gene locus_tag LOCUS_08930 7968 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 8883 7984 gene locus_tag LOCUS_08940 8883 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 9068 8901 gene locus_tag LOCUS_08950 9068 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 9184 9417 gene locus_tag LOCUS_08960 9184 9417 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_08960 10080 9418 gene locus_tag LOCUS_08970 10080 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 12446 10107 gene locus_tag LOCUS_08980 12446 10107 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948591.1 protein_id gnl|my_center|LOCUS_08980 12847 12440 gene locus_tag LOCUS_08990 12847 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 13831 12956 gene locus_tag LOCUS_09000 13831 12956 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_09000 14285 14211 gene locus_tag LOCUS_t00270 14285 14211 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 15952 14345 gene locus_tag LOCUS_09010 15952 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence17 1787 366 gene locus_tag LOCUS_09020 gene gatB 1787 366 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047680.1 protein_id gnl|my_center|LOCUS_09020 3223 1781 gene locus_tag LOCUS_09030 3223 1781 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166930.1 protein_id gnl|my_center|LOCUS_09030 3513 3223 gene locus_tag LOCUS_09040 3513 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 5574 3583 gene locus_tag LOCUS_09050 5574 3583 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987152.1 protein_id gnl|my_center|LOCUS_09050 8265 6313 gene locus_tag LOCUS_09060 gene uvrB 8265 6313 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441064.1 protein_id gnl|my_center|LOCUS_09060 9365 8475 gene locus_tag LOCUS_09070 9365 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9861 9358 gene locus_tag LOCUS_09080 9861 9358 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_09080 10765 9935 gene locus_tag LOCUS_09090 gene folD 10765 9935 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_09090 11939 10824 gene locus_tag LOCUS_09100 11939 10824 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_09100 12267 11923 gene locus_tag LOCUS_09110 12267 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12616 12260 gene locus_tag LOCUS_09120 12616 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 13014 12613 gene locus_tag LOCUS_09130 13014 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 13562 13212 gene locus_tag LOCUS_09140 13562 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence18 158 9 gene locus_tag LOCUS_09150 158 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 468 229 gene locus_tag LOCUS_09160 468 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 574 2268 gene locus_tag LOCUS_09170 574 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2381 2920 gene locus_tag LOCUS_09180 2381 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2921 3727 gene locus_tag LOCUS_09190 2921 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3789 4541 gene locus_tag LOCUS_09200 3789 4541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_09200 4546 5403 gene locus_tag LOCUS_09210 4546 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5366 7093 gene locus_tag LOCUS_09220 5366 7093 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 protein_id gnl|my_center|LOCUS_09220 7207 8394 gene locus_tag LOCUS_09230 7207 8394 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_09230 8819 8430 gene locus_tag LOCUS_09240 8819 8430 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_09240 9002 9199 gene locus_tag LOCUS_09250 9002 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 9208 9513 gene locus_tag LOCUS_09260 9208 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9886 9521 gene locus_tag LOCUS_09270 9886 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 9977 10516 gene locus_tag LOCUS_09280 9977 10516 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_09280 11416 10532 gene locus_tag LOCUS_09290 11416 10532 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_09290 11561 11486 gene locus_tag LOCUS_t00280 11561 11486 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11688 12638 gene locus_tag LOCUS_09300 11688 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence19 1246 1620 gene locus_tag LOCUS_09310 1246 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1641 2081 gene locus_tag LOCUS_09320 1641 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2114 2926 gene locus_tag LOCUS_09330 2114 2926 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364812.1 protein_id gnl|my_center|LOCUS_09330 2982 3057 gene locus_tag LOCUS_t00290 2982 3057 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3080 3373 gene locus_tag LOCUS_09340 3080 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 3432 4646 gene locus_tag LOCUS_09350 3432 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4643 6238 gene locus_tag LOCUS_09360 4643 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_09360 6531 8270 gene locus_tag LOCUS_09370 gene aspS 6531 8270 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599762.1 protein_id gnl|my_center|LOCUS_09370 9521 8283 gene locus_tag LOCUS_09380 9521 8283 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_09380 10249 9515 gene locus_tag LOCUS_09390 gene fabG 10249 9515 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881113.1 protein_id gnl|my_center|LOCUS_09390 10391 10729 gene locus_tag LOCUS_09400 gene rplS 10391 10729 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728425.1 protein_id gnl|my_center|LOCUS_09400 10782 11264 gene locus_tag LOCUS_09410 gene lepB 10782 11264 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 protein_id gnl|my_center|LOCUS_09410 11274 11624 gene locus_tag LOCUS_09420 11274 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 11627 11956 gene locus_tag LOCUS_09430 11627 11956 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795752.1 protein_id gnl|my_center|LOCUS_09430 12329 12478 gene locus_tag LOCUS_09440 12329 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence20 <1 504 gene locus_tag LOCUS_09450 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760645.1:NUDIX domain-containing protein 558 1076 gene locus_tag LOCUS_09460 558 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1081 1608 gene locus_tag LOCUS_09470 1081 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1605 2264 gene locus_tag LOCUS_09480 1605 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2265 2864 gene locus_tag LOCUS_09490 2265 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2883 3440 gene locus_tag LOCUS_09500 2883 3440 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359138.1 protein_id gnl|my_center|LOCUS_09500 4122 3484 gene locus_tag LOCUS_09510 4122 3484 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_09510 4241 6424 gene locus_tag LOCUS_09520 gene nrdD 4241 6424 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905257.1 protein_id gnl|my_center|LOCUS_09520 6424 6930 gene locus_tag LOCUS_09530 gene nrdG 6424 6930 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_09530 6923 7387 gene locus_tag LOCUS_09540 6923 7387 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389647.1 protein_id gnl|my_center|LOCUS_09540 8177 7407 gene locus_tag LOCUS_09550 8177 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 10081 8330 gene locus_tag LOCUS_09560 10081 8330 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387067.1 protein_id gnl|my_center|LOCUS_09560 10323 11699 gene locus_tag LOCUS_09570 10323 11699 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence21 2516 24 gene locus_tag LOCUS_09580 gene secA 2516 24 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579368.1 protein_id gnl|my_center|LOCUS_09580 3123 2602 gene locus_tag LOCUS_09590 gene raiA 3123 2602 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903257.1 protein_id gnl|my_center|LOCUS_09590 3517 3290 gene locus_tag LOCUS_09600 gene cspD 3517 3290 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728273.1 protein_id gnl|my_center|LOCUS_09600 3770 4372 gene locus_tag LOCUS_09610 3770 4372 CDS product accessory gene regulator ArgB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963405.1 protein_id gnl|my_center|LOCUS_09610 4377 4496 gene locus_tag LOCUS_09620 4377 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 5828 4527 gene locus_tag LOCUS_09630 5828 4527 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721673.1 protein_id gnl|my_center|LOCUS_09630 6559 5825 gene locus_tag LOCUS_09640 6559 5825 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948826.1 protein_id gnl|my_center|LOCUS_09640 7346 6705 gene locus_tag LOCUS_09650 7346 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 8176 7385 gene locus_tag LOCUS_09660 8176 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8852 8328 gene locus_tag LOCUS_09670 8852 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393021.1 protein_id gnl|my_center|LOCUS_09670 9833 9384 gene locus_tag LOCUS_09680 gene rpiB 9833 9384 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015889.1 protein_id gnl|my_center|LOCUS_09680 10113 9916 gene locus_tag LOCUS_09690 gene rpmE 10113 9916 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_09690 10711 10211 gene locus_tag LOCUS_09700 gene spoVT 10711 10211 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence22 673 92 gene locus_tag LOCUS_09710 673 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 915 685 gene locus_tag LOCUS_09720 915 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3330 973 gene locus_tag LOCUS_09730 3330 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 4971 3580 gene locus_tag LOCUS_09740 4971 3580 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_09740 5617 4955 gene locus_tag LOCUS_09750 5617 4955 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 protein_id gnl|my_center|LOCUS_09750 6669 5686 gene locus_tag LOCUS_09760 gene trpS 6669 5686 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110984.1 protein_id gnl|my_center|LOCUS_09760 8166 6721 gene locus_tag LOCUS_09770 gene murE 8166 6721 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766307.1 protein_id gnl|my_center|LOCUS_09770 9974 8247 gene locus_tag LOCUS_09780 9974 8247 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387067.1 protein_id gnl|my_center|LOCUS_09780 10095 10171 gene locus_tag LOCUS_t00300 10095 10171 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 1019 99 gene locus_tag LOCUS_09790 gene rnhC 1019 99 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071591.1 protein_id gnl|my_center|LOCUS_09790 1121 1735 gene locus_tag LOCUS_09800 1121 1735 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229537.1 protein_id gnl|my_center|LOCUS_09800 1735 2034 gene locus_tag LOCUS_09810 gene trxA 1735 2034 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 protein_id gnl|my_center|LOCUS_09810 2055 2408 gene locus_tag LOCUS_09820 2055 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2466 4214 gene locus_tag LOCUS_09830 2466 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4218 4712 gene locus_tag LOCUS_09840 4218 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4750 5808 gene locus_tag LOCUS_09850 gene queA 4750 5808 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 protein_id gnl|my_center|LOCUS_09850 6043 7158 gene locus_tag LOCUS_09860 gene tgt 6043 7158 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229725.1 protein_id gnl|my_center|LOCUS_09860 7166 7477 gene locus_tag LOCUS_09870 7166 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 7834 7466 gene locus_tag LOCUS_09880 7834 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7913 8557 gene locus_tag LOCUS_09890 7913 8557 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454832.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence24 <1 720 gene locus_tag LOCUS_09900 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946819.1:PDDEXK nuclease domain-containing protein 731 1639 gene locus_tag LOCUS_09910 731 1639 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09910 1650 1829 gene locus_tag LOCUS_09920 1650 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1918 2163 gene locus_tag LOCUS_09930 1918 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2528 3940 gene locus_tag LOCUS_09940 gene miaB 2528 3940 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_09940 4013 4729 gene locus_tag LOCUS_09950 4013 4729 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946239.1 protein_id gnl|my_center|LOCUS_09950 4743 5423 gene locus_tag LOCUS_09960 4743 5423 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_09960 5410 6132 gene locus_tag LOCUS_09970 5410 6132 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_09970 6518 6694 gene locus_tag LOCUS_09980 6518 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 6776 8053 gene locus_tag LOCUS_09990 6776 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence25 547 107 gene locus_tag LOCUS_10000 547 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1214 609 gene locus_tag LOCUS_10010 1214 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1983 1282 gene locus_tag LOCUS_10020 1983 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2841 1993 gene locus_tag LOCUS_10030 2841 1993 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455203.1 protein_id gnl|my_center|LOCUS_10030 3546 2935 gene locus_tag LOCUS_10040 3546 2935 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477966.1 protein_id gnl|my_center|LOCUS_10040 4297 3557 gene locus_tag LOCUS_10050 4297 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 5320 4307 gene locus_tag LOCUS_10060 5320 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6569 5391 gene locus_tag LOCUS_10070 6569 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 6822 7007 gene locus_tag LOCUS_10080 6822 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 6982 7236 gene locus_tag LOCUS_10090 6982 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence26 699 1094 gene locus_tag LOCUS_10100 699 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1131 1307 gene locus_tag LOCUS_10110 1131 1307 CDS product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621751.1 protein_id gnl|my_center|LOCUS_10110 1310 2932 gene locus_tag LOCUS_10120 1310 2932 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284028.1 protein_id gnl|my_center|LOCUS_10120 2932 3831 gene locus_tag LOCUS_10130 2932 3831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_10130 3821 5128 gene locus_tag LOCUS_10140 3821 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5148 5510 gene locus_tag LOCUS_10150 5148 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5519 5602 gene locus_tag LOCUS_t00310 5519 5602 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence27 3763 4398 gene locus_tag LOCUS_10160 gene vraR 3763 4398 CDS product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830439.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence28 1071 271 gene locus_tag LOCUS_10170 1071 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3211 1175 gene locus_tag LOCUS_10180 3211 1175 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965539.1 protein_id gnl|my_center|LOCUS_10180 3582 3211 gene locus_tag LOCUS_10190 3582 3211 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_10190 4505 3672 gene locus_tag LOCUS_10200 gene srtB 4505 3672 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence29 706 488 gene locus_tag LOCUS_10210 706 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2117 765 gene locus_tag LOCUS_10220 2117 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3177 2485 gene locus_tag LOCUS_10230 3177 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3620 3411 gene locus_tag LOCUS_10240 3620 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3753 3607 gene locus_tag LOCUS_10250 3753 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4278 3814 gene locus_tag LOCUS_10260 4278 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence30 1731 979 gene locus_tag LOCUS_10270 1731 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2640 1945 gene locus_tag LOCUS_10280 2640 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence31