>Feature sequence01 1054 773 gene locus_tag LOCUS_00010 1054 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3091 1130 gene locus_tag LOCUS_00020 3091 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4022 3105 gene locus_tag LOCUS_00030 gene dnaI 4022 3105 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_00030 5302 4019 gene locus_tag LOCUS_00040 5302 4019 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415039.1 protein_id gnl|my_center|LOCUS_00040 6805 5381 gene locus_tag LOCUS_00050 6805 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7341 6868 gene locus_tag LOCUS_00060 7341 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8083 7367 gene locus_tag LOCUS_00070 8083 7367 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464874.1 protein_id gnl|my_center|LOCUS_00070 9358 8156 gene locus_tag LOCUS_00080 9358 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10013 9348 gene locus_tag LOCUS_00090 gene rncS 10013 9348 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 protein_id gnl|my_center|LOCUS_00090 10183 10093 gene locus_tag LOCUS_t00010 10183 10093 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11680 10298 gene locus_tag LOCUS_00100 11680 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12618 11752 gene locus_tag LOCUS_00110 12618 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12838 12602 gene locus_tag LOCUS_00120 gene yidD 12838 12602 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_00120 12928 13347 gene locus_tag LOCUS_00130 12928 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13347 14288 gene locus_tag LOCUS_00140 13347 14288 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_00140 14682 14335 gene locus_tag LOCUS_00150 14682 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15735 14692 gene locus_tag LOCUS_00160 gene rseP 15735 14692 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_00160 16549 15749 gene locus_tag LOCUS_00170 16549 15749 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640734.1 protein_id gnl|my_center|LOCUS_00170 17255 16530 gene locus_tag LOCUS_00180 17255 16530 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_00180 17579 17337 gene locus_tag LOCUS_00190 17579 17337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17851 17579 gene locus_tag LOCUS_00200 gene rpsP 17851 17579 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_00200 18460 17924 gene locus_tag LOCUS_00210 gene cotE 18460 17924 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288799.1 protein_id gnl|my_center|LOCUS_00210 19708 18545 gene locus_tag LOCUS_00220 19708 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21227 19809 gene locus_tag LOCUS_00230 gene miaB 21227 19809 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_00230 21958 21299 gene locus_tag LOCUS_00240 21958 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23003 21975 gene locus_tag LOCUS_00250 23003 21975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24395 23121 gene locus_tag LOCUS_00260 24395 23121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25048 24392 gene locus_tag LOCUS_00270 25048 24392 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948085.1 protein_id gnl|my_center|LOCUS_00270 25742 25113 gene locus_tag LOCUS_00280 25742 25113 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194268.1 protein_id gnl|my_center|LOCUS_00280 27809 26115 gene locus_tag LOCUS_00290 27809 26115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30229 27848 gene locus_tag LOCUS_00300 gene leuS 30229 27848 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009455.1 protein_id gnl|my_center|LOCUS_00300 30569 30222 gene locus_tag LOCUS_00310 30569 30222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33213 30820 gene locus_tag LOCUS_00320 33213 30820 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688713.1 protein_id gnl|my_center|LOCUS_00320 34642 33230 gene locus_tag LOCUS_00330 gene pyk 34642 33230 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_00330 35003 34734 gene locus_tag LOCUS_00340 35003 34734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37713 35344 gene locus_tag LOCUS_00350 37713 35344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38779 38087 gene locus_tag LOCUS_00360 gene sigE 38779 38087 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_00360 39573 38782 gene locus_tag LOCUS_00370 gene spoIIGA 39573 38782 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965001.1 protein_id gnl|my_center|LOCUS_00370 40709 39630 gene locus_tag LOCUS_00380 gene ftsZ 40709 39630 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888987.1 protein_id gnl|my_center|LOCUS_00380 41960 40722 gene locus_tag LOCUS_00390 gene ftsA 41960 40722 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731981.1 protein_id gnl|my_center|LOCUS_00390 42821 42060 gene locus_tag LOCUS_00400 42821 42060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 43658 42834 gene locus_tag LOCUS_00410 43658 42834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 45559 43757 gene locus_tag LOCUS_00420 gene asnB 45559 43757 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_00420 45669 46517 gene locus_tag LOCUS_00430 gene dpaA 45669 46517 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231888.1 protein_id gnl|my_center|LOCUS_00430 46514 47095 gene locus_tag LOCUS_00440 46514 47095 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_00440 48038 47115 gene locus_tag LOCUS_00450 48038 47115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 49118 48099 gene locus_tag LOCUS_00460 49118 48099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 50626 49121 gene locus_tag LOCUS_00470 gene gpmI 50626 49121 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_00470 53627 50682 gene locus_tag LOCUS_00480 53627 50682 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_00480 56907 53710 gene locus_tag LOCUS_00490 56907 53710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 58574 56979 gene locus_tag LOCUS_00500 58574 56979 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_00500 59283 58924 gene locus_tag LOCUS_00510 59283 58924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 60130 59423 gene locus_tag LOCUS_00520 60130 59423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 61100 60144 gene locus_tag LOCUS_00530 61100 60144 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_00530 62962 61154 gene locus_tag LOCUS_00540 gene mutL 62962 61154 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_00540 63179 62973 gene locus_tag LOCUS_00550 63179 62973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 65225 63387 gene locus_tag LOCUS_00560 65225 63387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_00560 67404 65218 gene locus_tag LOCUS_00570 67404 65218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_00570 68012 67416 gene locus_tag LOCUS_00580 68012 67416 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287269.1 protein_id gnl|my_center|LOCUS_00580 68265 68786 gene locus_tag LOCUS_00590 68265 68786 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_00590 69453 68779 gene locus_tag LOCUS_00600 69453 68779 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183576.1 protein_id gnl|my_center|LOCUS_00600 70145 69450 gene locus_tag LOCUS_00610 70145 69450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 70380 70225 gene locus_tag LOCUS_00620 70380 70225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72663 70459 gene locus_tag LOCUS_00630 72663 70459 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398511.1 protein_id gnl|my_center|LOCUS_00630 73940 72663 gene locus_tag LOCUS_00640 gene mtaB 73940 72663 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_00640 74789 73971 gene locus_tag LOCUS_00650 74789 73971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 75498 74794 gene locus_tag LOCUS_00660 75498 74794 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183200.1 protein_id gnl|my_center|LOCUS_00660 76048 75506 gene locus_tag LOCUS_00670 76048 75506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 76746 76051 gene locus_tag LOCUS_00680 76746 76051 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 protein_id gnl|my_center|LOCUS_00680 77058 76897 gene locus_tag LOCUS_00690 77058 76897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 77102 77683 gene locus_tag LOCUS_00700 77102 77683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 81418 77933 gene locus_tag LOCUS_00710 81418 77933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 82306 81497 gene locus_tag LOCUS_00720 82306 81497 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_00720 82808 82380 gene locus_tag LOCUS_00730 82808 82380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 84473 82827 gene locus_tag LOCUS_00740 84473 82827 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823075.1 protein_id gnl|my_center|LOCUS_00740 86268 84841 gene locus_tag LOCUS_00750 86268 84841 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290378.1 protein_id gnl|my_center|LOCUS_00750 86852 86349 gene locus_tag LOCUS_00760 86852 86349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 87508 86909 gene locus_tag LOCUS_00770 87508 86909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 88642 87692 gene locus_tag LOCUS_00780 88642 87692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 89761 89177 gene locus_tag LOCUS_00790 89761 89177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 90311 89787 gene locus_tag LOCUS_00800 90311 89787 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359138.1 protein_id gnl|my_center|LOCUS_00800 90930 90322 gene locus_tag LOCUS_00810 90930 90322 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875112.1 protein_id gnl|my_center|LOCUS_00810 91460 90927 gene locus_tag LOCUS_00820 gene cobC 91460 90927 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_00820 92084 91479 gene locus_tag LOCUS_00830 92084 91479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 93502 92087 gene locus_tag LOCUS_00840 93502 92087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 94577 93594 gene locus_tag LOCUS_00850 94577 93594 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_00850 95413 94580 gene locus_tag LOCUS_00860 95413 94580 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_00860 95903 95403 gene locus_tag LOCUS_00870 gene coaD 95903 95403 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401377.1 protein_id gnl|my_center|LOCUS_00870 96457 95900 gene locus_tag LOCUS_00880 gene coaE 96457 95900 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_00880 96549 97442 gene locus_tag LOCUS_00890 96549 97442 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_00890 97474 97914 gene locus_tag LOCUS_00900 97474 97914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 99337 98243 gene locus_tag LOCUS_00910 99337 98243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 99918 99505 gene locus_tag LOCUS_00920 99918 99505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 100338 100066 gene locus_tag LOCUS_00930 100338 100066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 100480 100704 gene locus_tag LOCUS_00940 100480 100704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 100815 101120 gene locus_tag LOCUS_00950 100815 101120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 102025 101264 gene locus_tag LOCUS_00960 102025 101264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 103365 102109 gene locus_tag LOCUS_00970 gene mobV 103365 102109 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122374.1 protein_id gnl|my_center|LOCUS_00970 103952 103362 gene locus_tag LOCUS_00980 103952 103362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 104677 104138 gene locus_tag LOCUS_00990 104677 104138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 105162 104683 gene locus_tag LOCUS_01000 105162 104683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01000 105637 105362 gene locus_tag LOCUS_01010 105637 105362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 106673 105954 gene locus_tag LOCUS_01020 106673 105954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 106791 107834 gene locus_tag LOCUS_01030 106791 107834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 109163 107922 gene locus_tag LOCUS_01040 gene mobV 109163 107922 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122374.1 protein_id gnl|my_center|LOCUS_01040 110985 109144 gene locus_tag LOCUS_01050 110985 109144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 111363 111097 gene locus_tag LOCUS_01060 111363 111097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 111534 111459 gene locus_tag LOCUS_t00020 111534 111459 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 115340 111933 gene locus_tag LOCUS_01070 gene nifJ 115340 111933 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 protein_id gnl|my_center|LOCUS_01070 115837 115415 gene locus_tag LOCUS_01080 115837 115415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 116126 115830 gene locus_tag LOCUS_01090 116126 115830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 117379 116126 gene locus_tag LOCUS_01100 117379 116126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 118037 117381 gene locus_tag LOCUS_01110 118037 117381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 118752 118123 gene locus_tag LOCUS_01120 gene trmB 118752 118123 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_01120 118848 119150 gene locus_tag LOCUS_01130 118848 119150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 119186 120040 gene locus_tag LOCUS_01140 gene dapF 119186 120040 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_01140 120441 120049 gene locus_tag LOCUS_01150 120441 120049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 124150 120515 gene locus_tag LOCUS_01160 gene rpoC 124150 120515 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 protein_id gnl|my_center|LOCUS_01160 127746 124150 gene locus_tag LOCUS_01170 gene rpoB 127746 124150 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_01170 128428 127844 gene locus_tag LOCUS_01180 128428 127844 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 protein_id gnl|my_center|LOCUS_01180 128899 128531 gene locus_tag LOCUS_01190 gene rplL 128899 128531 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_01190 129413 128919 gene locus_tag LOCUS_01200 gene rplJ 129413 128919 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_01200 130284 129589 gene locus_tag LOCUS_01210 gene rplA 130284 129589 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_01210 130791 130366 gene locus_tag LOCUS_01220 gene rplK 130791 130366 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_01220 131467 130934 gene locus_tag LOCUS_01230 gene nusG 131467 130934 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_01230 131649 131467 gene locus_tag LOCUS_01240 131649 131467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 132039 131896 gene locus_tag LOCUS_01250 132039 131896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 132234 132941 gene locus_tag LOCUS_01260 132234 132941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 134336 132942 gene locus_tag LOCUS_01270 134336 132942 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937940.1 protein_id gnl|my_center|LOCUS_01270 134466 135356 gene locus_tag LOCUS_01280 134466 135356 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461645.1 protein_id gnl|my_center|LOCUS_01280 136695 135379 gene locus_tag LOCUS_01290 136695 135379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 137584 136688 gene locus_tag LOCUS_01300 137584 136688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_01300 137716 139008 gene locus_tag LOCUS_01310 gene spoVB 137716 139008 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198280.1 protein_id gnl|my_center|LOCUS_01310 139406 139005 gene locus_tag LOCUS_01320 139406 139005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 140089 139460 gene locus_tag LOCUS_01330 140089 139460 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398801.1 protein_id gnl|my_center|LOCUS_01330 140167 140541 gene locus_tag LOCUS_01340 140167 140541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 140588 141277 gene locus_tag LOCUS_01350 140588 141277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 142162 141452 gene locus_tag LOCUS_01360 gene deoD 142162 141452 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_01360 143362 142250 gene locus_tag LOCUS_01370 gene tgt 143362 142250 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229725.1 protein_id gnl|my_center|LOCUS_01370 143797 143420 gene locus_tag LOCUS_01380 143797 143420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 144220 143966 gene locus_tag LOCUS_01390 144220 143966 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_01390 144504 144220 gene locus_tag LOCUS_01400 144504 144220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 144671 144820 gene locus_tag LOCUS_01410 144671 144820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 144940 144867 gene locus_tag LOCUS_t00030 144940 144867 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 147215 145017 gene locus_tag LOCUS_01420 147215 145017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 148058 147318 gene locus_tag LOCUS_01430 148058 147318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 149468 148125 gene locus_tag LOCUS_01440 149468 148125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 150362 149517 gene locus_tag LOCUS_01450 150362 149517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 151270 150359 gene locus_tag LOCUS_01460 151270 150359 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350891.1 protein_id gnl|my_center|LOCUS_01460 151930 151364 gene locus_tag LOCUS_01470 151930 151364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 152822 151935 gene locus_tag LOCUS_01480 152822 151935 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_01480 153600 152806 gene locus_tag LOCUS_01490 153600 152806 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_01490 155070 153619 gene locus_tag LOCUS_01500 155070 153619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 155554 155075 gene locus_tag LOCUS_01510 155554 155075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 156806 155613 gene locus_tag LOCUS_01520 156806 155613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 160175 156819 gene locus_tag LOCUS_01530 160175 156819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 160630 160235 gene locus_tag LOCUS_01540 160630 160235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 162659 160746 gene locus_tag LOCUS_01550 162659 160746 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676339.1 protein_id gnl|my_center|LOCUS_01550 163218 162649 gene locus_tag LOCUS_01560 163218 162649 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080830.1 protein_id gnl|my_center|LOCUS_01560 165378 163333 gene locus_tag LOCUS_01570 165378 163333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 166109 165462 gene locus_tag LOCUS_01580 166109 165462 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 protein_id gnl|my_center|LOCUS_01580 166502 166191 gene locus_tag LOCUS_01590 166502 166191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 167745 166492 gene locus_tag LOCUS_01600 167745 166492 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_01600 168544 167783 gene locus_tag LOCUS_01610 gene map 168544 167783 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724059.1 protein_id gnl|my_center|LOCUS_01610 169019 168627 gene locus_tag LOCUS_01620 169019 168627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 170105 169032 gene locus_tag LOCUS_01630 170105 169032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 171503 170115 gene locus_tag LOCUS_01640 171503 170115 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_01640 172008 171547 gene locus_tag LOCUS_01650 172008 171547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 172438 172073 gene locus_tag LOCUS_01660 172438 172073 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191031.1 protein_id gnl|my_center|LOCUS_01660 172919 172488 gene locus_tag LOCUS_01670 172919 172488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 173231 172992 gene locus_tag LOCUS_01680 173231 172992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 173781 173293 gene locus_tag LOCUS_01690 173781 173293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 175059 173788 gene locus_tag LOCUS_01700 175059 173788 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597559.1 protein_id gnl|my_center|LOCUS_01700 >Feature sequence02 940 437 gene locus_tag LOCUS_01710 940 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 1559 987 gene locus_tag LOCUS_01720 gene clpP 1559 987 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 protein_id gnl|my_center|LOCUS_01720 1919 3580 gene locus_tag LOCUS_01730 1919 3580 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_01730 3599 4612 gene locus_tag LOCUS_01740 gene gap 3599 4612 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 protein_id gnl|my_center|LOCUS_01740 5081 4650 gene locus_tag LOCUS_01750 5081 4650 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_01750 5157 5936 gene locus_tag LOCUS_01760 gene yunB 5157 5936 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 protein_id gnl|my_center|LOCUS_01760 6021 7718 gene locus_tag LOCUS_01770 6021 7718 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797038.1 protein_id gnl|my_center|LOCUS_01770 7711 7998 gene locus_tag LOCUS_01780 7711 7998 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722426.1 protein_id gnl|my_center|LOCUS_01780 8103 9176 gene locus_tag LOCUS_01790 8103 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 9230 9619 gene locus_tag LOCUS_01800 9230 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 9741 11015 gene locus_tag LOCUS_01810 9741 11015 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_01810 11302 12639 gene locus_tag LOCUS_01820 11302 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 12626 12760 gene locus_tag LOCUS_01830 12626 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 12941 13918 gene locus_tag LOCUS_01840 gene prfB 12941 13918 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_01840 13921 14802 gene locus_tag LOCUS_01850 13921 14802 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964166.1 protein_id gnl|my_center|LOCUS_01850 14806 14958 gene locus_tag LOCUS_01860 14806 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 15041 15736 gene locus_tag LOCUS_01870 gene ftsE 15041 15736 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_01870 15723 16622 gene locus_tag LOCUS_01880 gene ftsX 15723 16622 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_01880 16695 17633 gene locus_tag LOCUS_01890 16695 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 17710 19821 gene locus_tag LOCUS_01900 gene rnr 17710 19821 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 protein_id gnl|my_center|LOCUS_01900 19884 20666 gene locus_tag LOCUS_01910 gene yabG 19884 20666 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458914.1 protein_id gnl|my_center|LOCUS_01910 20677 20898 gene locus_tag LOCUS_01920 20677 20898 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702215.1 protein_id gnl|my_center|LOCUS_01920 21006 21281 gene locus_tag LOCUS_01930 gene spoVG 21006 21281 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_01930 21384 21530 gene locus_tag LOCUS_01940 21384 21530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 21705 22004 gene locus_tag LOCUS_01950 21705 22004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 22124 22717 gene locus_tag LOCUS_01960 22124 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 22772 23251 gene locus_tag LOCUS_01970 22772 23251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 23262 25595 gene locus_tag LOCUS_01980 23262 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 25582 27546 gene locus_tag LOCUS_01990 25582 27546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 27756 28148 gene locus_tag LOCUS_02000 27756 28148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 28337 28507 gene locus_tag LOCUS_02010 28337 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 28512 29195 gene locus_tag LOCUS_02020 28512 29195 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016912.1 protein_id gnl|my_center|LOCUS_02020 29465 30382 gene locus_tag LOCUS_02030 29465 30382 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357629.1 protein_id gnl|my_center|LOCUS_02030 30393 32279 gene locus_tag LOCUS_02040 30393 32279 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763167.1 protein_id gnl|my_center|LOCUS_02040 32295 34976 gene locus_tag LOCUS_02050 32295 34976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 35062 35643 gene locus_tag LOCUS_02060 gene yihA 35062 35643 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732571.1 protein_id gnl|my_center|LOCUS_02060 35700 36209 gene locus_tag LOCUS_02070 35700 36209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 36299 36673 gene locus_tag LOCUS_02080 36299 36673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 36663 37196 gene locus_tag LOCUS_02090 36663 37196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 37358 37909 gene locus_tag LOCUS_02100 37358 37909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 38208 37906 gene locus_tag LOCUS_02110 38208 37906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 38303 39025 gene locus_tag LOCUS_02120 gene scpA 38303 39025 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199753.1 protein_id gnl|my_center|LOCUS_02120 39027 39596 gene locus_tag LOCUS_02130 gene scpB 39027 39596 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376225.1 protein_id gnl|my_center|LOCUS_02130 39634 40839 gene locus_tag LOCUS_02140 39634 40839 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_02140 40874 41884 gene locus_tag LOCUS_02150 gene trpS 40874 41884 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_02150 41903 42343 gene locus_tag LOCUS_02160 41903 42343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 42573 42367 gene locus_tag LOCUS_02170 42573 42367 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105789.1 protein_id gnl|my_center|LOCUS_02170 42681 43679 gene locus_tag LOCUS_02180 42681 43679 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_02180 44092 44265 gene locus_tag LOCUS_02190 44092 44265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 44401 45357 gene locus_tag LOCUS_02200 gene rhuM 44401 45357 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_02200 45477 46289 gene locus_tag LOCUS_02210 45477 46289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 46371 47966 gene locus_tag LOCUS_02220 46371 47966 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014339.1 protein_id gnl|my_center|LOCUS_02220 47968 48603 gene locus_tag LOCUS_02230 47968 48603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 48596 49714 gene locus_tag LOCUS_02240 48596 49714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014338.1 protein_id gnl|my_center|LOCUS_02240 49731 50864 gene locus_tag LOCUS_02250 49731 50864 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_02250 50960 51655 gene locus_tag LOCUS_02260 50960 51655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 52365 51748 gene locus_tag LOCUS_02270 52365 51748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 52325 52582 gene locus_tag LOCUS_02280 52325 52582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 53419 52628 gene locus_tag LOCUS_02290 53419 52628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_02290 54161 53412 gene locus_tag LOCUS_02300 54161 53412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_02300 54549 54136 gene locus_tag LOCUS_02310 54549 54136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 54694 55671 gene locus_tag LOCUS_02320 54694 55671 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_02320 55780 55968 gene locus_tag LOCUS_02330 55780 55968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 56010 57719 gene locus_tag LOCUS_02340 56010 57719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 57912 57751 gene locus_tag LOCUS_02350 57912 57751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 59008 57950 gene locus_tag LOCUS_02360 59008 57950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 59136 59255 gene locus_tag LOCUS_02370 59136 59255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 59321 60817 gene locus_tag LOCUS_02380 59321 60817 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_02380 60863 61882 gene locus_tag LOCUS_02390 60863 61882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 62340 61888 gene locus_tag LOCUS_02400 62340 61888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 62446 64554 gene locus_tag LOCUS_02410 gene pcrA 62446 64554 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989805.1 protein_id gnl|my_center|LOCUS_02410 64542 64709 gene locus_tag LOCUS_02420 64542 64709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 64706 65563 gene locus_tag LOCUS_02430 gene galU 64706 65563 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_02430 67327 65849 gene locus_tag LOCUS_02440 67327 65849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 67505 69826 gene locus_tag LOCUS_02450 67505 69826 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_02450 69855 71036 gene locus_tag LOCUS_02460 69855 71036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 71248 72447 gene locus_tag LOCUS_02470 71248 72447 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_02470 72498 73148 gene locus_tag LOCUS_02480 72498 73148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 73150 73341 gene locus_tag LOCUS_02490 73150 73341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 73595 74641 gene locus_tag LOCUS_02500 gene pheS 73595 74641 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_02500 74643 77015 gene locus_tag LOCUS_02510 gene pheT 74643 77015 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498183.1 protein_id gnl|my_center|LOCUS_02510 77109 78176 gene locus_tag LOCUS_02520 77109 78176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 78321 79727 gene locus_tag LOCUS_02530 gene pyk 78321 79727 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_02530 79922 80365 gene locus_tag LOCUS_02540 79922 80365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 80464 81309 gene locus_tag LOCUS_02550 80464 81309 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_02550 81299 81769 gene locus_tag LOCUS_02560 81299 81769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 81766 82335 gene locus_tag LOCUS_02570 81766 82335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 82614 83567 gene locus_tag LOCUS_02580 82614 83567 CDS product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082755.1 protein_id gnl|my_center|LOCUS_02580 83878 83805 gene locus_tag LOCUS_t00040 83878 83805 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 84016 86010 gene locus_tag LOCUS_02590 84016 86010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 88055 86037 gene locus_tag LOCUS_02600 88055 86037 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987152.1 protein_id gnl|my_center|LOCUS_02600 88717 88106 gene locus_tag LOCUS_02610 88717 88106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 88989 88747 gene locus_tag LOCUS_02620 88989 88747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 89203 89484 gene locus_tag LOCUS_02630 89203 89484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 89474 89596 gene locus_tag LOCUS_02640 89474 89596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 89583 89762 gene locus_tag LOCUS_02650 89583 89762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02650 89866 91209 gene locus_tag LOCUS_02660 89866 91209 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_02660 91199 91933 gene locus_tag LOCUS_02670 91199 91933 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_02670 91953 92687 gene locus_tag LOCUS_02680 91953 92687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 93825 92677 gene locus_tag LOCUS_02690 93825 92677 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902445.1 protein_id gnl|my_center|LOCUS_02690 93924 94409 gene locus_tag LOCUS_02700 93924 94409 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872145.1 protein_id gnl|my_center|LOCUS_02700 94424 94606 gene locus_tag LOCUS_02710 gene rpmF 94424 94606 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_02710 94683 95825 gene locus_tag LOCUS_02720 94683 95825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 95907 96065 gene locus_tag LOCUS_02730 95907 96065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 96595 96921 gene locus_tag LOCUS_02740 96595 96921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02740 98118 96988 gene locus_tag LOCUS_02750 98118 96988 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 protein_id gnl|my_center|LOCUS_02750 98237 98551 gene locus_tag LOCUS_02760 98237 98551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 98630 99892 gene locus_tag LOCUS_02770 gene kinB 98630 99892 CDS product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228853.1 protein_id gnl|my_center|LOCUS_02770 102905 99903 gene locus_tag LOCUS_02780 102905 99903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 103477 102902 gene locus_tag LOCUS_02790 gene recU 103477 102902 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155594.1 protein_id gnl|my_center|LOCUS_02790 104157 105911 gene locus_tag LOCUS_02800 104157 105911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 105877 106818 gene locus_tag LOCUS_02810 105877 106818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 107941 106829 gene locus_tag LOCUS_02820 107941 106829 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_02820 108423 108677 gene locus_tag LOCUS_02830 108423 108677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 109331 109008 gene locus_tag LOCUS_02840 109331 109008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 109475 110329 gene locus_tag LOCUS_02850 109475 110329 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_02850 110362 111126 gene locus_tag LOCUS_02860 110362 111126 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794285.1 protein_id gnl|my_center|LOCUS_02860 111119 112054 gene locus_tag LOCUS_02870 111119 112054 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905092.1 protein_id gnl|my_center|LOCUS_02870 112163 115759 gene locus_tag LOCUS_02880 112163 115759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387416.1 protein_id gnl|my_center|LOCUS_02880 116282 116052 gene locus_tag LOCUS_02890 116282 116052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 116824 116267 gene locus_tag LOCUS_02900 116824 116267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 117464 117078 gene locus_tag LOCUS_02910 117464 117078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02910 117753 118079 gene locus_tag LOCUS_02920 117753 118079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 118093 119070 gene locus_tag LOCUS_02930 118093 119070 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461870.1 protein_id gnl|my_center|LOCUS_02930 120925 119303 gene locus_tag LOCUS_02940 120925 119303 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170127867.1 protein_id gnl|my_center|LOCUS_02940 121044 120922 gene locus_tag LOCUS_02950 121044 120922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 122490 121684 gene locus_tag LOCUS_02960 122490 121684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 122704 122955 gene locus_tag LOCUS_02970 122704 122955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 122968 123252 gene locus_tag LOCUS_02980 122968 123252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 123269 123556 gene locus_tag LOCUS_02990 123269 123556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 123638 123931 gene locus_tag LOCUS_03000 123638 123931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 123936 124226 gene locus_tag LOCUS_03010 123936 124226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 124228 124647 gene locus_tag LOCUS_03020 124228 124647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 124657 124938 gene locus_tag LOCUS_03030 124657 124938 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899314.1 protein_id gnl|my_center|LOCUS_03030 124964 131278 gene locus_tag LOCUS_03040 124964 131278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 131300 131551 gene locus_tag LOCUS_03050 131300 131551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 131586 136211 gene locus_tag LOCUS_03060 gene essC 131586 136211 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963368.1 protein_id gnl|my_center|LOCUS_03060 136394 137437 gene locus_tag LOCUS_03070 136394 137437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 137492 138370 gene locus_tag LOCUS_03080 gene tsf 137492 138370 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699817.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence03 1784 456 gene locus_tag LOCUS_03090 1784 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 2950 1868 gene locus_tag LOCUS_03100 2950 1868 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208912178.1 protein_id gnl|my_center|LOCUS_03100 3904 2960 gene locus_tag LOCUS_03110 3904 2960 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_03110 4734 4075 gene locus_tag LOCUS_03120 gene cwlD 4734 4075 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_03120 5440 4784 gene locus_tag LOCUS_03130 5440 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 6177 5506 gene locus_tag LOCUS_03140 6177 5506 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_03140 7024 6152 gene locus_tag LOCUS_03150 7024 6152 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_03150 7430 7011 gene locus_tag LOCUS_03160 7430 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7949 7533 gene locus_tag LOCUS_03170 gene rpsI 7949 7533 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_03170 8394 7960 gene locus_tag LOCUS_03180 gene rplM 8394 7960 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_03180 9250 8510 gene locus_tag LOCUS_03190 gene truA 9250 8510 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 protein_id gnl|my_center|LOCUS_03190 10067 9276 gene locus_tag LOCUS_03200 10067 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 10783 10058 gene locus_tag LOCUS_03210 10783 10058 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389658.1 protein_id gnl|my_center|LOCUS_03210 11541 10789 gene locus_tag LOCUS_03220 11541 10789 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_03220 11847 11635 gene locus_tag LOCUS_03230 11847 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 13180 11900 gene locus_tag LOCUS_03240 13180 11900 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411954.1 protein_id gnl|my_center|LOCUS_03240 14033 13200 gene locus_tag LOCUS_03250 gene dinD 14033 13200 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_03250 15419 14148 gene locus_tag LOCUS_03260 15419 14148 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_03260 15858 15580 gene locus_tag LOCUS_03270 15858 15580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 16400 15855 gene locus_tag LOCUS_03280 16400 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 18802 16478 gene locus_tag LOCUS_03290 18802 16478 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048366.1 protein_id gnl|my_center|LOCUS_03290 19319 18906 gene locus_tag LOCUS_03300 19319 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 19764 19417 gene locus_tag LOCUS_03310 gene rplQ 19764 19417 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701337.1 protein_id gnl|my_center|LOCUS_03310 20733 19783 gene locus_tag LOCUS_03320 20733 19783 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_03320 21136 20753 gene locus_tag LOCUS_03330 gene rpsK 21136 20753 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966387.1 protein_id gnl|my_center|LOCUS_03330 21533 21168 gene locus_tag LOCUS_03340 gene rpsM 21533 21168 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829703.1 protein_id gnl|my_center|LOCUS_03340 21942 21676 gene locus_tag LOCUS_03350 gene infA 21942 21676 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_03350 22670 22020 gene locus_tag LOCUS_03360 22670 22020 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 protein_id gnl|my_center|LOCUS_03360 23936 22671 gene locus_tag LOCUS_03370 gene secY 23936 22671 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829707.1 protein_id gnl|my_center|LOCUS_03370 24379 23936 gene locus_tag LOCUS_03380 gene rplO 24379 23936 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 protein_id gnl|my_center|LOCUS_03380 24887 24381 gene locus_tag LOCUS_03390 gene rpsE 24887 24381 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129922.1 protein_id gnl|my_center|LOCUS_03390 25264 24902 gene locus_tag LOCUS_03400 gene rplR 25264 24902 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_03400 25820 25287 gene locus_tag LOCUS_03410 gene rplF 25820 25287 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379228.1 protein_id gnl|my_center|LOCUS_03410 26232 25840 gene locus_tag LOCUS_03420 gene rpsH 26232 25840 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_03420 26436 26251 gene locus_tag LOCUS_03430 gene rpsN 26436 26251 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 protein_id gnl|my_center|LOCUS_03430 26996 26457 gene locus_tag LOCUS_03440 gene rplE 26996 26457 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 protein_id gnl|my_center|LOCUS_03440 27322 27014 gene locus_tag LOCUS_03450 gene rplX 27322 27014 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567544.1 protein_id gnl|my_center|LOCUS_03450 27706 27341 gene locus_tag LOCUS_03460 gene rplN 27706 27341 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_03460 27998 27732 gene locus_tag LOCUS_03470 gene rpsQ 27998 27732 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004106.1 protein_id gnl|my_center|LOCUS_03470 28205 28008 gene locus_tag LOCUS_03480 gene rpmC 28205 28008 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810148.1 protein_id gnl|my_center|LOCUS_03480 28626 28195 gene locus_tag LOCUS_03490 gene rplP 28626 28195 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166906.1 protein_id gnl|my_center|LOCUS_03490 29278 28601 gene locus_tag LOCUS_03500 gene rpsC 29278 28601 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529877.1 protein_id gnl|my_center|LOCUS_03500 29631 29296 gene locus_tag LOCUS_03510 gene rplV 29631 29296 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387527.1 protein_id gnl|my_center|LOCUS_03510 29925 29653 gene locus_tag LOCUS_03520 gene rpsS 29925 29653 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124453.1 protein_id gnl|my_center|LOCUS_03520 30775 29945 gene locus_tag LOCUS_03530 gene rplB 30775 29945 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 protein_id gnl|my_center|LOCUS_03530 31069 30788 gene locus_tag LOCUS_03540 gene rplW 31069 30788 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829755.1 protein_id gnl|my_center|LOCUS_03540 31692 31069 gene locus_tag LOCUS_03550 gene rplD 31692 31069 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674916.1 protein_id gnl|my_center|LOCUS_03550 32445 31705 gene locus_tag LOCUS_03560 gene rplC 32445 31705 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_03560 32771 32463 gene locus_tag LOCUS_03570 gene rpsJ 32771 32463 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894478.1 protein_id gnl|my_center|LOCUS_03570 34435 32984 gene locus_tag LOCUS_03580 34435 32984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 34554 35066 gene locus_tag LOCUS_03590 34554 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 35078 35650 gene locus_tag LOCUS_03600 35078 35650 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948863.1 protein_id gnl|my_center|LOCUS_03600 36414 35689 gene locus_tag LOCUS_03610 36414 35689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 36768 36610 gene locus_tag LOCUS_03620 36768 36610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 36940 37905 gene locus_tag LOCUS_03630 36940 37905 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_03630 39733 37922 gene locus_tag LOCUS_03640 gene typA 39733 37922 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722695.1 protein_id gnl|my_center|LOCUS_03640 40142 39858 gene locus_tag LOCUS_03650 40142 39858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 40231 40773 gene locus_tag LOCUS_03660 40231 40773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 42365 40800 gene locus_tag LOCUS_03670 42365 40800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 43180 42470 gene locus_tag LOCUS_03680 43180 42470 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094941.1 protein_id gnl|my_center|LOCUS_03680 44026 43190 gene locus_tag LOCUS_03690 44026 43190 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_03690 45338 44088 gene locus_tag LOCUS_03700 45338 44088 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_03700 46077 45331 gene locus_tag LOCUS_03710 gene fabG 46077 45331 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_03710 47923 46145 gene locus_tag LOCUS_03720 47923 46145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 48559 48290 gene locus_tag LOCUS_03730 48559 48290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 49693 48560 gene locus_tag LOCUS_03740 49693 48560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 50158 49781 gene locus_tag LOCUS_03750 50158 49781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 52044 50179 gene locus_tag LOCUS_03760 gene htpG 52044 50179 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_03760 52892 52140 gene locus_tag LOCUS_03770 52892 52140 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296505.1 protein_id gnl|my_center|LOCUS_03770 53365 52973 gene locus_tag LOCUS_03780 53365 52973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 53775 54405 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttaataccatttaaaatgacatagatttaaaac 55161 54484 gene locus_tag LOCUS_03790 gene csn2 55161 54484 CDS product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681294.1 protein_id gnl|my_center|LOCUS_03790 55463 55158 gene locus_tag LOCUS_03800 gene cas2 55463 55158 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_03800 56340 55468 gene locus_tag LOCUS_03810 gene cas1 56340 55468 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_03810 60355 56330 gene locus_tag LOCUS_03820 gene cas9 60355 56330 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040087.1 protein_id gnl|my_center|LOCUS_03820 60726 60651 gene locus_tag LOCUS_t00050 60726 60651 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 60842 61120 gene locus_tag LOCUS_03830 60842 61120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 62652 61129 gene locus_tag LOCUS_03840 62652 61129 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_03840 62847 62662 gene locus_tag LOCUS_03850 62847 62662 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966985.1 protein_id gnl|my_center|LOCUS_03850 63631 62831 gene locus_tag LOCUS_03860 63631 62831 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966986.1 protein_id gnl|my_center|LOCUS_03860 64508 63633 gene locus_tag LOCUS_03870 64508 63633 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355975.1 protein_id gnl|my_center|LOCUS_03870 65320 64508 gene locus_tag LOCUS_03880 65320 64508 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_03880 65851 65489 gene locus_tag LOCUS_03890 65851 65489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 66391 66032 gene locus_tag LOCUS_03900 66391 66032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 66751 66527 gene locus_tag LOCUS_03910 66751 66527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 67071 66748 gene locus_tag LOCUS_03920 67071 66748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 69108 67126 gene locus_tag LOCUS_03930 gene ftsH 69108 67126 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079674.1 protein_id gnl|my_center|LOCUS_03930 70444 69119 gene locus_tag LOCUS_03940 gene tilS 70444 69119 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655465.1 protein_id gnl|my_center|LOCUS_03940 71114 70464 gene locus_tag LOCUS_03950 71114 70464 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181937.1 protein_id gnl|my_center|LOCUS_03950 72495 71197 gene locus_tag LOCUS_03960 72495 71197 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651160.1 protein_id gnl|my_center|LOCUS_03960 73369 72548 gene locus_tag LOCUS_03970 gene rsmA 73369 72548 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886500.1 protein_id gnl|my_center|LOCUS_03970 74130 73360 gene locus_tag LOCUS_03980 74130 73360 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_03980 75045 74134 gene locus_tag LOCUS_03990 75045 74134 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_03990 75271 75110 gene locus_tag LOCUS_04000 75271 75110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 77435 75423 gene locus_tag LOCUS_04010 77435 75423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 79328 77610 gene locus_tag LOCUS_04020 79328 77610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 79480 79328 gene locus_tag LOCUS_04030 79480 79328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 81240 79675 gene locus_tag LOCUS_04040 gene metG 81240 79675 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_04040 81727 81251 gene locus_tag LOCUS_04050 81727 81251 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_04050 82528 81995 gene locus_tag LOCUS_04060 gene spoVT 82528 81995 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648302.1 protein_id gnl|my_center|LOCUS_04060 82639 84258 gene locus_tag LOCUS_04070 82639 84258 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434813.1 protein_id gnl|my_center|LOCUS_04070 87566 84279 gene locus_tag LOCUS_04080 gene mfd 87566 84279 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425912.1 protein_id gnl|my_center|LOCUS_04080 88135 87578 gene locus_tag LOCUS_04090 gene pth 88135 87578 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_04090 88983 88138 gene locus_tag LOCUS_04100 gene rsmI 88983 88138 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700659.1 protein_id gnl|my_center|LOCUS_04100 89714 88995 gene locus_tag LOCUS_04110 89714 88995 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166255.1 protein_id gnl|my_center|LOCUS_04110 90490 89714 gene locus_tag LOCUS_04120 90490 89714 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_04120 91433 90483 gene locus_tag LOCUS_04130 gene holB 91433 90483 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 protein_id gnl|my_center|LOCUS_04130 91641 91453 gene locus_tag LOCUS_04140 91641 91453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 92288 91683 gene locus_tag LOCUS_04150 gene recR 92288 91683 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559159.1 protein_id gnl|my_center|LOCUS_04150 92584 92288 gene locus_tag LOCUS_04160 92584 92288 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 protein_id gnl|my_center|LOCUS_04160 94223 92601 gene locus_tag LOCUS_04170 gene dnaX 94223 92601 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829412.1 protein_id gnl|my_center|LOCUS_04170 94693 94253 gene locus_tag LOCUS_04180 94693 94253 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583589.1 protein_id gnl|my_center|LOCUS_04180 97945 95432 gene locus_tag LOCUS_04190 gene gyrA 97945 95432 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_04190 99885 97957 gene locus_tag LOCUS_04200 gene gyrB 99885 97957 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_04200 100987 99875 gene locus_tag LOCUS_04210 gene recF 100987 99875 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_04210 101546 101094 gene locus_tag LOCUS_04220 gene comK 101546 101094 CDS product competence transcription factor ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245329.1 protein_id gnl|my_center|LOCUS_04220 102810 101689 gene locus_tag LOCUS_04230 gene dnaN 102810 101689 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725616.1 protein_id gnl|my_center|LOCUS_04230 104302 102950 gene locus_tag LOCUS_04240 gene dnaA 104302 102950 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_04240 104725 104847 gene locus_tag LOCUS_04250 gene rpmH 104725 104847 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_04250 104901 105236 gene locus_tag LOCUS_04260 gene rnpA 104901 105236 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183578.1 protein_id gnl|my_center|LOCUS_04260 105239 106168 gene locus_tag LOCUS_04270 105239 106168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 106158 106778 gene locus_tag LOCUS_04280 106158 106778 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_04280 106809 107306 gene locus_tag LOCUS_04290 106809 107306 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_04290 107306 108658 gene locus_tag LOCUS_04300 gene mnmE 107306 108658 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379284.1 protein_id gnl|my_center|LOCUS_04300 108734 110605 gene locus_tag LOCUS_04310 gene mnmG 108734 110605 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_04310 110595 111299 gene locus_tag LOCUS_04320 gene rsmG 110595 111299 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_04320 111400 113253 gene locus_tag LOCUS_04330 111400 113253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 115000 113282 gene locus_tag LOCUS_04340 115000 113282 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_04340 115681 115010 gene locus_tag LOCUS_04350 115681 115010 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_04350 116375 115674 gene locus_tag LOCUS_04360 116375 115674 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_04360 116530 117612 gene locus_tag LOCUS_04370 116530 117612 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_04370 117635 118915 gene locus_tag LOCUS_04380 gene dadD 117635 118915 CDS product multifunctional 5'-deoxyadenosine/S-adenosyl-L-homocysteine/5'-methylthioadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871065.1 protein_id gnl|my_center|LOCUS_04380 118920 119435 gene locus_tag LOCUS_04390 118920 119435 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_04390 119587 119811 gene locus_tag LOCUS_04400 119587 119811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 120064 120612 gene locus_tag LOCUS_04410 120064 120612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 121657 120698 gene locus_tag LOCUS_04420 121657 120698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 121942 123888 gene locus_tag LOCUS_04430 gene uvrB 121942 123888 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441064.1 protein_id gnl|my_center|LOCUS_04430 123939 124343 gene locus_tag LOCUS_04440 123939 124343 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289566.1 protein_id gnl|my_center|LOCUS_04440 124345 125157 gene locus_tag LOCUS_04450 gene lgt 124345 125157 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_04450 125138 126043 gene locus_tag LOCUS_04460 gene trxB 125138 126043 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438914.1 protein_id gnl|my_center|LOCUS_04460 126096 127037 gene locus_tag LOCUS_04470 gene mgfK 126096 127037 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_04470 127037 127942 gene locus_tag LOCUS_04480 gene whiA 127037 127942 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358736.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence04 251 2842 gene locus_tag LOCUS_04490 gene polA 251 2842 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_04490 2857 3720 gene locus_tag LOCUS_04500 2857 3720 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_04500 5621 3969 gene locus_tag LOCUS_04510 5621 3969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966042.1 protein_id gnl|my_center|LOCUS_04510 7273 5621 gene locus_tag LOCUS_04520 7273 5621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 protein_id gnl|my_center|LOCUS_04520 7519 8889 gene locus_tag LOCUS_04530 7519 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 8882 10210 gene locus_tag LOCUS_04540 gene murD 8882 10210 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_04540 10231 11508 gene locus_tag LOCUS_04550 gene serS 10231 11508 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_04550 11518 11733 gene locus_tag LOCUS_04560 11518 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 11758 12252 gene locus_tag LOCUS_04570 11758 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 12698 12270 gene locus_tag LOCUS_04580 12698 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 12865 13254 gene locus_tag LOCUS_04590 12865 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 13295 13693 gene locus_tag LOCUS_04600 13295 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 13928 14542 gene locus_tag LOCUS_04610 13928 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 14594 15649 gene locus_tag LOCUS_04620 14594 15649 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_04620 15736 16569 gene locus_tag LOCUS_04630 15736 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 16621 17304 gene locus_tag LOCUS_04640 16621 17304 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494826.1 protein_id gnl|my_center|LOCUS_04640 17309 18133 gene locus_tag LOCUS_04650 gene mutM 17309 18133 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114480.1 protein_id gnl|my_center|LOCUS_04650 18608 18114 gene locus_tag LOCUS_04660 18608 18114 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011542.1 protein_id gnl|my_center|LOCUS_04660 18736 19383 gene locus_tag LOCUS_04670 18736 19383 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966116.1 protein_id gnl|my_center|LOCUS_04670 19462 19896 gene locus_tag LOCUS_04680 19462 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 20025 20582 gene locus_tag LOCUS_04690 gene ruvA 20025 20582 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837647.1 protein_id gnl|my_center|LOCUS_04690 20590 21198 gene locus_tag LOCUS_04700 20590 21198 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_04700 21199 22206 gene locus_tag LOCUS_04710 gene ruvB 21199 22206 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_04710 22258 23283 gene locus_tag LOCUS_04720 gene queA 22258 23283 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_04720 23283 24224 gene locus_tag LOCUS_04730 23283 24224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 24228 25118 gene locus_tag LOCUS_04740 gene miaA 24228 25118 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_04740 25120 26118 gene locus_tag LOCUS_04750 25120 26118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 27819 26128 gene locus_tag LOCUS_04760 gene rnjA 27819 26128 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245660.1 protein_id gnl|my_center|LOCUS_04760 27920 29662 gene locus_tag LOCUS_04770 27920 29662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 29837 29971 gene locus_tag LOCUS_04780 29837 29971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 29987 30712 gene locus_tag LOCUS_04790 29987 30712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 30709 31278 gene locus_tag LOCUS_04800 30709 31278 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_04800 31402 33507 gene locus_tag LOCUS_04810 31402 33507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 33494 34600 gene locus_tag LOCUS_04820 33494 34600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 34770 35762 gene locus_tag LOCUS_04830 gene ftsY 34770 35762 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_04830 35752 36018 gene locus_tag LOCUS_04840 35752 36018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 36005 36307 gene locus_tag LOCUS_04850 36005 36307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 36323 38074 gene locus_tag LOCUS_04860 36323 38074 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387067.1 protein_id gnl|my_center|LOCUS_04860 38091 38483 gene locus_tag LOCUS_04870 38091 38483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 38480 40402 gene locus_tag LOCUS_04880 38480 40402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 40386 42173 gene locus_tag LOCUS_04890 40386 42173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 42170 42463 gene locus_tag LOCUS_04900 42170 42463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 42538 43845 gene locus_tag LOCUS_04910 gene ffh 42538 43845 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863468.1 protein_id gnl|my_center|LOCUS_04910 43910 44176 gene locus_tag LOCUS_04920 43910 44176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 44309 44551 gene locus_tag LOCUS_04930 44309 44551 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262990.1 protein_id gnl|my_center|LOCUS_04930 44545 44886 gene locus_tag LOCUS_04940 44545 44886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 45582 44932 gene locus_tag LOCUS_04950 45582 44932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 46567 45626 gene locus_tag LOCUS_04960 46567 45626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 46730 49729 gene locus_tag LOCUS_04970 46730 49729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 49776 50336 gene locus_tag LOCUS_04980 49776 50336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 50481 51692 gene locus_tag LOCUS_04990 50481 51692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 51788 52939 gene locus_tag LOCUS_05000 gene dacF 51788 52939 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_05000 53336 54496 gene locus_tag LOCUS_05010 53336 54496 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_05010 54497 55912 gene locus_tag LOCUS_05020 54497 55912 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_05020 55951 57879 gene locus_tag LOCUS_05030 55951 57879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 57969 58919 gene locus_tag LOCUS_05040 57969 58919 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_05040 59321 59121 gene locus_tag LOCUS_05050 59321 59121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 59386 60660 gene locus_tag LOCUS_05060 59386 60660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 60650 62446 gene locus_tag LOCUS_05070 60650 62446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 62449 64143 gene locus_tag LOCUS_05080 62449 64143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 64156 66072 gene locus_tag LOCUS_05090 64156 66072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 66077 67531 gene locus_tag LOCUS_05100 66077 67531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 67537 69354 gene locus_tag LOCUS_05110 67537 69354 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_05110 69341 69907 gene locus_tag LOCUS_05120 69341 69907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 70823 71620 gene locus_tag LOCUS_05130 70823 71620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 71648 73393 gene locus_tag LOCUS_05140 71648 73393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 73844 75181 gene locus_tag LOCUS_05150 73844 75181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 75237 76346 gene locus_tag LOCUS_05160 75237 76346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 76562 76353 gene locus_tag LOCUS_05170 gene sspI 76562 76353 CDS product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009509.1 protein_id gnl|my_center|LOCUS_05170 76658 78808 gene locus_tag LOCUS_05180 76658 78808 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370122.1 protein_id gnl|my_center|LOCUS_05180 79717 78812 gene locus_tag LOCUS_05190 79717 78812 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715326.1 protein_id gnl|my_center|LOCUS_05190 81189 80077 gene locus_tag LOCUS_05200 81189 80077 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_05200 81486 81283 gene locus_tag LOCUS_05210 81486 81283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 81790 82041 gene locus_tag LOCUS_05220 81790 82041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 82233 83138 gene locus_tag LOCUS_05230 82233 83138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 83140 83592 gene locus_tag LOCUS_05240 83140 83592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 83991 83731 gene locus_tag LOCUS_05250 83991 83731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 84104 84448 gene locus_tag LOCUS_05260 84104 84448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 84453 84629 gene locus_tag LOCUS_05270 84453 84629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 84674 85471 gene locus_tag LOCUS_05280 84674 85471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 85490 86431 gene locus_tag LOCUS_05290 85490 86431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 86460 87461 gene locus_tag LOCUS_05300 86460 87461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 87509 87937 gene locus_tag LOCUS_05310 87509 87937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 88265 89062 gene locus_tag LOCUS_05320 88265 89062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 89304 90137 gene locus_tag LOCUS_05330 89304 90137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 90263 90448 gene locus_tag LOCUS_05340 90263 90448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 90438 90746 gene locus_tag LOCUS_05350 90438 90746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 91009 90785 gene locus_tag LOCUS_05360 91009 90785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 91379 91304 gene locus_tag LOCUS_t00060 91379 91304 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 91682 92008 gene locus_tag LOCUS_05370 gene gpsB 91682 92008 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622430.1 protein_id gnl|my_center|LOCUS_05370 92397 92882 gene locus_tag LOCUS_05380 92397 92882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 92891 93526 gene locus_tag LOCUS_05390 gene pgsA 92891 93526 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_05390 93644 94669 gene locus_tag LOCUS_05400 gene recA 93644 94669 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732286.1 protein_id gnl|my_center|LOCUS_05400 94785 95222 gene locus_tag LOCUS_05410 94785 95222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 95234 96415 gene locus_tag LOCUS_05420 95234 96415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 96423 98156 gene locus_tag LOCUS_05430 96423 98156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867421.1 protein_id gnl|my_center|LOCUS_05430 98201 98653 gene locus_tag LOCUS_05440 98201 98653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 98643 99002 gene locus_tag LOCUS_05450 98643 99002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 98995 100224 gene locus_tag LOCUS_05460 98995 100224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 100489 102042 gene locus_tag LOCUS_05470 gene rny 100489 102042 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354863.1 protein_id gnl|my_center|LOCUS_05470 102291 102067 gene locus_tag LOCUS_05480 102291 102067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 102406 103257 gene locus_tag LOCUS_05490 102406 103257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 103322 105490 gene locus_tag LOCUS_05500 103322 105490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 105552 105965 gene locus_tag LOCUS_05510 105552 105965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 106827 105988 gene locus_tag LOCUS_05520 106827 105988 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence05 531 373 gene locus_tag LOCUS_05530 531 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1236 595 gene locus_tag LOCUS_05540 1236 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2130 1426 gene locus_tag LOCUS_05550 gene pyrH 2130 1426 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_05550 3068 2292 gene locus_tag LOCUS_05560 3068 2292 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_05560 3514 3080 gene locus_tag LOCUS_05570 3514 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4385 3645 gene locus_tag LOCUS_05580 4385 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5125 4601 gene locus_tag LOCUS_05590 5125 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 7211 5184 gene locus_tag LOCUS_05600 7211 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 8959 7214 gene locus_tag LOCUS_05610 8959 7214 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_05610 9596 8952 gene locus_tag LOCUS_05620 9596 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 10549 10004 gene locus_tag LOCUS_05630 10549 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 10890 10525 gene locus_tag LOCUS_05640 10890 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 12810 10945 gene locus_tag LOCUS_05650 12810 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 14015 12879 gene locus_tag LOCUS_05660 14015 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 15966 14461 gene locus_tag LOCUS_05670 15966 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 16989 16249 gene locus_tag LOCUS_05680 16989 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 18143 17106 gene locus_tag LOCUS_05690 18143 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 18869 18255 gene locus_tag LOCUS_05700 18869 18255 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_05700 19764 18973 gene locus_tag LOCUS_05710 19764 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 20938 19736 gene locus_tag LOCUS_05720 20938 19736 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 21115 22173 gene locus_tag LOCUS_05730 21115 22173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 22786 22217 gene locus_tag LOCUS_05740 22786 22217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 25074 22798 gene locus_tag LOCUS_05750 25074 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 25181 25732 gene locus_tag LOCUS_05760 25181 25732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 26096 25884 gene locus_tag LOCUS_05770 26096 25884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 26347 26066 gene locus_tag LOCUS_05780 26347 26066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 28119 27043 gene locus_tag LOCUS_05790 28119 27043 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_05790 29330 28230 gene locus_tag LOCUS_05800 gene ychF 29330 28230 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524657.1 protein_id gnl|my_center|LOCUS_05800 29447 29818 gene locus_tag LOCUS_05810 29447 29818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 34595 29832 gene locus_tag LOCUS_05820 34595 29832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 34998 34681 gene locus_tag LOCUS_05830 34998 34681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 35489 35142 gene locus_tag LOCUS_05840 35489 35142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 36963 35806 gene locus_tag LOCUS_05850 36963 35806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05850 37608 37066 gene locus_tag LOCUS_05860 37608 37066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05860 38165 37698 gene locus_tag LOCUS_05870 38165 37698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 39170 38178 gene locus_tag LOCUS_05880 39170 38178 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700096.1 protein_id gnl|my_center|LOCUS_05880 40982 39180 gene locus_tag LOCUS_05890 gene lepA 40982 39180 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_05890 41491 41063 gene locus_tag LOCUS_05900 41491 41063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 44227 41669 gene locus_tag LOCUS_05910 gene valS 44227 41669 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_05910 45933 44509 gene locus_tag LOCUS_05920 45933 44509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 46717 46001 gene locus_tag LOCUS_05930 gene prmC 46717 46001 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922371.1 protein_id gnl|my_center|LOCUS_05930 47774 46719 gene locus_tag LOCUS_05940 gene prfA 47774 46719 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356619.1 protein_id gnl|my_center|LOCUS_05940 48286 47843 gene locus_tag LOCUS_05950 48286 47843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 49974 48298 gene locus_tag LOCUS_05960 gene argS 49974 48298 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288432.1 protein_id gnl|my_center|LOCUS_05960 50330 49971 gene locus_tag LOCUS_05970 50330 49971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 51590 50481 gene locus_tag LOCUS_05980 51590 50481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 52196 51654 gene locus_tag LOCUS_05990 gene frr 52196 51654 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_05990 52615 52220 gene locus_tag LOCUS_06000 52615 52220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 55042 52685 gene locus_tag LOCUS_06010 55042 52685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 55728 55207 gene locus_tag LOCUS_06020 55728 55207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 56912 55800 gene locus_tag LOCUS_06030 gene dnaJ 56912 55800 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043938.1 protein_id gnl|my_center|LOCUS_06030 58724 56928 gene locus_tag LOCUS_06040 gene pepF 58724 56928 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_06040 60603 58771 gene locus_tag LOCUS_06050 gene dnaK 60603 58771 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002446567.1 protein_id gnl|my_center|LOCUS_06050 61291 60623 gene locus_tag LOCUS_06060 61291 60623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 62307 61303 gene locus_tag LOCUS_06070 gene hrcA 62307 61303 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence06 1381 821 gene locus_tag LOCUS_06080 1381 821 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_06080 1457 3235 gene locus_tag LOCUS_06090 gene uvrC 1457 3235 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732777.1 protein_id gnl|my_center|LOCUS_06090 3298 3540 gene locus_tag LOCUS_06100 3298 3540 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131820.1 protein_id gnl|my_center|LOCUS_06100 3540 3974 gene locus_tag LOCUS_06110 gene ruvX 3540 3974 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 protein_id gnl|my_center|LOCUS_06110 3967 4272 gene locus_tag LOCUS_06120 3967 4272 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 protein_id gnl|my_center|LOCUS_06120 4281 5351 gene locus_tag LOCUS_06130 gene mltG 4281 5351 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572132.1 protein_id gnl|my_center|LOCUS_06130 5360 5632 gene locus_tag LOCUS_06140 5360 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5650 6234 gene locus_tag LOCUS_06150 5650 6234 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830827.1 protein_id gnl|my_center|LOCUS_06150 6425 7285 gene locus_tag LOCUS_06160 6425 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7386 9491 gene locus_tag LOCUS_06170 gene clpB 7386 9491 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_06170 9570 10436 gene locus_tag LOCUS_06180 9570 10436 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_06180 10429 11319 gene locus_tag LOCUS_06190 gene xerC 10429 11319 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456225.1 protein_id gnl|my_center|LOCUS_06190 11376 14018 gene locus_tag LOCUS_06200 gene ppdK 11376 14018 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_06200 14095 16050 gene locus_tag LOCUS_06210 14095 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 16175 17134 gene locus_tag LOCUS_06220 16175 17134 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_06220 17144 17416 gene locus_tag LOCUS_06230 17144 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 17498 18991 gene locus_tag LOCUS_06240 17498 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 19069 19491 gene locus_tag LOCUS_06250 19069 19491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 20268 19504 gene locus_tag LOCUS_06260 20268 19504 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 protein_id gnl|my_center|LOCUS_06260 20406 20322 gene locus_tag LOCUS_t00070 20406 20322 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20486 20410 gene locus_tag LOCUS_t00080 20486 20410 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 20678 21730 gene locus_tag LOCUS_06270 20678 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 21837 22574 gene locus_tag LOCUS_06280 21837 22574 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852645.1 protein_id gnl|my_center|LOCUS_06280 22567 24159 gene locus_tag LOCUS_06290 22567 24159 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_06290 24172 25356 gene locus_tag LOCUS_06300 24172 25356 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_06300 25423 27231 gene locus_tag LOCUS_06310 25423 27231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 27235 28443 gene locus_tag LOCUS_06320 27235 28443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 28547 29701 gene locus_tag LOCUS_06330 28547 29701 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832647.1 protein_id gnl|my_center|LOCUS_06330 29698 30237 gene locus_tag LOCUS_06340 29698 30237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 30234 32927 gene locus_tag LOCUS_06350 gene alaS 30234 32927 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836704.1 protein_id gnl|my_center|LOCUS_06350 32927 34081 gene locus_tag LOCUS_06360 32927 34081 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_06360 34149 38144 gene locus_tag LOCUS_06370 34149 38144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 38156 38617 gene locus_tag LOCUS_06380 38156 38617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 38729 38968 gene locus_tag LOCUS_06390 38729 38968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 38973 40151 gene locus_tag LOCUS_06400 38973 40151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 40156 40770 gene locus_tag LOCUS_06410 40156 40770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 40767 41213 gene locus_tag LOCUS_06420 gene ybeY 40767 41213 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_06420 41191 41586 gene locus_tag LOCUS_06430 41191 41586 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819532.1 protein_id gnl|my_center|LOCUS_06430 41608 41988 gene locus_tag LOCUS_06440 gene cdd 41608 41988 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183040.1 protein_id gnl|my_center|LOCUS_06440 41985 42869 gene locus_tag LOCUS_06450 gene era 41985 42869 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_06450 43013 43240 gene locus_tag LOCUS_06460 43013 43240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 43233 43961 gene locus_tag LOCUS_06470 gene recO 43233 43961 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730435.1 protein_id gnl|my_center|LOCUS_06470 43977 44408 gene locus_tag LOCUS_06480 43977 44408 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_06480 44461 45831 gene locus_tag LOCUS_06490 44461 45831 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_06490 45921 46373 gene locus_tag LOCUS_06500 45921 46373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 46490 46912 gene locus_tag LOCUS_06510 46490 46912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 46940 47419 gene locus_tag LOCUS_06520 gene divIVA 46940 47419 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_06520 47696 50791 gene locus_tag LOCUS_06530 gene ileS 47696 50791 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_06530 50855 51715 gene locus_tag LOCUS_06540 50855 51715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 52430 51729 gene locus_tag LOCUS_06550 gene sigK 52430 51729 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_06550 52525 53751 gene locus_tag LOCUS_06560 52525 53751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 53913 54257 gene locus_tag LOCUS_06570 53913 54257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 54266 54931 gene locus_tag LOCUS_06580 gene sigF 54266 54931 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_06580 54990 55430 gene locus_tag LOCUS_06590 gene spoVAC 54990 55430 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 protein_id gnl|my_center|LOCUS_06590 55434 56420 gene locus_tag LOCUS_06600 gene spoVAD 55434 56420 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241156.1 protein_id gnl|my_center|LOCUS_06600 56420 56770 gene locus_tag LOCUS_06610 gene spoVAE 56420 56770 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345915.1 protein_id gnl|my_center|LOCUS_06610 56829 57260 gene locus_tag LOCUS_06620 56829 57260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 57352 57864 gene locus_tag LOCUS_06630 57352 57864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence07 1141 206 gene locus_tag LOCUS_06640 gene rnhC 1141 206 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071591.1 protein_id gnl|my_center|LOCUS_06640 1239 1949 gene locus_tag LOCUS_06650 1239 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1952 2251 gene locus_tag LOCUS_06660 gene trxA 1952 2251 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871903.1 protein_id gnl|my_center|LOCUS_06660 2242 3483 gene locus_tag LOCUS_06670 2242 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 5093 3693 gene locus_tag LOCUS_06680 5093 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5259 6614 gene locus_tag LOCUS_06690 5259 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 6684 8096 gene locus_tag LOCUS_06700 6684 8096 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897439.1 protein_id gnl|my_center|LOCUS_06700 8148 8363 gene locus_tag LOCUS_06710 8148 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 8356 8673 gene locus_tag LOCUS_06720 8356 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 8812 9672 gene locus_tag LOCUS_06730 8812 9672 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742806.1 protein_id gnl|my_center|LOCUS_06730 9674 10903 gene locus_tag LOCUS_06740 9674 10903 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217966.1 protein_id gnl|my_center|LOCUS_06740 10974 11444 gene locus_tag LOCUS_06750 gene greA 10974 11444 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102591.1 protein_id gnl|my_center|LOCUS_06750 11479 11970 gene locus_tag LOCUS_06760 11479 11970 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_06760 12064 13311 gene locus_tag LOCUS_06770 gene tig 12064 13311 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_06770 13363 14979 gene locus_tag LOCUS_06780 13363 14979 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_06780 15070 15741 gene locus_tag LOCUS_06790 15070 15741 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_06790 15822 16526 gene locus_tag LOCUS_06800 15822 16526 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101561.1 protein_id gnl|my_center|LOCUS_06800 16523 17536 gene locus_tag LOCUS_06810 16523 17536 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832309.1 protein_id gnl|my_center|LOCUS_06810 17536 18600 gene locus_tag LOCUS_06820 17536 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 18611 19711 gene locus_tag LOCUS_06830 18611 19711 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143333.1 protein_id gnl|my_center|LOCUS_06830 19698 22292 gene locus_tag LOCUS_06840 gene ggaB 19698 22292 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_06840 22289 23077 gene locus_tag LOCUS_06850 22289 23077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_06850 23086 23808 gene locus_tag LOCUS_06860 23086 23808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812647.1 protein_id gnl|my_center|LOCUS_06860 23819 25177 gene locus_tag LOCUS_06870 23819 25177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 25146 25868 gene locus_tag LOCUS_06880 25146 25868 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_06880 25920 26390 gene locus_tag LOCUS_06890 25920 26390 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943873.1 protein_id gnl|my_center|LOCUS_06890 26384 26965 gene locus_tag LOCUS_06900 26384 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047754.1 protein_id gnl|my_center|LOCUS_06900 27005 27916 gene locus_tag LOCUS_06910 27005 27916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 28469 27921 gene locus_tag LOCUS_06920 gene def 28469 27921 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722677.1 protein_id gnl|my_center|LOCUS_06920 28627 30621 gene locus_tag LOCUS_06930 gene recG 28627 30621 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989820.1 protein_id gnl|my_center|LOCUS_06930 30781 31200 gene locus_tag LOCUS_06940 gene rpsL 30781 31200 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142341.1 protein_id gnl|my_center|LOCUS_06940 31241 31708 gene locus_tag LOCUS_06950 gene rpsG 31241 31708 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638057.1 protein_id gnl|my_center|LOCUS_06950 31730 33805 gene locus_tag LOCUS_06960 gene fusA 31730 33805 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090364.1 protein_id gnl|my_center|LOCUS_06960 33876 35060 gene locus_tag LOCUS_06970 gene tuf 33876 35060 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_06970 35272 35108 gene locus_tag LOCUS_06980 35272 35108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 35420 36604 gene locus_tag LOCUS_06990 gene spoVE 35420 36604 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_06990 36676 37317 gene locus_tag LOCUS_07000 36676 37317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 37286 39361 gene locus_tag LOCUS_07010 37286 39361 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_07010 39375 40265 gene locus_tag LOCUS_07020 39375 40265 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_07020 40283 41173 gene locus_tag LOCUS_07030 40283 41173 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_07030 41560 41679 gene locus_tag LOCUS_07040 41560 41679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 42235 41699 gene locus_tag LOCUS_07050 42235 41699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 42277 43218 gene locus_tag LOCUS_07060 gene uvsE 42277 43218 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110499.1 protein_id gnl|my_center|LOCUS_07060 43273 45033 gene locus_tag LOCUS_07070 gene dnaG 43273 45033 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528223.1 protein_id gnl|my_center|LOCUS_07070 45023 46108 gene locus_tag LOCUS_07080 gene rpoD 45023 46108 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283057.1 protein_id gnl|my_center|LOCUS_07080 46111 46764 gene locus_tag LOCUS_07090 46111 46764 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183168.1 protein_id gnl|my_center|LOCUS_07090 47126 46761 gene locus_tag LOCUS_07100 47126 46761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 47233 49503 gene locus_tag LOCUS_07110 47233 49503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 49520 50284 gene locus_tag LOCUS_07120 49520 50284 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861982.1 protein_id gnl|my_center|LOCUS_07120 50613 50290 gene locus_tag LOCUS_07130 50613 50290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence08 301 903 gene locus_tag LOCUS_07140 gene rpsD 301 903 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135317.1 protein_id gnl|my_center|LOCUS_07140 1955 966 gene locus_tag LOCUS_07150 1955 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3587 1956 gene locus_tag LOCUS_07160 3587 1956 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733826.1 protein_id gnl|my_center|LOCUS_07160 4815 3589 gene locus_tag LOCUS_07170 gene tyrS 4815 3589 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727370.1 protein_id gnl|my_center|LOCUS_07170 5471 4815 gene locus_tag LOCUS_07180 gene deoC 5471 4815 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_07180 6039 5695 gene locus_tag LOCUS_07190 6039 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 6412 6044 gene locus_tag LOCUS_07200 6412 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7239 6472 gene locus_tag LOCUS_07210 gene spo0A 7239 6472 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_07210 8067 7351 gene locus_tag LOCUS_07220 gene tpiA 8067 7351 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874260.1 protein_id gnl|my_center|LOCUS_07220 9295 8057 gene locus_tag LOCUS_07230 9295 8057 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675474.1 protein_id gnl|my_center|LOCUS_07230 10314 9286 gene locus_tag LOCUS_07240 10314 9286 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 protein_id gnl|my_center|LOCUS_07240 11512 10328 gene locus_tag LOCUS_07250 11512 10328 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902043.1 protein_id gnl|my_center|LOCUS_07250 12537 11524 gene locus_tag LOCUS_07260 12537 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 12804 12562 gene locus_tag LOCUS_07270 12804 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 13870 12797 gene locus_tag LOCUS_07280 13870 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 14436 13978 gene locus_tag LOCUS_07290 14436 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 15037 14894 gene locus_tag LOCUS_07300 15037 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 15763 15047 gene locus_tag LOCUS_07310 gene pflA 15763 15047 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_07310 17972 15750 gene locus_tag LOCUS_07320 gene pflB 17972 15750 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048196.1 protein_id gnl|my_center|LOCUS_07320 18124 18939 gene locus_tag LOCUS_07330 18124 18939 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_07330 19647 18967 gene locus_tag LOCUS_07340 gene gmk 19647 18967 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965025.1 protein_id gnl|my_center|LOCUS_07340 20425 19805 gene locus_tag LOCUS_07350 20425 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 21581 20514 gene locus_tag LOCUS_07360 gene alr 21581 20514 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234284.1 protein_id gnl|my_center|LOCUS_07360 23389 21620 gene locus_tag LOCUS_07370 23389 21620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_07370 24532 23468 gene locus_tag LOCUS_07380 24532 23468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 25551 24487 gene locus_tag LOCUS_07390 25551 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 27213 25957 gene locus_tag LOCUS_07400 27213 25957 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_07400 27773 27612 gene locus_tag LOCUS_07410 27773 27612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 28825 27902 gene locus_tag LOCUS_07420 28825 27902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 29639 28920 gene locus_tag LOCUS_07430 29639 28920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 30218 29820 gene locus_tag LOCUS_07440 30218 29820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 30469 30215 gene locus_tag LOCUS_07450 30469 30215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 30584 31123 gene locus_tag LOCUS_07460 30584 31123 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_07460 32013 31201 gene locus_tag LOCUS_07470 32013 31201 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 protein_id gnl|my_center|LOCUS_07470 33556 32681 gene locus_tag LOCUS_07480 33556 32681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 34572 33652 gene locus_tag LOCUS_07490 34572 33652 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933889.1 protein_id gnl|my_center|LOCUS_07490 35235 34804 gene locus_tag LOCUS_07500 35235 34804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 36662 35451 gene locus_tag LOCUS_07510 36662 35451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 37085 36789 gene locus_tag LOCUS_07520 37085 36789 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 protein_id gnl|my_center|LOCUS_07520 38126 37110 gene locus_tag LOCUS_07530 38126 37110 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_07530 38481 38302 gene locus_tag LOCUS_07540 38481 38302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 39861 38635 gene locus_tag LOCUS_07550 gene rlmD 39861 38635 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_07550 39952 41409 gene locus_tag LOCUS_07560 gene gerKA 39952 41409 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_07560 41396 42580 gene locus_tag LOCUS_07570 41396 42580 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966575.1 protein_id gnl|my_center|LOCUS_07570 42573 43664 gene locus_tag LOCUS_07580 42573 43664 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986512.1 protein_id gnl|my_center|LOCUS_07580 44457 43681 gene locus_tag LOCUS_07590 44457 43681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 44562 44765 gene locus_tag LOCUS_07600 44562 44765 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811990.1 protein_id gnl|my_center|LOCUS_07600 45267 44803 gene locus_tag LOCUS_07610 45267 44803 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_07610 45990 45274 gene locus_tag LOCUS_07620 gene rluB 45990 45274 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_07620 46558 46037 gene locus_tag LOCUS_07630 gene spmB 46558 46037 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230509.1 protein_id gnl|my_center|LOCUS_07630 47139 46558 gene locus_tag LOCUS_07640 gene spmA 47139 46558 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247808.1 protein_id gnl|my_center|LOCUS_07640 48131 47133 gene locus_tag LOCUS_07650 gene dacB 48131 47133 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence09 590 12 gene locus_tag LOCUS_07660 590 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 939 580 gene locus_tag LOCUS_07670 939 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2680 1019 gene locus_tag LOCUS_07680 2680 1019 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775553.1 protein_id gnl|my_center|LOCUS_07680 3353 3054 gene locus_tag LOCUS_07690 3353 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3596 3357 gene locus_tag LOCUS_07700 3596 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 7078 4010 gene locus_tag LOCUS_07710 7078 4010 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 protein_id gnl|my_center|LOCUS_07710 7790 7071 gene locus_tag LOCUS_07720 7790 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 9024 7792 gene locus_tag LOCUS_07730 9024 7792 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389438.1 protein_id gnl|my_center|LOCUS_07730 10585 9017 gene locus_tag LOCUS_07740 10585 9017 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_07740 11660 10815 gene locus_tag LOCUS_07750 11660 10815 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_07750 13905 11869 gene locus_tag LOCUS_07760 13905 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 14740 13898 gene locus_tag LOCUS_07770 14740 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 15290 15018 gene locus_tag LOCUS_07780 15290 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 15585 15370 gene locus_tag LOCUS_07790 15585 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 16081 15590 gene locus_tag LOCUS_07800 16081 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 16319 18631 gene locus_tag LOCUS_07810 16319 18631 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948591.1 protein_id gnl|my_center|LOCUS_07810 18700 19299 gene locus_tag LOCUS_07820 18700 19299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 21433 19343 gene locus_tag LOCUS_07830 21433 19343 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949064.1 protein_id gnl|my_center|LOCUS_07830 21697 21969 gene locus_tag LOCUS_07840 21697 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 22481 21966 gene locus_tag LOCUS_07850 22481 21966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 22682 22608 gene locus_tag LOCUS_t00090 22682 22608 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 22774 23202 gene locus_tag LOCUS_07860 gene cwlJ 22774 23202 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538153.1 protein_id gnl|my_center|LOCUS_07860 23378 23962 gene locus_tag LOCUS_07870 23378 23962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 23985 25475 gene locus_tag LOCUS_07880 23985 25475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 25672 25757 gene locus_tag LOCUS_t00100 25672 25757 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25825 26523 gene locus_tag LOCUS_07890 25825 26523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 26565 28019 gene locus_tag LOCUS_07900 26565 28019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 28069 28686 gene locus_tag LOCUS_07910 28069 28686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 29500 28730 gene locus_tag LOCUS_07920 29500 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 30178 29525 gene locus_tag LOCUS_07930 30178 29525 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861474.1 protein_id gnl|my_center|LOCUS_07930 30345 30270 gene locus_tag LOCUS_t00110 30345 30270 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31014 30403 gene locus_tag LOCUS_07940 31014 30403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 31402 31079 gene locus_tag LOCUS_07950 31402 31079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 32661 31444 gene locus_tag LOCUS_07960 32661 31444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 33535 32732 gene locus_tag LOCUS_07970 33535 32732 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865064.1 protein_id gnl|my_center|LOCUS_07970 33732 33568 gene locus_tag LOCUS_07980 33732 33568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 33849 34610 gene locus_tag LOCUS_07990 33849 34610 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_07990 35483 34623 gene locus_tag LOCUS_08000 35483 34623 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_08000 36187 35483 gene locus_tag LOCUS_08010 36187 35483 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_08010 38014 36365 gene locus_tag LOCUS_08020 38014 36365 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_08020 38629 38078 gene locus_tag LOCUS_08030 38629 38078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 38768 39817 gene locus_tag LOCUS_08040 38768 39817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 41667 39922 gene locus_tag LOCUS_08050 gene aspS 41667 39922 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_08050 43129 41672 gene locus_tag LOCUS_08060 gene gatB 43129 41672 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_08060 44586 43129 gene locus_tag LOCUS_08070 44586 43129 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183059.1 protein_id gnl|my_center|LOCUS_08070 44891 44586 gene locus_tag LOCUS_08080 44891 44586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 45020 44945 gene locus_tag LOCUS_t00120 45020 44945 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 45101 45026 gene locus_tag LOCUS_t00130 45101 45026 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 46632 45457 gene locus_tag LOCUS_08090 46632 45457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 47338 46694 gene locus_tag LOCUS_08100 47338 46694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 47546 47322 gene locus_tag LOCUS_08110 47546 47322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 47633 48457 gene locus_tag LOCUS_08120 47633 48457 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence10 1447 1070 gene locus_tag LOCUS_08130 1447 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1785 1525 gene locus_tag LOCUS_08140 1785 1525 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_08140 1898 2527 gene locus_tag LOCUS_08150 1898 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2538 3023 gene locus_tag LOCUS_08160 2538 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3641 3039 gene locus_tag LOCUS_08170 3641 3039 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963348.1 protein_id gnl|my_center|LOCUS_08170 3796 4506 gene locus_tag LOCUS_08180 3796 4506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816854.1 protein_id gnl|my_center|LOCUS_08180 4509 6878 gene locus_tag LOCUS_08190 gene mubY 4509 6878 CDS product mutanobactin A system ABC transporter permease subunit MubY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074618.1 protein_id gnl|my_center|LOCUS_08190 8105 7281 gene locus_tag LOCUS_08200 8105 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8233 8601 gene locus_tag LOCUS_08210 8233 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 8948 10420 gene locus_tag LOCUS_08220 8948 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 10398 12212 gene locus_tag LOCUS_08230 10398 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 12213 13139 gene locus_tag LOCUS_08240 12213 13139 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_08240 13136 13519 gene locus_tag LOCUS_08250 13136 13519 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 protein_id gnl|my_center|LOCUS_08250 13643 14209 gene locus_tag LOCUS_08260 13643 14209 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 protein_id gnl|my_center|LOCUS_08260 14209 15144 gene locus_tag LOCUS_08270 14209 15144 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681918.1 protein_id gnl|my_center|LOCUS_08270 15144 16292 gene locus_tag LOCUS_08280 15144 16292 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389793.1 protein_id gnl|my_center|LOCUS_08280 16279 17424 gene locus_tag LOCUS_08290 16279 17424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948981.1 protein_id gnl|my_center|LOCUS_08290 17682 18329 gene locus_tag LOCUS_08300 17682 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 18338 19816 gene locus_tag LOCUS_08310 18338 19816 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_08310 19824 20420 gene locus_tag LOCUS_08320 19824 20420 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526464.1 protein_id gnl|my_center|LOCUS_08320 20428 21183 gene locus_tag LOCUS_08330 gene nadE 20428 21183 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496806.1 protein_id gnl|my_center|LOCUS_08330 21192 22262 gene locus_tag LOCUS_08340 21192 22262 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_08340 22259 22840 gene locus_tag LOCUS_08350 gene nadD 22259 22840 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965087.1 protein_id gnl|my_center|LOCUS_08350 22879 23346 gene locus_tag LOCUS_08360 22879 23346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 23748 24566 gene locus_tag LOCUS_08370 23748 24566 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965083.1 protein_id gnl|my_center|LOCUS_08370 25443 24574 gene locus_tag LOCUS_08380 25443 24574 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_08380 25533 26084 gene locus_tag LOCUS_08390 25533 26084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 26087 27163 gene locus_tag LOCUS_08400 26087 27163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 27165 27887 gene locus_tag LOCUS_08410 27165 27887 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262266.1 protein_id gnl|my_center|LOCUS_08410 28531 28238 gene locus_tag LOCUS_08420 28531 28238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 28843 29994 gene locus_tag LOCUS_08430 28843 29994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 30005 30172 gene locus_tag LOCUS_08440 30005 30172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 30224 30952 gene locus_tag LOCUS_08450 30224 30952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 31034 32803 gene locus_tag LOCUS_08460 gene pepF 31034 32803 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_08460 33438 32836 gene locus_tag LOCUS_08470 33438 32836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08470 34187 33681 gene locus_tag LOCUS_08480 34187 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08480 34610 35584 gene locus_tag LOCUS_08490 34610 35584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 35621 35743 gene locus_tag LOCUS_08500 35621 35743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 35740 36273 gene locus_tag LOCUS_08510 35740 36273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 36357 36809 gene locus_tag LOCUS_08520 36357 36809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 36873 37391 gene locus_tag LOCUS_08530 36873 37391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 37726 38862 gene locus_tag LOCUS_08540 37726 38862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 38862 39356 gene locus_tag LOCUS_08550 38862 39356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 39358 41277 gene locus_tag LOCUS_08560 39358 41277 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262047.1 protein_id gnl|my_center|LOCUS_08560 41449 41688 gene locus_tag LOCUS_08570 41449 41688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 41864 42658 gene locus_tag LOCUS_08580 41864 42658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08580 43365 43697 gene locus_tag LOCUS_08590 43365 43697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 43690 45516 gene locus_tag LOCUS_08600 43690 45516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 45696 45481 gene locus_tag LOCUS_08610 45696 45481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 46083 46637 gene locus_tag LOCUS_08620 46083 46637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 46627 47337 gene locus_tag LOCUS_08630 46627 47337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence11 154 528 gene locus_tag LOCUS_tm00010 154 528 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2256 667 gene locus_tag LOCUS_08640 2256 667 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235856733.1 protein_id gnl|my_center|LOCUS_08640 2548 3846 gene locus_tag LOCUS_08650 2548 3846 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_08650 4243 4839 gene locus_tag LOCUS_08660 4243 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 4832 6547 gene locus_tag LOCUS_08670 4832 6547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480410.1 protein_id gnl|my_center|LOCUS_08670 6644 6850 gene locus_tag LOCUS_08680 6644 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 7023 7283 gene locus_tag LOCUS_08690 7023 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7349 7762 gene locus_tag LOCUS_08700 7349 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08700 8784 7915 gene locus_tag LOCUS_08710 8784 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10965 8869 gene locus_tag LOCUS_08720 gene infB 10965 8869 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036341.1 protein_id gnl|my_center|LOCUS_08720 11502 10984 gene locus_tag LOCUS_08730 11502 10984 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183284.1 protein_id gnl|my_center|LOCUS_08730 11773 11510 gene locus_tag LOCUS_08740 11773 11510 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071128.1 protein_id gnl|my_center|LOCUS_08740 12943 11777 gene locus_tag LOCUS_08750 gene nusA 12943 11777 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102609.1 protein_id gnl|my_center|LOCUS_08750 13197 12958 gene locus_tag LOCUS_08760 13197 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 13341 14267 gene locus_tag LOCUS_08770 13341 14267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 14260 15120 gene locus_tag LOCUS_08780 14260 15120 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 protein_id gnl|my_center|LOCUS_08780 15641 15351 gene locus_tag LOCUS_08790 15641 15351 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890717.1 protein_id gnl|my_center|LOCUS_08790 17877 15733 gene locus_tag LOCUS_08800 17877 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 18559 17894 gene locus_tag LOCUS_08810 18559 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 20309 18522 gene locus_tag LOCUS_08820 20309 18522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 22123 20339 gene locus_tag LOCUS_08830 22123 20339 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222039.1 protein_id gnl|my_center|LOCUS_08830 22668 22114 gene locus_tag LOCUS_08840 22668 22114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 22969 22646 gene locus_tag LOCUS_08850 22969 22646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 25065 22987 gene locus_tag LOCUS_08860 25065 22987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 26813 25089 gene locus_tag LOCUS_08870 26813 25089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 27206 26826 gene locus_tag LOCUS_08880 27206 26826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 27800 27426 gene locus_tag LOCUS_08890 27800 27426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 28920 27895 gene locus_tag LOCUS_08900 28920 27895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 29508 28936 gene locus_tag LOCUS_08910 29508 28936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 29979 29512 gene locus_tag LOCUS_08920 29979 29512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 30220 29999 gene locus_tag LOCUS_08930 30220 29999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 31078 30296 gene locus_tag LOCUS_08940 31078 30296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 31980 31078 gene locus_tag LOCUS_08950 31980 31078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 33117 31993 gene locus_tag LOCUS_08960 33117 31993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 33948 33121 gene locus_tag LOCUS_08970 33948 33121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 34368 33967 gene locus_tag LOCUS_08980 34368 33967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 36617 34365 gene locus_tag LOCUS_08990 36617 34365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 37273 36626 gene locus_tag LOCUS_09000 37273 36626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 38935 37358 gene locus_tag LOCUS_09010 38935 37358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 40096 39782 gene locus_tag LOCUS_09020 40096 39782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09020 40913 40737 gene locus_tag LOCUS_09030 40913 40737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 41452 41051 gene locus_tag LOCUS_09040 41452 41051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 43725 41449 gene locus_tag LOCUS_09050 43725 41449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 44381 43734 gene locus_tag LOCUS_09060 44381 43734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 44677 44465 gene locus_tag LOCUS_09070 44677 44465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 45095 46612 gene locus_tag LOCUS_09080 45095 46612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence12 158 1060 gene locus_tag LOCUS_09090 158 1060 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_09090 1165 4053 gene locus_tag LOCUS_09100 1165 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 4055 4735 gene locus_tag LOCUS_09110 4055 4735 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_09110 4748 5419 gene locus_tag LOCUS_09120 4748 5419 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_09120 5423 6688 gene locus_tag LOCUS_09130 5423 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 6691 7701 gene locus_tag LOCUS_09140 6691 7701 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_09140 7837 9597 gene locus_tag LOCUS_09150 7837 9597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861229.1 protein_id gnl|my_center|LOCUS_09150 9590 11305 gene locus_tag LOCUS_09160 9590 11305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583190.1 protein_id gnl|my_center|LOCUS_09160 11394 12047 gene locus_tag LOCUS_09170 11394 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 12070 14124 gene locus_tag LOCUS_09180 12070 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 14146 16212 gene locus_tag LOCUS_09190 14146 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 16289 17416 gene locus_tag LOCUS_09200 16289 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 17445 18389 gene locus_tag LOCUS_09210 gene holA 17445 18389 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 protein_id gnl|my_center|LOCUS_09210 19627 18407 gene locus_tag LOCUS_09220 19627 18407 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812943.1 protein_id gnl|my_center|LOCUS_09220 19806 21722 gene locus_tag LOCUS_09230 19806 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 21840 22727 gene locus_tag LOCUS_09240 gene xerD 21840 22727 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546237.1 protein_id gnl|my_center|LOCUS_09240 22748 23902 gene locus_tag LOCUS_09250 gene deoB 22748 23902 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_09250 23911 25287 gene locus_tag LOCUS_09260 23911 25287 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_09260 25559 26479 gene locus_tag LOCUS_09270 25559 26479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 26566 28743 gene locus_tag LOCUS_09280 26566 28743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 28754 29110 gene locus_tag LOCUS_09290 28754 29110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 29179 30012 gene locus_tag LOCUS_09300 29179 30012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 30059 30811 gene locus_tag LOCUS_09310 gene zupT 30059 30811 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811500.1 protein_id gnl|my_center|LOCUS_09310 30853 31110 gene locus_tag LOCUS_09320 30853 31110 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_09320 31314 31138 gene locus_tag LOCUS_09330 31314 31138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 32276 31488 gene locus_tag LOCUS_09340 32276 31488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 33441 32344 gene locus_tag LOCUS_09350 gene mnmA 33441 32344 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943733.1 protein_id gnl|my_center|LOCUS_09350 34101 33472 gene locus_tag LOCUS_09360 34101 33472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 35446 34256 gene locus_tag LOCUS_09370 35446 34256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 37006 35450 gene locus_tag LOCUS_09380 37006 35450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 37828 37016 gene locus_tag LOCUS_09390 37828 37016 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_09390 38912 37920 gene locus_tag LOCUS_09400 gene spoIVB 38912 37920 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_09400 39224 39015 gene locus_tag LOCUS_09410 39224 39015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 40497 39214 gene locus_tag LOCUS_09420 gene xseA 40497 39214 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_09420 40903 40484 gene locus_tag LOCUS_09430 gene nusB 40903 40484 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_09430 41366 40962 gene locus_tag LOCUS_09440 41366 40962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 42838 41516 gene locus_tag LOCUS_09450 42838 41516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 43233 42838 gene locus_tag LOCUS_09460 43233 42838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 45800 43245 gene locus_tag LOCUS_09470 gene mutS 45800 43245 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 protein_id gnl|my_center|LOCUS_09470 46160 45861 gene locus_tag LOCUS_09480 46160 45861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence13 460 1494 gene locus_tag LOCUS_09490 460 1494 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_09490 1909 2586 gene locus_tag LOCUS_09500 1909 2586 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 protein_id gnl|my_center|LOCUS_09500 2588 3601 gene locus_tag LOCUS_09510 2588 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3627 4667 gene locus_tag LOCUS_09520 3627 4667 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_09520 4684 5769 gene locus_tag LOCUS_09530 4684 5769 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_09530 5818 7872 gene locus_tag LOCUS_09540 5818 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 7877 9280 gene locus_tag LOCUS_09550 7877 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 9261 10454 gene locus_tag LOCUS_09560 9261 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 10441 11211 gene locus_tag LOCUS_09570 10441 11211 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_09570 11228 12331 gene locus_tag LOCUS_09580 gene glf 11228 12331 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_09580 12333 13247 gene locus_tag LOCUS_09590 12333 13247 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875982.1 protein_id gnl|my_center|LOCUS_09590 13360 14802 gene locus_tag LOCUS_09600 13360 14802 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_09600 14821 16827 gene locus_tag LOCUS_09610 14821 16827 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351383.1 protein_id gnl|my_center|LOCUS_09610 16824 17591 gene locus_tag LOCUS_09620 16824 17591 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935416.1 protein_id gnl|my_center|LOCUS_09620 17629 19119 gene locus_tag LOCUS_09630 17629 19119 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_09630 19219 20286 gene locus_tag LOCUS_09640 19219 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 20293 20703 gene locus_tag LOCUS_09650 20293 20703 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_09650 20752 21717 gene locus_tag LOCUS_09660 20752 21717 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 protein_id gnl|my_center|LOCUS_09660 22099 22905 gene locus_tag LOCUS_09670 22099 22905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_09670 22916 23665 gene locus_tag LOCUS_09680 22916 23665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_09680 23662 24726 gene locus_tag LOCUS_09690 23662 24726 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017013.1 protein_id gnl|my_center|LOCUS_09690 24748 27111 gene locus_tag LOCUS_09700 24748 27111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 27116 28081 gene locus_tag LOCUS_09710 27116 28081 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_09710 28068 29582 gene locus_tag LOCUS_09720 28068 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 30557 29589 gene locus_tag LOCUS_09730 30557 29589 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727474.1 protein_id gnl|my_center|LOCUS_09730 30827 30961 gene locus_tag LOCUS_09740 30827 30961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 31085 31513 gene locus_tag LOCUS_09750 gene mraZ 31085 31513 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_09750 31525 32445 gene locus_tag LOCUS_09760 gene rsmH 31525 32445 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 protein_id gnl|my_center|LOCUS_09760 32456 32752 gene locus_tag LOCUS_09770 32456 32752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 32767 34962 gene locus_tag LOCUS_09780 32767 34962 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731976.1 protein_id gnl|my_center|LOCUS_09780 34981 36315 gene locus_tag LOCUS_09790 34981 36315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 36373 36666 gene locus_tag LOCUS_09800 36373 36666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 37853 36762 gene locus_tag LOCUS_09810 gene spoVE 37853 36762 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_09810 38846 37854 gene locus_tag LOCUS_09820 gene mraY 38846 37854 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893060.1 protein_id gnl|my_center|LOCUS_09820 40764 38857 gene locus_tag LOCUS_09830 40764 38857 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_09830 40874 41872 gene locus_tag LOCUS_09840 40874 41872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 41920 43149 gene locus_tag LOCUS_09850 gene eno 41920 43149 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_09850 43239 43622 gene locus_tag LOCUS_09860 43239 43622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 43701 45641 gene locus_tag LOCUS_09870 43701 45641 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510954.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence14 711 926 gene locus_tag LOCUS_09880 gene rpmE 711 926 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_09880 2413 971 gene locus_tag LOCUS_09890 2413 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2549 2983 gene locus_tag LOCUS_09900 gene rpiB 2549 2983 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_09900 2976 3170 gene locus_tag LOCUS_09910 2976 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3210 4121 gene locus_tag LOCUS_09920 gene spoIID 3210 4121 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_09920 4176 4811 gene locus_tag LOCUS_09930 4176 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4881 5138 gene locus_tag LOCUS_09940 gene spoIIID 4881 5138 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544012.1 protein_id gnl|my_center|LOCUS_09940 5189 6181 gene locus_tag LOCUS_09950 gene mbl 5189 6181 CDS product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 protein_id gnl|my_center|LOCUS_09950 6266 7180 gene locus_tag LOCUS_09960 6266 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 7276 8337 gene locus_tag LOCUS_09970 7276 8337 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_09970 8381 9115 gene locus_tag LOCUS_09980 8381 9115 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948896.1 protein_id gnl|my_center|LOCUS_09980 9234 11144 gene locus_tag LOCUS_09990 9234 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 11178 13079 gene locus_tag LOCUS_10000 11178 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 13076 13468 gene locus_tag LOCUS_10010 13076 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 13478 14932 gene locus_tag LOCUS_10020 13478 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 15067 17421 gene locus_tag LOCUS_10030 15067 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 17422 20511 gene locus_tag LOCUS_10040 17422 20511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 20563 20907 gene locus_tag LOCUS_10050 20563 20907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 20897 22075 gene locus_tag LOCUS_10060 20897 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 22113 22652 gene locus_tag LOCUS_10070 gene yfcE 22113 22652 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_10070 22756 23274 gene locus_tag LOCUS_10080 22756 23274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 23438 23647 gene locus_tag LOCUS_10090 23438 23647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 23957 24385 gene locus_tag LOCUS_10100 23957 24385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 24779 25276 gene locus_tag LOCUS_10110 24779 25276 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_10110 25452 26396 gene locus_tag LOCUS_10120 25452 26396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 26485 28518 gene locus_tag LOCUS_10130 26485 28518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 28638 29120 gene locus_tag LOCUS_10140 28638 29120 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_10140 29580 29131 gene locus_tag LOCUS_10150 29580 29131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 29917 30471 gene locus_tag LOCUS_10160 29917 30471 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027149.1 protein_id gnl|my_center|LOCUS_10160 30780 33398 gene locus_tag LOCUS_10170 30780 33398 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_10170 33545 34252 gene locus_tag LOCUS_10180 33545 34252 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399975.1 protein_id gnl|my_center|LOCUS_10180 34249 35580 gene locus_tag LOCUS_10190 34249 35580 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721673.1 protein_id gnl|my_center|LOCUS_10190 35788 35666 gene locus_tag LOCUS_10200 35788 35666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 36432 35824 gene locus_tag LOCUS_10210 36432 35824 CDS product accessory gene regulator ArgB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932273.1 protein_id gnl|my_center|LOCUS_10210 36758 36970 gene locus_tag LOCUS_10220 gene cspD 36758 36970 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728273.1 protein_id gnl|my_center|LOCUS_10220 37043 37576 gene locus_tag LOCUS_10230 gene raiA 37043 37576 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_10230 37676 40168 gene locus_tag LOCUS_10240 gene secA 37676 40168 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence15 668 300 gene locus_tag LOCUS_10250 668 300 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870381.1 protein_id gnl|my_center|LOCUS_10250 1360 686 gene locus_tag LOCUS_10260 1360 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1541 2290 gene locus_tag LOCUS_10270 gene sufC 1541 2290 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_10270 2280 3074 gene locus_tag LOCUS_10280 2280 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3080 4273 gene locus_tag LOCUS_10290 3080 4273 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_10290 4330 4914 gene locus_tag LOCUS_10300 4330 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4952 5389 gene locus_tag LOCUS_10310 4952 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5447 6310 gene locus_tag LOCUS_10320 5447 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 6310 6948 gene locus_tag LOCUS_10330 6310 6948 CDS product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858500.1 protein_id gnl|my_center|LOCUS_10330 6955 8172 gene locus_tag LOCUS_10340 6955 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 8259 8429 gene locus_tag LOCUS_10350 8259 8429 CDS product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621751.1 protein_id gnl|my_center|LOCUS_10350 8543 8854 gene locus_tag LOCUS_10360 8543 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 8835 11030 gene locus_tag LOCUS_10370 gene secDF 8835 11030 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119059.1 protein_id gnl|my_center|LOCUS_10370 11056 13227 gene locus_tag LOCUS_10380 gene relA 11056 13227 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_10380 13246 14304 gene locus_tag LOCUS_10390 13246 14304 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 protein_id gnl|my_center|LOCUS_10390 14315 15580 gene locus_tag LOCUS_10400 gene hisS 14315 15580 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830876.1 protein_id gnl|my_center|LOCUS_10400 15580 16059 gene locus_tag LOCUS_10410 15580 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 16028 17341 gene locus_tag LOCUS_10420 gene aspS 16028 17341 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_10420 17451 20735 gene locus_tag LOCUS_10430 17451 20735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 22596 20758 gene locus_tag LOCUS_10440 22596 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 22717 23955 gene locus_tag LOCUS_10450 22717 23955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 23942 24871 gene locus_tag LOCUS_10460 23942 24871 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020707.1 protein_id gnl|my_center|LOCUS_10460 24955 25431 gene locus_tag LOCUS_10470 24955 25431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 25415 26098 gene locus_tag LOCUS_10480 gene radC 25415 26098 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_10480 26145 27002 gene locus_tag LOCUS_10490 gene mreC 26145 27002 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132018.1 protein_id gnl|my_center|LOCUS_10490 26999 27496 gene locus_tag LOCUS_10500 26999 27496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 27536 28144 gene locus_tag LOCUS_10510 27536 28144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 28116 28874 gene locus_tag LOCUS_10520 gene spoIVFB 28116 28874 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599058.1 protein_id gnl|my_center|LOCUS_10520 28982 29284 gene locus_tag LOCUS_10530 gene rplU 28982 29284 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_10530 29286 29594 gene locus_tag LOCUS_10540 29286 29594 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_10540 29609 29902 gene locus_tag LOCUS_10550 gene rpmA 29609 29902 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355868.1 protein_id gnl|my_center|LOCUS_10550 30071 30580 gene locus_tag LOCUS_10560 gene infC 30071 30580 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973214.1 protein_id gnl|my_center|LOCUS_10560 30591 30782 gene locus_tag LOCUS_10570 30591 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 30800 31330 gene locus_tag LOCUS_10580 30800 31330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 31409 32539 gene locus_tag LOCUS_10590 31409 32539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 32544 33014 gene locus_tag LOCUS_10600 32544 33014 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_10600 33011 33490 gene locus_tag LOCUS_10610 33011 33490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 33505 34497 gene locus_tag LOCUS_10620 gene galE 33505 34497 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 protein_id gnl|my_center|LOCUS_10620 34612 35334 gene locus_tag LOCUS_10630 34612 35334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence16 1177 104 gene locus_tag LOCUS_10640 1177 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2274 1270 gene locus_tag LOCUS_10650 gene yqeH 2274 1270 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703227.1 protein_id gnl|my_center|LOCUS_10650 2788 2267 gene locus_tag LOCUS_10660 2788 2267 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831044.1 protein_id gnl|my_center|LOCUS_10660 3430 2873 gene locus_tag LOCUS_10670 gene efp 3430 2873 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_10670 3640 3473 gene locus_tag LOCUS_10680 gene rpmG 3640 3473 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_10680 5768 3684 gene locus_tag LOCUS_10690 gene pbpA 5768 3684 CDS product penicillin-binding protein 2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398702.1 protein_id gnl|my_center|LOCUS_10690 6360 5746 gene locus_tag LOCUS_10700 6360 5746 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831217.1 protein_id gnl|my_center|LOCUS_10700 6446 6709 gene locus_tag LOCUS_10710 6446 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7611 6700 gene locus_tag LOCUS_10720 7611 6700 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 protein_id gnl|my_center|LOCUS_10720 8774 8352 gene locus_tag LOCUS_10730 8774 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 11882 8838 gene locus_tag LOCUS_10740 11882 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12244 11969 gene locus_tag LOCUS_10750 12244 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065696.1 protein_id gnl|my_center|LOCUS_10750 12998 12285 gene locus_tag LOCUS_10760 12998 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15102 13060 gene locus_tag LOCUS_10770 gene topA 15102 13060 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_10770 16137 15199 gene locus_tag LOCUS_10780 16137 15199 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809839.1 protein_id gnl|my_center|LOCUS_10780 17170 16112 gene locus_tag LOCUS_10790 17170 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809841.1 protein_id gnl|my_center|LOCUS_10790 18104 17193 gene locus_tag LOCUS_10800 18104 17193 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198966.1 protein_id gnl|my_center|LOCUS_10800 18193 18351 gene locus_tag LOCUS_10810 18193 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 18428 19675 gene locus_tag LOCUS_10820 18428 19675 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830979.1 protein_id gnl|my_center|LOCUS_10820 21034 19688 gene locus_tag LOCUS_10830 21034 19688 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_10830 21638 21021 gene locus_tag LOCUS_10840 21638 21021 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965071.1 protein_id gnl|my_center|LOCUS_10840 21893 21672 gene locus_tag LOCUS_10850 21893 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 22404 21952 gene locus_tag LOCUS_10860 22404 21952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 24440 22455 gene locus_tag LOCUS_10870 gene tkt 24440 22455 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193030.1 protein_id gnl|my_center|LOCUS_10870 24829 24686 gene locus_tag LOCUS_10880 24829 24686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 24956 25573 gene locus_tag LOCUS_10890 gene lexA 24956 25573 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_10890 26220 25588 gene locus_tag LOCUS_10900 26220 25588 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_10900 27377 26217 gene locus_tag LOCUS_10910 27377 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 28281 27379 gene locus_tag LOCUS_10920 28281 27379 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_10920 28729 28274 gene locus_tag LOCUS_10930 gene lspA 28729 28274 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989666.1 protein_id gnl|my_center|LOCUS_10930 29856 28846 gene locus_tag LOCUS_10940 29856 28846 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_10940 30153 29923 gene locus_tag LOCUS_10950 30153 29923 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236745.1 protein_id gnl|my_center|LOCUS_10950 30246 31022 gene locus_tag LOCUS_10960 gene sigG 30246 31022 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_10960 32844 31039 gene locus_tag LOCUS_10970 gene dxs 32844 31039 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence17 104 541 gene locus_tag LOCUS_10980 104 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 598 1047 gene locus_tag LOCUS_10990 gene tsaE 598 1047 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_10990 1044 1658 gene locus_tag LOCUS_11000 gene tsaB 1044 1658 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832485.1 protein_id gnl|my_center|LOCUS_11000 1655 2059 gene locus_tag LOCUS_11010 gene rimI 1655 2059 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902598.1 protein_id gnl|my_center|LOCUS_11010 2063 3067 gene locus_tag LOCUS_11020 gene tsaD 2063 3067 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830015.1 protein_id gnl|my_center|LOCUS_11020 3173 3246 gene locus_tag LOCUS_t00140 3173 3246 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3300 4961 gene locus_tag LOCUS_11030 3300 4961 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_11030 5061 5137 gene locus_tag LOCUS_t00150 5061 5137 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5273 5572 gene locus_tag LOCUS_11040 5273 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5640 7991 gene locus_tag LOCUS_11050 5640 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 8023 8412 gene locus_tag LOCUS_11060 8023 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 8491 9477 gene locus_tag LOCUS_11070 gene dusB 8491 9477 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 protein_id gnl|my_center|LOCUS_11070 9464 10039 gene locus_tag LOCUS_11080 9464 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 10052 11521 gene locus_tag LOCUS_11090 gene lysS 10052 11521 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296055.1 protein_id gnl|my_center|LOCUS_11090 11521 12048 gene locus_tag LOCUS_11100 11521 12048 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003289268.1 protein_id gnl|my_center|LOCUS_11100 12062 13240 gene locus_tag LOCUS_11110 gene ackA 12062 13240 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034575.1 protein_id gnl|my_center|LOCUS_11110 13258 14226 gene locus_tag LOCUS_11120 13258 14226 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545136.1 protein_id gnl|my_center|LOCUS_11120 14422 16122 gene locus_tag LOCUS_11130 14422 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 16542 16162 gene locus_tag LOCUS_11140 16542 16162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 17741 16542 gene locus_tag LOCUS_11150 gene pdaC 17741 16542 CDS product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 protein_id gnl|my_center|LOCUS_11150 18126 20435 gene locus_tag LOCUS_11160 18126 20435 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436320.1 protein_id gnl|my_center|LOCUS_11160 20447 20611 gene locus_tag LOCUS_11170 20447 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 20614 21171 gene locus_tag LOCUS_11180 gene nrdG 20614 21171 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432598.1 protein_id gnl|my_center|LOCUS_11180 21681 21451 gene locus_tag LOCUS_11190 21681 21451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 22249 21683 gene locus_tag LOCUS_11200 22249 21683 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392695.1 protein_id gnl|my_center|LOCUS_11200 22341 22724 gene locus_tag LOCUS_11210 gene gerQ 22341 22724 CDS product spore coat protein GerQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068652.1 protein_id gnl|my_center|LOCUS_11210 22757 23302 gene locus_tag LOCUS_11220 22757 23302 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963812.1 protein_id gnl|my_center|LOCUS_11220 23728 23321 gene locus_tag LOCUS_11230 23728 23321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 24046 23759 gene locus_tag LOCUS_11240 24046 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 24336 24043 gene locus_tag LOCUS_11250 gene yabP 24336 24043 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226714.1 protein_id gnl|my_center|LOCUS_11250 25656 24388 gene locus_tag LOCUS_11260 25656 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836438.1 protein_id gnl|my_center|LOCUS_11260 27665 25716 gene locus_tag LOCUS_11270 27665 25716 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 protein_id gnl|my_center|LOCUS_11270 27776 28996 gene locus_tag LOCUS_11280 27776 28996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 29963 29013 gene locus_tag LOCUS_11290 29963 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 31172 30051 gene locus_tag LOCUS_11300 31172 30051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 32167 31262 gene locus_tag LOCUS_11310 32167 31262 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462306.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence18 1231 791 gene locus_tag LOCUS_11320 1231 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1903 1304 gene locus_tag LOCUS_11330 1903 1304 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476167.1 protein_id gnl|my_center|LOCUS_11330 2567 1878 gene locus_tag LOCUS_11340 2567 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3981 2770 gene locus_tag LOCUS_11350 3981 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4544 3999 gene locus_tag LOCUS_11360 4544 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 5758 4595 gene locus_tag LOCUS_11370 5758 4595 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455004.1 protein_id gnl|my_center|LOCUS_11370 6344 5790 gene locus_tag LOCUS_11380 6344 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 6796 6341 gene locus_tag LOCUS_11390 6796 6341 CDS product DUF5680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328005.1 protein_id gnl|my_center|LOCUS_11390 7625 6798 gene locus_tag LOCUS_11400 7625 6798 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_11400 8421 7615 gene locus_tag LOCUS_11410 8421 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 8982 8437 gene locus_tag LOCUS_11420 8982 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 9942 9097 gene locus_tag LOCUS_11430 9942 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 10571 10017 gene locus_tag LOCUS_11440 10571 10017 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_11440 11673 10588 gene locus_tag LOCUS_11450 11673 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 12228 11743 gene locus_tag LOCUS_11460 gene lepB 12228 11743 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 protein_id gnl|my_center|LOCUS_11460 12615 12271 gene locus_tag LOCUS_11470 gene rplS 12615 12271 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640385.1 protein_id gnl|my_center|LOCUS_11470 13205 12735 gene locus_tag LOCUS_11480 13205 12735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 13879 13211 gene locus_tag LOCUS_11490 gene trmD 13879 13211 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_11490 14363 13869 gene locus_tag LOCUS_11500 gene rimM 14363 13869 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832559.1 protein_id gnl|my_center|LOCUS_11500 15097 14372 gene locus_tag LOCUS_11510 15097 14372 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_11510 16231 15146 gene locus_tag LOCUS_11520 16231 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 17244 16351 gene locus_tag LOCUS_11530 gene htpX 17244 16351 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989629.1 protein_id gnl|my_center|LOCUS_11530 17768 17241 gene locus_tag LOCUS_11540 17768 17241 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_11540 19360 17849 gene locus_tag LOCUS_11550 19360 17849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 19889 19452 gene locus_tag LOCUS_11560 19889 19452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 20254 19946 gene locus_tag LOCUS_11570 20254 19946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 20456 21043 gene locus_tag LOCUS_11580 20456 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 21520 21182 gene locus_tag LOCUS_11590 21520 21182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 22532 21525 gene locus_tag LOCUS_11600 22532 21525 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045264.1 protein_id gnl|my_center|LOCUS_11600 23620 22604 gene locus_tag LOCUS_11610 gene gpr 23620 22604 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229991.1 protein_id gnl|my_center|LOCUS_11610 23726 23986 gene locus_tag LOCUS_11620 gene rpsT 23726 23986 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_11620 24050 24976 gene locus_tag LOCUS_11630 24050 24976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 26718 24973 gene locus_tag LOCUS_11640 26718 24973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 27196 26807 gene locus_tag LOCUS_11650 27196 26807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 27809 27189 gene locus_tag LOCUS_11660 gene nth 27809 27189 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967580.1 protein_id gnl|my_center|LOCUS_11660 28431 27799 gene locus_tag LOCUS_11670 gene dnaD 28431 27799 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728549.1 protein_id gnl|my_center|LOCUS_11670 29111 28479 gene locus_tag LOCUS_11680 29111 28479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 30185 29148 gene locus_tag LOCUS_11690 30185 29148 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 protein_id gnl|my_center|LOCUS_11690 30481 30209 gene locus_tag LOCUS_11700 gene hupB 30481 30209 CDS product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312721.1 protein_id gnl|my_center|LOCUS_11700 31517 30615 gene locus_tag LOCUS_11710 31517 30615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence19 151 1920 gene locus_tag LOCUS_11720 151 1920 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084726.1 protein_id gnl|my_center|LOCUS_11720 1938 2960 gene locus_tag LOCUS_11730 gene rlmN 1938 2960 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989487.1 protein_id gnl|my_center|LOCUS_11730 2960 3706 gene locus_tag LOCUS_11740 2960 3706 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_11740 3699 5423 gene locus_tag LOCUS_11750 gene pknB 3699 5423 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674550.1 protein_id gnl|my_center|LOCUS_11750 5424 6257 gene locus_tag LOCUS_11760 gene rsgA 5424 6257 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378814.1 protein_id gnl|my_center|LOCUS_11760 6261 6896 gene locus_tag LOCUS_11770 gene rpe 6261 6896 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476680.1 protein_id gnl|my_center|LOCUS_11770 6898 8118 gene locus_tag LOCUS_11780 6898 8118 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_11780 9104 8142 gene locus_tag LOCUS_11790 9104 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9229 10794 gene locus_tag LOCUS_11800 9229 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 10875 11957 gene locus_tag LOCUS_11810 gene murG 10875 11957 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476139.1 protein_id gnl|my_center|LOCUS_11810 11947 12846 gene locus_tag LOCUS_11820 gene murB 11947 12846 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_11820 12856 13587 gene locus_tag LOCUS_11830 12856 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 14075 14320 gene locus_tag LOCUS_11840 14075 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 14320 15114 gene locus_tag LOCUS_11850 14320 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 15378 15196 gene locus_tag LOCUS_11860 15378 15196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 17144 15465 gene locus_tag LOCUS_11870 17144 15465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 17463 18668 gene locus_tag LOCUS_11880 17463 18668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 18655 19158 gene locus_tag LOCUS_11890 18655 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 19212 20489 gene locus_tag LOCUS_11900 gene obgE 19212 20489 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724114.1 protein_id gnl|my_center|LOCUS_11900 20486 21016 gene locus_tag LOCUS_11910 20486 21016 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289118.1 protein_id gnl|my_center|LOCUS_11910 21102 21557 gene locus_tag LOCUS_11920 21102 21557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 21571 23640 gene locus_tag LOCUS_11930 21571 23640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 23673 24500 gene locus_tag LOCUS_11940 23673 24500 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226530.1 protein_id gnl|my_center|LOCUS_11940 24702 26063 gene locus_tag LOCUS_11950 24702 26063 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_11950 27203 27709 gene locus_tag LOCUS_11960 27203 27709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 27769 29118 gene locus_tag LOCUS_11970 27769 29118 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_11970 29131 30123 gene locus_tag LOCUS_11980 gene mraY 29131 30123 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence20 2655 2422 gene locus_tag LOCUS_11990 2655 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3027 2719 gene locus_tag LOCUS_12000 3027 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4162 3152 gene locus_tag LOCUS_12010 4162 3152 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476283.1 protein_id gnl|my_center|LOCUS_12010 4209 5189 gene locus_tag LOCUS_12020 gene ylbJ 4209 5189 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273082.1 protein_id gnl|my_center|LOCUS_12020 6854 5181 gene locus_tag LOCUS_12030 6854 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7378 6857 gene locus_tag LOCUS_12040 7378 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 7474 9231 gene locus_tag LOCUS_12050 7474 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 10035 9283 gene locus_tag LOCUS_12060 10035 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 11008 10043 gene locus_tag LOCUS_12070 gene fmt 11008 10043 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_12070 13202 11034 gene locus_tag LOCUS_12080 gene priA 13202 11034 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_12080 13693 13217 gene locus_tag LOCUS_12090 13693 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 14919 13708 gene locus_tag LOCUS_12100 14919 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150048584.1 protein_id gnl|my_center|LOCUS_12100 15179 14919 gene locus_tag LOCUS_12110 15179 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 16312 15188 gene locus_tag LOCUS_12120 16312 15188 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638965.1 protein_id gnl|my_center|LOCUS_12120 16803 16372 gene locus_tag LOCUS_12130 gene mscL 16803 16372 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267001.1 protein_id gnl|my_center|LOCUS_12130 17919 16831 gene locus_tag LOCUS_12140 17919 16831 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587069.1 protein_id gnl|my_center|LOCUS_12140 18758 18003 gene locus_tag LOCUS_12150 18758 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 19032 18748 gene locus_tag LOCUS_12160 19032 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 19334 19035 gene locus_tag LOCUS_12170 19334 19035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 19626 19702 gene locus_tag LOCUS_t00160 19626 19702 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20581 19826 gene locus_tag LOCUS_12180 20581 19826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 21630 20884 gene locus_tag LOCUS_12190 21630 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 22723 21764 gene locus_tag LOCUS_12200 22723 21764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 22979 22773 gene locus_tag LOCUS_12210 gene gerE 22979 22773 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_12210 23616 23089 gene locus_tag LOCUS_12220 23616 23089 CDS product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914708.1 protein_id gnl|my_center|LOCUS_12220 24035 23706 gene locus_tag LOCUS_12230 24035 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 25864 24113 gene locus_tag LOCUS_12240 gene thrS 25864 24113 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 protein_id gnl|my_center|LOCUS_12240 26307 26086 gene locus_tag LOCUS_12250 gene rpsR 26307 26086 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420527.1 protein_id gnl|my_center|LOCUS_12250 26778 26323 gene locus_tag LOCUS_12260 gene ssb 26778 26323 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722552.1 protein_id gnl|my_center|LOCUS_12260 27084 26794 gene locus_tag LOCUS_12270 gene rpsF 27084 26794 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 protein_id gnl|my_center|LOCUS_12270 29166 27220 gene locus_tag LOCUS_12280 29166 27220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 29444 29163 gene locus_tag LOCUS_12290 29444 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence21 2114 3928 gene locus_tag LOCUS_12300 gene glmS 2114 3928 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_12300 4792 3959 gene locus_tag LOCUS_12310 4792 3959 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455196.1 protein_id gnl|my_center|LOCUS_12310 5720 4806 gene locus_tag LOCUS_12320 5720 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 8329 5783 gene locus_tag LOCUS_12330 8329 5783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861226.1 protein_id gnl|my_center|LOCUS_12330 9003 8326 gene locus_tag LOCUS_12340 9003 8326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438655.1 protein_id gnl|my_center|LOCUS_12340 10293 9088 gene locus_tag LOCUS_12350 10293 9088 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861225.1 protein_id gnl|my_center|LOCUS_12350 10957 10280 gene locus_tag LOCUS_12360 10957 10280 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434895.1 protein_id gnl|my_center|LOCUS_12360 11419 11054 gene locus_tag LOCUS_12370 11419 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 11956 11498 gene locus_tag LOCUS_12380 11956 11498 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_12380 14387 12015 gene locus_tag LOCUS_12390 14387 12015 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_12390 15371 14487 gene locus_tag LOCUS_12400 15371 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 16425 15493 gene locus_tag LOCUS_12410 16425 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 16826 16993 gene locus_tag LOCUS_12420 16826 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 17103 18713 gene locus_tag LOCUS_12430 17103 18713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547588.1 protein_id gnl|my_center|LOCUS_12430 18762 20480 gene locus_tag LOCUS_12440 18762 20480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_12440 21498 20689 gene locus_tag LOCUS_12450 21498 20689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 21607 22494 gene locus_tag LOCUS_12460 21607 22494 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_12460 23452 22628 gene locus_tag LOCUS_12470 23452 22628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 23754 24254 gene locus_tag LOCUS_12480 23754 24254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 24279 25460 gene locus_tag LOCUS_12490 24279 25460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence22 2047 119 gene locus_tag LOCUS_12500 2047 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2585 2145 gene locus_tag LOCUS_12510 2585 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4728 2569 gene locus_tag LOCUS_12520 gene pnp 4728 2569 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378800.1 protein_id gnl|my_center|LOCUS_12520 5098 4712 gene locus_tag LOCUS_12530 5098 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5521 5150 gene locus_tag LOCUS_12540 5521 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5929 5567 gene locus_tag LOCUS_12550 5929 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6262 5993 gene locus_tag LOCUS_12560 gene rpsO 6262 5993 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_12560 9534 6379 gene locus_tag LOCUS_12570 9534 6379 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373559.1 protein_id gnl|my_center|LOCUS_12570 10417 9551 gene locus_tag LOCUS_12580 gene truB 10417 9551 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 protein_id gnl|my_center|LOCUS_12580 10866 10459 gene locus_tag LOCUS_12590 10866 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11036 10960 gene locus_tag LOCUS_t00170 11036 10960 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11121 11045 gene locus_tag LOCUS_t00180 11121 11045 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 14060 11250 gene locus_tag LOCUS_12600 gene uvrA 14060 11250 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_12600 14361 14161 gene locus_tag LOCUS_12610 gene rpoZ 14361 14161 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728294.1 protein_id gnl|my_center|LOCUS_12610 15725 14451 gene locus_tag LOCUS_12620 15725 14451 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485262.1 protein_id gnl|my_center|LOCUS_12620 15881 16108 gene locus_tag LOCUS_12630 15881 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 16466 16128 gene locus_tag LOCUS_12640 16466 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 17941 16625 gene locus_tag LOCUS_12650 gene sufB 17941 16625 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118827.1 protein_id gnl|my_center|LOCUS_12650 18536 18093 gene locus_tag LOCUS_12660 gene sufU 18536 18093 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222809.1 protein_id gnl|my_center|LOCUS_12660 18672 18745 gene locus_tag LOCUS_t00190 18672 18745 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 406 333 gene locus_tag LOCUS_t00200 406 333 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 896 453 gene locus_tag LOCUS_12670 896 453 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_12670 1105 911 gene locus_tag LOCUS_12680 1105 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1392 1213 gene locus_tag LOCUS_12690 1392 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1544 1380 gene locus_tag LOCUS_12700 1544 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1691 1557 gene locus_tag LOCUS_12710 1691 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2131 1688 gene locus_tag LOCUS_12720 2131 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 4208 2124 gene locus_tag LOCUS_12730 4208 2124 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_12730 4813 4277 gene locus_tag LOCUS_12740 gene rsmD 4813 4277 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263796.1 protein_id gnl|my_center|LOCUS_12740 5043 4822 gene locus_tag LOCUS_12750 5043 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5417 5043 gene locus_tag LOCUS_12760 5417 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7967 5463 gene locus_tag LOCUS_12770 gene parC 7967 5463 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989723.1 protein_id gnl|my_center|LOCUS_12770 9879 7975 gene locus_tag LOCUS_12780 gene parE 9879 7975 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905666.1 protein_id gnl|my_center|LOCUS_12780 10881 9976 gene locus_tag LOCUS_12790 10881 9976 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681874.1 protein_id gnl|my_center|LOCUS_12790 11941 11042 gene locus_tag LOCUS_12800 11941 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 14452 12182 gene locus_tag LOCUS_12810 gene spoIIIE 14452 12182 CDS product DNA translocase SpoIIIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245350.1 protein_id gnl|my_center|LOCUS_12810 15073 14510 gene locus_tag LOCUS_12820 15073 14510 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987073.1 protein_id gnl|my_center|LOCUS_12820 15758 15093 gene locus_tag LOCUS_12830 15758 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence24 437 249 gene locus_tag LOCUS_12840 gene sspD 437 249 CDS product acid-soluble spore protein SspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218568.1 protein_id gnl|my_center|LOCUS_12840 751 542 gene locus_tag LOCUS_12850 gene sasP 751 542 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013338.1 protein_id gnl|my_center|LOCUS_12850 2005 830 gene locus_tag LOCUS_12860 gene thiI 2005 830 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830758.1 protein_id gnl|my_center|LOCUS_12860 2549 2010 gene locus_tag LOCUS_12870 2549 2010 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_12870 4365 2638 gene locus_tag LOCUS_12880 gene ezrA 4365 2638 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377302.1 protein_id gnl|my_center|LOCUS_12880 4667 4591 gene locus_tag LOCUS_t00210 4667 4591 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4751 4675 gene locus_tag LOCUS_t00220 4751 4675 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4859 4784 gene locus_tag LOCUS_t00230 4859 4784 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4944 4869 gene locus_tag LOCUS_t00240 4944 4869 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5025 4949 gene locus_tag LOCUS_t00250 5025 4949 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5129 5039 gene locus_tag LOCUS_t00260 5129 5039 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5223 5135 gene locus_tag LOCUS_t00270 5223 5135 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5435 5360 gene locus_tag LOCUS_t00280 5435 5360 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5519 5445 gene locus_tag LOCUS_t00290 5519 5445 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5616 5533 gene locus_tag LOCUS_t00300 5616 5533 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5695 5620 gene locus_tag LOCUS_t00310 5695 5620 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5775 5699 gene locus_tag LOCUS_t00320 5775 5699 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6180 5818 gene locus_tag LOCUS_12890 gene yugI 6180 5818 CDS product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722395.1 protein_id gnl|my_center|LOCUS_12890 6279 6506 gene locus_tag LOCUS_12900 6279 6506 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142871.1 protein_id gnl|my_center|LOCUS_12900 7406 6507 gene locus_tag LOCUS_12910 7406 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 8228 7458 gene locus_tag LOCUS_12920 8228 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 9641 8295 gene locus_tag LOCUS_12930 9641 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 10452 9628 gene locus_tag LOCUS_12940 gene cdaA 10452 9628 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115697.1 protein_id gnl|my_center|LOCUS_12940 11569 10496 gene locus_tag LOCUS_12950 11569 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 12140 11634 gene locus_tag LOCUS_12960 gene trmL 12140 11634 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829836.1 protein_id gnl|my_center|LOCUS_12960 12616 12140 gene locus_tag LOCUS_12970 12616 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 13631 12630 gene locus_tag LOCUS_12980 13631 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 14063 13632 gene locus_tag LOCUS_12990 14063 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 14599 14138 gene locus_tag LOCUS_13000 14599 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 14724 15167 gene locus_tag LOCUS_13010 14724 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence25 729 190 gene locus_tag LOCUS_13020 729 190 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_13020 1466 819 gene locus_tag LOCUS_13030 1466 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2115 1489 gene locus_tag LOCUS_13040 2115 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2248 2172 gene locus_tag LOCUS_t00330 2248 2172 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3828 2284 gene locus_tag LOCUS_13050 3828 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4379 3864 gene locus_tag LOCUS_13060 4379 3864 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459433.1 protein_id gnl|my_center|LOCUS_13060 5078 4521 gene locus_tag LOCUS_13070 5078 4521 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219823.1 protein_id gnl|my_center|LOCUS_13070 6560 5148 gene locus_tag LOCUS_13080 6560 5148 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_13080 7422 6616 gene locus_tag LOCUS_13090 7422 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 8308 7412 gene locus_tag LOCUS_13100 8308 7412 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_13100 8730 8311 gene locus_tag LOCUS_13110 8730 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 9438 8824 gene locus_tag LOCUS_13120 gene sigH 9438 8824 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 protein_id gnl|my_center|LOCUS_13120 10159 9461 gene locus_tag LOCUS_13130 gene rlmB 10159 9461 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093759.1 protein_id gnl|my_center|LOCUS_13130 10536 10162 gene locus_tag LOCUS_13140 10536 10162 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 protein_id gnl|my_center|LOCUS_13140 11413 10523 gene locus_tag LOCUS_13150 gene ylqF 11413 10523 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_13150 11932 11432 gene locus_tag LOCUS_13160 11932 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 12212 11925 gene locus_tag LOCUS_13170 12212 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 12589 12212 gene locus_tag LOCUS_13180 12589 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13180 >Feature sequence26 1850 528 gene locus_tag LOCUS_13190 gene engA 1850 528 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230565.1 protein_id gnl|my_center|LOCUS_13190 3883 1898 gene locus_tag LOCUS_13200 gene ligA 3883 1898 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_13200 5237 3864 gene locus_tag LOCUS_13210 5237 3864 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966567.1 protein_id gnl|my_center|LOCUS_13210 8155 5234 gene locus_tag LOCUS_13220 gene dnaE 8155 5234 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673740.1 protein_id gnl|my_center|LOCUS_13220 8282 8461 gene locus_tag LOCUS_13230 8282 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 9084 8506 gene locus_tag LOCUS_13240 9084 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 10204 9086 gene locus_tag LOCUS_13250 gene hemW 10204 9086 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914664.1 protein_id gnl|my_center|LOCUS_13250 12087 10246 gene locus_tag LOCUS_13260 12087 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 12383 12084 gene locus_tag LOCUS_13270 12383 12084 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence27 <1 621 gene locus_tag LOCUS_13280 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680773.1:Rpn family recombination-promoting nuclease/putative transposase 737 1708 gene locus_tag LOCUS_13290 737 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1712 2158 gene locus_tag LOCUS_13300 gene rplI 1712 2158 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288372.1 protein_id gnl|my_center|LOCUS_13300 2160 3503 gene locus_tag LOCUS_13310 gene dnaB 2160 3503 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_13310 3511 4959 gene locus_tag LOCUS_13320 3511 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 4959 5714 gene locus_tag LOCUS_13330 4959 5714 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985641.1 protein_id gnl|my_center|LOCUS_13330 5711 6166 gene locus_tag LOCUS_13340 gene rlmH 5711 6166 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966801.1 protein_id gnl|my_center|LOCUS_13340 6216 6740 gene locus_tag LOCUS_13350 6216 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6928 7458 gene locus_tag LOCUS_13360 6928 7458 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_13360 7535 8377 gene locus_tag LOCUS_13370 7535 8377 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829938.1 protein_id gnl|my_center|LOCUS_13370 8432 9688 gene locus_tag LOCUS_13380 8432 9688 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732525.1 protein_id gnl|my_center|LOCUS_13380 9755 10468 gene locus_tag LOCUS_13390 9755 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence28 1025 177 gene locus_tag LOCUS_13400 1025 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1895 1116 gene locus_tag LOCUS_13410 1895 1116 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986711.1 protein_id gnl|my_center|LOCUS_13410 3256 1952 gene locus_tag LOCUS_13420 gene murC 3256 1952 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296400.1 protein_id gnl|my_center|LOCUS_13420 3998 3291 gene locus_tag LOCUS_13430 3998 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 5517 4003 gene locus_tag LOCUS_13440 5517 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 6854 5529 gene locus_tag LOCUS_13450 6854 5529 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_13450 7626 6856 gene locus_tag LOCUS_13460 7626 6856 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890861.1 protein_id gnl|my_center|LOCUS_13460 8020 7631 gene locus_tag LOCUS_13470 8020 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 8351 8013 gene locus_tag LOCUS_13480 8351 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 8667 8467 gene locus_tag LOCUS_13490 8667 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence29 2444 150 gene locus_tag LOCUS_13500 2444 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3850 2951 gene locus_tag LOCUS_13510 3850 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4556 3837 gene locus_tag LOCUS_13520 4556 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 5346 4615 gene locus_tag LOCUS_13530 5346 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 7684 5339 gene locus_tag LOCUS_13540 gene lon 7684 5339 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence30 436 56 gene locus_tag LOCUS_13550 436 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1911 514 gene locus_tag LOCUS_13560 1911 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2063 1932 gene locus_tag LOCUS_13570 2063 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2827 2117 gene locus_tag LOCUS_13580 2827 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3841 2927 gene locus_tag LOCUS_13590 3841 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 4176 3931 gene locus_tag LOCUS_13600 4176 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence31 615 58 gene locus_tag LOCUS_13610 615 58 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775321.1 protein_id gnl|my_center|LOCUS_13610 1864 692 gene locus_tag LOCUS_13620 1864 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2015 2473 gene locus_tag LOCUS_13630 gene smpB 2015 2473 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700605.1 protein_id gnl|my_center|LOCUS_13630