>Feature sequence01 449 225 gene locus_tag LOCUS_00010 449 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1482 664 gene locus_tag LOCUS_00020 1482 664 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_00020 2373 1498 gene locus_tag LOCUS_00030 2373 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3753 2395 gene locus_tag LOCUS_00040 3753 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4914 3838 gene locus_tag LOCUS_00050 4914 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5413 4883 gene locus_tag LOCUS_00060 5413 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6072 5494 gene locus_tag LOCUS_00070 6072 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6438 6166 gene locus_tag LOCUS_00080 6438 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6860 6630 gene locus_tag LOCUS_00090 6860 6630 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 protein_id gnl|my_center|LOCUS_00090 7124 6879 gene locus_tag LOCUS_00100 7124 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7698 7358 gene locus_tag LOCUS_tm00010 7698 7358 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 8226 7786 gene locus_tag LOCUS_00110 gene smpB 8226 7786 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_00110 10363 8261 gene locus_tag LOCUS_00120 gene rnr 10363 8261 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 protein_id gnl|my_center|LOCUS_00120 10650 10432 gene locus_tag LOCUS_00130 gene secG 10650 10432 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_00130 10916 10725 gene locus_tag LOCUS_00140 10916 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12256 11021 gene locus_tag LOCUS_00150 gene eno 12256 11021 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880276.1 protein_id gnl|my_center|LOCUS_00150 12744 12292 gene locus_tag LOCUS_00160 12744 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14101 12737 gene locus_tag LOCUS_00170 gene murD 14101 12737 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286638.1 protein_id gnl|my_center|LOCUS_00170 14464 14192 gene locus_tag LOCUS_00180 14464 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 14575 15813 gene locus_tag LOCUS_00190 14575 15813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17095 15911 gene locus_tag LOCUS_00200 gene tuf 17095 15911 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290442.1 protein_id gnl|my_center|LOCUS_00200 19246 17177 gene locus_tag LOCUS_00210 gene fusA 19246 17177 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183519.1 protein_id gnl|my_center|LOCUS_00210 19729 19262 gene locus_tag LOCUS_00220 gene rpsG 19729 19262 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183520.1 protein_id gnl|my_center|LOCUS_00220 20171 19758 gene locus_tag LOCUS_00230 gene rpsL 20171 19758 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142341.1 protein_id gnl|my_center|LOCUS_00230 20459 20307 gene locus_tag LOCUS_00240 20459 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24168 20530 gene locus_tag LOCUS_00250 gene rpoC 24168 20530 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 protein_id gnl|my_center|LOCUS_00250 27776 24168 gene locus_tag LOCUS_00260 gene rpoB 27776 24168 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_00260 28461 27877 gene locus_tag LOCUS_00270 28461 27877 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763267.1 protein_id gnl|my_center|LOCUS_00270 29070 28876 gene locus_tag LOCUS_00280 29070 28876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29860 29492 gene locus_tag LOCUS_00290 gene rplL 29860 29492 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196960.1 protein_id gnl|my_center|LOCUS_00290 30390 29890 gene locus_tag LOCUS_00300 gene rplJ 30390 29890 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048716.1 protein_id gnl|my_center|LOCUS_00300 31246 30551 gene locus_tag LOCUS_00310 gene rplA 31246 30551 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356425.1 protein_id gnl|my_center|LOCUS_00310 31880 31323 gene locus_tag LOCUS_00320 gene rplK 31880 31323 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_00320 32556 32023 gene locus_tag LOCUS_00330 gene nusG 32556 32023 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288302.1 protein_id gnl|my_center|LOCUS_00330 32887 32573 gene locus_tag LOCUS_00340 32887 32573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33645 32983 gene locus_tag LOCUS_00350 33645 32983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 34311 33706 gene locus_tag LOCUS_00360 34311 33706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35019 34321 gene locus_tag LOCUS_00370 gene rlmB 35019 34321 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494715.1 protein_id gnl|my_center|LOCUS_00370 35397 35023 gene locus_tag LOCUS_00380 35397 35023 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_00380 36060 35431 gene locus_tag LOCUS_00390 36060 35431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 37524 36133 gene locus_tag LOCUS_00400 37524 36133 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_00400 39879 37576 gene locus_tag LOCUS_00410 39879 37576 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048366.1 protein_id gnl|my_center|LOCUS_00410 41582 40002 gene locus_tag LOCUS_00420 41582 40002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43201 41720 gene locus_tag LOCUS_00430 gene lysS 43201 41720 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905307.1 protein_id gnl|my_center|LOCUS_00430 43824 43204 gene locus_tag LOCUS_00440 43824 43204 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769080.1 protein_id gnl|my_center|LOCUS_00440 44798 43821 gene locus_tag LOCUS_00450 gene dusB 44798 43821 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 protein_id gnl|my_center|LOCUS_00450 45341 44931 gene locus_tag LOCUS_00460 gene mscL 45341 44931 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 protein_id gnl|my_center|LOCUS_00460 47373 45412 gene locus_tag LOCUS_00470 gene ftsH 47373 45412 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079674.1 protein_id gnl|my_center|LOCUS_00470 48709 47387 gene locus_tag LOCUS_00480 gene tilS 48709 47387 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 protein_id gnl|my_center|LOCUS_00480 49058 48765 gene locus_tag LOCUS_00490 49058 48765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49451 49119 gene locus_tag LOCUS_00500 49451 49119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 49741 49451 gene locus_tag LOCUS_00510 49741 49451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 50091 49813 gene locus_tag LOCUS_00520 gene spoVG 50091 49813 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421453.1 protein_id gnl|my_center|LOCUS_00520 50400 50167 gene locus_tag LOCUS_00530 50400 50167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 51191 50397 gene locus_tag LOCUS_00540 gene prtG 51191 50397 CDS product sporulation-specific protease PrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243478.1 protein_id gnl|my_center|LOCUS_00540 52028 51231 gene locus_tag LOCUS_00550 gene rsmA 52028 51231 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_00550 52529 52071 gene locus_tag LOCUS_00560 52529 52071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 53214 52531 gene locus_tag LOCUS_00570 53214 52531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 53745 53224 gene locus_tag LOCUS_00580 53745 53224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 54515 53757 gene locus_tag LOCUS_00590 54515 53757 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767813.1 protein_id gnl|my_center|LOCUS_00590 55176 54592 gene locus_tag LOCUS_00600 55176 54592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 55820 55206 gene locus_tag LOCUS_00610 55820 55206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 56442 55834 gene locus_tag LOCUS_00620 56442 55834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 57257 56499 gene locus_tag LOCUS_00630 57257 56499 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_00630 57480 57316 gene locus_tag LOCUS_00640 57480 57316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 59159 57618 gene locus_tag LOCUS_00650 gene metG 59159 57618 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_00650 59987 59457 gene locus_tag LOCUS_00660 gene spoVT 59987 59457 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648302.1 protein_id gnl|my_center|LOCUS_00660 60806 60141 gene locus_tag LOCUS_00670 60806 60141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 64166 60858 gene locus_tag LOCUS_00680 gene mfd 64166 60858 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258129.1 protein_id gnl|my_center|LOCUS_00680 64739 64173 gene locus_tag LOCUS_00690 gene pth 64739 64173 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 protein_id gnl|my_center|LOCUS_00690 65584 64745 gene locus_tag LOCUS_00700 gene rsmI 65584 64745 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243457.1 protein_id gnl|my_center|LOCUS_00700 66306 65584 gene locus_tag LOCUS_00710 66306 65584 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183570.1 protein_id gnl|my_center|LOCUS_00710 67090 66290 gene locus_tag LOCUS_00720 67090 66290 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 protein_id gnl|my_center|LOCUS_00720 67895 67083 gene locus_tag LOCUS_00730 67895 67083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 68100 67915 gene locus_tag LOCUS_00740 68100 67915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 68744 68151 gene locus_tag LOCUS_00750 gene recR 68744 68151 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829377.1 protein_id gnl|my_center|LOCUS_00750 69043 68744 gene locus_tag LOCUS_00760 69043 68744 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700666.1 protein_id gnl|my_center|LOCUS_00760 70816 69065 gene locus_tag LOCUS_00770 gene dnaX 70816 69065 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829412.1 protein_id gnl|my_center|LOCUS_00770 71306 70857 gene locus_tag LOCUS_00780 71306 70857 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421624.1 protein_id gnl|my_center|LOCUS_00780 74789 72243 gene locus_tag LOCUS_00790 gene gyrA 74789 72243 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_00790 76733 74802 gene locus_tag LOCUS_00800 gene gyrB 76733 74802 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_00800 77848 76736 gene locus_tag LOCUS_00810 gene recF 77848 76736 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723768.1 protein_id gnl|my_center|LOCUS_00810 78417 77962 gene locus_tag LOCUS_00820 78417 77962 CDS product competence protein ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444443.1 protein_id gnl|my_center|LOCUS_00820 79679 78549 gene locus_tag LOCUS_00830 gene dnaN 79679 78549 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212527.1 protein_id gnl|my_center|LOCUS_00830 81197 79806 gene locus_tag LOCUS_00840 gene dnaA 81197 79806 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_00840 81514 81636 gene locus_tag LOCUS_00850 gene rpmH 81514 81636 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_00850 81689 82024 gene locus_tag LOCUS_00860 gene rnpA 81689 82024 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167186.1 protein_id gnl|my_center|LOCUS_00860 82025 82954 gene locus_tag LOCUS_00870 82025 82954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 82941 83546 gene locus_tag LOCUS_00880 82941 83546 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_00880 83625 84617 gene locus_tag LOCUS_00890 83625 84617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 84774 86129 gene locus_tag LOCUS_00900 gene mnmE 84774 86129 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700790.1 protein_id gnl|my_center|LOCUS_00900 86138 88018 gene locus_tag LOCUS_00910 gene mnmG 86138 88018 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_00910 88011 88646 gene locus_tag LOCUS_00920 gene rsmG 88011 88646 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_00920 88783 90156 gene locus_tag LOCUS_00930 88783 90156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 90249 91034 gene locus_tag LOCUS_00940 90249 91034 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_00940 91024 91935 gene locus_tag LOCUS_00950 91024 91935 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_00950 91957 92766 gene locus_tag LOCUS_00960 91957 92766 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455953.1 protein_id gnl|my_center|LOCUS_00960 92756 92950 gene locus_tag LOCUS_00970 92756 92950 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966985.1 protein_id gnl|my_center|LOCUS_00970 92954 94549 gene locus_tag LOCUS_00980 92954 94549 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_00980 94669 95769 gene locus_tag LOCUS_00990 gene ychF 94669 95769 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524669.1 protein_id gnl|my_center|LOCUS_00990 95944 96450 gene locus_tag LOCUS_01000 95944 96450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 96991 97392 gene locus_tag LOCUS_01010 96991 97392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 97376 98500 gene locus_tag LOCUS_01020 97376 98500 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_01020 98493 98906 gene locus_tag LOCUS_01030 98493 98906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 99044 99331 gene locus_tag LOCUS_01040 gene rpsF 99044 99331 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_01040 99351 99836 gene locus_tag LOCUS_01050 gene ssb 99351 99836 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 protein_id gnl|my_center|LOCUS_01050 99853 100068 gene locus_tag LOCUS_01060 gene rpsR 99853 100068 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_01060 100174 101163 gene locus_tag LOCUS_01070 100174 101163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 101165 101605 gene locus_tag LOCUS_01080 gene rplI 101165 101605 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724881.1 protein_id gnl|my_center|LOCUS_01080 101616 102971 gene locus_tag LOCUS_01090 gene dnaB 101616 102971 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_01090 102964 104460 gene locus_tag LOCUS_01100 102964 104460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 104462 105214 gene locus_tag LOCUS_01110 104462 105214 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 protein_id gnl|my_center|LOCUS_01110 105217 105672 gene locus_tag LOCUS_01120 gene rlmH 105217 105672 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_01120 106571 105675 gene locus_tag LOCUS_01130 106571 105675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 106661 107548 gene locus_tag LOCUS_01140 106661 107548 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_01140 107582 108247 gene locus_tag LOCUS_01150 107582 108247 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432519.1 protein_id gnl|my_center|LOCUS_01150 108834 108274 gene locus_tag LOCUS_01160 108834 108274 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219822.1 protein_id gnl|my_center|LOCUS_01160 110865 108898 gene locus_tag LOCUS_01170 110865 108898 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372958.1 protein_id gnl|my_center|LOCUS_01170 110971 111309 gene locus_tag LOCUS_01180 110971 111309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 111314 113062 gene locus_tag LOCUS_01190 gene argS 111314 113062 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_01190 113171 113626 gene locus_tag LOCUS_01200 113171 113626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 113686 114750 gene locus_tag LOCUS_01210 gene prfA 113686 114750 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475834.1 protein_id gnl|my_center|LOCUS_01210 114753 115574 gene locus_tag LOCUS_01220 gene prmC 114753 115574 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267042.1 protein_id gnl|my_center|LOCUS_01220 115621 116142 gene locus_tag LOCUS_01230 115621 116142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 116177 116713 gene locus_tag LOCUS_01240 116177 116713 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_01240 116840 118093 gene locus_tag LOCUS_01250 gene murA 116840 118093 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413260.1 protein_id gnl|my_center|LOCUS_01250 118130 118849 gene locus_tag LOCUS_01260 118130 118849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 118946 119164 gene locus_tag LOCUS_01270 gene rpmE 118946 119164 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_01270 119216 119653 gene locus_tag LOCUS_01280 gene rpiB 119216 119653 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_01280 119656 119853 gene locus_tag LOCUS_01290 119656 119853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 119905 120543 gene locus_tag LOCUS_01300 119905 120543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 120689 121681 gene locus_tag LOCUS_01310 120689 121681 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_01310 121748 122884 gene locus_tag LOCUS_01320 121748 122884 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 protein_id gnl|my_center|LOCUS_01320 122952 123683 gene locus_tag LOCUS_01330 122952 123683 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_01330 123664 124956 gene locus_tag LOCUS_01340 123664 124956 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721673.1 protein_id gnl|my_center|LOCUS_01340 125152 125030 gene locus_tag LOCUS_01350 125152 125030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 125795 125205 gene locus_tag LOCUS_01360 125795 125205 CDS product accessory gene regulator ArgB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932273.1 protein_id gnl|my_center|LOCUS_01360 126035 126253 gene locus_tag LOCUS_01370 gene cspC 126035 126253 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_01370 126303 126830 gene locus_tag LOCUS_01380 gene raiA 126303 126830 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_01380 126921 129413 gene locus_tag LOCUS_01390 gene secA 126921 129413 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_01390 129781 131049 gene locus_tag LOCUS_01400 129781 131049 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597559.1 protein_id gnl|my_center|LOCUS_01400 131209 131556 gene locus_tag LOCUS_01410 131209 131556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01410 131903 133045 gene locus_tag LOCUS_01420 131903 133045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 133135 134991 gene locus_tag LOCUS_01430 133135 134991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 135046 135396 gene locus_tag LOCUS_01440 135046 135396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 135372 135920 gene locus_tag LOCUS_01450 135372 135920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 136408 136076 gene locus_tag LOCUS_01460 136408 136076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 137295 136597 gene locus_tag LOCUS_01470 137295 136597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 137413 138045 gene locus_tag LOCUS_01480 137413 138045 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861651.1 protein_id gnl|my_center|LOCUS_01480 138338 139315 gene locus_tag LOCUS_01490 gene prfB 138338 139315 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_01490 139316 140197 gene locus_tag LOCUS_01500 139316 140197 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 protein_id gnl|my_center|LOCUS_01500 140199 141092 gene locus_tag LOCUS_01510 140199 141092 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_01510 141172 141867 gene locus_tag LOCUS_01520 gene ftsE 141172 141867 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_01520 141854 142753 gene locus_tag LOCUS_01530 gene ftsX 141854 142753 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_01530 142750 143976 gene locus_tag LOCUS_01540 142750 143976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 144052 144489 gene locus_tag LOCUS_01550 144052 144489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 144539 145084 gene locus_tag LOCUS_01560 144539 145084 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068193.1 protein_id gnl|my_center|LOCUS_01560 145185 145574 gene locus_tag LOCUS_01570 145185 145574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 145555 145719 gene locus_tag LOCUS_01580 145555 145719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 147619 145745 gene locus_tag LOCUS_01590 147619 145745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 148548 147754 gene locus_tag LOCUS_01600 148548 147754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 148790 149929 gene locus_tag LOCUS_01610 148790 149929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 150012 150320 gene locus_tag LOCUS_01620 150012 150320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 150525 151112 gene locus_tag LOCUS_01630 gene tmk 150525 151112 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791380.1 protein_id gnl|my_center|LOCUS_01630 151096 151728 gene locus_tag LOCUS_01640 151096 151728 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_01640 151685 151999 gene locus_tag LOCUS_01650 151685 151999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 151986 152825 gene locus_tag LOCUS_01660 151986 152825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 153251 155200 gene locus_tag LOCUS_01670 gene uvrB 153251 155200 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229241.1 protein_id gnl|my_center|LOCUS_01670 155197 156036 gene locus_tag LOCUS_01680 155197 156036 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_01680 156107 158920 gene locus_tag LOCUS_01690 gene uvrA 156107 158920 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_01690 158932 159360 gene locus_tag LOCUS_01700 158932 159360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 159341 160189 gene locus_tag LOCUS_01710 gene lgt 159341 160189 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_01710 160268 161218 gene locus_tag LOCUS_01720 gene mgfK 160268 161218 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_01720 161220 162152 gene locus_tag LOCUS_01730 gene whiA 161220 162152 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358736.1 protein_id gnl|my_center|LOCUS_01730 162234 163097 gene locus_tag LOCUS_01740 162234 163097 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676321.1 protein_id gnl|my_center|LOCUS_01740 163796 163215 gene locus_tag LOCUS_01750 gene clpP 163796 163215 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_01750 163906 165561 gene locus_tag LOCUS_01760 163906 165561 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_01760 165733 166740 gene locus_tag LOCUS_01770 gene gap 165733 166740 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_01770 166804 167385 gene locus_tag LOCUS_01780 166804 167385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 167403 168575 gene locus_tag LOCUS_01790 167403 168575 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902043.1 protein_id gnl|my_center|LOCUS_01790 168591 169040 gene locus_tag LOCUS_01800 168591 169040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 169037 170053 gene locus_tag LOCUS_01810 169037 170053 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 protein_id gnl|my_center|LOCUS_01810 170050 171282 gene locus_tag LOCUS_01820 170050 171282 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724023.1 protein_id gnl|my_center|LOCUS_01820 171279 171971 gene locus_tag LOCUS_01830 gene tpiA 171279 171971 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_01830 172053 173051 gene locus_tag LOCUS_01840 172053 173051 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_01840 173174 174181 gene locus_tag LOCUS_01850 173174 174181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 174240 174788 gene locus_tag LOCUS_01860 174240 174788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 174808 174884 gene locus_tag LOCUS_t00010 174808 174884 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 174981 175763 gene locus_tag LOCUS_01870 174981 175763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 175809 177161 gene locus_tag LOCUS_01880 175809 177161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 177187 178443 gene locus_tag LOCUS_01890 177187 178443 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037436.1 protein_id gnl|my_center|LOCUS_01890 178948 178436 gene locus_tag LOCUS_01900 178948 178436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 180413 178974 gene locus_tag LOCUS_01910 180413 178974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 180671 182251 gene locus_tag LOCUS_01920 180671 182251 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_01920 182969 182265 gene locus_tag LOCUS_01930 182969 182265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 183108 183533 gene locus_tag LOCUS_01940 183108 183533 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_01940 183534 184421 gene locus_tag LOCUS_01950 183534 184421 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_01950 184432 185568 gene locus_tag LOCUS_01960 184432 185568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 185583 186194 gene locus_tag LOCUS_01970 185583 186194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 187179 186229 gene locus_tag LOCUS_01980 187179 186229 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_01980 188328 187180 gene locus_tag LOCUS_01990 188328 187180 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_01990 188397 189524 gene locus_tag LOCUS_02000 188397 189524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 190256 192676 gene locus_tag LOCUS_02010 190256 192676 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688713.1 protein_id gnl|my_center|LOCUS_02010 192915 193331 gene locus_tag LOCUS_02020 192915 193331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 193324 195726 gene locus_tag LOCUS_02030 gene leuS 193324 195726 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_02030 195845 196639 gene locus_tag LOCUS_02040 195845 196639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 196760 198424 gene locus_tag LOCUS_02050 196760 198424 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284028.1 protein_id gnl|my_center|LOCUS_02050 199610 198435 gene locus_tag LOCUS_02060 199610 198435 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485777.1 protein_id gnl|my_center|LOCUS_02060 200901 199588 gene locus_tag LOCUS_02070 200901 199588 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438530.1 protein_id gnl|my_center|LOCUS_02070 201205 200993 gene locus_tag LOCUS_02080 201205 200993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 201285 201926 gene locus_tag LOCUS_02090 gene trmB 201285 201926 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939002.1 protein_id gnl|my_center|LOCUS_02090 201996 202658 gene locus_tag LOCUS_02100 201996 202658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 202670 203791 gene locus_tag LOCUS_02110 202670 203791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 203806 204093 gene locus_tag LOCUS_02120 203806 204093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 204086 204490 gene locus_tag LOCUS_02130 204086 204490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 204795 206027 gene locus_tag LOCUS_02140 gene tyrS 204795 206027 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_02140 206041 207258 gene locus_tag LOCUS_02150 206041 207258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 207259 207801 gene locus_tag LOCUS_02160 207259 207801 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 protein_id gnl|my_center|LOCUS_02160 208445 207843 gene locus_tag LOCUS_02170 gene rpsD 208445 207843 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703954.1 protein_id gnl|my_center|LOCUS_02170 209161 210873 gene locus_tag LOCUS_02180 gene ezrA 209161 210873 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989755.1 protein_id gnl|my_center|LOCUS_02180 210951 212138 gene locus_tag LOCUS_02190 gene thiI 210951 212138 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922339.1 protein_id gnl|my_center|LOCUS_02190 212213 212425 gene locus_tag LOCUS_02200 gene sspB 212213 212425 CDS product beta type acid-soluble spore protein SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233287.1 protein_id gnl|my_center|LOCUS_02200 212541 213578 gene locus_tag LOCUS_02210 212541 213578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 213758 213931 gene locus_tag LOCUS_02220 213758 213931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 214067 214483 gene locus_tag LOCUS_02230 214067 214483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 214480 214806 gene locus_tag LOCUS_02240 214480 214806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 214790 215923 gene locus_tag LOCUS_02250 214790 215923 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_02250 216010 216915 gene locus_tag LOCUS_02260 216010 216915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 217032 218018 gene locus_tag LOCUS_02270 217032 218018 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681431.1 protein_id gnl|my_center|LOCUS_02270 218125 219324 gene locus_tag LOCUS_02280 218125 219324 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989750.1 protein_id gnl|my_center|LOCUS_02280 219329 220288 gene locus_tag LOCUS_02290 219329 220288 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989747.1 protein_id gnl|my_center|LOCUS_02290 220290 220889 gene locus_tag LOCUS_02300 gene yihA 220290 220889 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732571.1 protein_id gnl|my_center|LOCUS_02300 220923 221384 gene locus_tag LOCUS_02310 220923 221384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 222879 221404 gene locus_tag LOCUS_02320 gene spoIVA 222879 221404 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416519.1 protein_id gnl|my_center|LOCUS_02320 223240 223001 gene locus_tag LOCUS_02330 223240 223001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 223502 223314 gene locus_tag LOCUS_02340 223502 223314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 224814 223504 gene locus_tag LOCUS_02350 gene der 224814 223504 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_02350 224942 225913 gene locus_tag LOCUS_02360 224942 225913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 226053 226325 gene locus_tag LOCUS_02370 226053 226325 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_02370 226395 227498 gene locus_tag LOCUS_02380 226395 227498 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 protein_id gnl|my_center|LOCUS_02380 227798 229426 gene locus_tag LOCUS_02390 227798 229426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 229511 230191 gene locus_tag LOCUS_02400 gene dnaD 229511 230191 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728549.1 protein_id gnl|my_center|LOCUS_02400 230178 230801 gene locus_tag LOCUS_02410 gene nth 230178 230801 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922193.1 protein_id gnl|my_center|LOCUS_02410 233659 230825 gene locus_tag LOCUS_02420 233659 230825 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 protein_id gnl|my_center|LOCUS_02420 234227 233637 gene locus_tag LOCUS_02430 gene recU 234227 233637 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155598.1 protein_id gnl|my_center|LOCUS_02430 234535 234864 gene locus_tag LOCUS_02440 gene gpsB 234535 234864 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622431.1 protein_id gnl|my_center|LOCUS_02440 235244 235738 gene locus_tag LOCUS_02450 235244 235738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 235722 236327 gene locus_tag LOCUS_02460 gene pgsA 235722 236327 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_02460 236473 237498 gene locus_tag LOCUS_02470 gene recA 236473 237498 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283860.1 protein_id gnl|my_center|LOCUS_02470 237532 238329 gene locus_tag LOCUS_02480 237532 238329 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_02480 238424 239137 gene locus_tag LOCUS_02490 238424 239137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 239192 240589 gene locus_tag LOCUS_02500 239192 240589 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768129.1 protein_id gnl|my_center|LOCUS_02500 240664 243399 gene locus_tag LOCUS_02510 240664 243399 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164979579.1 protein_id gnl|my_center|LOCUS_02510 243728 244558 gene locus_tag LOCUS_02520 gene dinD 243728 244558 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_02520 244755 246308 gene locus_tag LOCUS_02530 gene rny 244755 246308 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287336.1 protein_id gnl|my_center|LOCUS_02530 246308 246694 gene locus_tag LOCUS_02540 246308 246694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 248385 246691 gene locus_tag LOCUS_02550 gene rnjA 248385 246691 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670379.1 protein_id gnl|my_center|LOCUS_02550 248556 249629 gene locus_tag LOCUS_02560 gene ftsY 248556 249629 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_02560 249637 249930 gene locus_tag LOCUS_02570 249637 249930 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723862.1 protein_id gnl|my_center|LOCUS_02570 250019 252154 gene locus_tag LOCUS_02580 250019 252154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 252297 253604 gene locus_tag LOCUS_02590 gene ffh 252297 253604 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_02590 253679 255010 gene locus_tag LOCUS_02600 253679 255010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 255066 257690 gene locus_tag LOCUS_02610 gene mgtA 255066 257690 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047937.1 protein_id gnl|my_center|LOCUS_02610 257792 258133 gene locus_tag LOCUS_02620 257792 258133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 258243 258443 gene locus_tag LOCUS_02630 258243 258443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 258533 259279 gene locus_tag LOCUS_02640 gene recX 258533 259279 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318634.1 protein_id gnl|my_center|LOCUS_02640 259691 259341 gene locus_tag LOCUS_02650 259691 259341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 261851 259800 gene locus_tag LOCUS_02660 261851 259800 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676329.1 protein_id gnl|my_center|LOCUS_02660 262422 261865 gene locus_tag LOCUS_02670 262422 261865 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948348.1 protein_id gnl|my_center|LOCUS_02670 262655 263107 gene locus_tag LOCUS_02680 262655 263107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 263116 263337 gene locus_tag LOCUS_02690 263116 263337 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 protein_id gnl|my_center|LOCUS_02690 263327 264514 gene locus_tag LOCUS_02700 263327 264514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 264591 264998 gene locus_tag LOCUS_02710 264591 264998 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836998.1 protein_id gnl|my_center|LOCUS_02710 265480 265148 gene locus_tag LOCUS_02720 265480 265148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 265572 266060 gene locus_tag LOCUS_02730 265572 266060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 266624 266343 gene locus_tag LOCUS_02740 266624 266343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 266735 267100 gene locus_tag LOCUS_02750 266735 267100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 267434 267361 gene locus_tag LOCUS_t00020 267434 267361 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 267608 268657 gene locus_tag LOCUS_02760 267608 268657 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_02760 268668 269645 gene locus_tag LOCUS_02770 268668 269645 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831154.1 protein_id gnl|my_center|LOCUS_02770 269730 270407 gene locus_tag LOCUS_02780 269730 270407 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288181.1 protein_id gnl|my_center|LOCUS_02780 270517 271050 gene locus_tag LOCUS_02790 270517 271050 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290817.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence02 522 1202 gene locus_tag LOCUS_02800 522 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1232 1804 gene locus_tag LOCUS_02810 1232 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 1999 2598 gene locus_tag LOCUS_02820 1999 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2696 3130 gene locus_tag LOCUS_02830 2696 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3630 4268 gene locus_tag LOCUS_02840 3630 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4591 6033 gene locus_tag LOCUS_02850 4591 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 6158 7027 gene locus_tag LOCUS_02860 6158 7027 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 protein_id gnl|my_center|LOCUS_02860 7224 8267 gene locus_tag LOCUS_02870 7224 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 8547 9266 gene locus_tag LOCUS_02880 gene deoD 8547 9266 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183561.1 protein_id gnl|my_center|LOCUS_02880 9306 10577 gene locus_tag LOCUS_02890 9306 10577 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_02890 10564 11850 gene locus_tag LOCUS_02900 10564 11850 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_02900 13024 11936 gene locus_tag LOCUS_02910 13024 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 13136 13801 gene locus_tag LOCUS_02920 gene rnc 13136 13801 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028264.1 protein_id gnl|my_center|LOCUS_02920 13815 14228 gene locus_tag LOCUS_02930 13815 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 14302 15954 gene locus_tag LOCUS_02940 14302 15954 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823075.1 protein_id gnl|my_center|LOCUS_02940 16096 16656 gene locus_tag LOCUS_02950 16096 16656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 16667 17749 gene locus_tag LOCUS_02960 16667 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 17742 18548 gene locus_tag LOCUS_02970 17742 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 18557 19060 gene locus_tag LOCUS_02980 18557 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 19057 19551 gene locus_tag LOCUS_02990 19057 19551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 19555 20901 gene locus_tag LOCUS_03000 19555 20901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 20910 21704 gene locus_tag LOCUS_03010 20910 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 21866 22813 gene locus_tag LOCUS_03020 21866 22813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 22904 24742 gene locus_tag LOCUS_03030 22904 24742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 24784 25611 gene locus_tag LOCUS_03040 24784 25611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 25629 26426 gene locus_tag LOCUS_03050 25629 26426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 26484 27257 gene locus_tag LOCUS_03060 26484 27257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 27392 27694 gene locus_tag LOCUS_03070 gene rplU 27392 27694 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905746.1 protein_id gnl|my_center|LOCUS_03070 27697 27999 gene locus_tag LOCUS_03080 27697 27999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 28012 28302 gene locus_tag LOCUS_03090 gene rpmA 28012 28302 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564659.1 protein_id gnl|my_center|LOCUS_03090 28427 29128 gene locus_tag LOCUS_03100 28427 29128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 29217 29561 gene locus_tag LOCUS_03110 29217 29561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 29599 30882 gene locus_tag LOCUS_03120 gene obgE 29599 30882 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_03120 30941 31017 gene locus_tag LOCUS_t00030 30941 31017 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31023 31107 gene locus_tag LOCUS_t00040 31023 31107 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31258 31971 gene locus_tag LOCUS_03130 31258 31971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 32020 32739 gene locus_tag LOCUS_03140 32020 32739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 32717 33220 gene locus_tag LOCUS_03150 32717 33220 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832140.1 protein_id gnl|my_center|LOCUS_03150 33237 33623 gene locus_tag LOCUS_03160 33237 33623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 33738 34109 gene locus_tag LOCUS_03170 33738 34109 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_03170 34112 34336 gene locus_tag LOCUS_03180 34112 34336 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_03180 34346 36184 gene locus_tag LOCUS_03190 34346 36184 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_03190 36294 36875 gene locus_tag LOCUS_03200 36294 36875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 36890 37345 gene locus_tag LOCUS_03210 36890 37345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 37339 39099 gene locus_tag LOCUS_03220 37339 39099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_03220 39092 41458 gene locus_tag LOCUS_03230 39092 41458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 41509 42288 gene locus_tag LOCUS_03240 41509 42288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 42288 42980 gene locus_tag LOCUS_03250 gene sigE 42288 42980 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_03250 43044 43928 gene locus_tag LOCUS_03260 43044 43928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 43997 44602 gene locus_tag LOCUS_03270 43997 44602 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_03270 44649 47285 gene locus_tag LOCUS_03280 gene ppdK 44649 47285 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_03280 47640 49586 gene locus_tag LOCUS_03290 47640 49586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 49600 51345 gene locus_tag LOCUS_03300 49600 51345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 51342 51698 gene locus_tag LOCUS_03310 51342 51698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 51710 52723 gene locus_tag LOCUS_03320 51710 52723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 52793 53704 gene locus_tag LOCUS_03330 52793 53704 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256595.1 protein_id gnl|my_center|LOCUS_03330 53691 53960 gene locus_tag LOCUS_03340 53691 53960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 54044 55513 gene locus_tag LOCUS_03350 54044 55513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 55524 57311 gene locus_tag LOCUS_03360 55524 57311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 57420 57842 gene locus_tag LOCUS_03370 57420 57842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 57937 58656 gene locus_tag LOCUS_03380 57937 58656 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_03380 58770 60251 gene locus_tag LOCUS_03390 58770 60251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 60730 61224 gene locus_tag LOCUS_03400 60730 61224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 62441 61221 gene locus_tag LOCUS_03410 62441 61221 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398500.1 protein_id gnl|my_center|LOCUS_03410 62537 63436 gene locus_tag LOCUS_03420 gene xerD 62537 63436 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_03420 63498 64664 gene locus_tag LOCUS_03430 gene deoB 63498 64664 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_03430 64885 64706 gene locus_tag LOCUS_03440 64885 64706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 66427 65360 gene locus_tag LOCUS_03450 66427 65360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 66992 66444 gene locus_tag LOCUS_03460 66992 66444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 67831 67064 gene locus_tag LOCUS_03470 67831 67064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 68002 67838 gene locus_tag LOCUS_03480 68002 67838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 69050 67947 gene locus_tag LOCUS_03490 gene mnmA 69050 67947 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943733.1 protein_id gnl|my_center|LOCUS_03490 69686 69084 gene locus_tag LOCUS_03500 69686 69084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 70187 69891 gene locus_tag LOCUS_03510 70187 69891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 70967 70251 gene locus_tag LOCUS_03520 70967 70251 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964829.1 protein_id gnl|my_center|LOCUS_03520 72018 71032 gene locus_tag LOCUS_03530 72018 71032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 73476 72097 gene locus_tag LOCUS_03540 73476 72097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 75297 73498 gene locus_tag LOCUS_03550 75297 73498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 76288 75302 gene locus_tag LOCUS_03560 76288 75302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 76582 76352 gene locus_tag LOCUS_03570 76582 76352 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983901.1 protein_id gnl|my_center|LOCUS_03570 77854 76601 gene locus_tag LOCUS_03580 gene xseA 77854 76601 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246103.1 protein_id gnl|my_center|LOCUS_03580 78255 77854 gene locus_tag LOCUS_03590 gene nusB 78255 77854 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276210.1 protein_id gnl|my_center|LOCUS_03590 79263 78406 gene locus_tag LOCUS_03600 79263 78406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 81871 79322 gene locus_tag LOCUS_03610 gene mutS 81871 79322 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990113.1 protein_id gnl|my_center|LOCUS_03610 83048 81945 gene locus_tag LOCUS_03620 83048 81945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 84158 83139 gene locus_tag LOCUS_03630 84158 83139 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727277.1 protein_id gnl|my_center|LOCUS_03630 84204 85118 gene locus_tag LOCUS_03640 gene ylbJ 84204 85118 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273100.1 protein_id gnl|my_center|LOCUS_03640 85784 85098 gene locus_tag LOCUS_03650 85784 85098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 86491 85781 gene locus_tag LOCUS_03660 86491 85781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 86587 88263 gene locus_tag LOCUS_03670 86587 88263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 88945 88256 gene locus_tag LOCUS_03680 88945 88256 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 protein_id gnl|my_center|LOCUS_03680 89582 88989 gene locus_tag LOCUS_03690 89582 88989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 90252 89671 gene locus_tag LOCUS_03700 90252 89671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 91343 90255 gene locus_tag LOCUS_03710 gene hemW 91343 90255 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352330.1 protein_id gnl|my_center|LOCUS_03710 91864 91376 gene locus_tag LOCUS_03720 91864 91376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 93691 91889 gene locus_tag LOCUS_03730 gene lepA 93691 91889 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726525.1 protein_id gnl|my_center|LOCUS_03730 94887 93871 gene locus_tag LOCUS_03740 94887 93871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 95548 95024 gene locus_tag LOCUS_03750 95548 95024 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_03750 95964 95650 gene locus_tag LOCUS_03760 95964 95650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 96265 96089 gene locus_tag LOCUS_03770 96265 96089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 98194 96458 gene locus_tag LOCUS_03780 98194 96458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 100019 98280 gene locus_tag LOCUS_03790 100019 98280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 102452 100122 gene locus_tag LOCUS_03800 102452 100122 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_03800 103303 102524 gene locus_tag LOCUS_03810 103303 102524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 103820 103389 gene locus_tag LOCUS_03820 103820 103389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 104498 103830 gene locus_tag LOCUS_03830 gene trmD 104498 103830 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_03830 104984 104499 gene locus_tag LOCUS_03840 gene rimM 104984 104499 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832559.1 protein_id gnl|my_center|LOCUS_03840 105711 104977 gene locus_tag LOCUS_03850 105711 104977 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183155.1 protein_id gnl|my_center|LOCUS_03850 106360 105722 gene locus_tag LOCUS_03860 106360 105722 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_03860 106476 107255 gene locus_tag LOCUS_03870 106476 107255 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852645.1 protein_id gnl|my_center|LOCUS_03870 108118 107279 gene locus_tag LOCUS_03880 108118 107279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 108371 108231 gene locus_tag LOCUS_03890 108371 108231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 109261 108500 gene locus_tag LOCUS_03900 109261 108500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 110405 109347 gene locus_tag LOCUS_03910 110405 109347 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943093.1 protein_id gnl|my_center|LOCUS_03910 110845 110411 gene locus_tag LOCUS_03920 gene dtd 110845 110411 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691430.1 protein_id gnl|my_center|LOCUS_03920 113004 110842 gene locus_tag LOCUS_03930 113004 110842 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723527.1 protein_id gnl|my_center|LOCUS_03930 115292 113019 gene locus_tag LOCUS_03940 gene secDF 115292 113019 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485294.1 protein_id gnl|my_center|LOCUS_03940 115542 115294 gene locus_tag LOCUS_03950 115542 115294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 116519 115617 gene locus_tag LOCUS_03960 gene xerC 116519 115617 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 protein_id gnl|my_center|LOCUS_03960 117631 116534 gene locus_tag LOCUS_03970 117631 116534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 119730 117700 gene locus_tag LOCUS_03980 gene topA 119730 117700 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_03980 120320 119844 gene locus_tag LOCUS_03990 120320 119844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 121248 120322 gene locus_tag LOCUS_04000 121248 120322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 122222 121245 gene locus_tag LOCUS_04010 122222 121245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 123143 122274 gene locus_tag LOCUS_04020 gene ylqF 123143 122274 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_04020 123702 123157 gene locus_tag LOCUS_04030 123702 123157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 123940 123809 gene locus_tag LOCUS_04040 123940 123809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 124736 123963 gene locus_tag LOCUS_04050 124736 123963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 125035 124757 gene locus_tag LOCUS_04060 125035 124757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 125897 125025 gene locus_tag LOCUS_04070 125897 125025 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016475763.1 protein_id gnl|my_center|LOCUS_04070 127174 126245 gene locus_tag LOCUS_04080 127174 126245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 128163 127453 gene locus_tag LOCUS_04090 128163 127453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 129579 128833 gene locus_tag LOCUS_04100 129579 128833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 130207 129755 gene locus_tag LOCUS_04110 130207 129755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 130522 130211 gene locus_tag LOCUS_04120 130522 130211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 131151 130561 gene locus_tag LOCUS_04130 131151 130561 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_04130 132226 131249 gene locus_tag LOCUS_04140 gene rfaJ 132226 131249 CDS product lipopolysaccharide 1,2-glucosyltransferase RfaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376863.1 protein_id gnl|my_center|LOCUS_04140 132964 132314 gene locus_tag LOCUS_04150 132964 132314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 134790 133036 gene locus_tag LOCUS_04160 134790 133036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 136564 134858 gene locus_tag LOCUS_04170 136564 134858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130205.1 protein_id gnl|my_center|LOCUS_04170 138299 136557 gene locus_tag LOCUS_04180 138299 136557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 138925 138407 gene locus_tag LOCUS_04190 gene lepB 138925 138407 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 protein_id gnl|my_center|LOCUS_04190 139376 138999 gene locus_tag LOCUS_04200 gene rplS 139376 138999 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897519.1 protein_id gnl|my_center|LOCUS_04200 139828 139508 gene locus_tag LOCUS_04210 139828 139508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 140759 139818 gene locus_tag LOCUS_04220 140759 139818 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045264.1 protein_id gnl|my_center|LOCUS_04220 141829 140795 gene locus_tag LOCUS_04230 gene gpr 141829 140795 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229991.1 protein_id gnl|my_center|LOCUS_04230 141935 142198 gene locus_tag LOCUS_04240 gene rpsT 141935 142198 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_04240 142245 143159 gene locus_tag LOCUS_04250 142245 143159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 143351 143190 gene locus_tag LOCUS_04260 143351 143190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 145608 143416 gene locus_tag LOCUS_04270 145608 143416 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398511.1 protein_id gnl|my_center|LOCUS_04270 146888 145620 gene locus_tag LOCUS_04280 gene mtaB 146888 145620 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108679.1 protein_id gnl|my_center|LOCUS_04280 148908 146995 gene locus_tag LOCUS_04290 148908 146995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 149854 148988 gene locus_tag LOCUS_04300 149854 148988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 151048 149942 gene locus_tag LOCUS_04310 151048 149942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 151245 152537 gene locus_tag LOCUS_04320 gene spoVB 151245 152537 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198280.1 protein_id gnl|my_center|LOCUS_04320 154597 152534 gene locus_tag LOCUS_04330 154597 152534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 156711 154663 gene locus_tag LOCUS_04340 156711 154663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 159413 156909 gene locus_tag LOCUS_04350 159413 156909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 159966 159478 gene locus_tag LOCUS_04360 159966 159478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 160164 160088 gene locus_tag LOCUS_t00050 160164 160088 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 161024 160452 gene locus_tag LOCUS_04370 161024 160452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 161248 161039 gene locus_tag LOCUS_04380 161248 161039 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831215.1 protein_id gnl|my_center|LOCUS_04380 161718 161293 gene locus_tag LOCUS_04390 161718 161293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 163750 161774 gene locus_tag LOCUS_04400 gene tkt 163750 161774 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_04400 163924 164628 gene locus_tag LOCUS_04410 163924 164628 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_04410 165416 164664 gene locus_tag LOCUS_04420 165416 164664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 166547 165531 gene locus_tag LOCUS_04430 166547 165531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 167373 166813 gene locus_tag LOCUS_04440 167373 166813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 167699 167493 gene locus_tag LOCUS_04450 167699 167493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 168637 168164 gene locus_tag LOCUS_04460 168637 168164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 169135 168980 gene locus_tag LOCUS_04470 169135 168980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04470 170402 169713 gene locus_tag LOCUS_04480 170402 169713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 170858 170409 gene locus_tag LOCUS_04490 170858 170409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 171136 170939 gene locus_tag LOCUS_04500 171136 170939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 171662 171150 gene locus_tag LOCUS_04510 171662 171150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 172289 171840 gene locus_tag LOCUS_04520 172289 171840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 172369 173463 gene locus_tag LOCUS_04530 172369 173463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 173822 173472 gene locus_tag LOCUS_04540 173822 173472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 177473 174636 gene locus_tag LOCUS_04550 177473 174636 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074841.1 protein_id gnl|my_center|LOCUS_04550 180057 177475 gene locus_tag LOCUS_04560 180057 177475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 180383 180153 gene locus_tag LOCUS_04570 180383 180153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 180873 180550 gene locus_tag LOCUS_04580 180873 180550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 181126 180866 gene locus_tag LOCUS_04590 181126 180866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 181424 181348 gene locus_tag LOCUS_t00060 181424 181348 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 182072 181572 gene locus_tag LOCUS_04600 182072 181572 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459433.1 protein_id gnl|my_center|LOCUS_04600 182637 182143 gene locus_tag LOCUS_04610 182637 182143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 183988 182684 gene locus_tag LOCUS_04620 183988 182684 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415049.1 protein_id gnl|my_center|LOCUS_04620 184812 184048 gene locus_tag LOCUS_04630 184812 184048 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_04630 186285 184822 gene locus_tag LOCUS_04640 186285 184822 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_04640 186413 186754 gene locus_tag LOCUS_04650 186413 186754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 187387 186782 gene locus_tag LOCUS_04660 187387 186782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 188190 187486 gene locus_tag LOCUS_04670 188190 187486 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_04670 189016 188168 gene locus_tag LOCUS_04680 189016 188168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 190438 189305 gene locus_tag LOCUS_04690 gene tgt 190438 189305 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723534.1 protein_id gnl|my_center|LOCUS_04690 191505 190480 gene locus_tag LOCUS_04700 gene queA 191505 190480 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_04700 192123 191533 gene locus_tag LOCUS_04710 192123 191533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence03 774 319 gene locus_tag LOCUS_04720 gene tnpA 774 319 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014124664.1 protein_id gnl|my_center|LOCUS_04720 1034 961 gene locus_tag LOCUS_t00070 1034 961 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1174 1860 gene locus_tag LOCUS_04730 1174 1860 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478981.1 protein_id gnl|my_center|LOCUS_04730 1896 2501 gene locus_tag LOCUS_04740 1896 2501 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_04740 2550 3719 gene locus_tag LOCUS_04750 2550 3719 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_04750 3909 4700 gene locus_tag LOCUS_04760 3909 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4848 5420 gene locus_tag LOCUS_04770 4848 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 5507 6292 gene locus_tag LOCUS_04780 5507 6292 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_04780 6311 6913 gene locus_tag LOCUS_04790 6311 6913 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 protein_id gnl|my_center|LOCUS_04790 6928 7371 gene locus_tag LOCUS_04800 6928 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 7399 8070 gene locus_tag LOCUS_04810 7399 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 8224 9843 gene locus_tag LOCUS_04820 8224 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 9932 11746 gene locus_tag LOCUS_04830 gene typA 9932 11746 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 protein_id gnl|my_center|LOCUS_04830 11822 12463 gene locus_tag LOCUS_04840 11822 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 12707 12522 gene locus_tag LOCUS_04850 12707 12522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 12837 15788 gene locus_tag LOCUS_04860 gene dnaE 12837 15788 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476006.1 protein_id gnl|my_center|LOCUS_04860 15788 16270 gene locus_tag LOCUS_04870 gene lspA 15788 16270 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_04870 16273 17154 gene locus_tag LOCUS_04880 16273 17154 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830176.1 protein_id gnl|my_center|LOCUS_04880 17630 18622 gene locus_tag LOCUS_04890 17630 18622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 19306 21000 gene locus_tag LOCUS_04900 19306 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 21351 20989 gene locus_tag LOCUS_04910 21351 20989 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878972.1 protein_id gnl|my_center|LOCUS_04910 21509 22663 gene locus_tag LOCUS_04920 21509 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 22757 23005 gene locus_tag LOCUS_04930 22757 23005 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_04930 23002 23421 gene locus_tag LOCUS_04940 gene ruvX 23002 23421 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 protein_id gnl|my_center|LOCUS_04940 23418 23702 gene locus_tag LOCUS_04950 23418 23702 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 protein_id gnl|my_center|LOCUS_04950 23727 24812 gene locus_tag LOCUS_04960 gene mltG 23727 24812 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572132.1 protein_id gnl|my_center|LOCUS_04960 24806 25402 gene locus_tag LOCUS_04970 24806 25402 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229800.1 protein_id gnl|my_center|LOCUS_04970 25472 26254 gene locus_tag LOCUS_04980 25472 26254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 26307 27176 gene locus_tag LOCUS_04990 26307 27176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 27250 28125 gene locus_tag LOCUS_05000 27250 28125 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742806.1 protein_id gnl|my_center|LOCUS_05000 28127 29320 gene locus_tag LOCUS_05010 28127 29320 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 protein_id gnl|my_center|LOCUS_05010 29313 30452 gene locus_tag LOCUS_05020 29313 30452 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258767.1 protein_id gnl|my_center|LOCUS_05020 30520 30993 gene locus_tag LOCUS_05030 gene greA 30520 30993 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129554.1 protein_id gnl|my_center|LOCUS_05030 31094 32368 gene locus_tag LOCUS_05040 gene tig 31094 32368 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_05040 32493 34796 gene locus_tag LOCUS_05050 gene lon 32493 34796 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 protein_id gnl|my_center|LOCUS_05050 34796 35452 gene locus_tag LOCUS_05060 34796 35452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 35507 36331 gene locus_tag LOCUS_05070 35507 36331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 36324 37235 gene locus_tag LOCUS_05080 36324 37235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 37522 38703 gene locus_tag LOCUS_05090 37522 38703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 38780 39175 gene locus_tag LOCUS_05100 38780 39175 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_05100 39177 39719 gene locus_tag LOCUS_05110 39177 39719 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_05110 39790 39987 gene locus_tag LOCUS_05120 39790 39987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 40045 42147 gene locus_tag LOCUS_05130 gene clpB 40045 42147 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_05130 42241 43419 gene locus_tag LOCUS_05140 42241 43419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 43523 44236 gene locus_tag LOCUS_05150 43523 44236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 44328 44729 gene locus_tag LOCUS_05160 44328 44729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 44757 45302 gene locus_tag LOCUS_05170 44757 45302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 46287 45325 gene locus_tag LOCUS_05180 gene add 46287 45325 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966287.1 protein_id gnl|my_center|LOCUS_05180 47324 46284 gene locus_tag LOCUS_05190 47324 46284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 47428 47691 gene locus_tag LOCUS_05200 47428 47691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 47771 48382 gene locus_tag LOCUS_05210 gene ywaC 47771 48382 CDS product GTP pyrophosphokinase YwaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244564.1 protein_id gnl|my_center|LOCUS_05210 48406 49191 gene locus_tag LOCUS_05220 48406 49191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 49423 49683 gene locus_tag LOCUS_05230 49423 49683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 49697 50563 gene locus_tag LOCUS_05240 49697 50563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 50574 51200 gene locus_tag LOCUS_05250 50574 51200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 52243 51512 gene locus_tag LOCUS_05260 52243 51512 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_05260 52400 53089 gene locus_tag LOCUS_05270 52400 53089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 53846 54451 gene locus_tag LOCUS_05280 53846 54451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_05280 54460 55155 gene locus_tag LOCUS_05290 54460 55155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 55206 55886 gene locus_tag LOCUS_05300 55206 55886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 56009 57601 gene locus_tag LOCUS_05310 56009 57601 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830940.1 protein_id gnl|my_center|LOCUS_05310 57594 57959 gene locus_tag LOCUS_05320 57594 57959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 58923 57979 gene locus_tag LOCUS_05330 58923 57979 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809839.1 protein_id gnl|my_center|LOCUS_05330 59984 58920 gene locus_tag LOCUS_05340 59984 58920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809841.1 protein_id gnl|my_center|LOCUS_05340 60895 59981 gene locus_tag LOCUS_05350 60895 59981 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198966.1 protein_id gnl|my_center|LOCUS_05350 60998 61558 gene locus_tag LOCUS_05360 60998 61558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 61580 62152 gene locus_tag LOCUS_05370 61580 62152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 62156 62605 gene locus_tag LOCUS_05380 62156 62605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 62658 63905 gene locus_tag LOCUS_05390 62658 63905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 63976 64049 gene locus_tag LOCUS_t00080 63976 64049 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 64054 64128 gene locus_tag LOCUS_t00090 64054 64128 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 64367 64221 gene locus_tag LOCUS_05400 64367 64221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 64524 64730 gene locus_tag LOCUS_05410 64524 64730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 64730 65545 gene locus_tag LOCUS_05420 64730 65545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 65623 66300 gene locus_tag LOCUS_05430 65623 66300 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_05430 66854 66297 gene locus_tag LOCUS_05440 66854 66297 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_05440 67443 66841 gene locus_tag LOCUS_05450 67443 66841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 67568 69307 gene locus_tag LOCUS_05460 67568 69307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948104.1 protein_id gnl|my_center|LOCUS_05460 69601 70404 gene locus_tag LOCUS_05470 69601 70404 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_05470 70385 72913 gene locus_tag LOCUS_05480 gene valS 70385 72913 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072238.1 protein_id gnl|my_center|LOCUS_05480 73010 73456 gene locus_tag LOCUS_05490 73010 73456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 73490 74179 gene locus_tag LOCUS_05500 gene radC 73490 74179 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_05500 74236 75033 gene locus_tag LOCUS_05510 gene mreC 74236 75033 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725674.1 protein_id gnl|my_center|LOCUS_05510 75033 75542 gene locus_tag LOCUS_05520 75033 75542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 75589 76179 gene locus_tag LOCUS_05530 75589 76179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 76418 76924 gene locus_tag LOCUS_05540 76418 76924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 76977 77052 gene locus_tag LOCUS_t00100 76977 77052 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 77095 77168 gene locus_tag LOCUS_t00110 77095 77168 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 77661 78179 gene locus_tag LOCUS_05550 77661 78179 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911193.1 protein_id gnl|my_center|LOCUS_05550 78187 78414 gene locus_tag LOCUS_05560 78187 78414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 78445 79233 gene locus_tag LOCUS_05570 78445 79233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 79703 80476 gene locus_tag LOCUS_05580 79703 80476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 80967 83159 gene locus_tag LOCUS_05590 gene rnr 80967 83159 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_05590 83263 84042 gene locus_tag LOCUS_05600 83263 84042 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901989.1 protein_id gnl|my_center|LOCUS_05600 84095 85108 gene locus_tag LOCUS_05610 84095 85108 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_05610 85219 86493 gene locus_tag LOCUS_05620 85219 86493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 86827 87642 gene locus_tag LOCUS_05630 86827 87642 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676321.1 protein_id gnl|my_center|LOCUS_05630 87804 88808 gene locus_tag LOCUS_05640 gene galE 87804 88808 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_05640 90354 88837 gene locus_tag LOCUS_05650 90354 88837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 90505 91800 gene locus_tag LOCUS_05660 90505 91800 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830979.1 protein_id gnl|my_center|LOCUS_05660 91851 92423 gene locus_tag LOCUS_05670 91851 92423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 92538 93920 gene locus_tag LOCUS_05680 92538 93920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 94047 95330 gene locus_tag LOCUS_05690 94047 95330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 95460 96857 gene locus_tag LOCUS_05700 95460 96857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 96973 98364 gene locus_tag LOCUS_05710 96973 98364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 98477 100081 gene locus_tag LOCUS_05720 98477 100081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 100681 100133 gene locus_tag LOCUS_05730 gene def 100681 100133 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957056.1 protein_id gnl|my_center|LOCUS_05730 100941 100774 gene locus_tag LOCUS_05740 100941 100774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 101082 102239 gene locus_tag LOCUS_05750 gene ftsW 101082 102239 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 protein_id gnl|my_center|LOCUS_05750 102286 102981 gene locus_tag LOCUS_05760 gene comEA 102286 102981 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 protein_id gnl|my_center|LOCUS_05760 102950 105016 gene locus_tag LOCUS_05770 102950 105016 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_05770 105149 106051 gene locus_tag LOCUS_05780 gene dnaI 105149 106051 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_05780 106056 108056 gene locus_tag LOCUS_05790 106056 108056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 108129 108872 gene locus_tag LOCUS_05800 108129 108872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 109185 110942 gene locus_tag LOCUS_05810 gene thrS 109185 110942 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830850.1 protein_id gnl|my_center|LOCUS_05810 111013 112614 gene locus_tag LOCUS_05820 111013 112614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 112697 113980 gene locus_tag LOCUS_05830 112697 113980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 114374 114811 gene locus_tag LOCUS_05840 gene mraZ 114374 114811 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_05840 114808 115734 gene locus_tag LOCUS_05850 gene rsmH 114808 115734 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731975.1 protein_id gnl|my_center|LOCUS_05850 115750 116055 gene locus_tag LOCUS_05860 115750 116055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 116073 118217 gene locus_tag LOCUS_05870 gene pbpB 116073 118217 CDS product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 protein_id gnl|my_center|LOCUS_05870 118227 118775 gene locus_tag LOCUS_05880 118227 118775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 119298 120674 gene locus_tag LOCUS_05890 119298 120674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 120684 120968 gene locus_tag LOCUS_05900 120684 120968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 121087 121968 gene locus_tag LOCUS_05910 121087 121968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 122062 122742 gene locus_tag LOCUS_05920 122062 122742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05920 122732 122959 gene locus_tag LOCUS_05930 122732 122959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05930 123269 123943 gene locus_tag LOCUS_05940 123269 123943 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_05940 123945 124520 gene locus_tag LOCUS_05950 123945 124520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 124577 125038 gene locus_tag LOCUS_05960 124577 125038 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_05960 125038 125514 gene locus_tag LOCUS_05970 125038 125514 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_05970 125519 126400 gene locus_tag LOCUS_05980 125519 126400 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_05980 126400 127440 gene locus_tag LOCUS_05990 126400 127440 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_05990 127456 128478 gene locus_tag LOCUS_06000 127456 128478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 129630 130700 gene locus_tag LOCUS_06010 129630 130700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 130703 132124 gene locus_tag LOCUS_06020 130703 132124 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_06020 132133 132570 gene locus_tag LOCUS_06030 132133 132570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 132588 133757 gene locus_tag LOCUS_06040 gene ugd 132588 133757 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 protein_id gnl|my_center|LOCUS_06040 133985 134440 gene locus_tag LOCUS_06050 133985 134440 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460983.1 protein_id gnl|my_center|LOCUS_06050 134557 135228 gene locus_tag LOCUS_06060 134557 135228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 136069 135242 gene locus_tag LOCUS_06070 136069 135242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 136192 137820 gene locus_tag LOCUS_06080 136192 137820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 137940 139346 gene locus_tag LOCUS_06090 137940 139346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 139455 140729 gene locus_tag LOCUS_06100 139455 140729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 140824 142218 gene locus_tag LOCUS_06110 140824 142218 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_06110 142281 143681 gene locus_tag LOCUS_06120 142281 143681 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_06120 143681 144157 gene locus_tag LOCUS_06130 143681 144157 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_06130 145421 144147 gene locus_tag LOCUS_06140 145421 144147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 145661 146287 gene locus_tag LOCUS_06150 145661 146287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 146280 147086 gene locus_tag LOCUS_06160 146280 147086 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_06160 149009 147093 gene locus_tag LOCUS_06170 149009 147093 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266234.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence04 980 471 gene locus_tag LOCUS_06180 980 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1658 1071 gene locus_tag LOCUS_06190 1658 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 9835 1673 gene locus_tag LOCUS_06200 9835 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11020 9857 gene locus_tag LOCUS_06210 11020 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 12720 11092 gene locus_tag LOCUS_06220 12720 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 12820 12695 gene locus_tag LOCUS_06230 12820 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 13924 12881 gene locus_tag LOCUS_06240 13924 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 14655 13942 gene locus_tag LOCUS_06250 14655 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 14842 15129 gene locus_tag LOCUS_06260 14842 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 15986 15504 gene locus_tag LOCUS_06270 15986 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 17957 15987 gene locus_tag LOCUS_06280 17957 15987 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306202.1 protein_id gnl|my_center|LOCUS_06280 18755 18060 gene locus_tag LOCUS_06290 18755 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 19086 18919 gene locus_tag LOCUS_06300 19086 18919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 20356 19031 gene locus_tag LOCUS_06310 20356 19031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 20858 20358 gene locus_tag LOCUS_06320 20858 20358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 22398 21202 gene locus_tag LOCUS_06330 22398 21202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 22885 22415 gene locus_tag LOCUS_06340 22885 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 23803 23405 gene locus_tag LOCUS_06350 23803 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 25235 24021 gene locus_tag LOCUS_06360 25235 24021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 27060 25222 gene locus_tag LOCUS_06370 27060 25222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 27559 27224 gene locus_tag LOCUS_06380 27559 27224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 28061 27906 gene locus_tag LOCUS_06390 28061 27906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 28324 28797 gene locus_tag LOCUS_06400 28324 28797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06400 28730 29026 gene locus_tag LOCUS_06410 28730 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06410 30245 29355 gene locus_tag LOCUS_06420 30245 29355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 30626 30282 gene locus_tag LOCUS_06430 30626 30282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 31298 30627 gene locus_tag LOCUS_06440 31298 30627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 31644 31291 gene locus_tag LOCUS_06450 31644 31291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 32618 31662 gene locus_tag LOCUS_06460 32618 31662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 33544 32615 gene locus_tag LOCUS_06470 33544 32615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 34085 33561 gene locus_tag LOCUS_06480 34085 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 34253 34486 gene locus_tag LOCUS_06490 34253 34486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 34491 35447 gene locus_tag LOCUS_06500 34491 35447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 35625 37055 gene locus_tag LOCUS_06510 35625 37055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 37151 38281 gene locus_tag LOCUS_06520 37151 38281 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002392915.1 protein_id gnl|my_center|LOCUS_06520 38975 38535 gene locus_tag LOCUS_06530 38975 38535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 41176 39182 gene locus_tag LOCUS_06540 gene recG 41176 39182 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000816.1 protein_id gnl|my_center|LOCUS_06540 42043 41246 gene locus_tag LOCUS_06550 42043 41246 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186309.1 protein_id gnl|my_center|LOCUS_06550 42641 42021 gene locus_tag LOCUS_06560 42641 42021 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055744452.1 protein_id gnl|my_center|LOCUS_06560 43578 42691 gene locus_tag LOCUS_06570 43578 42691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 43714 43902 gene locus_tag LOCUS_06580 43714 43902 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393332.1 protein_id gnl|my_center|LOCUS_06580 44948 43938 gene locus_tag LOCUS_06590 44948 43938 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_06590 45017 46033 gene locus_tag LOCUS_06600 45017 46033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 46734 46057 gene locus_tag LOCUS_06610 46734 46057 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948863.1 protein_id gnl|my_center|LOCUS_06610 47180 46734 gene locus_tag LOCUS_06620 47180 46734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 47305 47380 gene locus_tag LOCUS_t00120 47305 47380 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 47667 47795 gene locus_tag LOCUS_06630 47667 47795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 47992 48597 gene locus_tag LOCUS_06640 47992 48597 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476292.1 protein_id gnl|my_center|LOCUS_06640 49537 48701 gene locus_tag LOCUS_06650 49537 48701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 50184 49642 gene locus_tag LOCUS_06660 50184 49642 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_06660 50938 50339 gene locus_tag LOCUS_06670 50938 50339 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963348.1 protein_id gnl|my_center|LOCUS_06670 53378 51018 gene locus_tag LOCUS_06680 gene mubY 53378 51018 CDS product mutanobactin A system ABC transporter permease subunit MubY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002282912.1 protein_id gnl|my_center|LOCUS_06680 54090 53380 gene locus_tag LOCUS_06690 54090 53380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816854.1 protein_id gnl|my_center|LOCUS_06690 55999 54254 gene locus_tag LOCUS_06700 gene aspS 55999 54254 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_06700 57431 55992 gene locus_tag LOCUS_06710 gene gatB 57431 55992 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457087.1 protein_id gnl|my_center|LOCUS_06710 58894 57431 gene locus_tag LOCUS_06720 58894 57431 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183059.1 protein_id gnl|my_center|LOCUS_06720 59186 58896 gene locus_tag LOCUS_06730 59186 58896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 59830 59570 gene locus_tag LOCUS_06740 59830 59570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 60297 60088 gene locus_tag LOCUS_06750 60297 60088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 61274 60492 gene locus_tag LOCUS_06760 61274 60492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 61973 61365 gene locus_tag LOCUS_06770 61973 61365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 62855 62202 gene locus_tag LOCUS_06780 62855 62202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 62959 63882 gene locus_tag LOCUS_06790 62959 63882 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 protein_id gnl|my_center|LOCUS_06790 64918 63887 gene locus_tag LOCUS_06800 gene dacB 64918 63887 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252614.1 protein_id gnl|my_center|LOCUS_06800 65654 64965 gene locus_tag LOCUS_06810 65654 64965 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029719.1 protein_id gnl|my_center|LOCUS_06810 66232 65693 gene locus_tag LOCUS_06820 66232 65693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 68068 66287 gene locus_tag LOCUS_06830 gene glmS 68068 66287 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_06830 68541 68146 gene locus_tag LOCUS_06840 68541 68146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 69484 68534 gene locus_tag LOCUS_06850 69484 68534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 70599 69625 gene locus_tag LOCUS_06860 70599 69625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 71792 70710 gene locus_tag LOCUS_06870 71792 70710 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_06870 72753 71845 gene locus_tag LOCUS_06880 72753 71845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 73814 72750 gene locus_tag LOCUS_06890 73814 72750 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_06890 74656 74138 gene locus_tag LOCUS_06900 74656 74138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 74772 75776 gene locus_tag LOCUS_06910 gene trpS 74772 75776 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_06910 76454 75789 gene locus_tag LOCUS_06920 76454 75789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 76660 76448 gene locus_tag LOCUS_06930 76660 76448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 77817 76738 gene locus_tag LOCUS_06940 77817 76738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 78400 77828 gene locus_tag LOCUS_06950 78400 77828 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347517.1 protein_id gnl|my_center|LOCUS_06950 78790 78491 gene locus_tag LOCUS_06960 78790 78491 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890717.1 protein_id gnl|my_center|LOCUS_06960 80111 78849 gene locus_tag LOCUS_06970 80111 78849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 82256 80130 gene locus_tag LOCUS_06980 82256 80130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 83057 82299 gene locus_tag LOCUS_06990 83057 82299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 84913 83069 gene locus_tag LOCUS_07000 84913 83069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 86730 84940 gene locus_tag LOCUS_07010 86730 84940 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222039.1 protein_id gnl|my_center|LOCUS_07010 87278 86727 gene locus_tag LOCUS_07020 87278 86727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 87576 87253 gene locus_tag LOCUS_07030 87576 87253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 89825 87618 gene locus_tag LOCUS_07040 89825 87618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 90276 89845 gene locus_tag LOCUS_07050 90276 89845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 90722 90381 gene locus_tag LOCUS_07060 90722 90381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 92381 90840 gene locus_tag LOCUS_07070 92381 90840 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_07070 93876 92389 gene locus_tag LOCUS_07080 93876 92389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 93988 95370 gene locus_tag LOCUS_07090 93988 95370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964306.1 protein_id gnl|my_center|LOCUS_07090 96703 95387 gene locus_tag LOCUS_07100 96703 95387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 98020 96716 gene locus_tag LOCUS_07110 98020 96716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 99102 98104 gene locus_tag LOCUS_07120 99102 98104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 99588 99130 gene locus_tag LOCUS_07130 99588 99130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 99811 99608 gene locus_tag LOCUS_07140 99811 99608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 100678 99896 gene locus_tag LOCUS_07150 100678 99896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 101571 100678 gene locus_tag LOCUS_07160 101571 100678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 102901 101585 gene locus_tag LOCUS_07170 102901 101585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 103754 102951 gene locus_tag LOCUS_07180 103754 102951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 104221 103775 gene locus_tag LOCUS_07190 104221 103775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 107211 104236 gene locus_tag LOCUS_07200 107211 104236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 107983 107204 gene locus_tag LOCUS_07210 107983 107204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 109771 107999 gene locus_tag LOCUS_07220 109771 107999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 111428 109866 gene locus_tag LOCUS_07230 111428 109866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 112741 111494 gene locus_tag LOCUS_07240 112741 111494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 113305 112796 gene locus_tag LOCUS_07250 gene trmL 113305 112796 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_07250 113835 113308 gene locus_tag LOCUS_07260 113835 113308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 116064 113902 gene locus_tag LOCUS_07270 116064 113902 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_07270 116161 116520 gene locus_tag LOCUS_07280 116161 116520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 116804 116523 gene locus_tag LOCUS_07290 116804 116523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 116855 117229 gene locus_tag LOCUS_07300 116855 117229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 118169 117234 gene locus_tag LOCUS_07310 118169 117234 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289773.1 protein_id gnl|my_center|LOCUS_07310 118690 118283 gene locus_tag LOCUS_07320 118690 118283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 119861 118683 gene locus_tag LOCUS_07330 119861 118683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 121649 119871 gene locus_tag LOCUS_07340 121649 119871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 123201 121633 gene locus_tag LOCUS_07350 123201 121633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 124153 123194 gene locus_tag LOCUS_07360 124153 123194 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_07360 126738 124168 gene locus_tag LOCUS_07370 126738 124168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 129625 126710 gene locus_tag LOCUS_07380 129625 126710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 131543 129627 gene locus_tag LOCUS_07390 131543 129627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 132384 131548 gene locus_tag LOCUS_07400 132384 131548 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965609.1 protein_id gnl|my_center|LOCUS_07400 133148 132381 gene locus_tag LOCUS_07410 133148 132381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_07410 133898 133158 gene locus_tag LOCUS_07420 133898 133158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_07420 <134979 133977 gene locus_tag LOCUS_07430 <134979 133977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976587.1:choline binding-anchored murein hydrolase LytC >Feature sequence05 791 147 gene locus_tag LOCUS_07440 791 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1644 865 gene locus_tag LOCUS_07450 1644 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1830 2228 gene locus_tag LOCUS_07460 1830 2228 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_07460 2320 4899 gene locus_tag LOCUS_07470 2320 4899 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_07470 5940 4924 gene locus_tag LOCUS_07480 gene prsA 5940 4924 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 protein_id gnl|my_center|LOCUS_07480 6355 6867 gene locus_tag LOCUS_07490 6355 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7246 6851 gene locus_tag LOCUS_07500 7246 6851 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775686.1 protein_id gnl|my_center|LOCUS_07500 7999 7256 gene locus_tag LOCUS_07510 7999 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 8136 9878 gene locus_tag LOCUS_07520 8136 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 9976 10284 gene locus_tag LOCUS_07530 9976 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10295 11113 gene locus_tag LOCUS_07540 10295 11113 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_07540 11165 11920 gene locus_tag LOCUS_07550 gene sufC 11165 11920 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831944.1 protein_id gnl|my_center|LOCUS_07550 11910 12563 gene locus_tag LOCUS_07560 11910 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 12566 13762 gene locus_tag LOCUS_07570 12566 13762 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_07570 13763 14188 gene locus_tag LOCUS_07580 13763 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 14210 15523 gene locus_tag LOCUS_07590 gene sufB 14210 15523 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 protein_id gnl|my_center|LOCUS_07590 15690 16040 gene locus_tag LOCUS_07600 gene ssbB 15690 16040 CDS product single-stranded DNA-binding protein SsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227798.1 protein_id gnl|my_center|LOCUS_07600 16127 16480 gene locus_tag LOCUS_07610 16127 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 16541 16948 gene locus_tag LOCUS_07620 16541 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 16948 18171 gene locus_tag LOCUS_07630 16948 18171 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485262.1 protein_id gnl|my_center|LOCUS_07630 18259 19335 gene locus_tag LOCUS_07640 18259 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 19301 19993 gene locus_tag LOCUS_07650 19301 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 20010 20594 gene locus_tag LOCUS_07660 20010 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 20612 21550 gene locus_tag LOCUS_07670 gene uvsE 20612 21550 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961155.1 protein_id gnl|my_center|LOCUS_07670 22427 21534 gene locus_tag LOCUS_07680 22427 21534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 22517 23671 gene locus_tag LOCUS_07690 gene dacF 22517 23671 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_07690 23803 24321 gene locus_tag LOCUS_07700 23803 24321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 24806 26194 gene locus_tag LOCUS_07710 24806 26194 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937940.1 protein_id gnl|my_center|LOCUS_07710 26227 27144 gene locus_tag LOCUS_07720 26227 27144 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_07720 27168 27893 gene locus_tag LOCUS_07730 27168 27893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 28015 28353 gene locus_tag LOCUS_07740 28015 28353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 28457 28999 gene locus_tag LOCUS_07750 28457 28999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 29109 29552 gene locus_tag LOCUS_07760 gene spoVAC 29109 29552 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147736.1 protein_id gnl|my_center|LOCUS_07760 29549 30541 gene locus_tag LOCUS_07770 gene spoVAD 29549 30541 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241166.1 protein_id gnl|my_center|LOCUS_07770 30541 30891 gene locus_tag LOCUS_07780 gene spoVAE 30541 30891 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345915.1 protein_id gnl|my_center|LOCUS_07780 31210 30908 gene locus_tag LOCUS_07790 31210 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 31377 31649 gene locus_tag LOCUS_07800 31377 31649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 31674 31958 gene locus_tag LOCUS_07810 31674 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 32060 32656 gene locus_tag LOCUS_07820 32060 32656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 32672 34054 gene locus_tag LOCUS_07830 32672 34054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 34076 34444 gene locus_tag LOCUS_07840 34076 34444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 34561 34833 gene locus_tag LOCUS_07850 34561 34833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 34858 35142 gene locus_tag LOCUS_07860 34858 35142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 35247 35891 gene locus_tag LOCUS_07870 35247 35891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 35910 37394 gene locus_tag LOCUS_07880 35910 37394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 37415 37816 gene locus_tag LOCUS_07890 37415 37816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 37883 38599 gene locus_tag LOCUS_07900 gene scpA 37883 38599 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199753.1 protein_id gnl|my_center|LOCUS_07900 38596 39189 gene locus_tag LOCUS_07910 gene scpB 38596 39189 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375167.1 protein_id gnl|my_center|LOCUS_07910 39222 39308 gene locus_tag LOCUS_t00130 39222 39308 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40021 40224 gene locus_tag LOCUS_07920 40021 40224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 40327 40938 gene locus_tag LOCUS_07930 40327 40938 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556752.1 protein_id gnl|my_center|LOCUS_07930 40976 41734 gene locus_tag LOCUS_07940 gene murI 40976 41734 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_07940 41778 42239 gene locus_tag LOCUS_07950 41778 42239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 42245 43117 gene locus_tag LOCUS_07960 42245 43117 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_07960 43110 43775 gene locus_tag LOCUS_07970 43110 43775 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_07970 43864 44964 gene locus_tag LOCUS_07980 43864 44964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 45061 45972 gene locus_tag LOCUS_07990 45061 45972 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 protein_id gnl|my_center|LOCUS_07990 45992 46957 gene locus_tag LOCUS_08000 45992 46957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 47025 47285 gene locus_tag LOCUS_08010 47025 47285 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_08010 47534 48442 gene locus_tag LOCUS_08020 47534 48442 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868074.1 protein_id gnl|my_center|LOCUS_08020 48445 49734 gene locus_tag LOCUS_08030 gene serS 48445 49734 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_08030 50296 49778 gene locus_tag LOCUS_08040 50296 49778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 50477 51157 gene locus_tag LOCUS_08050 50477 51157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 51242 51814 gene locus_tag LOCUS_08060 51242 51814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 51881 53293 gene locus_tag LOCUS_08070 gene miaB 51881 53293 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439565.1 protein_id gnl|my_center|LOCUS_08070 53277 53624 gene locus_tag LOCUS_08080 53277 53624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 53702 55387 gene locus_tag LOCUS_08090 53702 55387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 55475 56035 gene locus_tag LOCUS_08100 gene cotE 55475 56035 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 protein_id gnl|my_center|LOCUS_08100 56112 56387 gene locus_tag LOCUS_08110 gene rpsP 56112 56387 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_08110 56389 56637 gene locus_tag LOCUS_08120 56389 56637 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_08120 56720 57520 gene locus_tag LOCUS_08130 56720 57520 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732813.1 protein_id gnl|my_center|LOCUS_08130 57529 58566 gene locus_tag LOCUS_08140 gene rseP 57529 58566 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583162.1 protein_id gnl|my_center|LOCUS_08140 58579 58731 gene locus_tag LOCUS_08150 58579 58731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 58789 60951 gene locus_tag LOCUS_08160 gene priA 58789 60951 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_08160 61025 61285 gene locus_tag LOCUS_08170 61025 61285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 61303 62532 gene locus_tag LOCUS_08180 61303 62532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 62538 63461 gene locus_tag LOCUS_08190 gene fmt 62538 63461 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598811.1 protein_id gnl|my_center|LOCUS_08190 63471 64196 gene locus_tag LOCUS_08200 63471 64196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 64288 65199 gene locus_tag LOCUS_08210 64288 65199 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814609.1 protein_id gnl|my_center|LOCUS_08210 65304 66323 gene locus_tag LOCUS_08220 gene rlmN 65304 66323 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356987.1 protein_id gnl|my_center|LOCUS_08220 66323 67066 gene locus_tag LOCUS_08230 66323 67066 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_08230 67067 68902 gene locus_tag LOCUS_08240 gene prkC 67067 68902 CDS product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 protein_id gnl|my_center|LOCUS_08240 68918 69745 gene locus_tag LOCUS_08250 gene rsgA 68918 69745 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162036.1 protein_id gnl|my_center|LOCUS_08250 69750 70376 gene locus_tag LOCUS_08260 gene rpe 69750 70376 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287380.1 protein_id gnl|my_center|LOCUS_08260 70398 71279 gene locus_tag LOCUS_08270 70398 71279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 71375 72061 gene locus_tag LOCUS_08280 71375 72061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 72148 73281 gene locus_tag LOCUS_08290 72148 73281 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723322.1 protein_id gnl|my_center|LOCUS_08290 73316 73537 gene locus_tag LOCUS_08300 73316 73537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 73530 74744 gene locus_tag LOCUS_08310 73530 74744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150048584.1 protein_id gnl|my_center|LOCUS_08310 74807 75658 gene locus_tag LOCUS_08320 74807 75658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 75771 76289 gene locus_tag LOCUS_08330 75771 76289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 76661 77764 gene locus_tag LOCUS_08340 76661 77764 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587069.1 protein_id gnl|my_center|LOCUS_08340 78062 79489 gene locus_tag LOCUS_08350 78062 79489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 79492 80097 gene locus_tag LOCUS_08360 79492 80097 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875112.1 protein_id gnl|my_center|LOCUS_08360 80546 81109 gene locus_tag LOCUS_08370 80546 81109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 81123 82142 gene locus_tag LOCUS_08380 81123 82142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 82458 83210 gene locus_tag LOCUS_08390 82458 83210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 83226 83789 gene locus_tag LOCUS_08400 83226 83789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 83776 83910 gene locus_tag LOCUS_08410 83776 83910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 84279 85877 gene locus_tag LOCUS_08420 84279 85877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 85891 86349 gene locus_tag LOCUS_08430 85891 86349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 86520 86377 gene locus_tag LOCUS_08440 86520 86377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 87108 86974 gene locus_tag LOCUS_08450 87108 86974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 87362 88300 gene locus_tag LOCUS_08460 87362 88300 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681918.1 protein_id gnl|my_center|LOCUS_08460 88300 89481 gene locus_tag LOCUS_08470 88300 89481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294551.1 protein_id gnl|my_center|LOCUS_08470 89468 90616 gene locus_tag LOCUS_08480 89468 90616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence06 1362 244 gene locus_tag LOCUS_08490 1362 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2506 1391 gene locus_tag LOCUS_08500 2506 1391 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_08500 3479 2613 gene locus_tag LOCUS_08510 3479 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4541 3537 gene locus_tag LOCUS_08520 gene rfbB 4541 3537 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_08520 5483 4554 gene locus_tag LOCUS_08530 gene rfbD 5483 4554 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_08530 6059 5487 gene locus_tag LOCUS_08540 gene rfbC 6059 5487 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_08540 6947 6069 gene locus_tag LOCUS_08550 gene rfbA 6947 6069 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462486.1 protein_id gnl|my_center|LOCUS_08550 7801 6950 gene locus_tag LOCUS_08560 7801 6950 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592816.1 protein_id gnl|my_center|LOCUS_08560 9094 7829 gene locus_tag LOCUS_08570 9094 7829 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628931.1 protein_id gnl|my_center|LOCUS_08570 9268 11073 gene locus_tag LOCUS_08580 9268 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 11181 11966 gene locus_tag LOCUS_08590 11181 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 17592 12025 gene locus_tag LOCUS_08600 17592 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 18518 17709 gene locus_tag LOCUS_08610 18518 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 21005 18828 gene locus_tag LOCUS_08620 21005 18828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 24557 21099 gene locus_tag LOCUS_08630 24557 21099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 24750 26804 gene locus_tag LOCUS_08640 24750 26804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 27272 26868 gene locus_tag LOCUS_08650 27272 26868 CDS product DUF5684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028234.1 protein_id gnl|my_center|LOCUS_08650 27648 27250 gene locus_tag LOCUS_08660 27648 27250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 27680 27859 gene locus_tag LOCUS_08670 27680 27859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 28047 27892 gene locus_tag LOCUS_08680 28047 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08680 28802 28149 gene locus_tag LOCUS_08690 28802 28149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 30886 28802 gene locus_tag LOCUS_08700 30886 28802 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987152.1 protein_id gnl|my_center|LOCUS_08700 37629 30979 gene locus_tag LOCUS_08710 37629 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 37979 37731 gene locus_tag LOCUS_08720 37979 37731 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_08720 39210 37984 gene locus_tag LOCUS_08730 gene fmhC 39210 37984 CDS product FemA/FemB family glycyltransferase FmhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672869.1 protein_id gnl|my_center|LOCUS_08730 40107 39226 gene locus_tag LOCUS_08740 40107 39226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 40859 40200 gene locus_tag LOCUS_08750 40859 40200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 41433 40975 gene locus_tag LOCUS_08760 41433 40975 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287450.1 protein_id gnl|my_center|LOCUS_08760 41974 41426 gene locus_tag LOCUS_08770 gene nrdG 41974 41426 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_08770 44109 41986 gene locus_tag LOCUS_08780 gene nrdD 44109 41986 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187770.1 protein_id gnl|my_center|LOCUS_08780 44226 44861 gene locus_tag LOCUS_08790 44226 44861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 47029 44876 gene locus_tag LOCUS_08800 47029 44876 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296403.1 protein_id gnl|my_center|LOCUS_08800 47455 47090 gene locus_tag LOCUS_08810 47455 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 48367 47465 gene locus_tag LOCUS_08820 gene trxB 48367 47465 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_08820 48678 48367 gene locus_tag LOCUS_08830 gene trxA 48678 48367 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_08830 49390 48935 gene locus_tag LOCUS_08840 49390 48935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 56822 49326 gene locus_tag LOCUS_08850 56822 49326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 57361 57002 gene locus_tag LOCUS_08860 57361 57002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 57876 57316 gene locus_tag LOCUS_08870 57876 57316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 61460 58029 gene locus_tag LOCUS_08880 gene nifJ 61460 58029 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 protein_id gnl|my_center|LOCUS_08880 61870 61550 gene locus_tag LOCUS_08890 61870 61550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 62625 62125 gene locus_tag LOCUS_08900 62625 62125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 62851 62675 gene locus_tag LOCUS_08910 62851 62675 CDS product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621751.1 protein_id gnl|my_center|LOCUS_08910 64050 62944 gene locus_tag LOCUS_08920 64050 62944 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_08920 64697 64050 gene locus_tag LOCUS_08930 64697 64050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 65576 64734 gene locus_tag LOCUS_08940 65576 64734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 66046 65576 gene locus_tag LOCUS_08950 66046 65576 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_08950 67183 66047 gene locus_tag LOCUS_08960 67183 66047 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831623.1 protein_id gnl|my_center|LOCUS_08960 67899 67252 gene locus_tag LOCUS_08970 67899 67252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence07 857 2617 gene locus_tag LOCUS_08980 gene uvrC 857 2617 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_08980 2646 3800 gene locus_tag LOCUS_08990 2646 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 3887 5662 gene locus_tag LOCUS_09000 gene mutL 3887 5662 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_09000 5711 6478 gene locus_tag LOCUS_09010 5711 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 6485 7357 gene locus_tag LOCUS_09020 gene miaA 6485 7357 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_09020 7423 7893 gene locus_tag LOCUS_09030 7423 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 8121 9401 gene locus_tag LOCUS_09040 8121 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 9711 19517 gene locus_tag LOCUS_09050 9711 19517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 19622 19756 gene locus_tag LOCUS_09060 19622 19756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 19922 21823 gene locus_tag LOCUS_09070 gene parE 19922 21823 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381887.1 protein_id gnl|my_center|LOCUS_09070 21865 22470 gene locus_tag LOCUS_09080 21865 22470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 22488 25022 gene locus_tag LOCUS_09090 gene parC 22488 25022 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989723.1 protein_id gnl|my_center|LOCUS_09090 25102 26496 gene locus_tag LOCUS_09100 25102 26496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 26616 27893 gene locus_tag LOCUS_09110 26616 27893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 28650 27916 gene locus_tag LOCUS_09120 gene zupT 28650 27916 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_09120 28725 29321 gene locus_tag LOCUS_09130 28725 29321 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_09130 29343 30512 gene locus_tag LOCUS_09140 29343 30512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 30764 32152 gene locus_tag LOCUS_09150 gene hisS 30764 32152 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590826.1 protein_id gnl|my_center|LOCUS_09150 32156 32563 gene locus_tag LOCUS_09160 32156 32563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 32563 34308 gene locus_tag LOCUS_09170 gene aspS 32563 34308 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830872.1 protein_id gnl|my_center|LOCUS_09170 34313 35743 gene locus_tag LOCUS_09180 gene proS 34313 35743 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_09180 35797 37098 gene locus_tag LOCUS_09190 gene murC 35797 37098 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484970.1 protein_id gnl|my_center|LOCUS_09190 37487 38179 gene locus_tag LOCUS_09200 37487 38179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 38630 39211 gene locus_tag LOCUS_09210 38630 39211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 39297 40718 gene locus_tag LOCUS_09220 39297 40718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 40715 40996 gene locus_tag LOCUS_09230 40715 40996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 41202 41861 gene locus_tag LOCUS_09240 41202 41861 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948085.1 protein_id gnl|my_center|LOCUS_09240 41858 43132 gene locus_tag LOCUS_09250 41858 43132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 43176 43967 gene locus_tag LOCUS_09260 43176 43967 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986711.1 protein_id gnl|my_center|LOCUS_09260 44039 44115 gene locus_tag LOCUS_t00140 44039 44115 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 44428 44192 gene locus_tag LOCUS_09270 44428 44192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 44866 47076 gene locus_tag LOCUS_09280 44866 47076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 47176 48477 gene locus_tag LOCUS_09290 47176 48477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 48672 49016 gene locus_tag LOCUS_09300 48672 49016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 49179 49790 gene locus_tag LOCUS_09310 49179 49790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 49801 50313 gene locus_tag LOCUS_09320 49801 50313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 51080 50310 gene locus_tag LOCUS_09330 51080 50310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 51645 51073 gene locus_tag LOCUS_09340 51645 51073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 53045 51645 gene locus_tag LOCUS_09350 53045 51645 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947970.1 protein_id gnl|my_center|LOCUS_09350 53116 54330 gene locus_tag LOCUS_09360 gene rlmD 53116 54330 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_09360 54465 55499 gene locus_tag LOCUS_09370 54465 55499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 55522 56019 gene locus_tag LOCUS_09380 55522 56019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 56600 57484 gene locus_tag LOCUS_09390 56600 57484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 57540 58046 gene locus_tag LOCUS_09400 57540 58046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 58245 60794 gene locus_tag LOCUS_09410 58245 60794 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence08 1202 168 gene locus_tag LOCUS_09420 1202 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2873 1281 gene locus_tag LOCUS_09430 gene gpmI 2873 1281 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_09430 3897 2917 gene locus_tag LOCUS_09440 gene mraY 3897 2917 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_09440 4709 4005 gene locus_tag LOCUS_09450 4709 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5502 4798 gene locus_tag LOCUS_09460 5502 4798 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966343.1 protein_id gnl|my_center|LOCUS_09460 6185 5505 gene locus_tag LOCUS_09470 gene cap8B 6185 5505 CDS product type 8 capsular polysaccharide synthesis protein Cap8B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037332.1 protein_id gnl|my_center|LOCUS_09470 6868 6188 gene locus_tag LOCUS_09480 6868 6188 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393150.1 protein_id gnl|my_center|LOCUS_09480 7056 7280 gene locus_tag LOCUS_09490 gene sspI 7056 7280 CDS product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 protein_id gnl|my_center|LOCUS_09490 7365 7883 gene locus_tag LOCUS_09500 7365 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 8885 7872 gene locus_tag LOCUS_09510 gene yqeH 8885 7872 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990141.1 protein_id gnl|my_center|LOCUS_09510 9396 8878 gene locus_tag LOCUS_09520 9396 8878 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836600.1 protein_id gnl|my_center|LOCUS_09520 10830 9442 gene locus_tag LOCUS_09530 10830 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 11625 10936 gene locus_tag LOCUS_09540 gene sigK 11625 10936 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_09540 12194 11676 gene locus_tag LOCUS_09550 gene yfcE 12194 11676 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_09550 13270 12191 gene locus_tag LOCUS_09560 13270 12191 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_09560 13559 13353 gene locus_tag LOCUS_09570 13559 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 14458 13619 gene locus_tag LOCUS_09580 14458 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 14746 14996 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq actggtcctaccggaccaactgg 15171 16256 gene locus_tag LOCUS_09590 15171 16256 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_09590 17665 16292 gene locus_tag LOCUS_09600 17665 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 19003 17765 gene locus_tag LOCUS_09610 19003 17765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 19942 19055 gene locus_tag LOCUS_09620 19942 19055 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890749.1 protein_id gnl|my_center|LOCUS_09620 20420 20061 gene locus_tag LOCUS_09630 20420 20061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 20961 20680 gene locus_tag LOCUS_09640 20961 20680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 21422 21066 gene locus_tag LOCUS_09650 21422 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 22787 21726 gene locus_tag LOCUS_09660 22787 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 25983 23029 gene locus_tag LOCUS_09670 25983 23029 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183129.1 protein_id gnl|my_center|LOCUS_09670 26716 26060 gene locus_tag LOCUS_09680 26716 26060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 27274 26831 gene locus_tag LOCUS_09690 27274 26831 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_09690 28234 27371 gene locus_tag LOCUS_09700 28234 27371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 28894 28298 gene locus_tag LOCUS_09710 28894 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 31129 28970 gene locus_tag LOCUS_09720 gene pnp 31129 28970 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 protein_id gnl|my_center|LOCUS_09720 31450 31181 gene locus_tag LOCUS_09730 gene rpsO 31450 31181 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_09730 32986 31586 gene locus_tag LOCUS_09740 32986 31586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 34081 33128 gene locus_tag LOCUS_09750 gene rhuM 34081 33128 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_09750 34515 34246 gene locus_tag LOCUS_09760 34515 34246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 34940 34512 gene locus_tag LOCUS_09770 34940 34512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 39572 34953 gene locus_tag LOCUS_09780 39572 34953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 40433 39594 gene locus_tag LOCUS_09790 40433 39594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 42021 40717 gene locus_tag LOCUS_09800 42021 40717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 44008 42125 gene locus_tag LOCUS_09810 gene htpG 44008 42125 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_09810 44990 44106 gene locus_tag LOCUS_09820 44990 44106 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_09820 46619 45171 gene locus_tag LOCUS_09830 46619 45171 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966104.1 protein_id gnl|my_center|LOCUS_09830 46729 47637 gene locus_tag LOCUS_09840 gene rocF 46729 47637 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_09840 50749 47651 gene locus_tag LOCUS_09850 gene ileS 50749 47651 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_09850 51740 50787 gene locus_tag LOCUS_09860 51740 50787 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_09860 52481 52044 gene locus_tag LOCUS_09870 gene divIVA 52481 52044 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 protein_id gnl|my_center|LOCUS_09870 52943 52518 gene locus_tag LOCUS_09880 gene sepF 52943 52518 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_09880 54901 53132 gene locus_tag LOCUS_09890 54901 53132 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387067.1 protein_id gnl|my_center|LOCUS_09890 55020 55751 gene locus_tag LOCUS_09900 55020 55751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 55869 55793 gene locus_tag LOCUS_t00150 55869 55793 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 55950 55874 gene locus_tag LOCUS_t00160 55950 55874 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56074 55999 gene locus_tag LOCUS_t00170 56074 55999 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 994 1473 gene locus_tag LOCUS_09910 994 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1529 2560 gene locus_tag LOCUS_09920 1529 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2562 3170 gene locus_tag LOCUS_09930 2562 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3483 4757 gene locus_tag LOCUS_09940 3483 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4975 5160 gene locus_tag LOCUS_09950 4975 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5537 6136 gene locus_tag LOCUS_09960 gene def 5537 6136 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527648.1 protein_id gnl|my_center|LOCUS_09960 6518 6228 gene locus_tag LOCUS_09970 6518 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 6890 7723 gene locus_tag LOCUS_09980 6890 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7752 8159 gene locus_tag LOCUS_09990 7752 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 8152 9501 gene locus_tag LOCUS_10000 8152 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 9582 9812 gene locus_tag LOCUS_10010 9582 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 9805 10119 gene locus_tag LOCUS_10020 9805 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 10175 10375 gene locus_tag LOCUS_10030 10175 10375 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105789.1 protein_id gnl|my_center|LOCUS_10030 10424 10499 gene locus_tag LOCUS_t00180 10424 10499 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10788 11276 gene locus_tag LOCUS_10040 10788 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 11353 11910 gene locus_tag LOCUS_10050 11353 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 11976 12809 gene locus_tag LOCUS_10060 gene cdaA 11976 12809 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476186.1 protein_id gnl|my_center|LOCUS_10060 12793 14148 gene locus_tag LOCUS_10070 12793 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 14261 15037 gene locus_tag LOCUS_10080 gene spo0A 14261 15037 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_10080 15147 16424 gene locus_tag LOCUS_10090 15147 16424 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_10090 16536 17744 gene locus_tag LOCUS_10100 16536 17744 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_10100 17996 18307 gene locus_tag LOCUS_10110 gene rpsJ 17996 18307 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_10110 18325 19065 gene locus_tag LOCUS_10120 gene rplC 18325 19065 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160208.1 protein_id gnl|my_center|LOCUS_10120 19131 19757 gene locus_tag LOCUS_10130 gene rplD 19131 19757 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986657.1 protein_id gnl|my_center|LOCUS_10130 19757 20041 gene locus_tag LOCUS_10140 gene rplW 19757 20041 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829755.1 protein_id gnl|my_center|LOCUS_10140 20057 20887 gene locus_tag LOCUS_10150 gene rplB 20057 20887 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727696.1 protein_id gnl|my_center|LOCUS_10150 20905 21174 gene locus_tag LOCUS_10160 gene rpsS 20905 21174 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183024.1 protein_id gnl|my_center|LOCUS_10160 21199 21531 gene locus_tag LOCUS_10170 gene rplV 21199 21531 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_10170 21549 22202 gene locus_tag LOCUS_10180 gene rpsC 21549 22202 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529877.1 protein_id gnl|my_center|LOCUS_10180 22204 22623 gene locus_tag LOCUS_10190 gene rplP 22204 22623 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926310.1 protein_id gnl|my_center|LOCUS_10190 22625 22819 gene locus_tag LOCUS_10200 gene rpmC 22625 22819 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_10200 22830 23090 gene locus_tag LOCUS_10210 gene rpsQ 22830 23090 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198401951.1 protein_id gnl|my_center|LOCUS_10210 23116 23484 gene locus_tag LOCUS_10220 gene rplN 23116 23484 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_10220 23497 23805 gene locus_tag LOCUS_10230 gene rplX 23497 23805 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_10230 23824 24363 gene locus_tag LOCUS_10240 gene rplE 23824 24363 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720938.1 protein_id gnl|my_center|LOCUS_10240 24376 24561 gene locus_tag LOCUS_10250 24376 24561 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_10250 24583 24984 gene locus_tag LOCUS_10260 gene rpsH 24583 24984 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 protein_id gnl|my_center|LOCUS_10260 25010 25540 gene locus_tag LOCUS_10270 gene rplF 25010 25540 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567536.1 protein_id gnl|my_center|LOCUS_10270 25569 25931 gene locus_tag LOCUS_10280 gene rplR 25569 25931 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_10280 25944 26450 gene locus_tag LOCUS_10290 gene rpsE 25944 26450 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554646.1 protein_id gnl|my_center|LOCUS_10290 26450 26893 gene locus_tag LOCUS_10300 gene rplO 26450 26893 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_10300 26895 28163 gene locus_tag LOCUS_10310 gene secY 26895 28163 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_10310 28163 28825 gene locus_tag LOCUS_10320 28163 28825 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_10320 28822 29580 gene locus_tag LOCUS_10330 gene map 28822 29580 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_10330 29573 29788 gene locus_tag LOCUS_10340 gene infA 29573 29788 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_10340 29940 30308 gene locus_tag LOCUS_10350 gene rpsM 29940 30308 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_10350 30349 30732 gene locus_tag LOCUS_10360 gene rpsK 30349 30732 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 protein_id gnl|my_center|LOCUS_10360 30754 31704 gene locus_tag LOCUS_10370 30754 31704 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641267.1 protein_id gnl|my_center|LOCUS_10370 31722 32084 gene locus_tag LOCUS_10380 gene rplQ 31722 32084 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701337.1 protein_id gnl|my_center|LOCUS_10380 32160 32393 gene locus_tag LOCUS_10390 32160 32393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 32383 33702 gene locus_tag LOCUS_10400 32383 33702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 33762 34520 gene locus_tag LOCUS_10410 33762 34520 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_10410 34540 35328 gene locus_tag LOCUS_10420 34540 35328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 35319 36083 gene locus_tag LOCUS_10430 35319 36083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 36092 36841 gene locus_tag LOCUS_10440 gene truA 36092 36841 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988132.1 protein_id gnl|my_center|LOCUS_10440 36960 37391 gene locus_tag LOCUS_10450 gene rplM 36960 37391 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_10450 37404 37829 gene locus_tag LOCUS_10460 gene rpsI 37404 37829 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_10460 37903 38202 gene locus_tag LOCUS_10470 37903 38202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 38364 39158 gene locus_tag LOCUS_10480 38364 39158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 39252 39908 gene locus_tag LOCUS_10490 gene cwlD 39252 39908 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822439.1 protein_id gnl|my_center|LOCUS_10490 39986 44590 gene locus_tag LOCUS_10500 gene essC 39986 44590 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963368.1 protein_id gnl|my_center|LOCUS_10500 44599 44856 gene locus_tag LOCUS_10510 44599 44856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 44867 45049 gene locus_tag LOCUS_10520 44867 45049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 45049 45279 gene locus_tag LOCUS_10530 45049 45279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 46456 45401 gene locus_tag LOCUS_10540 gene spoIID 46456 45401 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432452.1 protein_id gnl|my_center|LOCUS_10540 47467 46502 gene locus_tag LOCUS_10550 47467 46502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 47570 48523 gene locus_tag LOCUS_10560 47570 48523 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_10560 48516 49889 gene locus_tag LOCUS_10570 48516 49889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 51084 50020 gene locus_tag LOCUS_10580 51084 50020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 52294 51110 gene locus_tag LOCUS_10590 52294 51110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 53227 52313 gene locus_tag LOCUS_10600 53227 52313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 53804 53244 gene locus_tag LOCUS_10610 53804 53244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 53960 54664 gene locus_tag LOCUS_10620 53960 54664 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence10 187 855 gene locus_tag LOCUS_10630 187 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 947 1816 gene locus_tag LOCUS_10640 947 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1883 2125 gene locus_tag LOCUS_10650 1883 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2118 3302 gene locus_tag LOCUS_10660 gene yqfD 2118 3302 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_10660 3286 3882 gene locus_tag LOCUS_10670 3286 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3899 4348 gene locus_tag LOCUS_10680 gene ybeY 3899 4348 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230039.1 protein_id gnl|my_center|LOCUS_10680 4332 4727 gene locus_tag LOCUS_10690 4332 4727 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_10690 4772 5158 gene locus_tag LOCUS_10700 gene cdd 4772 5158 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830967.1 protein_id gnl|my_center|LOCUS_10700 5155 6042 gene locus_tag LOCUS_10710 gene era 5155 6042 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_10710 6174 6920 gene locus_tag LOCUS_10720 gene recO 6174 6920 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730435.1 protein_id gnl|my_center|LOCUS_10720 6930 7196 gene locus_tag LOCUS_10730 6930 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 7230 7616 gene locus_tag LOCUS_10740 7230 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 7946 8497 gene locus_tag LOCUS_10750 7946 8497 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762909.1 protein_id gnl|my_center|LOCUS_10750 8485 9861 gene locus_tag LOCUS_10760 8485 9861 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_10760 9873 10607 gene locus_tag LOCUS_10770 9873 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 10680 11522 gene locus_tag LOCUS_10780 10680 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 11650 12243 gene locus_tag LOCUS_10790 11650 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 12398 13003 gene locus_tag LOCUS_10800 12398 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 13005 14780 gene locus_tag LOCUS_10810 13005 14780 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_10810 14752 15411 gene locus_tag LOCUS_10820 14752 15411 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_10820 15597 16142 gene locus_tag LOCUS_10830 gene infC 15597 16142 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 protein_id gnl|my_center|LOCUS_10830 16158 16370 gene locus_tag LOCUS_10840 16158 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 16397 16993 gene locus_tag LOCUS_10850 16397 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 17086 18030 gene locus_tag LOCUS_10860 17086 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 18077 18949 gene locus_tag LOCUS_10870 gene tsf 18077 18949 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699817.1 protein_id gnl|my_center|LOCUS_10870 18953 19495 gene locus_tag LOCUS_10880 18953 19495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 19571 20608 gene locus_tag LOCUS_10890 19571 20608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 20678 21223 gene locus_tag LOCUS_10900 gene frr 20678 21223 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_10900 21500 22558 gene locus_tag LOCUS_10910 gene pheS 21500 22558 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003566.1 protein_id gnl|my_center|LOCUS_10910 22551 24923 gene locus_tag LOCUS_10920 gene pheT 22551 24923 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498183.1 protein_id gnl|my_center|LOCUS_10920 25037 25636 gene locus_tag LOCUS_10930 25037 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 25708 26796 gene locus_tag LOCUS_10940 gene murG 25708 26796 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_10940 26793 27698 gene locus_tag LOCUS_10950 gene murB 26793 27698 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437020.1 protein_id gnl|my_center|LOCUS_10950 27704 28393 gene locus_tag LOCUS_10960 27704 28393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 28602 29843 gene locus_tag LOCUS_10970 gene ftsA 28602 29843 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774997.1 protein_id gnl|my_center|LOCUS_10970 29856 30998 gene locus_tag LOCUS_10980 gene ftsZ 29856 30998 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888987.1 protein_id gnl|my_center|LOCUS_10980 31088 31636 gene locus_tag LOCUS_10990 31088 31636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 31717 33969 gene locus_tag LOCUS_11000 31717 33969 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990110.1 protein_id gnl|my_center|LOCUS_11000 34030 34389 gene locus_tag LOCUS_11010 34030 34389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 34389 34610 gene locus_tag LOCUS_11020 34389 34610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 34668 34952 gene locus_tag LOCUS_11030 34668 34952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 34949 35488 gene locus_tag LOCUS_11040 gene rsmD 34949 35488 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_11040 35532 37214 gene locus_tag LOCUS_11050 35532 37214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 37335 38324 gene locus_tag LOCUS_11060 gene hrcA 37335 38324 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_11060 38338 38940 gene locus_tag LOCUS_11070 38338 38940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 38961 40784 gene locus_tag LOCUS_11080 gene dnaK 38961 40784 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 protein_id gnl|my_center|LOCUS_11080 40850 42649 gene locus_tag LOCUS_11090 gene pepF 40850 42649 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_11090 42661 43800 gene locus_tag LOCUS_11100 gene dnaJ 42661 43800 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016154.1 protein_id gnl|my_center|LOCUS_11100 44718 43813 gene locus_tag LOCUS_11110 gene rnhC 44718 43813 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071591.1 protein_id gnl|my_center|LOCUS_11110 44792 45493 gene locus_tag LOCUS_11120 44792 45493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 45590 46492 gene locus_tag LOCUS_11130 gene rpoD 45590 46492 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_11130 47070 46480 gene locus_tag LOCUS_11140 47070 46480 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence11 <1 511 gene locus_tag LOCUS_11150 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964229.1:glycoside hydrolase family 48 protein 682 2169 gene locus_tag LOCUS_11160 682 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2343 3737 gene locus_tag LOCUS_11170 2343 3737 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_11170 4390 3773 gene locus_tag LOCUS_11180 gene lexA 4390 3773 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_11180 4520 4669 gene locus_tag LOCUS_11190 4520 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4713 7337 gene locus_tag LOCUS_11200 gene polA 4713 7337 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_11200 7355 8176 gene locus_tag LOCUS_11210 gene mutM 7355 8176 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_11210 8286 9695 gene locus_tag LOCUS_11220 gene pyk 8286 9695 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_11220 10460 9795 gene locus_tag LOCUS_11230 gene gmk 10460 9795 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965025.1 protein_id gnl|my_center|LOCUS_11230 11616 10453 gene locus_tag LOCUS_11240 11616 10453 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_11240 11750 12205 gene locus_tag LOCUS_11250 11750 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 12211 12420 gene locus_tag LOCUS_11260 gene rpmF 12211 12420 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154457.1 protein_id gnl|my_center|LOCUS_11260 12515 13270 gene locus_tag LOCUS_11270 12515 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 13513 14403 gene locus_tag LOCUS_11280 13513 14403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 14463 16760 gene locus_tag LOCUS_11290 14463 16760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 17027 16896 gene locus_tag LOCUS_11300 17027 16896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 17190 17780 gene locus_tag LOCUS_11310 17190 17780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 17829 20918 gene locus_tag LOCUS_11320 17829 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 21507 20929 gene locus_tag LOCUS_11330 21507 20929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 21657 23273 gene locus_tag LOCUS_11340 21657 23273 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434813.1 protein_id gnl|my_center|LOCUS_11340 23288 24151 gene locus_tag LOCUS_11350 23288 24151 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680113.1 protein_id gnl|my_center|LOCUS_11350 24153 24989 gene locus_tag LOCUS_11360 24153 24989 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 protein_id gnl|my_center|LOCUS_11360 25086 25829 gene locus_tag LOCUS_11370 25086 25829 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_11370 26501 25845 gene locus_tag LOCUS_11380 26501 25845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262246.1 protein_id gnl|my_center|LOCUS_11380 27998 26511 gene locus_tag LOCUS_11390 27998 26511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262247.1 protein_id gnl|my_center|LOCUS_11390 28139 29512 gene locus_tag LOCUS_11400 28139 29512 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771434.1 protein_id gnl|my_center|LOCUS_11400 29612 30523 gene locus_tag LOCUS_11410 29612 30523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 30646 32673 gene locus_tag LOCUS_11420 30646 32673 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860818.1 protein_id gnl|my_center|LOCUS_11420 34111 32723 gene locus_tag LOCUS_11430 34111 32723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 34763 34098 gene locus_tag LOCUS_11440 34763 34098 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_11440 34901 36448 gene locus_tag LOCUS_11450 34901 36448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 36528 37166 gene locus_tag LOCUS_11460 36528 37166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 37144 37671 gene locus_tag LOCUS_11470 37144 37671 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_11470 37655 38164 gene locus_tag LOCUS_11480 37655 38164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 38181 38257 gene locus_tag LOCUS_t00190 38181 38257 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38280 38681 gene locus_tag LOCUS_11490 38280 38681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 38767 39747 gene locus_tag LOCUS_11500 38767 39747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 39834 40190 gene locus_tag LOCUS_11510 39834 40190 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191027.1 protein_id gnl|my_center|LOCUS_11510 40243 40782 gene locus_tag LOCUS_11520 gene cobC 40243 40782 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_11520 40772 41269 gene locus_tag LOCUS_11530 40772 41269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 41271 41795 gene locus_tag LOCUS_11540 41271 41795 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903719.1 protein_id gnl|my_center|LOCUS_11540 41805 42251 gene locus_tag LOCUS_11550 41805 42251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 42253 42834 gene locus_tag LOCUS_11560 42253 42834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 42987 43502 gene locus_tag LOCUS_11570 42987 43502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence12 849 64 gene locus_tag LOCUS_11580 849 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1139 936 gene locus_tag LOCUS_11590 1139 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1401 1222 gene locus_tag LOCUS_11600 1401 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1553 1386 gene locus_tag LOCUS_11610 1553 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1690 1550 gene locus_tag LOCUS_11620 1690 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2097 1687 gene locus_tag LOCUS_11630 2097 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 4156 2081 gene locus_tag LOCUS_11640 4156 2081 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_11640 4356 4280 gene locus_tag LOCUS_t00200 4356 4280 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5457 4534 gene locus_tag LOCUS_11650 5457 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5712 5506 gene locus_tag LOCUS_11660 gene gerE 5712 5506 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_11660 6289 5786 gene locus_tag LOCUS_11670 6289 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6959 6354 gene locus_tag LOCUS_11680 6959 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 8250 7021 gene locus_tag LOCUS_11690 8250 7021 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_11690 8990 8250 gene locus_tag LOCUS_11700 gene fabG 8990 8250 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_11700 9769 9212 gene locus_tag LOCUS_11710 gene efp 9769 9212 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 protein_id gnl|my_center|LOCUS_11710 9945 9766 gene locus_tag LOCUS_11720 9945 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 10123 9959 gene locus_tag LOCUS_11730 gene rpmG 10123 9959 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583730.1 protein_id gnl|my_center|LOCUS_11730 10974 10327 gene locus_tag LOCUS_11740 10974 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 12028 10967 gene locus_tag LOCUS_11750 12028 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 13907 12501 gene locus_tag LOCUS_11760 13907 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 16073 14013 gene locus_tag LOCUS_11770 16073 14013 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038974.1 protein_id gnl|my_center|LOCUS_11770 16139 16402 gene locus_tag LOCUS_11780 16139 16402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 17297 16413 gene locus_tag LOCUS_11790 17297 16413 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924220.1 protein_id gnl|my_center|LOCUS_11790 18013 17378 gene locus_tag LOCUS_11800 18013 17378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 19031 18138 gene locus_tag LOCUS_11810 19031 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 20701 19070 gene locus_tag LOCUS_11820 20701 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 22422 20698 gene locus_tag LOCUS_11830 22422 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 23624 22428 gene locus_tag LOCUS_11840 23624 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 23828 24823 gene locus_tag LOCUS_11850 23828 24823 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092280.1 protein_id gnl|my_center|LOCUS_11850 24820 25692 gene locus_tag LOCUS_11860 24820 25692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 25676 26131 gene locus_tag LOCUS_11870 25676 26131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 26122 27135 gene locus_tag LOCUS_11880 26122 27135 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053180.1 protein_id gnl|my_center|LOCUS_11880 27132 28079 gene locus_tag LOCUS_11890 27132 28079 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775923.1 protein_id gnl|my_center|LOCUS_11890 28076 28741 gene locus_tag LOCUS_11900 28076 28741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 29394 28825 gene locus_tag LOCUS_11910 29394 28825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 29964 29494 gene locus_tag LOCUS_11920 29964 29494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 31167 29998 gene locus_tag LOCUS_11930 31167 29998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 31854 31216 gene locus_tag LOCUS_11940 31854 31216 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454832.1 protein_id gnl|my_center|LOCUS_11940 31933 32295 gene locus_tag LOCUS_11950 31933 32295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 32922 32296 gene locus_tag LOCUS_11960 32922 32296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 34052 32961 gene locus_tag LOCUS_11970 gene rpoD 34052 32961 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_11970 35779 34055 gene locus_tag LOCUS_11980 gene dnaG 35779 34055 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528223.1 protein_id gnl|my_center|LOCUS_11980 37355 36339 gene locus_tag LOCUS_11990 37355 36339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence13 182 1210 gene locus_tag LOCUS_12000 182 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1934 1257 gene locus_tag LOCUS_12010 1934 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2060 3217 gene locus_tag LOCUS_12020 2060 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3207 4232 gene locus_tag LOCUS_12030 3207 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4247 5371 gene locus_tag LOCUS_12040 4247 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5447 5716 gene locus_tag LOCUS_12050 5447 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 5709 6842 gene locus_tag LOCUS_12060 gene nusA 5709 6842 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428238.1 protein_id gnl|my_center|LOCUS_12060 6851 7114 gene locus_tag LOCUS_12070 6851 7114 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_12070 7133 9265 gene locus_tag LOCUS_12080 gene infB 7133 9265 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036343.1 protein_id gnl|my_center|LOCUS_12080 9276 9611 gene locus_tag LOCUS_12090 9276 9611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 9624 9974 gene locus_tag LOCUS_12100 gene rbfA 9624 9974 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_12100 10104 10835 gene locus_tag LOCUS_12110 gene estV 10104 10835 CDS product lipase EstV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129409.1 protein_id gnl|my_center|LOCUS_12110 10837 12444 gene locus_tag LOCUS_12120 10837 12444 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_12120 12457 13680 gene locus_tag LOCUS_12130 12457 13680 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_12130 13710 14282 gene locus_tag LOCUS_12140 13710 14282 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461522.1 protein_id gnl|my_center|LOCUS_12140 14361 14879 gene locus_tag LOCUS_12150 14361 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 15174 15099 gene locus_tag LOCUS_t00210 15174 15099 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15414 15490 gene locus_tag LOCUS_t00220 15414 15490 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 15499 15575 gene locus_tag LOCUS_t00230 15499 15575 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 15584 15660 gene locus_tag LOCUS_t00240 15584 15660 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15748 15838 gene locus_tag LOCUS_t00250 15748 15838 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15941 23590 gene locus_tag LOCUS_12160 15941 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 23590 24780 gene locus_tag LOCUS_12170 23590 24780 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148852.1 protein_id gnl|my_center|LOCUS_12170 24885 25721 gene locus_tag LOCUS_12180 24885 25721 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_12180 25738 26439 gene locus_tag LOCUS_12190 25738 26439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 26604 27254 gene locus_tag LOCUS_12200 26604 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 27254 28360 gene locus_tag LOCUS_12210 27254 28360 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054224.1 protein_id gnl|my_center|LOCUS_12210 28422 29198 gene locus_tag LOCUS_12220 gene sigG 28422 29198 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_12220 29232 29459 gene locus_tag LOCUS_12230 29232 29459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 29600 30256 gene locus_tag LOCUS_12240 29600 30256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 30287 30565 gene locus_tag LOCUS_12250 30287 30565 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722426.1 protein_id gnl|my_center|LOCUS_12250 30631 30909 gene locus_tag LOCUS_12260 30631 30909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 30927 32144 gene locus_tag LOCUS_12270 30927 32144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 32187 33095 gene locus_tag LOCUS_12280 32187 33095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 33331 33098 gene locus_tag LOCUS_12290 33331 33098 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431159.1 protein_id gnl|my_center|LOCUS_12290 33452 33823 gene locus_tag LOCUS_12300 gene yugI 33452 33823 CDS product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722395.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence14 863 78 gene locus_tag LOCUS_12310 863 78 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679709.1 protein_id gnl|my_center|LOCUS_12310 2030 1173 gene locus_tag LOCUS_12320 2030 1173 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_12320 4080 2044 gene locus_tag LOCUS_12330 4080 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4544 4080 gene locus_tag LOCUS_12340 4544 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 6020 4593 gene locus_tag LOCUS_12350 gene gatB 6020 4593 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_12350 7476 6013 gene locus_tag LOCUS_12360 gene gatA 7476 6013 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458553.1 protein_id gnl|my_center|LOCUS_12360 7765 7469 gene locus_tag LOCUS_12370 7765 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 8402 7836 gene locus_tag LOCUS_12380 8402 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 10459 8471 gene locus_tag LOCUS_12390 gene ligA 10459 8471 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 protein_id gnl|my_center|LOCUS_12390 11047 10511 gene locus_tag LOCUS_12400 11047 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 11710 11066 gene locus_tag LOCUS_12410 11710 11066 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373626.1 protein_id gnl|my_center|LOCUS_12410 12647 11733 gene locus_tag LOCUS_12420 12647 11733 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_12420 14756 12660 gene locus_tag LOCUS_12430 gene pcrA 14756 12660 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989805.1 protein_id gnl|my_center|LOCUS_12430 15835 14834 gene locus_tag LOCUS_12440 15835 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 16528 15860 gene locus_tag LOCUS_12450 16528 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 18353 16494 gene locus_tag LOCUS_12460 18353 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 18596 19600 gene locus_tag LOCUS_12470 18596 19600 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_12470 20869 19781 gene locus_tag LOCUS_12480 20869 19781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 21230 21979 gene locus_tag LOCUS_12490 21230 21979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_12490 21966 22766 gene locus_tag LOCUS_12500 21966 22766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_12500 23488 22874 gene locus_tag LOCUS_12510 23488 22874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 24634 23630 gene locus_tag LOCUS_12520 gene tsaD 24634 23630 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414606.1 protein_id gnl|my_center|LOCUS_12520 25052 24648 gene locus_tag LOCUS_12530 25052 24648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 25672 25052 gene locus_tag LOCUS_12540 gene tsaB 25672 25052 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234078.1 protein_id gnl|my_center|LOCUS_12540 26127 25669 gene locus_tag LOCUS_12550 gene tsaE 26127 25669 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_12550 26316 26247 gene locus_tag LOCUS_r00010 26316 26247 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 58 percent of the 5S ribosomal RNA >Feature sequence15 329 952 gene locus_tag LOCUS_12560 329 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 961 1542 gene locus_tag LOCUS_12570 961 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1544 2473 gene locus_tag LOCUS_12580 1544 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2529 3623 gene locus_tag LOCUS_12590 2529 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3632 5176 gene locus_tag LOCUS_12600 3632 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5195 6310 gene locus_tag LOCUS_12610 5195 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6320 6910 gene locus_tag LOCUS_12620 6320 6910 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767792.1 protein_id gnl|my_center|LOCUS_12620 6894 7622 gene locus_tag LOCUS_12630 6894 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7688 8752 gene locus_tag LOCUS_12640 7688 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 9370 8780 gene locus_tag LOCUS_12650 9370 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 9477 9782 gene locus_tag LOCUS_12660 9477 9782 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349637.1 protein_id gnl|my_center|LOCUS_12660 10028 10921 gene locus_tag LOCUS_12670 10028 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12670 11089 13290 gene locus_tag LOCUS_12680 11089 13290 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_12680 13283 13504 gene locus_tag LOCUS_12690 13283 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 13513 13659 gene locus_tag LOCUS_12700 13513 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 14102 15040 gene locus_tag LOCUS_12710 14102 15040 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681918.1 protein_id gnl|my_center|LOCUS_12710 15040 16221 gene locus_tag LOCUS_12720 15040 16221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294551.1 protein_id gnl|my_center|LOCUS_12720 16208 17359 gene locus_tag LOCUS_12730 16208 17359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 17482 18000 gene locus_tag LOCUS_12740 17482 18000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 18003 18626 gene locus_tag LOCUS_12750 18003 18626 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762300.1 protein_id gnl|my_center|LOCUS_12750 18639 19253 gene locus_tag LOCUS_12760 18639 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 19297 20670 gene locus_tag LOCUS_12770 19297 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence16 1998 994 gene locus_tag LOCUS_12780 gene ruvB 1998 994 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_12780 2571 2011 gene locus_tag LOCUS_12790 gene ruvA 2571 2011 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272487.1 protein_id gnl|my_center|LOCUS_12790 3317 2667 gene locus_tag LOCUS_12800 3317 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4433 3402 gene locus_tag LOCUS_12810 4433 3402 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158639.1 protein_id gnl|my_center|LOCUS_12810 5433 4474 gene locus_tag LOCUS_12820 5433 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6478 5546 gene locus_tag LOCUS_12830 gene holA 6478 5546 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279906.1 protein_id gnl|my_center|LOCUS_12830 9158 6471 gene locus_tag LOCUS_12840 gene alaS 9158 6471 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811741.1 protein_id gnl|my_center|LOCUS_12840 9717 9163 gene locus_tag LOCUS_12850 9717 9163 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870916.1 protein_id gnl|my_center|LOCUS_12850 11069 9921 gene locus_tag LOCUS_12860 11069 9921 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 protein_id gnl|my_center|LOCUS_12860 11488 11207 gene locus_tag LOCUS_12870 11488 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence17 1724 141 gene locus_tag LOCUS_12880 1724 141 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_12880 2922 1711 gene locus_tag LOCUS_12890 2922 1711 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_12890 5090 2982 gene locus_tag LOCUS_12900 5090 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 5298 5179 gene locus_tag LOCUS_12910 5298 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5766 5347 gene locus_tag LOCUS_12920 5766 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12920 7030 5945 gene locus_tag LOCUS_12930 gene spoVE 7030 5945 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_12930 7166 7966 gene locus_tag LOCUS_12940 7166 7966 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence18 797 78 gene locus_tag LOCUS_12950 797 78 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701782.1 protein_id gnl|my_center|LOCUS_12950 909 1202 gene locus_tag LOCUS_12960 909 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2489 1215 gene locus_tag LOCUS_12970 2489 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2886 2581 gene locus_tag LOCUS_12980 2886 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3047 3433 gene locus_tag LOCUS_12990 gene cotY 3047 3433 CDS product spore coat protein CotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239243.1 protein_id gnl|my_center|LOCUS_12990 3449 3832 gene locus_tag LOCUS_13000 3449 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4205 3846 gene locus_tag LOCUS_13010 4205 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4242 5372 gene locus_tag LOCUS_13020 4242 5372 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence19 1668 559 gene locus_tag LOCUS_13030 gene dcm 1668 559 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964810.1 protein_id gnl|my_center|LOCUS_13030 2838 1711 gene locus_tag LOCUS_13040 2838 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3412 2825 gene locus_tag LOCUS_13050 3412 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3662 3928 gene locus_tag LOCUS_13060 3662 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence20 990 103 gene locus_tag LOCUS_13070 990 103 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_13070 3028 1034 gene locus_tag LOCUS_13080 3028 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence21 849 1175 gene locus_tag LOCUS_13090 849 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1252 1536 gene locus_tag LOCUS_13100 1252 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1537 2088 gene locus_tag LOCUS_13110 1537 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13110 2951 2367 gene locus_tag LOCUS_13120 2951 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120