>Feature sequence01 350 826 gene locus_tag LOCUS_00010 350 826 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106578.1 protein_id gnl|my_center|LOCUS_00010 851 1243 gene locus_tag LOCUS_00020 851 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1288 1467 gene locus_tag LOCUS_00030 1288 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1579 2583 gene locus_tag LOCUS_00040 1579 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4041 2665 gene locus_tag LOCUS_00050 4041 2665 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_00050 4228 5547 gene locus_tag LOCUS_00060 4228 5547 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_00060 5583 9131 gene locus_tag LOCUS_00070 5583 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9159 10394 gene locus_tag LOCUS_00080 9159 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10413 11192 gene locus_tag LOCUS_00090 10413 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11206 12306 gene locus_tag LOCUS_00100 11206 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12605 15241 gene locus_tag LOCUS_00110 12605 15241 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_00110 15311 15454 gene locus_tag LOCUS_00120 15311 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15477 16886 gene locus_tag LOCUS_00130 15477 16886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17076 17405 gene locus_tag LOCUS_00140 gene spoIIAA 17076 17405 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_00140 17415 17867 gene locus_tag LOCUS_00150 gene spoIIAB 17415 17867 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_00150 17875 18582 gene locus_tag LOCUS_00160 gene sigF 17875 18582 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_00160 18722 18841 gene locus_tag LOCUS_00170 18722 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18850 19476 gene locus_tag LOCUS_00180 18850 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19476 19913 gene locus_tag LOCUS_00190 19476 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20024 20482 gene locus_tag LOCUS_00200 gene spoVAC 20024 20482 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965602.1 protein_id gnl|my_center|LOCUS_00200 20582 22480 gene locus_tag LOCUS_00210 20582 22480 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_00210 24260 22746 gene locus_tag LOCUS_00220 24260 22746 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_00220 24532 25542 gene locus_tag LOCUS_00230 gene spoVAD 24532 25542 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965601.1 protein_id gnl|my_center|LOCUS_00230 25688 26041 gene locus_tag LOCUS_00240 gene spoVAE 25688 26041 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_00240 26251 27585 gene locus_tag LOCUS_00250 gene gdhA 26251 27585 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_00250 30240 27667 gene locus_tag LOCUS_00260 30240 27667 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806946.1 protein_id gnl|my_center|LOCUS_00260 30369 31007 gene locus_tag LOCUS_00270 30369 31007 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_00270 31209 33041 gene locus_tag LOCUS_00280 gene typA 31209 33041 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_00280 33901 33206 gene locus_tag LOCUS_00290 33901 33206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34070 34234 gene locus_tag LOCUS_00300 34070 34234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34231 35250 gene locus_tag LOCUS_00310 34231 35250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 35419 35346 gene locus_tag LOCUS_t00010 35419 35346 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35573 36631 gene locus_tag LOCUS_00320 35573 36631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36682 37290 gene locus_tag LOCUS_00330 36682 37290 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_00330 37293 38111 gene locus_tag LOCUS_00340 37293 38111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38126 40084 gene locus_tag LOCUS_00350 gene ligA 38126 40084 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015784.1 protein_id gnl|my_center|LOCUS_00350 40238 40612 gene locus_tag LOCUS_00360 40238 40612 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775014.1 protein_id gnl|my_center|LOCUS_00360 40609 41493 gene locus_tag LOCUS_00370 40609 41493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922156.1 protein_id gnl|my_center|LOCUS_00370 41483 43699 gene locus_tag LOCUS_00380 41483 43699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 43923 44948 gene locus_tag LOCUS_00390 43923 44948 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_00390 45011 45850 gene locus_tag LOCUS_00400 45011 45850 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_00400 45977 47161 gene locus_tag LOCUS_00410 45977 47161 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_00410 47273 48064 gene locus_tag LOCUS_00420 47273 48064 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_00420 48154 49026 gene locus_tag LOCUS_00430 48154 49026 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_00430 49060 50217 gene locus_tag LOCUS_00440 49060 50217 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_00440 50233 51021 gene locus_tag LOCUS_00450 50233 51021 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_00450 51041 52093 gene locus_tag LOCUS_00460 51041 52093 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_00460 52452 53822 gene locus_tag LOCUS_00470 52452 53822 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_00470 53946 55103 gene locus_tag LOCUS_00480 53946 55103 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_00480 55415 56761 gene locus_tag LOCUS_00490 55415 56761 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425390.1 protein_id gnl|my_center|LOCUS_00490 56903 57160 gene locus_tag LOCUS_00500 56903 57160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57160 59238 gene locus_tag LOCUS_00510 57160 59238 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_00510 59633 60196 gene locus_tag LOCUS_00520 59633 60196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 60256 60678 gene locus_tag LOCUS_00530 60256 60678 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_00530 60918 61832 gene locus_tag LOCUS_00540 gene ptb 60918 61832 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_00540 61876 62940 gene locus_tag LOCUS_00550 gene buk 61876 62940 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_00550 63103 64830 gene locus_tag LOCUS_00560 63103 64830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_00560 64831 66579 gene locus_tag LOCUS_00570 64831 66579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_00570 66592 68487 gene locus_tag LOCUS_00580 66592 68487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 69560 68484 gene locus_tag LOCUS_00590 69560 68484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 69664 69861 gene locus_tag LOCUS_00600 69664 69861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70079 71203 gene locus_tag LOCUS_00610 gene nifS 70079 71203 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_00610 72231 71464 gene locus_tag LOCUS_00620 72231 71464 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_00620 72485 73501 gene locus_tag LOCUS_00630 gene gap 72485 73501 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_00630 73623 74828 gene locus_tag LOCUS_00640 73623 74828 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_00640 75012 75761 gene locus_tag LOCUS_00650 gene tpiA 75012 75761 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_00650 76105 77646 gene locus_tag LOCUS_00660 gene gpmI 76105 77646 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_00660 77751 79085 gene locus_tag LOCUS_00670 77751 79085 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_00670 79408 80154 gene locus_tag LOCUS_00680 79408 80154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 80319 81191 gene locus_tag LOCUS_00690 80319 81191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 81320 82585 gene locus_tag LOCUS_00700 gene eno 81320 82585 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 protein_id gnl|my_center|LOCUS_00700 82871 83116 gene locus_tag LOCUS_00710 gene secG 82871 83116 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_00710 83329 85446 gene locus_tag LOCUS_00720 gene rnr 83329 85446 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_00720 85472 85930 gene locus_tag LOCUS_00730 gene smpB 85472 85930 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_00730 86021 87205 gene locus_tag LOCUS_00740 86021 87205 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_00740 87277 87456 gene locus_tag LOCUS_00750 87277 87456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 87744 88238 gene locus_tag LOCUS_00760 87744 88238 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074563.1 protein_id gnl|my_center|LOCUS_00760 88259 89617 gene locus_tag LOCUS_00770 88259 89617 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_00770 89701 90933 gene locus_tag LOCUS_00780 89701 90933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 91047 91850 gene locus_tag LOCUS_00790 91047 91850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 91941 92594 gene locus_tag LOCUS_00800 91941 92594 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383057.1 protein_id gnl|my_center|LOCUS_00800 92608 93393 gene locus_tag LOCUS_00810 92608 93393 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144055.1 protein_id gnl|my_center|LOCUS_00810 94028 95431 gene locus_tag LOCUS_00820 94028 95431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 95565 95783 gene locus_tag LOCUS_00830 95565 95783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 95991 96836 gene locus_tag LOCUS_00840 95991 96836 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_00840 97143 97637 gene locus_tag LOCUS_00850 gene folA 97143 97637 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261097.1 protein_id gnl|my_center|LOCUS_00850 97899 99173 gene locus_tag LOCUS_00860 gene sleC 97899 99173 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_00860 99547 100626 gene locus_tag LOCUS_00870 gene carA 99547 100626 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_00870 100619 103816 gene locus_tag LOCUS_00880 gene carB 100619 103816 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_00880 103825 104649 gene locus_tag LOCUS_00890 103825 104649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 104699 105928 gene locus_tag LOCUS_00900 104699 105928 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_00900 105957 107720 gene locus_tag LOCUS_00910 gene argS 105957 107720 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_00910 108133 107810 gene locus_tag LOCUS_00920 108133 107810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 108348 109004 gene locus_tag LOCUS_00930 108348 109004 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_00930 109006 109917 gene locus_tag LOCUS_00940 109006 109917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 109883 110896 gene locus_tag LOCUS_00950 109883 110896 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_00950 111493 111053 gene locus_tag LOCUS_00960 111493 111053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 111884 114016 gene locus_tag LOCUS_00970 111884 114016 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966127.1 protein_id gnl|my_center|LOCUS_00970 114976 114101 gene locus_tag LOCUS_00980 114976 114101 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_00980 115158 118322 gene locus_tag LOCUS_00990 115158 118322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 118338 118475 gene locus_tag LOCUS_01000 118338 118475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 118665 118739 gene locus_tag LOCUS_t00020 118665 118739 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 118795 118869 gene locus_tag LOCUS_t00030 118795 118869 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 118932 120146 gene locus_tag LOCUS_01010 gene pncB 118932 120146 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427809.1 protein_id gnl|my_center|LOCUS_01010 120203 120670 gene locus_tag LOCUS_01020 gene ispF 120203 120670 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_01020 120707 121618 gene locus_tag LOCUS_01030 120707 121618 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_01030 121773 122783 gene locus_tag LOCUS_01040 121773 122783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 122867 123493 gene locus_tag LOCUS_01050 gene cysE 122867 123493 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_01050 123516 124928 gene locus_tag LOCUS_01060 123516 124928 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_01060 124957 125406 gene locus_tag LOCUS_01070 124957 125406 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_01070 125412 126152 gene locus_tag LOCUS_01080 gene rlmB 125412 126152 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_01080 126341 127426 gene locus_tag LOCUS_01090 126341 127426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 127640 127568 gene locus_tag LOCUS_t00040 127640 127568 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 128082 128435 gene locus_tag LOCUS_01100 128082 128435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 128691 130106 gene locus_tag LOCUS_01110 128691 130106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 130063 130221 gene locus_tag LOCUS_01120 130063 130221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 130275 130430 gene locus_tag LOCUS_01130 130275 130430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 130555 131037 gene locus_tag LOCUS_01140 gene ilvN 130555 131037 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_01140 131100 132125 gene locus_tag LOCUS_01150 gene ilvC 131100 132125 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142651.1 protein_id gnl|my_center|LOCUS_01150 132505 132972 gene locus_tag LOCUS_01160 132505 132972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 132985 134649 gene locus_tag LOCUS_01170 132985 134649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 134985 135467 gene locus_tag LOCUS_01180 134985 135467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 135835 136395 gene locus_tag LOCUS_01190 135835 136395 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459747.1 protein_id gnl|my_center|LOCUS_01190 136405 137400 gene locus_tag LOCUS_01200 136405 137400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 138322 137414 gene locus_tag LOCUS_01210 138322 137414 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_01210 138518 138428 gene locus_tag LOCUS_t00050 138518 138428 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 138892 145038 gene locus_tag LOCUS_01220 138892 145038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 145261 146529 gene locus_tag LOCUS_01230 145261 146529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 146573 147613 gene locus_tag LOCUS_01240 146573 147613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 147830 149095 gene locus_tag LOCUS_01250 gene leuC 147830 149095 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_01250 149106 149591 gene locus_tag LOCUS_01260 gene leuD 149106 149591 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_01260 149604 151094 gene locus_tag LOCUS_01270 gene thrC 149604 151094 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_01270 151404 151979 gene locus_tag LOCUS_01280 gene yfbR 151404 151979 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158196.1 protein_id gnl|my_center|LOCUS_01280 152074 154200 gene locus_tag LOCUS_01290 152074 154200 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948909.1 protein_id gnl|my_center|LOCUS_01290 154200 156020 gene locus_tag LOCUS_01300 gene glmS 154200 156020 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_01300 156206 156865 gene locus_tag LOCUS_01310 156206 156865 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_01310 157332 158705 gene locus_tag LOCUS_01320 157332 158705 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583956.1 protein_id gnl|my_center|LOCUS_01320 159569 158706 gene locus_tag LOCUS_01330 159569 158706 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_01330 160262 161281 gene locus_tag LOCUS_01340 gene pheS 160262 161281 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_01340 161300 163717 gene locus_tag LOCUS_01350 gene pheT 161300 163717 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_01350 163915 164361 gene locus_tag LOCUS_01360 gene dtd 163915 164361 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_01360 164386 165447 gene locus_tag LOCUS_01370 gene queA 164386 165447 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965581.1 protein_id gnl|my_center|LOCUS_01370 165475 165891 gene locus_tag LOCUS_01380 165475 165891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 166115 167314 gene locus_tag LOCUS_01390 166115 167314 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_01390 167341 168618 gene locus_tag LOCUS_01400 gene aroA 167341 168618 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633771.1 protein_id gnl|my_center|LOCUS_01400 169921 168815 gene locus_tag LOCUS_01410 169921 168815 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230615.1 protein_id gnl|my_center|LOCUS_01410 170166 172253 gene locus_tag LOCUS_01420 gene fusA 170166 172253 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_01420 172712 174169 gene locus_tag LOCUS_01430 gene trpE 172712 174169 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_01430 174169 174741 gene locus_tag LOCUS_01440 174169 174741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01440 174752 175762 gene locus_tag LOCUS_01450 gene trpD 174752 175762 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_01450 175772 176557 gene locus_tag LOCUS_01460 gene trpC 175772 176557 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_01460 176550 177734 gene locus_tag LOCUS_01470 gene trpB 176550 177734 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_01470 177727 178497 gene locus_tag LOCUS_01480 gene trpA 177727 178497 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_01480 178507 179154 gene locus_tag LOCUS_01490 178507 179154 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_01490 179329 180717 gene locus_tag LOCUS_01500 179329 180717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 180780 183194 gene locus_tag LOCUS_01510 gene leuS 180780 183194 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 protein_id gnl|my_center|LOCUS_01510 183388 184068 gene locus_tag LOCUS_01520 183388 184068 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_01520 184046 184690 gene locus_tag LOCUS_01530 184046 184690 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_01530 184787 185758 gene locus_tag LOCUS_01540 184787 185758 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_01540 185935 186420 gene locus_tag LOCUS_01550 185935 186420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 186435 186677 gene locus_tag LOCUS_01560 186435 186677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 187013 186729 gene locus_tag LOCUS_01570 187013 186729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 187410 186988 gene locus_tag LOCUS_01580 187410 186988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 187842 187594 gene locus_tag LOCUS_01590 187842 187594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 187987 188898 gene locus_tag LOCUS_01600 187987 188898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 189140 190585 gene locus_tag LOCUS_01610 189140 190585 CDS product chromosome condensation protein RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966009.1 protein_id gnl|my_center|LOCUS_01610 190680 191894 gene locus_tag LOCUS_01620 190680 191894 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_01620 191947 193779 gene locus_tag LOCUS_01630 191947 193779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_01630 194941 194009 gene locus_tag LOCUS_01640 gene arcC 194941 194009 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 protein_id gnl|my_center|LOCUS_01640 196952 195039 gene locus_tag LOCUS_01650 196952 195039 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_01650 197100 197732 gene locus_tag LOCUS_01660 197100 197732 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_01660 197757 199235 gene locus_tag LOCUS_01670 197757 199235 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_01670 199253 200443 gene locus_tag LOCUS_01680 gene alr 199253 200443 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_01680 200581 200928 gene locus_tag LOCUS_01690 gene ndoA 200581 200928 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_01690 201008 201736 gene locus_tag LOCUS_01700 201008 201736 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_01700 201749 202486 gene locus_tag LOCUS_01710 201749 202486 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_01710 202718 203530 gene locus_tag LOCUS_01720 gene larE 202718 203530 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896918.1 protein_id gnl|my_center|LOCUS_01720 203634 204389 gene locus_tag LOCUS_01730 gene larB 203634 204389 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 protein_id gnl|my_center|LOCUS_01730 204406 205695 gene locus_tag LOCUS_01740 gene larC 204406 205695 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_01740 205700 206692 gene locus_tag LOCUS_01750 205700 206692 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_01750 206711 207478 gene locus_tag LOCUS_01760 gene cbiQ 206711 207478 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023913.1 protein_id gnl|my_center|LOCUS_01760 207517 208224 gene locus_tag LOCUS_01770 207517 208224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_01770 208853 208272 gene locus_tag LOCUS_01780 208853 208272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 209029 209508 gene locus_tag LOCUS_01790 gene rlmH 209029 209508 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 protein_id gnl|my_center|LOCUS_01790 210996 209716 gene locus_tag LOCUS_01800 210996 209716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 211178 212026 gene locus_tag LOCUS_01810 gene spoIIIAA 211178 212026 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_01810 212017 212535 gene locus_tag LOCUS_01820 212017 212535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 212552 212746 gene locus_tag LOCUS_01830 212552 212746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 212755 213135 gene locus_tag LOCUS_01840 212755 213135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 213150 214271 gene locus_tag LOCUS_01850 gene spoIIIAE 213150 214271 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965389.1 protein_id gnl|my_center|LOCUS_01850 214273 214608 gene locus_tag LOCUS_01860 214273 214608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 214722 215255 gene locus_tag LOCUS_01870 214722 215255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 215265 215867 gene locus_tag LOCUS_01880 215265 215867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 216257 215892 gene locus_tag LOCUS_01890 216257 215892 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_01890 216444 216656 gene locus_tag LOCUS_01900 216444 216656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 216680 216901 gene locus_tag LOCUS_01910 216680 216901 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427474.1 protein_id gnl|my_center|LOCUS_01910 216972 219104 gene locus_tag LOCUS_01920 gene feoB 216972 219104 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_01920 219487 220185 gene locus_tag LOCUS_01930 219487 220185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384767.1 protein_id gnl|my_center|LOCUS_01930 220197 222464 gene locus_tag LOCUS_01940 220197 222464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 224196 222592 gene locus_tag LOCUS_01950 224196 222592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 224540 224761 gene locus_tag LOCUS_01960 224540 224761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 225142 225993 gene locus_tag LOCUS_01970 225142 225993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 226009 227430 gene locus_tag LOCUS_01980 226009 227430 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_01980 227444 228847 gene locus_tag LOCUS_01990 227444 228847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 228862 229413 gene locus_tag LOCUS_02000 228862 229413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 229544 229915 gene locus_tag LOCUS_02010 229544 229915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 229977 230372 gene locus_tag LOCUS_02020 gene nusB 229977 230372 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_02020 230411 231625 gene locus_tag LOCUS_02030 gene xseA 230411 231625 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_02030 231615 231800 gene locus_tag LOCUS_02040 231615 231800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 231815 232705 gene locus_tag LOCUS_02050 231815 232705 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_02050 232742 234610 gene locus_tag LOCUS_02060 gene dxs 232742 234610 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_02060 234610 235419 gene locus_tag LOCUS_02070 234610 235419 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_02070 235429 236283 gene locus_tag LOCUS_02080 235429 236283 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_02080 236297 236746 gene locus_tag LOCUS_02090 236297 236746 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_02090 236778 238466 gene locus_tag LOCUS_02100 gene recN 236778 238466 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_02100 238546 239757 gene locus_tag LOCUS_02110 gene spoIVB 238546 239757 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_02110 239841 240593 gene locus_tag LOCUS_02120 239841 240593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 240814 241668 gene locus_tag LOCUS_02130 gene spo0A 240814 241668 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_02130 241700 243142 gene locus_tag LOCUS_02140 gene glgA 241700 243142 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_02140 244939 243203 gene locus_tag LOCUS_02150 244939 243203 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_02150 245153 246031 gene locus_tag LOCUS_02160 245153 246031 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_02160 246041 246670 gene locus_tag LOCUS_02170 gene gmk 246041 246670 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_02170 246670 246909 gene locus_tag LOCUS_02180 gene rpoZ 246670 246909 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965026.1 protein_id gnl|my_center|LOCUS_02180 246930 247175 gene locus_tag LOCUS_02190 246930 247175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 247280 248608 gene locus_tag LOCUS_02200 gene rimO 247280 248608 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_02200 248623 249159 gene locus_tag LOCUS_02210 gene pgsA 248623 249159 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_02210 249196 250479 gene locus_tag LOCUS_02220 249196 250479 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_02220 250845 251888 gene locus_tag LOCUS_02230 gene recA 250845 251888 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_02230 251881 252510 gene locus_tag LOCUS_02240 251881 252510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 252644 254197 gene locus_tag LOCUS_02250 gene rny 252644 254197 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_02250 254358 255152 gene locus_tag LOCUS_02260 gene proC 254358 255152 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360701.1 protein_id gnl|my_center|LOCUS_02260 255233 255769 gene locus_tag LOCUS_02270 255233 255769 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_02270 255849 256304 gene locus_tag LOCUS_02280 255849 256304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 256475 257377 gene locus_tag LOCUS_02290 gene xerD 256475 257377 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_02290 258554 257526 gene locus_tag LOCUS_02300 258554 257526 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_02300 258727 260898 gene locus_tag LOCUS_02310 258727 260898 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_02310 261006 262172 gene locus_tag LOCUS_02320 gene dacF 261006 262172 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_02320 262243 262986 gene locus_tag LOCUS_02330 262243 262986 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_02330 262995 263561 gene locus_tag LOCUS_02340 gene scpB 262995 263561 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_02340 263640 264932 gene locus_tag LOCUS_02350 263640 264932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 265042 265881 gene locus_tag LOCUS_02360 gene dapF 265042 265881 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_02360 265904 267379 gene locus_tag LOCUS_02370 265904 267379 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_02370 267405 269288 gene locus_tag LOCUS_02380 gene asnB 267405 269288 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_02380 269469 270881 gene locus_tag LOCUS_02390 269469 270881 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_02390 270891 271715 gene locus_tag LOCUS_02400 270891 271715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 271748 272110 gene locus_tag LOCUS_02410 271748 272110 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_02410 272138 273277 gene locus_tag LOCUS_02420 272138 273277 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_02420 273316 274722 gene locus_tag LOCUS_02430 273316 274722 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_02430 274836 276065 gene locus_tag LOCUS_02440 274836 276065 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_02440 276084 276740 gene locus_tag LOCUS_02450 gene cmk 276084 276740 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_02450 276768 277619 gene locus_tag LOCUS_02460 276768 277619 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_02460 277600 278712 gene locus_tag LOCUS_02470 gene rpsA 277600 278712 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_02470 278786 279346 gene locus_tag LOCUS_02480 gene rsmD 278786 279346 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_02480 279348 279845 gene locus_tag LOCUS_02490 gene coaD 279348 279845 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_02490 279838 280440 gene locus_tag LOCUS_02500 279838 280440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 280632 280964 gene locus_tag LOCUS_02510 280632 280964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 281725 282528 gene locus_tag LOCUS_02520 281725 282528 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_02520 282548 282820 gene locus_tag LOCUS_02530 282548 282820 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_02530 282871 284235 gene locus_tag LOCUS_02540 282871 284235 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_02540 285649 284432 gene locus_tag LOCUS_02550 285649 284432 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_02550 285762 286811 gene locus_tag LOCUS_02560 gene pta 285762 286811 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_02560 286826 288019 gene locus_tag LOCUS_02570 286826 288019 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_02570 288087 288611 gene locus_tag LOCUS_02580 288087 288611 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214224.1 protein_id gnl|my_center|LOCUS_02580 288615 288794 gene locus_tag LOCUS_02590 gene rpmF 288615 288794 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_02590 288991 290004 gene locus_tag LOCUS_02600 gene plsX 288991 290004 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_02600 290008 290241 gene locus_tag LOCUS_02610 gene acpP 290008 290241 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_02610 290295 290978 gene locus_tag LOCUS_02620 gene rncS 290295 290978 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 protein_id gnl|my_center|LOCUS_02620 291049 294609 gene locus_tag LOCUS_02630 gene smc 291049 294609 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_02630 294638 295555 gene locus_tag LOCUS_02640 gene ftsY 294638 295555 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_02640 295658 296878 gene locus_tag LOCUS_02650 gene ilvA 295658 296878 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_02650 297852 296971 gene locus_tag LOCUS_02660 297852 296971 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_02660 297984 300236 gene locus_tag LOCUS_02670 gene glgP 297984 300236 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_02670 300542 301834 gene locus_tag LOCUS_02680 300542 301834 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_02680 301938 302864 gene locus_tag LOCUS_02690 301938 302864 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_02690 302864 303790 gene locus_tag LOCUS_02700 302864 303790 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_02700 303815 305305 gene locus_tag LOCUS_02710 gene malQ 303815 305305 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_02710 305432 306460 gene locus_tag LOCUS_02720 gene ccpA 305432 306460 CDS product LacI family transcriptional regulator CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888871.1 protein_id gnl|my_center|LOCUS_02720 306473 307087 gene locus_tag LOCUS_02730 306473 307087 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068637.1 protein_id gnl|my_center|LOCUS_02730 307257 307589 gene locus_tag LOCUS_02740 307257 307589 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_02740 307601 308950 gene locus_tag LOCUS_02750 gene ffh 307601 308950 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_02750 308996 309241 gene locus_tag LOCUS_02760 gene rpsP 308996 309241 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813195.1 protein_id gnl|my_center|LOCUS_02760 309259 309486 gene locus_tag LOCUS_02770 309259 309486 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_02770 309557 310066 gene locus_tag LOCUS_02780 gene rimM 309557 310066 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_02780 310066 310794 gene locus_tag LOCUS_02790 gene trmD 310066 310794 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_02790 310890 311234 gene locus_tag LOCUS_02800 gene rplS 310890 311234 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_02800 311372 312208 gene locus_tag LOCUS_02810 gene ylqF 311372 312208 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_02810 312217 312975 gene locus_tag LOCUS_02820 312217 312975 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_02820 313090 313440 gene locus_tag LOCUS_02830 313090 313440 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 protein_id gnl|my_center|LOCUS_02830 313440 314288 gene locus_tag LOCUS_02840 gene pgeF 313440 314288 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 protein_id gnl|my_center|LOCUS_02840 314357 315679 gene locus_tag LOCUS_02850 gene der 314357 315679 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_02850 315701 316360 gene locus_tag LOCUS_02860 gene plsY 315701 316360 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_02860 316362 317372 gene locus_tag LOCUS_02870 316362 317372 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_02870 317415 318983 gene locus_tag LOCUS_02880 gene cls 317415 318983 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638280.1 protein_id gnl|my_center|LOCUS_02880 319039 320505 gene locus_tag LOCUS_02890 gene spoIVA 319039 320505 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_02890 320683 321909 gene locus_tag LOCUS_02900 gene tyrS 320683 321909 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_02900 321927 324566 gene locus_tag LOCUS_02910 gene alaS 321927 324566 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_02910 324676 324852 gene locus_tag LOCUS_02920 gene rpsU 324676 324852 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_02920 324970 325221 gene locus_tag LOCUS_02930 324970 325221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 325202 326413 gene locus_tag LOCUS_02940 gene yqfD 325202 326413 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_02940 326427 327437 gene locus_tag LOCUS_02950 326427 327437 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_02950 327457 327957 gene locus_tag LOCUS_02960 gene ybeY 327457 327957 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_02960 327957 329039 gene locus_tag LOCUS_02970 327957 329039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 329072 330727 gene locus_tag LOCUS_02980 329072 330727 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_02980 330812 331150 gene locus_tag LOCUS_02990 330812 331150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 331171 332340 gene locus_tag LOCUS_03000 331171 332340 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_03000 332340 333926 gene locus_tag LOCUS_03010 332340 333926 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 protein_id gnl|my_center|LOCUS_03010 334028 335215 gene locus_tag LOCUS_03020 334028 335215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 335218 335427 gene locus_tag LOCUS_03030 335218 335427 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 protein_id gnl|my_center|LOCUS_03030 335429 335971 gene locus_tag LOCUS_03040 335429 335971 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986919.1 protein_id gnl|my_center|LOCUS_03040 335984 337390 gene locus_tag LOCUS_03050 gene miaB 335984 337390 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_03050 337390 340080 gene locus_tag LOCUS_03060 gene mutS 337390 340080 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_03060 340093 341943 gene locus_tag LOCUS_03070 gene mutL 340093 341943 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_03070 341965 342912 gene locus_tag LOCUS_03080 gene miaA 341965 342912 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_03080 342916 344199 gene locus_tag LOCUS_03090 342916 344199 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_03090 344330 345016 gene locus_tag LOCUS_03100 gene radC 344330 345016 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_03100 345033 346064 gene locus_tag LOCUS_03110 345033 346064 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964555.1 protein_id gnl|my_center|LOCUS_03110 346089 346940 gene locus_tag LOCUS_03120 gene mreC 346089 346940 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_03120 346953 347486 gene locus_tag LOCUS_03130 346953 347486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 347476 350301 gene locus_tag LOCUS_03140 347476 350301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 350370 351164 gene locus_tag LOCUS_03150 gene minD 350370 351164 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_03150 351161 351406 gene locus_tag LOCUS_03160 351161 351406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 351406 352548 gene locus_tag LOCUS_03170 gene rodA 351406 352548 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 protein_id gnl|my_center|LOCUS_03170 352586 352984 gene locus_tag LOCUS_03180 gene mgsA 352586 352984 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_03180 353298 353086 gene locus_tag LOCUS_03190 353298 353086 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964294.1 protein_id gnl|my_center|LOCUS_03190 353559 354941 gene locus_tag LOCUS_03200 353559 354941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 355079 355771 gene locus_tag LOCUS_03210 355079 355771 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_03210 355793 356365 gene locus_tag LOCUS_03220 355793 356365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 356374 357129 gene locus_tag LOCUS_03230 356374 357129 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_03230 357142 358257 gene locus_tag LOCUS_03240 gene aroB 357142 358257 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_03240 358250 358780 gene locus_tag LOCUS_03250 gene lspA 358250 358780 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965414.1 protein_id gnl|my_center|LOCUS_03250 358830 359741 gene locus_tag LOCUS_03260 358830 359741 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_03260 359953 360660 gene locus_tag LOCUS_03270 359953 360660 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_03270 360677 361735 gene locus_tag LOCUS_03280 360677 361735 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_03280 362321 361941 gene locus_tag LOCUS_03290 362321 361941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 362649 363266 gene locus_tag LOCUS_03300 gene lexA 362649 363266 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 protein_id gnl|my_center|LOCUS_03300 364784 363462 gene locus_tag LOCUS_03310 364784 363462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 366161 364854 gene locus_tag LOCUS_03320 366161 364854 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_03320 366519 366172 gene locus_tag LOCUS_03330 gene rsfS 366519 366172 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_03330 367700 366516 gene locus_tag LOCUS_03340 367700 366516 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183272.1 protein_id gnl|my_center|LOCUS_03340 368034 367741 gene locus_tag LOCUS_03350 gene yhbY 368034 367741 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_03350 369394 368111 gene locus_tag LOCUS_03360 gene obgE 369394 368111 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_03360 369780 369496 gene locus_tag LOCUS_03370 gene rpmA 369780 369496 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 protein_id gnl|my_center|LOCUS_03370 370106 369783 gene locus_tag LOCUS_03380 370106 369783 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289451.1 protein_id gnl|my_center|LOCUS_03380 370419 370120 gene locus_tag LOCUS_03390 gene rplU 370419 370120 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_03390 371789 370614 gene locus_tag LOCUS_03400 371789 370614 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964047.1 protein_id gnl|my_center|LOCUS_03400 372528 371830 gene locus_tag LOCUS_03410 372528 371830 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_03410 374059 372614 gene locus_tag LOCUS_03420 374059 372614 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582720.1 protein_id gnl|my_center|LOCUS_03420 375717 374056 gene locus_tag LOCUS_03430 375717 374056 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_03430 377405 375831 gene locus_tag LOCUS_03440 377405 375831 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_03440 378549 377437 gene locus_tag LOCUS_03450 378549 377437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 379213 378542 gene locus_tag LOCUS_03460 379213 378542 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_03460 381065 379197 gene locus_tag LOCUS_03470 381065 379197 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_03470 381404 382075 gene locus_tag LOCUS_03480 381404 382075 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 protein_id gnl|my_center|LOCUS_03480 383429 382212 gene locus_tag LOCUS_03490 383429 382212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 384016 383429 gene locus_tag LOCUS_03500 gene hisB 384016 383429 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_03500 385332 384037 gene locus_tag LOCUS_03510 gene hisD 385332 384037 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_03510 386069 385434 gene locus_tag LOCUS_03520 gene hisG 386069 385434 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_03520 387278 386079 gene locus_tag LOCUS_03530 387278 386079 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_03530 387894 387349 gene locus_tag LOCUS_03540 gene recU 387894 387349 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_03540 388865 387906 gene locus_tag LOCUS_03550 388865 387906 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_03550 389600 388896 gene locus_tag LOCUS_03560 389600 388896 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217125.1 protein_id gnl|my_center|LOCUS_03560 390067 389630 gene locus_tag LOCUS_03570 390067 389630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 390459 390088 gene locus_tag LOCUS_03580 390459 390088 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964577.1 protein_id gnl|my_center|LOCUS_03580 391391 390558 gene locus_tag LOCUS_03590 391391 390558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 393337 391445 gene locus_tag LOCUS_03600 393337 391445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_03600 395136 393337 gene locus_tag LOCUS_03610 395136 393337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_03610 395618 395130 gene locus_tag LOCUS_03620 395618 395130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 396326 395754 gene locus_tag LOCUS_03630 gene coaE 396326 395754 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_03630 398972 396336 gene locus_tag LOCUS_03640 gene polA 398972 396336 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_03640 399335 398994 gene locus_tag LOCUS_03650 399335 398994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 399674 399375 gene locus_tag LOCUS_03660 399674 399375 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_03660 399817 399734 gene locus_tag LOCUS_t00060 399817 399734 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 401448 399886 gene locus_tag LOCUS_03670 401448 399886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 402144 401533 gene locus_tag LOCUS_03680 402144 401533 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_03680 402644 402186 gene locus_tag LOCUS_03690 402644 402186 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_03690 404244 402757 gene locus_tag LOCUS_03700 404244 402757 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_03700 405598 404177 gene locus_tag LOCUS_03710 405598 404177 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_03710 407871 405613 gene locus_tag LOCUS_03720 407871 405613 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_03720 408339 407941 gene locus_tag LOCUS_03730 408339 407941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 409608 408439 gene locus_tag LOCUS_03740 409608 408439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 410652 409654 gene locus_tag LOCUS_03750 gene ruvB 410652 409654 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_03750 411342 410755 gene locus_tag LOCUS_03760 gene ruvA 411342 410755 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_03760 411585 412601 gene locus_tag LOCUS_03770 411585 412601 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_03770 414117 412681 gene locus_tag LOCUS_03780 414117 412681 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_03780 414987 414172 gene locus_tag LOCUS_03790 414987 414172 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_03790 415574 414999 gene locus_tag LOCUS_03800 gene rsxA 415574 414999 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_03800 416258 415575 gene locus_tag LOCUS_03810 416258 415575 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_03810 416899 416258 gene locus_tag LOCUS_03820 416899 416258 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_03820 417884 416901 gene locus_tag LOCUS_03830 417884 416901 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_03830 419200 417887 gene locus_tag LOCUS_03840 gene rsxC 419200 417887 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_03840 422518 419570 gene locus_tag LOCUS_03850 422518 419570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 422930 424042 gene locus_tag LOCUS_03860 422930 424042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 424272 424072 gene locus_tag LOCUS_03870 424272 424072 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_03870 425765 424404 gene locus_tag LOCUS_03880 425765 424404 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_03880 426825 425797 gene locus_tag LOCUS_03890 426825 425797 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_03890 428894 426870 gene locus_tag LOCUS_03900 gene recG 428894 426870 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986837.1 protein_id gnl|my_center|LOCUS_03900 431823 429175 gene locus_tag LOCUS_03910 431823 429175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 433736 432114 gene locus_tag LOCUS_03920 gene groL 433736 432114 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_03920 434061 433777 gene locus_tag LOCUS_03930 gene groES 434061 433777 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_03930 435094 434222 gene locus_tag LOCUS_03940 435094 434222 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048247.1 protein_id gnl|my_center|LOCUS_03940 435402 435986 gene locus_tag LOCUS_03950 435402 435986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 437808 436111 gene locus_tag LOCUS_03960 437808 436111 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_03960 438741 438067 gene locus_tag LOCUS_03970 438741 438067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 439213 438866 gene locus_tag LOCUS_03980 439213 438866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 444285 439501 gene locus_tag LOCUS_03990 444285 439501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 444444 445256 gene locus_tag LOCUS_04000 gene dpsA 444444 445256 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_04000 445246 445851 gene locus_tag LOCUS_04010 445246 445851 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429956.1 protein_id gnl|my_center|LOCUS_04010 445872 447716 gene locus_tag LOCUS_04020 gene asnB 445872 447716 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_04020 <449598 448038 gene locus_tag LOCUS_04030 <449598 448038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674041.1:family 20 glycosylhydrolase >Feature sequence02 918 790 gene locus_tag LOCUS_04040 918 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 3603 994 gene locus_tag LOCUS_04050 3603 994 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_04050 3789 5378 gene locus_tag LOCUS_04060 3789 5378 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_04060 6461 5451 gene locus_tag LOCUS_04070 6461 5451 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_04070 7166 6474 gene locus_tag LOCUS_04080 7166 6474 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_04080 9841 7283 gene locus_tag LOCUS_04090 9841 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 11369 10275 gene locus_tag LOCUS_04100 gene asd 11369 10275 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_04100 11899 11453 gene locus_tag LOCUS_04110 11899 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 12459 11914 gene locus_tag LOCUS_04120 12459 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 12557 12485 gene locus_tag LOCUS_t00070 12557 12485 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14396 12624 gene locus_tag LOCUS_04130 gene uidA 14396 12624 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583888.1 protein_id gnl|my_center|LOCUS_04130 19656 14509 gene locus_tag LOCUS_04140 19656 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 20619 19897 gene locus_tag LOCUS_04150 20619 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04150 22242 20692 gene locus_tag LOCUS_04160 22242 20692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04160 23218 22271 gene locus_tag LOCUS_04170 23218 22271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 25325 23253 gene locus_tag LOCUS_04180 25325 23253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 27811 25445 gene locus_tag LOCUS_04190 27811 25445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 28168 28659 gene locus_tag LOCUS_04200 28168 28659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 28961 30949 gene locus_tag LOCUS_04210 gene htpG 28961 30949 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_04210 32092 31136 gene locus_tag LOCUS_04220 32092 31136 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_04220 32300 33670 gene locus_tag LOCUS_04230 gene argH 32300 33670 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_04230 35154 33865 gene locus_tag LOCUS_04240 35154 33865 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_04240 36275 35178 gene locus_tag LOCUS_04250 36275 35178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 36666 36262 gene locus_tag LOCUS_04260 36666 36262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 37629 36736 gene locus_tag LOCUS_04270 gene mscS 37629 36736 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_04270 38867 37704 gene locus_tag LOCUS_04280 38867 37704 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_04280 40017 38935 gene locus_tag LOCUS_04290 gene serC 40017 38935 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_04290 41765 40074 gene locus_tag LOCUS_04300 gene ilvB 41765 40074 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_04300 43451 41784 gene locus_tag LOCUS_04310 gene ilvD 43451 41784 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_04310 44552 43470 gene locus_tag LOCUS_04320 gene leuB 44552 43470 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_04320 45004 44819 gene locus_tag LOCUS_04330 45004 44819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 45932 45630 gene locus_tag LOCUS_04340 45932 45630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 47080 45944 gene locus_tag LOCUS_04350 gene tgt 47080 45944 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_04350 47229 48326 gene locus_tag LOCUS_04360 gene aroC 47229 48326 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_04360 48902 48498 gene locus_tag LOCUS_04370 48902 48498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 50403 49162 gene locus_tag LOCUS_04380 50403 49162 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532252.1 protein_id gnl|my_center|LOCUS_04380 51450 50539 gene locus_tag LOCUS_04390 51450 50539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 51562 52320 gene locus_tag LOCUS_04400 51562 52320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 53627 52311 gene locus_tag LOCUS_04410 53627 52311 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_04410 54294 53650 gene locus_tag LOCUS_04420 54294 53650 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_04420 56216 54420 gene locus_tag LOCUS_04430 gene aspS 56216 54420 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_04430 57576 56317 gene locus_tag LOCUS_04440 57576 56317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 59092 57653 gene locus_tag LOCUS_04450 59092 57653 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_04450 59619 59092 gene locus_tag LOCUS_04460 59619 59092 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_04460 62320 60041 gene locus_tag LOCUS_04470 62320 60041 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_04470 62868 62344 gene locus_tag LOCUS_04480 62868 62344 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_04480 64647 62893 gene locus_tag LOCUS_04490 gene recJ 64647 62893 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_04490 66957 64723 gene locus_tag LOCUS_04500 66957 64723 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_04500 68397 67036 gene locus_tag LOCUS_04510 gene scfB 68397 67036 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_04510 68619 68479 gene locus_tag LOCUS_04520 gene scfA 68619 68479 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_04520 69135 68779 gene locus_tag LOCUS_04530 69135 68779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 69317 70624 gene locus_tag LOCUS_04540 69317 70624 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_04540 72244 70724 gene locus_tag LOCUS_04550 72244 70724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 72371 72225 gene locus_tag LOCUS_04560 72371 72225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 72926 72594 gene locus_tag LOCUS_04570 72926 72594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 73274 73089 gene locus_tag LOCUS_04580 73274 73089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 73656 73213 gene locus_tag LOCUS_04590 73656 73213 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_04590 74567 73650 gene locus_tag LOCUS_04600 gene pyrB 74567 73650 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_04600 74694 75524 gene locus_tag LOCUS_04610 74694 75524 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_04610 77651 75996 gene locus_tag LOCUS_04620 77651 75996 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_04620 78288 77644 gene locus_tag LOCUS_04630 78288 77644 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_04630 80089 78329 gene locus_tag LOCUS_04640 gene dnaG 80089 78329 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_04640 81117 80110 gene locus_tag LOCUS_04650 81117 80110 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_04650 81315 81401 gene locus_tag LOCUS_t00080 81315 81401 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 81411 81496 gene locus_tag LOCUS_t00090 81411 81496 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 82164 81556 gene locus_tag LOCUS_04660 82164 81556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 84353 82164 gene locus_tag LOCUS_04670 84353 82164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 85408 84353 gene locus_tag LOCUS_04680 85408 84353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_04680 85944 85588 gene locus_tag LOCUS_04690 gene rplT 85944 85588 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_04690 86164 85967 gene locus_tag LOCUS_04700 gene rpmI 86164 85967 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_04700 86689 86195 gene locus_tag LOCUS_04710 gene infC 86689 86195 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_04710 87260 86934 gene locus_tag LOCUS_04720 87260 86934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 89413 87461 gene locus_tag LOCUS_04730 gene thrS 89413 87461 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_04730 91078 89987 gene locus_tag LOCUS_04740 91078 89987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 92553 91471 gene locus_tag LOCUS_04750 92553 91471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 93945 92668 gene locus_tag LOCUS_04760 93945 92668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 95577 94123 gene locus_tag LOCUS_04770 gene guaB 95577 94123 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_04770 96241 95741 gene locus_tag LOCUS_04780 96241 95741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 97928 96252 gene locus_tag LOCUS_04790 97928 96252 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_04790 98315 97956 gene locus_tag LOCUS_04800 98315 97956 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_04800 98635 98450 gene locus_tag LOCUS_04810 gene rpmB 98635 98450 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_04810 101179 98765 gene locus_tag LOCUS_04820 101179 98765 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_04820 101875 101207 gene locus_tag LOCUS_04830 101875 101207 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_04830 102896 102027 gene locus_tag LOCUS_04840 gene metF 102896 102027 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_04840 103470 103129 gene locus_tag LOCUS_04850 103470 103129 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966538.1 protein_id gnl|my_center|LOCUS_04850 104491 103508 gene locus_tag LOCUS_04860 104491 103508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 104812 104495 gene locus_tag LOCUS_04870 104812 104495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 106219 104834 gene locus_tag LOCUS_04880 106219 104834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 107495 106239 gene locus_tag LOCUS_04890 107495 106239 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_04890 109012 107519 gene locus_tag LOCUS_04900 gene malQ 109012 107519 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_04900 109894 109028 gene locus_tag LOCUS_04910 109894 109028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 110098 114342 gene locus_tag LOCUS_04920 110098 114342 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_04920 116023 114734 gene locus_tag LOCUS_04930 116023 114734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 117268 116519 gene locus_tag LOCUS_04940 gene glcR 117268 116519 CDS product transcriptional regulator GlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244075.1 protein_id gnl|my_center|LOCUS_04940 117856 117665 gene locus_tag LOCUS_04950 117856 117665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 118951 118277 gene locus_tag LOCUS_04960 118951 118277 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_04960 120016 119114 gene locus_tag LOCUS_04970 120016 119114 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_04970 120846 120085 gene locus_tag LOCUS_04980 gene hisF 120846 120085 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_04980 121464 120856 gene locus_tag LOCUS_04990 gene hisH 121464 120856 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496519.1 protein_id gnl|my_center|LOCUS_04990 122958 121480 gene locus_tag LOCUS_05000 122958 121480 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_05000 123681 123004 gene locus_tag LOCUS_05010 123681 123004 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_05010 124809 123871 gene locus_tag LOCUS_05020 124809 123871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 125896 124943 gene locus_tag LOCUS_05030 125896 124943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 127025 125991 gene locus_tag LOCUS_05040 127025 125991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 127156 127485 gene locus_tag LOCUS_05050 127156 127485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 128026 127690 gene locus_tag LOCUS_tm00010 128026 127690 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 128378 128857 gene locus_tag LOCUS_05060 128378 128857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 129626 128832 gene locus_tag LOCUS_05070 129626 128832 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_05070 130777 129797 gene locus_tag LOCUS_05080 130777 129797 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964544.1 protein_id gnl|my_center|LOCUS_05080 132247 130844 gene locus_tag LOCUS_05090 132247 130844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 132959 132264 gene locus_tag LOCUS_05100 132959 132264 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 protein_id gnl|my_center|LOCUS_05100 135479 133032 gene locus_tag LOCUS_05110 135479 133032 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254445.1 protein_id gnl|my_center|LOCUS_05110 137544 135871 gene locus_tag LOCUS_05120 137544 135871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 138614 137616 gene locus_tag LOCUS_05130 138614 137616 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_05130 139215 138583 gene locus_tag LOCUS_05140 139215 138583 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974308.1 protein_id gnl|my_center|LOCUS_05140 140275 139358 gene locus_tag LOCUS_05150 140275 139358 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_05150 141013 140285 gene locus_tag LOCUS_05160 141013 140285 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_05160 142016 141006 gene locus_tag LOCUS_05170 142016 141006 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_05170 145652 142092 gene locus_tag LOCUS_05180 gene addA 145652 142092 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948198.1 protein_id gnl|my_center|LOCUS_05180 149075 145653 gene locus_tag LOCUS_05190 gene addB 149075 145653 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_05190 149192 149629 gene locus_tag LOCUS_05200 149192 149629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 151766 149727 gene locus_tag LOCUS_05210 151766 149727 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_05210 153211 151901 gene locus_tag LOCUS_05220 153211 151901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 153964 153227 gene locus_tag LOCUS_05230 gene rgbR 153964 153227 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_05230 154400 154251 gene locus_tag LOCUS_05240 154400 154251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 154854 154447 gene locus_tag LOCUS_05250 154854 154447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 155366 154974 gene locus_tag LOCUS_05260 155366 154974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 155575 155363 gene locus_tag LOCUS_05270 155575 155363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 155947 155600 gene locus_tag LOCUS_05280 155947 155600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 156950 156381 gene locus_tag LOCUS_05290 156950 156381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 157955 157188 gene locus_tag LOCUS_05300 gene cwlC 157955 157188 CDS product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244862.1 protein_id gnl|my_center|LOCUS_05300 158514 158188 gene locus_tag LOCUS_05310 158514 158188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 159365 158610 gene locus_tag LOCUS_05320 gene dapB 159365 158610 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_05320 160356 159472 gene locus_tag LOCUS_05330 gene dapA 160356 159472 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965674.1 protein_id gnl|my_center|LOCUS_05330 162039 160738 gene locus_tag LOCUS_05340 162039 160738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 163710 162238 gene locus_tag LOCUS_05350 163710 162238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 165277 163733 gene locus_tag LOCUS_05360 165277 163733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 166810 165434 gene locus_tag LOCUS_05370 166810 165434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 168063 166894 gene locus_tag LOCUS_05380 168063 166894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 170140 168422 gene locus_tag LOCUS_05390 170140 168422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 170996 170367 gene locus_tag LOCUS_05400 170996 170367 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_05400 172053 171181 gene locus_tag LOCUS_05410 172053 171181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 173089 172160 gene locus_tag LOCUS_05420 173089 172160 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476165.1 protein_id gnl|my_center|LOCUS_05420 173811 173254 gene locus_tag LOCUS_05430 gene efp 173811 173254 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_05430 175123 173891 gene locus_tag LOCUS_05440 175123 173891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 175249 176121 gene locus_tag LOCUS_05450 175249 176121 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_05450 176765 176256 gene locus_tag LOCUS_05460 176765 176256 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524903.1 protein_id gnl|my_center|LOCUS_05460 177235 176786 gene locus_tag LOCUS_05470 gene nrdR 177235 176786 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_05470 177669 177409 gene locus_tag LOCUS_05480 177669 177409 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_05480 178620 177844 gene locus_tag LOCUS_05490 gene sigG 178620 177844 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_05490 179484 178747 gene locus_tag LOCUS_05500 gene sigE 179484 178747 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_05500 180163 179378 gene locus_tag LOCUS_05510 gene spoIIGA 180163 179378 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_05510 181639 180512 gene locus_tag LOCUS_05520 gene ftsZ 181639 180512 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_05520 182545 181751 gene locus_tag LOCUS_05530 182545 181751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 183735 182554 gene locus_tag LOCUS_05540 gene spoVE 183735 182554 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_05540 185200 183845 gene locus_tag LOCUS_05550 gene murD 185200 183845 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_05550 186191 185211 gene locus_tag LOCUS_05560 gene mraY 186191 185211 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_05560 187926 186193 gene locus_tag LOCUS_05570 187926 186193 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 protein_id gnl|my_center|LOCUS_05570 189824 187956 gene locus_tag LOCUS_05580 189824 187956 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_05580 190288 189827 gene locus_tag LOCUS_05590 190288 189827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 191226 190291 gene locus_tag LOCUS_05600 gene rsmH 191226 190291 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_05600 191700 191251 gene locus_tag LOCUS_05610 gene mraZ 191700 191251 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_05610 193042 192143 gene locus_tag LOCUS_05620 gene lgt 193042 192143 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_05620 193269 194366 gene locus_tag LOCUS_05630 gene ychF 193269 194366 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_05630 195194 194556 gene locus_tag LOCUS_05640 195194 194556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 196016 195354 gene locus_tag LOCUS_05650 gene rpe 196016 195354 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_05650 197039 196116 gene locus_tag LOCUS_05660 gene rsgA 197039 196116 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_05660 199084 197072 gene locus_tag LOCUS_05670 gene pknB 199084 197072 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_05670 199840 199088 gene locus_tag LOCUS_05680 gene prpC 199840 199088 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_05680 200891 199833 gene locus_tag LOCUS_05690 gene rlmN 200891 199833 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_05690 202241 200901 gene locus_tag LOCUS_05700 gene rsmB 202241 200901 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_05700 202941 202234 gene locus_tag LOCUS_05710 202941 202234 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_05710 203949 203029 gene locus_tag LOCUS_05720 gene fmt 203949 203029 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_05720 204456 203962 gene locus_tag LOCUS_05730 gene def 204456 203962 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_05730 206700 204472 gene locus_tag LOCUS_05740 gene priA 206700 204472 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965028.1 protein_id gnl|my_center|LOCUS_05740 207648 206803 gene locus_tag LOCUS_05750 gene folD 207648 206803 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_05750 208965 207880 gene locus_tag LOCUS_05760 208965 207880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 211298 208968 gene locus_tag LOCUS_05770 211298 208968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 213184 211514 gene locus_tag LOCUS_05780 213184 211514 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048375.1 protein_id gnl|my_center|LOCUS_05780 215844 213196 gene locus_tag LOCUS_05790 215844 213196 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438328.1 protein_id gnl|my_center|LOCUS_05790 216716 216069 gene locus_tag LOCUS_05800 216716 216069 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388341.1 protein_id gnl|my_center|LOCUS_05800 217577 216807 gene locus_tag LOCUS_05810 217577 216807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 218875 217601 gene locus_tag LOCUS_05820 218875 217601 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_05820 219113 218910 gene locus_tag LOCUS_05830 219113 218910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 221344 219278 gene locus_tag LOCUS_05840 gene pnp 221344 219278 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_05840 221857 221591 gene locus_tag LOCUS_05850 gene rpsO 221857 221591 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_05850 222743 222021 gene locus_tag LOCUS_05860 222743 222021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 223532 222855 gene locus_tag LOCUS_05870 223532 222855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 224099 223593 gene locus_tag LOCUS_05880 224099 223593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 225163 224270 gene locus_tag LOCUS_05890 225163 224270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 226203 225292 gene locus_tag LOCUS_05900 226203 225292 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_05900 227193 226282 gene locus_tag LOCUS_05910 gene truB 227193 226282 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_05910 228170 227226 gene locus_tag LOCUS_05920 228170 227226 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_05920 228533 228180 gene locus_tag LOCUS_05930 gene rbfA 228533 228180 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_05930 231658 228650 gene locus_tag LOCUS_05940 231658 228650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 231977 231672 gene locus_tag LOCUS_05950 231977 231672 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419470.1 protein_id gnl|my_center|LOCUS_05950 232245 231970 gene locus_tag LOCUS_05960 232245 231970 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965106.1 protein_id gnl|my_center|LOCUS_05960 233440 232256 gene locus_tag LOCUS_05970 gene nusA 233440 232256 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_05970 233923 233456 gene locus_tag LOCUS_05980 gene rimP 233923 233456 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288499.1 protein_id gnl|my_center|LOCUS_05980 234912 234097 gene locus_tag LOCUS_05990 234912 234097 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228103.1 protein_id gnl|my_center|LOCUS_05990 235066 235138 gene locus_tag LOCUS_t00100 235066 235138 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 240314 235794 gene locus_tag LOCUS_06000 gene polC 240314 235794 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_06000 241371 240316 gene locus_tag LOCUS_06010 gene ispG 241371 240316 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_06010 242780 241476 gene locus_tag LOCUS_06020 gene rseP 242780 241476 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680259.1 protein_id gnl|my_center|LOCUS_06020 243925 242783 gene locus_tag LOCUS_06030 243925 242783 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_06030 244761 243937 gene locus_tag LOCUS_06040 244761 243937 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_06040 245489 244761 gene locus_tag LOCUS_06050 245489 244761 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_06050 246112 245558 gene locus_tag LOCUS_06060 gene frr 246112 245558 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 protein_id gnl|my_center|LOCUS_06060 246837 246139 gene locus_tag LOCUS_06070 gene pyrH 246837 246139 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_06070 247203 248369 gene locus_tag LOCUS_06080 247203 248369 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_06080 249406 248549 gene locus_tag LOCUS_06090 249406 248549 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948584.1 protein_id gnl|my_center|LOCUS_06090 249651 249532 gene locus_tag LOCUS_06100 249651 249532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 250333 249695 gene locus_tag LOCUS_06110 250333 249695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 251626 250352 gene locus_tag LOCUS_06120 251626 250352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157309541.1 protein_id gnl|my_center|LOCUS_06120 252830 251772 gene locus_tag LOCUS_06130 252830 251772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 253587 253252 gene locus_tag LOCUS_06140 253587 253252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 255105 253741 gene locus_tag LOCUS_06150 255105 253741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 255422 256045 gene locus_tag LOCUS_06160 255422 256045 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_06160 256058 257323 gene locus_tag LOCUS_06170 256058 257323 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_06170 257398 257730 gene locus_tag LOCUS_06180 257398 257730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 258427 257825 gene locus_tag LOCUS_06190 258427 257825 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 protein_id gnl|my_center|LOCUS_06190 259221 258574 gene locus_tag LOCUS_06200 259221 258574 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_06200 260635 259295 gene locus_tag LOCUS_06210 260635 259295 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_06210 262135 260678 gene locus_tag LOCUS_06220 262135 260678 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_06220 263507 262149 gene locus_tag LOCUS_06230 gene trkA 263507 262149 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_06230 264236 263592 gene locus_tag LOCUS_06240 264236 263592 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_06240 265206 264475 gene locus_tag LOCUS_06250 265206 264475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 265574 265224 gene locus_tag LOCUS_06260 265574 265224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 266945 265797 gene locus_tag LOCUS_06270 266945 265797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 267713 266946 gene locus_tag LOCUS_06280 267713 266946 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_06280 268406 267879 gene locus_tag LOCUS_06290 268406 267879 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_06290 269316 268498 gene locus_tag LOCUS_06300 269316 268498 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 protein_id gnl|my_center|LOCUS_06300 271122 269329 gene locus_tag LOCUS_06310 271122 269329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 272464 271265 gene locus_tag LOCUS_06320 272464 271265 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_06320 272993 272502 gene locus_tag LOCUS_06330 272993 272502 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641270.1 protein_id gnl|my_center|LOCUS_06330 273417 273025 gene locus_tag LOCUS_06340 273417 273025 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948150.1 protein_id gnl|my_center|LOCUS_06340 273542 273417 gene locus_tag LOCUS_06350 273542 273417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 274247 273756 gene locus_tag LOCUS_06360 274247 273756 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_06360 275177 274263 gene locus_tag LOCUS_06370 275177 274263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 275334 275113 gene locus_tag LOCUS_06380 275334 275113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 276392 275979 gene locus_tag LOCUS_06390 276392 275979 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_06390 277784 276396 gene locus_tag LOCUS_06400 gene atpD 277784 276396 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161587876.1 protein_id gnl|my_center|LOCUS_06400 278683 277799 gene locus_tag LOCUS_06410 gene atpG 278683 277799 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_06410 280286 278778 gene locus_tag LOCUS_06420 gene atpA 280286 278778 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_06420 280810 280292 gene locus_tag LOCUS_06430 280810 280292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 281240 280788 gene locus_tag LOCUS_06440 281240 280788 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_06440 281497 281267 gene locus_tag LOCUS_06450 gene atpE 281497 281267 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421370.1 protein_id gnl|my_center|LOCUS_06450 282227 281541 gene locus_tag LOCUS_06460 282227 281541 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966155.1 protein_id gnl|my_center|LOCUS_06460 282621 283511 gene locus_tag LOCUS_06470 282621 283511 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_06470 284831 283536 gene locus_tag LOCUS_06480 284831 283536 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_06480 285316 284849 gene locus_tag LOCUS_06490 285316 284849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 286498 285353 gene locus_tag LOCUS_06500 286498 285353 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_06500 287746 286544 gene locus_tag LOCUS_06510 287746 286544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 288149 287751 gene locus_tag LOCUS_06520 288149 287751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 289226 288351 gene locus_tag LOCUS_06530 289226 288351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_06530 290162 289389 gene locus_tag LOCUS_06540 290162 289389 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_06540 290777 290166 gene locus_tag LOCUS_06550 290777 290166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 291849 290791 gene locus_tag LOCUS_06560 gene nirJ1 291849 290791 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966081.1 protein_id gnl|my_center|LOCUS_06560 292171 291875 gene locus_tag LOCUS_06570 292171 291875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 292518 292844 gene locus_tag LOCUS_06580 292518 292844 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_06580 295118 293538 gene locus_tag LOCUS_06590 295118 293538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 296597 295134 gene locus_tag LOCUS_06600 296597 295134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 297743 296640 gene locus_tag LOCUS_06610 297743 296640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 298878 297748 gene locus_tag LOCUS_06620 298878 297748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 299837 299157 gene locus_tag LOCUS_06630 299837 299157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 300194 299859 gene locus_tag LOCUS_06640 300194 299859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 300951 300199 gene locus_tag LOCUS_06650 300951 300199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 301832 301197 gene locus_tag LOCUS_06660 301832 301197 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_06660 302466 301825 gene locus_tag LOCUS_06670 302466 301825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 303184 302468 gene locus_tag LOCUS_06680 303184 302468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 304343 303933 gene locus_tag LOCUS_06690 304343 303933 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 protein_id gnl|my_center|LOCUS_06690 304805 304446 gene locus_tag LOCUS_06700 304805 304446 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 protein_id gnl|my_center|LOCUS_06700 305342 304932 gene locus_tag LOCUS_06710 305342 304932 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272575.1 protein_id gnl|my_center|LOCUS_06710 305506 305369 gene locus_tag LOCUS_06720 305506 305369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 306321 305554 gene locus_tag LOCUS_06730 306321 305554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 306675 306538 gene locus_tag LOCUS_06740 306675 306538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 307004 306873 gene locus_tag LOCUS_06750 307004 306873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 307653 307054 gene locus_tag LOCUS_06760 307653 307054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583336.1 protein_id gnl|my_center|LOCUS_06760 308373 308011 gene locus_tag LOCUS_06770 308373 308011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 308949 308416 gene locus_tag LOCUS_06780 308949 308416 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_06780 309421 308939 gene locus_tag LOCUS_06790 309421 308939 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876564.1 protein_id gnl|my_center|LOCUS_06790 309735 309514 gene locus_tag LOCUS_06800 309735 309514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 309953 309765 gene locus_tag LOCUS_06810 309953 309765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 310930 309893 gene locus_tag LOCUS_06820 310930 309893 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_06820 311971 310985 gene locus_tag LOCUS_06830 311971 310985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence03 201 338 gene locus_tag LOCUS_06840 201 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 559 780 gene locus_tag LOCUS_06850 559 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 840 1721 gene locus_tag LOCUS_06860 840 1721 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_06860 1864 2649 gene locus_tag LOCUS_06870 gene proB 1864 2649 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_06870 2850 3728 gene locus_tag LOCUS_06880 2850 3728 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_06880 3749 5110 gene locus_tag LOCUS_06890 3749 5110 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_06890 5197 5694 gene locus_tag LOCUS_06900 gene greA 5197 5694 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972123.1 protein_id gnl|my_center|LOCUS_06900 5717 6706 gene locus_tag LOCUS_06910 5717 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6723 7355 gene locus_tag LOCUS_06920 6723 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 7475 8395 gene locus_tag LOCUS_06930 7475 8395 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966067.1 protein_id gnl|my_center|LOCUS_06930 8531 9058 gene locus_tag LOCUS_06940 8531 9058 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_06940 9332 11221 gene locus_tag LOCUS_06950 9332 11221 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_06950 11307 11573 gene locus_tag LOCUS_06960 gene spoIIID 11307 11573 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_06960 12138 13139 gene locus_tag LOCUS_06970 12138 13139 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_06970 13207 15477 gene locus_tag LOCUS_06980 13207 15477 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_06980 15570 16313 gene locus_tag LOCUS_06990 15570 16313 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583764.1 protein_id gnl|my_center|LOCUS_06990 16596 18017 gene locus_tag LOCUS_07000 16596 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 18264 18413 gene locus_tag LOCUS_07010 gene rpmG 18264 18413 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_07010 18434 18640 gene locus_tag LOCUS_07020 18434 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 18673 19194 gene locus_tag LOCUS_07030 gene nusG 18673 19194 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_07030 19314 19739 gene locus_tag LOCUS_07040 gene rplK 19314 19739 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894851.1 protein_id gnl|my_center|LOCUS_07040 19815 20519 gene locus_tag LOCUS_07050 gene rplA 19815 20519 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_07050 20849 21343 gene locus_tag LOCUS_07060 gene rplJ 20849 21343 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 protein_id gnl|my_center|LOCUS_07060 21392 21757 gene locus_tag LOCUS_07070 gene rplL 21392 21757 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832283.1 protein_id gnl|my_center|LOCUS_07070 22145 25975 gene locus_tag LOCUS_07080 gene rpoB 22145 25975 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_07080 25994 29797 gene locus_tag LOCUS_07090 25994 29797 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399740.1 protein_id gnl|my_center|LOCUS_07090 30001 30729 gene locus_tag LOCUS_07100 30001 30729 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861304.1 protein_id gnl|my_center|LOCUS_07100 30811 31539 gene locus_tag LOCUS_07110 30811 31539 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_07110 31778 33214 gene locus_tag LOCUS_07120 31778 33214 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_07120 33252 33449 gene locus_tag LOCUS_07130 33252 33449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 33771 33442 gene locus_tag LOCUS_07140 33771 33442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 33925 34113 gene locus_tag LOCUS_07150 33925 34113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 34173 35123 gene locus_tag LOCUS_07160 34173 35123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 35258 35830 gene locus_tag LOCUS_07170 35258 35830 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_07170 35830 36132 gene locus_tag LOCUS_07180 35830 36132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 36134 37327 gene locus_tag LOCUS_07190 36134 37327 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_07190 37327 38259 gene locus_tag LOCUS_07200 37327 38259 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_07200 38298 38756 gene locus_tag LOCUS_07210 38298 38756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 39179 40630 gene locus_tag LOCUS_07220 39179 40630 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216257.1 protein_id gnl|my_center|LOCUS_07220 42161 40806 gene locus_tag LOCUS_07230 42161 40806 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_07230 42463 43848 gene locus_tag LOCUS_07240 gene asnS 42463 43848 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_07240 43980 44393 gene locus_tag LOCUS_07250 gene rpsL 43980 44393 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_07250 44555 45025 gene locus_tag LOCUS_07260 gene rpsG 44555 45025 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_07260 45349 47466 gene locus_tag LOCUS_07270 gene fusA 45349 47466 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_07270 47590 48777 gene locus_tag LOCUS_07280 gene tuf 47590 48777 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_07280 49431 48940 gene locus_tag LOCUS_07290 49431 48940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 49560 49760 gene locus_tag LOCUS_07300 49560 49760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 49765 49893 gene locus_tag LOCUS_07310 49765 49893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 50052 50813 gene locus_tag LOCUS_07320 50052 50813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07320 51006 52397 gene locus_tag LOCUS_07330 51006 52397 CDS product virulence-associated E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001668899.1 protein_id gnl|my_center|LOCUS_07330 52669 52914 gene locus_tag LOCUS_07340 52669 52914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 53419 53994 gene locus_tag LOCUS_07350 53419 53994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 54022 54840 gene locus_tag LOCUS_07360 54022 54840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 54974 55774 gene locus_tag LOCUS_07370 54974 55774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 55892 56176 gene locus_tag LOCUS_07380 55892 56176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 56189 56641 gene locus_tag LOCUS_07390 56189 56641 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 protein_id gnl|my_center|LOCUS_07390 56691 57485 gene locus_tag LOCUS_07400 56691 57485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 57490 57930 gene locus_tag LOCUS_07410 57490 57930 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_07410 58000 58854 gene locus_tag LOCUS_07420 58000 58854 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930957.1 protein_id gnl|my_center|LOCUS_07420 58990 60612 gene locus_tag LOCUS_07430 58990 60612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 60777 61790 gene locus_tag LOCUS_07440 60777 61790 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_07440 63247 62168 gene locus_tag LOCUS_07450 63247 62168 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_07450 63743 63258 gene locus_tag LOCUS_07460 63743 63258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 63899 64081 gene locus_tag LOCUS_07470 63899 64081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_07470 64118 64378 gene locus_tag LOCUS_07480 64118 64378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 64590 66134 gene locus_tag LOCUS_07490 64590 66134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 66487 68775 gene locus_tag LOCUS_07500 66487 68775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 68808 72683 gene locus_tag LOCUS_07510 68808 72683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 72984 72742 gene locus_tag LOCUS_07520 72984 72742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 73529 73783 gene locus_tag LOCUS_07530 73529 73783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 73725 74024 gene locus_tag LOCUS_07540 73725 74024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 74258 74446 gene locus_tag LOCUS_07550 74258 74446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 74463 76127 gene locus_tag LOCUS_07560 74463 76127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109060.1 protein_id gnl|my_center|LOCUS_07560 76141 77019 gene locus_tag LOCUS_07570 76141 77019 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206252.1 protein_id gnl|my_center|LOCUS_07570 77130 77753 gene locus_tag LOCUS_07580 77130 77753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 77756 78328 gene locus_tag LOCUS_07590 77756 78328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 78331 81237 gene locus_tag LOCUS_07600 78331 81237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 81610 82179 gene locus_tag LOCUS_07610 81610 82179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814794.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07610 82450 82632 gene locus_tag LOCUS_07620 82450 82632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 82786 83511 gene locus_tag LOCUS_07630 gene rgaR 82786 83511 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_07630 83508 84797 gene locus_tag LOCUS_07640 83508 84797 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964890.1 protein_id gnl|my_center|LOCUS_07640 85176 85322 gene locus_tag LOCUS_07650 85176 85322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 85564 85896 gene locus_tag LOCUS_07660 85564 85896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 86089 86694 gene locus_tag LOCUS_07670 86089 86694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 86821 87288 gene locus_tag LOCUS_07680 86821 87288 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_07680 87281 87727 gene locus_tag LOCUS_07690 87281 87727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 88295 87942 gene locus_tag LOCUS_07700 88295 87942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 88369 89553 gene locus_tag LOCUS_07710 88369 89553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 89654 90220 gene locus_tag LOCUS_07720 89654 90220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 90399 90854 gene locus_tag LOCUS_07730 90399 90854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 91415 91011 gene locus_tag LOCUS_07740 91415 91011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 91896 91408 gene locus_tag LOCUS_07750 91896 91408 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_07750 92190 93791 gene locus_tag LOCUS_07760 92190 93791 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_07760 93813 94640 gene locus_tag LOCUS_07770 93813 94640 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_07770 94656 95456 gene locus_tag LOCUS_07780 94656 95456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_07780 95494 95895 gene locus_tag LOCUS_07790 95494 95895 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962808.1 protein_id gnl|my_center|LOCUS_07790 96104 96592 gene locus_tag LOCUS_07800 96104 96592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 96745 97704 gene locus_tag LOCUS_07810 96745 97704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 97765 98169 gene locus_tag LOCUS_07820 97765 98169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 100216 98288 gene locus_tag LOCUS_07830 100216 98288 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861602.1 protein_id gnl|my_center|LOCUS_07830 100571 101023 gene locus_tag LOCUS_07840 100571 101023 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932304.1 protein_id gnl|my_center|LOCUS_07840 101025 101336 gene locus_tag LOCUS_07850 101025 101336 CDS product fructose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454881.1 protein_id gnl|my_center|LOCUS_07850 101362 102471 gene locus_tag LOCUS_07860 101362 102471 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893660.1 protein_id gnl|my_center|LOCUS_07860 102644 105355 gene locus_tag LOCUS_07870 gene mngB 102644 105355 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 protein_id gnl|my_center|LOCUS_07870 105356 106252 gene locus_tag LOCUS_07880 105356 106252 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_07880 106538 106849 gene locus_tag LOCUS_07890 106538 106849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 107199 108422 gene locus_tag LOCUS_07900 107199 108422 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_07900 108471 109067 gene locus_tag LOCUS_07910 108471 109067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 110578 109208 gene locus_tag LOCUS_07920 110578 109208 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_07920 111135 111608 gene locus_tag LOCUS_07930 111135 111608 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 protein_id gnl|my_center|LOCUS_07930 111874 112308 gene locus_tag LOCUS_07940 111874 112308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 112469 113287 gene locus_tag LOCUS_07950 112469 113287 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_07950 113436 114407 gene locus_tag LOCUS_07960 113436 114407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 114608 115477 gene locus_tag LOCUS_07970 114608 115477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 115489 116379 gene locus_tag LOCUS_07980 115489 116379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 116973 116500 gene locus_tag LOCUS_07990 116973 116500 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_07990 117171 118550 gene locus_tag LOCUS_08000 117171 118550 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_08000 118583 118906 gene locus_tag LOCUS_08010 118583 118906 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_08010 119320 120447 gene locus_tag LOCUS_08020 119320 120447 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989865.1 protein_id gnl|my_center|LOCUS_08020 120449 120862 gene locus_tag LOCUS_08030 120449 120862 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585661.1 protein_id gnl|my_center|LOCUS_08030 120974 121444 gene locus_tag LOCUS_08040 120974 121444 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 protein_id gnl|my_center|LOCUS_08040 121463 122257 gene locus_tag LOCUS_08050 121463 122257 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 protein_id gnl|my_center|LOCUS_08050 122247 123077 gene locus_tag LOCUS_08060 122247 123077 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723163.1 protein_id gnl|my_center|LOCUS_08060 123155 124171 gene locus_tag LOCUS_08070 123155 124171 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 protein_id gnl|my_center|LOCUS_08070 124173 124853 gene locus_tag LOCUS_08080 124173 124853 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 protein_id gnl|my_center|LOCUS_08080 125013 125774 gene locus_tag LOCUS_08090 125013 125774 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287926.1 protein_id gnl|my_center|LOCUS_08090 125764 126498 gene locus_tag LOCUS_08100 125764 126498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 126517 126996 gene locus_tag LOCUS_08110 gene ybaK 126517 126996 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_08110 127212 127850 gene locus_tag LOCUS_08120 127212 127850 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964638.1 protein_id gnl|my_center|LOCUS_08120 128892 128032 gene locus_tag LOCUS_08130 128892 128032 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_08130 129027 129566 gene locus_tag LOCUS_08140 129027 129566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 129609 130595 gene locus_tag LOCUS_08150 129609 130595 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_08150 130880 131596 gene locus_tag LOCUS_08160 130880 131596 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_08160 131589 131894 gene locus_tag LOCUS_08170 131589 131894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 131968 132780 gene locus_tag LOCUS_08180 131968 132780 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_08180 132777 133178 gene locus_tag LOCUS_08190 132777 133178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 133196 134092 gene locus_tag LOCUS_08200 133196 134092 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_08200 134240 135508 gene locus_tag LOCUS_08210 gene rpoD 134240 135508 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861220.1 protein_id gnl|my_center|LOCUS_08210 135863 140410 gene locus_tag LOCUS_08220 gene gltB 135863 140410 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_08220 140423 141913 gene locus_tag LOCUS_08230 140423 141913 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_08230 143327 142002 gene locus_tag LOCUS_08240 143327 142002 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389802.1 protein_id gnl|my_center|LOCUS_08240 144003 143422 gene locus_tag LOCUS_08250 144003 143422 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_08250 144354 144974 gene locus_tag LOCUS_08260 144354 144974 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_08260 145076 145891 gene locus_tag LOCUS_08270 145076 145891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 146739 145915 gene locus_tag LOCUS_08280 146739 145915 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900455.1 protein_id gnl|my_center|LOCUS_08280 146876 147784 gene locus_tag LOCUS_08290 146876 147784 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912466.1 protein_id gnl|my_center|LOCUS_08290 147906 148853 gene locus_tag LOCUS_08300 147906 148853 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_08300 149814 148858 gene locus_tag LOCUS_08310 149814 148858 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_08310 149903 150565 gene locus_tag LOCUS_08320 149903 150565 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_08320 151454 150525 gene locus_tag LOCUS_08330 151454 150525 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_08330 151808 151987 gene locus_tag LOCUS_08340 151808 151987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 152179 152940 gene locus_tag LOCUS_08350 152179 152940 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_08350 152969 153973 gene locus_tag LOCUS_08360 152969 153973 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_08360 154106 154177 gene locus_tag LOCUS_t00110 154106 154177 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 154369 156525 gene locus_tag LOCUS_08370 154369 156525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 156653 157216 gene locus_tag LOCUS_08380 156653 157216 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_08380 157278 157691 gene locus_tag LOCUS_08390 157278 157691 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_08390 158444 157746 gene locus_tag LOCUS_08400 158444 157746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 158908 160089 gene locus_tag LOCUS_08410 gene nifS 158908 160089 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_08410 160118 160492 gene locus_tag LOCUS_08420 gene nifU 160118 160492 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_08420 160595 161509 gene locus_tag LOCUS_08430 gene nadA 160595 161509 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_08430 161658 162749 gene locus_tag LOCUS_08440 gene mnmA 161658 162749 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_08440 163118 163588 gene locus_tag LOCUS_08450 163118 163588 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_08450 164058 165389 gene locus_tag LOCUS_08460 164058 165389 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957111.1 protein_id gnl|my_center|LOCUS_08460 166208 167140 gene locus_tag LOCUS_08470 gene cysK 166208 167140 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_08470 167290 168576 gene locus_tag LOCUS_08480 167290 168576 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_08480 168778 169209 gene locus_tag LOCUS_08490 168778 169209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 169340 170290 gene locus_tag LOCUS_08500 169340 170290 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861477.1 protein_id gnl|my_center|LOCUS_08500 170292 171374 gene locus_tag LOCUS_08510 170292 171374 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303623.1 protein_id gnl|my_center|LOCUS_08510 171388 172197 gene locus_tag LOCUS_08520 171388 172197 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_08520 172227 172385 gene locus_tag LOCUS_08530 172227 172385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 172499 172654 gene locus_tag LOCUS_08540 172499 172654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 172846 173847 gene locus_tag LOCUS_08550 172846 173847 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461144.1 protein_id gnl|my_center|LOCUS_08550 174007 174942 gene locus_tag LOCUS_08560 174007 174942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461145.1 protein_id gnl|my_center|LOCUS_08560 174942 175742 gene locus_tag LOCUS_08570 174942 175742 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_08570 176341 176922 gene locus_tag LOCUS_08580 176341 176922 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946902.1 protein_id gnl|my_center|LOCUS_08580 177265 179505 gene locus_tag LOCUS_08590 177265 179505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 179520 181589 gene locus_tag LOCUS_08600 179520 181589 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_08600 181757 182347 gene locus_tag LOCUS_08610 181757 182347 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_08610 182573 183847 gene locus_tag LOCUS_08620 182573 183847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 184118 184534 gene locus_tag LOCUS_08630 184118 184534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 184912 185607 gene locus_tag LOCUS_08640 gene sfsA 184912 185607 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_08640 185719 186294 gene locus_tag LOCUS_08650 185719 186294 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964891.1 protein_id gnl|my_center|LOCUS_08650 186435 187892 gene locus_tag LOCUS_08660 gene gltX 186435 187892 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_08660 187975 189417 gene locus_tag LOCUS_08670 187975 189417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 189621 191102 gene locus_tag LOCUS_08680 189621 191102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 191284 193194 gene locus_tag LOCUS_08690 191284 193194 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_08690 193292 193612 gene locus_tag LOCUS_08700 193292 193612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 193627 194211 gene locus_tag LOCUS_08710 193627 194211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 194379 195785 gene locus_tag LOCUS_08720 194379 195785 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_08720 195778 196335 gene locus_tag LOCUS_08730 gene folE 195778 196335 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 protein_id gnl|my_center|LOCUS_08730 196466 197284 gene locus_tag LOCUS_08740 gene folP 196466 197284 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_08740 197268 198149 gene locus_tag LOCUS_08750 gene folK 197268 198149 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966210.1 protein_id gnl|my_center|LOCUS_08750 198177 199304 gene locus_tag LOCUS_08760 gene pheA 198177 199304 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_08760 200331 199435 gene locus_tag LOCUS_08770 200331 199435 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_08770 201981 200347 gene locus_tag LOCUS_08780 201981 200347 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_08780 202157 202642 gene locus_tag LOCUS_08790 202157 202642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 202678 204507 gene locus_tag LOCUS_08800 202678 204507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 204530 205300 gene locus_tag LOCUS_08810 204530 205300 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_08810 205397 207349 gene locus_tag LOCUS_08820 205397 207349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 207450 207632 gene locus_tag LOCUS_08830 207450 207632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 207887 208960 gene locus_tag LOCUS_08840 207887 208960 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_08840 208945 211083 gene locus_tag LOCUS_08850 208945 211083 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 protein_id gnl|my_center|LOCUS_08850 211195 213303 gene locus_tag LOCUS_08860 211195 213303 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721318.1 protein_id gnl|my_center|LOCUS_08860 214094 213612 gene locus_tag LOCUS_08870 214094 213612 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_08870 214366 214815 gene locus_tag LOCUS_08880 214366 214815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 214904 215338 gene locus_tag LOCUS_08890 214904 215338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 216020 217108 gene locus_tag LOCUS_08900 gene rsmH 216020 217108 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015778.1 protein_id gnl|my_center|LOCUS_08900 217257 218261 gene locus_tag LOCUS_08910 gene trpS 217257 218261 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_08910 218261 218950 gene locus_tag LOCUS_08920 218261 218950 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355700.1 protein_id gnl|my_center|LOCUS_08920 219815 219159 gene locus_tag LOCUS_08930 219815 219159 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262713.1 protein_id gnl|my_center|LOCUS_08930 221522 219993 gene locus_tag LOCUS_08940 221522 219993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 221691 222215 gene locus_tag LOCUS_08950 221691 222215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 222397 222810 gene locus_tag LOCUS_08960 222397 222810 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052499.1 protein_id gnl|my_center|LOCUS_08960 222837 223502 gene locus_tag LOCUS_08970 222837 223502 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_08970 223647 225554 gene locus_tag LOCUS_08980 gene gyrB 223647 225554 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_08980 225566 227959 gene locus_tag LOCUS_08990 gene gyrA 225566 227959 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_08990 227990 230125 gene locus_tag LOCUS_09000 227990 230125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 230143 230931 gene locus_tag LOCUS_09010 230143 230931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 230940 231968 gene locus_tag LOCUS_09020 230940 231968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 232072 232257 gene locus_tag LOCUS_09030 232072 232257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 235183 232403 gene locus_tag LOCUS_09040 235183 232403 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_09040 235655 235164 gene locus_tag LOCUS_09050 235655 235164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 236624 235686 gene locus_tag LOCUS_09060 236624 235686 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196763.1 protein_id gnl|my_center|LOCUS_09060 238001 236778 gene locus_tag LOCUS_09070 238001 236778 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_09070 238350 239390 gene locus_tag LOCUS_09080 gene argC 238350 239390 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_09080 239853 241082 gene locus_tag LOCUS_09090 gene argJ 239853 241082 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 protein_id gnl|my_center|LOCUS_09090 241194 242117 gene locus_tag LOCUS_09100 gene argB 241194 242117 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_09100 242117 243298 gene locus_tag LOCUS_09110 242117 243298 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_09110 243484 245130 gene locus_tag LOCUS_09120 243484 245130 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_09120 245183 245875 gene locus_tag LOCUS_09130 245183 245875 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_09130 245939 247267 gene locus_tag LOCUS_09140 245939 247267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 247324 247752 gene locus_tag LOCUS_09150 247324 247752 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_09150 247860 248459 gene locus_tag LOCUS_09160 247860 248459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 248476 249162 gene locus_tag LOCUS_09170 gene walR 248476 249162 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_09170 249167 250627 gene locus_tag LOCUS_09180 249167 250627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 250639 251556 gene locus_tag LOCUS_09190 250639 251556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 251633 254113 gene locus_tag LOCUS_09200 251633 254113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 254255 255856 gene locus_tag LOCUS_09210 254255 255856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119166.1 protein_id gnl|my_center|LOCUS_09210 255934 256914 gene locus_tag LOCUS_09220 gene holA 255934 256914 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_09220 257230 256967 gene locus_tag LOCUS_09230 gene rpsT 257230 256967 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_09230 257540 258436 gene locus_tag LOCUS_09240 gene gpr 257540 258436 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_09240 258487 259764 gene locus_tag LOCUS_09250 258487 259764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 260255 259824 gene locus_tag LOCUS_09260 gene dut 260255 259824 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933085.1 protein_id gnl|my_center|LOCUS_09260 261121 260594 gene locus_tag LOCUS_09270 261121 260594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 262297 261146 gene locus_tag LOCUS_09280 262297 261146 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_09280 262606 264108 gene locus_tag LOCUS_09290 gene rho 262606 264108 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_09290 264254 264454 gene locus_tag LOCUS_09300 gene rpmE 264254 264454 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_09300 264532 265587 gene locus_tag LOCUS_09310 264532 265587 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_09310 265575 266414 gene locus_tag LOCUS_09320 gene prmC 265575 266414 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_09320 266417 267487 gene locus_tag LOCUS_09330 gene prfA 266417 267487 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_09330 268606 268139 gene locus_tag LOCUS_09340 268606 268139 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_09340 268882 269610 gene locus_tag LOCUS_09350 gene cps4B 268882 269610 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 protein_id gnl|my_center|LOCUS_09350 269629 270432 gene locus_tag LOCUS_09360 269629 270432 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922111.1 protein_id gnl|my_center|LOCUS_09360 270439 271158 gene locus_tag LOCUS_09370 270439 271158 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704149.1 protein_id gnl|my_center|LOCUS_09370 271219 272397 gene locus_tag LOCUS_09380 271219 272397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 272397 273146 gene locus_tag LOCUS_09390 272397 273146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 273164 273427 gene locus_tag LOCUS_09400 273164 273427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 273420 273884 gene locus_tag LOCUS_09410 273420 273884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 273892 275595 gene locus_tag LOCUS_09420 273892 275595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 275768 275592 gene locus_tag LOCUS_09430 275768 275592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 275966 277309 gene locus_tag LOCUS_09440 gene glmM 275966 277309 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_09440 277408 277953 gene locus_tag LOCUS_09450 277408 277953 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_09450 277928 278983 gene locus_tag LOCUS_09460 gene hisC 277928 278983 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_09460 279012 279584 gene locus_tag LOCUS_09470 279012 279584 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_09470 279851 282430 gene locus_tag LOCUS_09480 gene clpB 279851 282430 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_09480 282616 282969 gene locus_tag LOCUS_09490 282616 282969 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_09490 283085 285208 gene locus_tag LOCUS_09500 283085 285208 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_09500 285265 285993 gene locus_tag LOCUS_09510 285265 285993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 286363 287337 gene locus_tag LOCUS_09520 286363 287337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 287519 287854 gene locus_tag LOCUS_09530 287519 287854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence04 619 942 gene locus_tag LOCUS_09540 619 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 946 2244 gene locus_tag LOCUS_09550 946 2244 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_09550 2270 3529 gene locus_tag LOCUS_09560 2270 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3557 4234 gene locus_tag LOCUS_09570 3557 4234 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_09570 4234 5514 gene locus_tag LOCUS_09580 4234 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 7386 5827 gene locus_tag LOCUS_09590 7386 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 7440 7622 gene locus_tag LOCUS_09600 7440 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7713 8351 gene locus_tag LOCUS_09610 7713 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8432 8599 gene locus_tag LOCUS_09620 8432 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 8699 9109 gene locus_tag LOCUS_09630 8699 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 9127 9768 gene locus_tag LOCUS_09640 9127 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 9792 10907 gene locus_tag LOCUS_09650 9792 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 10919 12304 gene locus_tag LOCUS_09660 10919 12304 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_09660 12320 13270 gene locus_tag LOCUS_09670 12320 13270 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_09670 13282 14214 gene locus_tag LOCUS_09680 13282 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 14227 14574 gene locus_tag LOCUS_09690 14227 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 14574 15122 gene locus_tag LOCUS_09700 14574 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 15326 16033 gene locus_tag LOCUS_09710 15326 16033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_09710 16033 17655 gene locus_tag LOCUS_09720 16033 17655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_09720 17712 18164 gene locus_tag LOCUS_09730 17712 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 18241 18801 gene locus_tag LOCUS_09740 18241 18801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 19678 18953 gene locus_tag LOCUS_09750 19678 18953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 20063 21061 gene locus_tag LOCUS_09760 20063 21061 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426117.1 protein_id gnl|my_center|LOCUS_09760 21148 21798 gene locus_tag LOCUS_09770 21148 21798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 21805 23565 gene locus_tag LOCUS_09780 21805 23565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 23546 24862 gene locus_tag LOCUS_09790 23546 24862 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263064.1 protein_id gnl|my_center|LOCUS_09790 24960 25115 gene locus_tag LOCUS_09800 24960 25115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 25156 25623 gene locus_tag LOCUS_09810 25156 25623 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775605.1 protein_id gnl|my_center|LOCUS_09810 25908 27140 gene locus_tag LOCUS_09820 25908 27140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 27169 27942 gene locus_tag LOCUS_09830 27169 27942 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459132.1 protein_id gnl|my_center|LOCUS_09830 28050 28298 gene locus_tag LOCUS_09840 28050 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 28412 30385 gene locus_tag LOCUS_09850 28412 30385 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_09850 30417 31625 gene locus_tag LOCUS_09860 30417 31625 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_09860 31646 32398 gene locus_tag LOCUS_09870 31646 32398 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_09870 32391 33149 gene locus_tag LOCUS_09880 32391 33149 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706684.1 protein_id gnl|my_center|LOCUS_09880 33157 34329 gene locus_tag LOCUS_09890 33157 34329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 34397 35635 gene locus_tag LOCUS_09900 34397 35635 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_09900 35654 36148 gene locus_tag LOCUS_09910 35654 36148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 36163 37386 gene locus_tag LOCUS_09920 36163 37386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 37401 38201 gene locus_tag LOCUS_09930 37401 38201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 38228 39451 gene locus_tag LOCUS_09940 38228 39451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 39444 40997 gene locus_tag LOCUS_09950 gene murJ 39444 40997 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454106.1 protein_id gnl|my_center|LOCUS_09950 40994 42130 gene locus_tag LOCUS_09960 40994 42130 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267353.1 protein_id gnl|my_center|LOCUS_09960 42143 43096 gene locus_tag LOCUS_09970 42143 43096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 43106 43720 gene locus_tag LOCUS_09980 43106 43720 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038461.1 protein_id gnl|my_center|LOCUS_09980 43724 44755 gene locus_tag LOCUS_09990 gene neuB 43724 44755 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066002.1 protein_id gnl|my_center|LOCUS_09990 44748 45425 gene locus_tag LOCUS_10000 44748 45425 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_10000 45476 46627 gene locus_tag LOCUS_10010 gene neuC 45476 46627 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723247.1 protein_id gnl|my_center|LOCUS_10010 46684 47445 gene locus_tag LOCUS_10020 46684 47445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 47547 49172 gene locus_tag LOCUS_10030 47547 49172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 49209 50681 gene locus_tag LOCUS_10040 49209 50681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 50684 52177 gene locus_tag LOCUS_10050 50684 52177 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_10050 52750 52178 gene locus_tag LOCUS_10060 52750 52178 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943862.1 protein_id gnl|my_center|LOCUS_10060 53007 53981 gene locus_tag LOCUS_10070 53007 53981 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_10070 54040 54264 gene locus_tag LOCUS_10080 54040 54264 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830184.1 protein_id gnl|my_center|LOCUS_10080 54300 55247 gene locus_tag LOCUS_10090 gene fabK 54300 55247 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_10090 55240 56160 gene locus_tag LOCUS_10100 gene fabD 55240 56160 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_10100 56154 56888 gene locus_tag LOCUS_10110 gene fabG 56154 56888 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_10110 56922 58157 gene locus_tag LOCUS_10120 gene fabF 56922 58157 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_10120 58169 58642 gene locus_tag LOCUS_10130 gene accB 58169 58642 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264861.1 protein_id gnl|my_center|LOCUS_10130 58647 59069 gene locus_tag LOCUS_10140 gene fabZ 58647 59069 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_10140 59086 60432 gene locus_tag LOCUS_10150 59086 60432 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_10150 60448 62142 gene locus_tag LOCUS_10160 60448 62142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 62161 63219 gene locus_tag LOCUS_10170 62161 63219 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048432.1 protein_id gnl|my_center|LOCUS_10170 63296 63520 gene locus_tag LOCUS_10180 63296 63520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 64931 63600 gene locus_tag LOCUS_10190 64931 63600 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_10190 65271 66137 gene locus_tag LOCUS_10200 65271 66137 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861970.1 protein_id gnl|my_center|LOCUS_10200 66210 66806 gene locus_tag LOCUS_10210 66210 66806 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439458.1 protein_id gnl|my_center|LOCUS_10210 67030 67533 gene locus_tag LOCUS_10220 67030 67533 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_10220 67530 68213 gene locus_tag LOCUS_10230 67530 68213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 68210 69028 gene locus_tag LOCUS_10240 68210 69028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 69060 70655 gene locus_tag LOCUS_10250 69060 70655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 70788 71225 gene locus_tag LOCUS_10260 70788 71225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 71225 72181 gene locus_tag LOCUS_10270 71225 72181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 72216 73100 gene locus_tag LOCUS_10280 gene cdaA 72216 73100 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_10280 73075 74310 gene locus_tag LOCUS_10290 73075 74310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 74325 75341 gene locus_tag LOCUS_10300 gene galE 74325 75341 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_10300 75394 76716 gene locus_tag LOCUS_10310 75394 76716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 76816 78207 gene locus_tag LOCUS_10320 76816 78207 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385251.1 protein_id gnl|my_center|LOCUS_10320 78414 79976 gene locus_tag LOCUS_10330 78414 79976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 80820 82640 gene locus_tag LOCUS_10340 80820 82640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 82796 84532 gene locus_tag LOCUS_10350 gene proS 82796 84532 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231918.1 protein_id gnl|my_center|LOCUS_10350 84608 85426 gene locus_tag LOCUS_10360 84608 85426 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986912.1 protein_id gnl|my_center|LOCUS_10360 86063 85509 gene locus_tag LOCUS_10370 86063 85509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 86277 86681 gene locus_tag LOCUS_10380 gene fur 86277 86681 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218609.1 protein_id gnl|my_center|LOCUS_10380 86775 87824 gene locus_tag LOCUS_10390 86775 87824 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126169.1 protein_id gnl|my_center|LOCUS_10390 87911 88627 gene locus_tag LOCUS_10400 87911 88627 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 protein_id gnl|my_center|LOCUS_10400 88620 89444 gene locus_tag LOCUS_10410 88620 89444 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_10410 89536 91935 gene locus_tag LOCUS_10420 89536 91935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 92065 94152 gene locus_tag LOCUS_10430 92065 94152 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_10430 94820 94257 gene locus_tag LOCUS_10440 94820 94257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 94990 94823 gene locus_tag LOCUS_10450 94990 94823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 95191 95898 gene locus_tag LOCUS_10460 95191 95898 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399975.1 protein_id gnl|my_center|LOCUS_10460 95898 97151 gene locus_tag LOCUS_10470 95898 97151 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_10470 97416 98060 gene locus_tag LOCUS_10480 97416 98060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 98588 99025 gene locus_tag LOCUS_10490 98588 99025 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_10490 99070 100779 gene locus_tag LOCUS_10500 99070 100779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 100782 101627 gene locus_tag LOCUS_10510 100782 101627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 101880 102761 gene locus_tag LOCUS_10520 101880 102761 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_10520 102780 103631 gene locus_tag LOCUS_10530 gene pstC 102780 103631 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_10530 103648 104571 gene locus_tag LOCUS_10540 gene pstA 103648 104571 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_10540 104749 105498 gene locus_tag LOCUS_10550 gene pstB 104749 105498 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_10550 105502 106155 gene locus_tag LOCUS_10560 gene phoU 105502 106155 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_10560 106327 107376 gene locus_tag LOCUS_10570 gene hydE 106327 107376 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_10570 107500 108954 gene locus_tag LOCUS_10580 gene hydG 107500 108954 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_10580 109177 110748 gene locus_tag LOCUS_10590 gene hydF 109177 110748 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_10590 110920 111582 gene locus_tag LOCUS_10600 110920 111582 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_10600 111592 113352 gene locus_tag LOCUS_10610 111592 113352 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_10610 113519 113800 gene locus_tag LOCUS_10620 113519 113800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 114006 114473 gene locus_tag LOCUS_10630 114006 114473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 114726 117824 gene locus_tag LOCUS_10640 114726 117824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 117955 119205 gene locus_tag LOCUS_10650 117955 119205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 119261 120985 gene locus_tag LOCUS_10660 119261 120985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 121423 122076 gene locus_tag LOCUS_10670 121423 122076 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_10670 122158 123561 gene locus_tag LOCUS_10680 122158 123561 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_10680 123562 124299 gene locus_tag LOCUS_10690 123562 124299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 124332 125216 gene locus_tag LOCUS_10700 124332 125216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 125168 125338 gene locus_tag LOCUS_10710 125168 125338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 125487 126170 gene locus_tag LOCUS_10720 125487 126170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 126163 126678 gene locus_tag LOCUS_10730 126163 126678 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_10730 126701 127531 gene locus_tag LOCUS_10740 126701 127531 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028237.1 protein_id gnl|my_center|LOCUS_10740 128374 127580 gene locus_tag LOCUS_10750 gene pdaB 128374 127580 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965679.1 protein_id gnl|my_center|LOCUS_10750 128494 129852 gene locus_tag LOCUS_10760 128494 129852 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905168.1 protein_id gnl|my_center|LOCUS_10760 130463 129924 gene locus_tag LOCUS_10770 130463 129924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 131429 130578 gene locus_tag LOCUS_10780 131429 130578 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_10780 131822 132079 gene locus_tag LOCUS_10790 131822 132079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 132127 132399 gene locus_tag LOCUS_10800 132127 132399 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054380.1 protein_id gnl|my_center|LOCUS_10800 132580 134940 gene locus_tag LOCUS_10810 gene feoB 132580 134940 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_10810 135406 137163 gene locus_tag LOCUS_10820 gene aspS 135406 137163 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_10820 137462 138115 gene locus_tag LOCUS_10830 137462 138115 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_10830 139077 138310 gene locus_tag LOCUS_10840 139077 138310 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_10840 139991 139053 gene locus_tag LOCUS_10850 139991 139053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 140369 141700 gene locus_tag LOCUS_10860 gene glnA 140369 141700 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_10860 141715 142263 gene locus_tag LOCUS_10870 141715 142263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 142286 143500 gene locus_tag LOCUS_10880 142286 143500 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_10880 143751 144713 gene locus_tag LOCUS_10890 143751 144713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 144908 146560 gene locus_tag LOCUS_10900 144908 146560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 146864 147559 gene locus_tag LOCUS_10910 146864 147559 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_10910 147569 149221 gene locus_tag LOCUS_10920 147569 149221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 149565 149353 gene locus_tag LOCUS_10930 149565 149353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 149664 151559 gene locus_tag LOCUS_10940 149664 151559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 151572 152906 gene locus_tag LOCUS_10950 151572 152906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 152989 154353 gene locus_tag LOCUS_10960 152989 154353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 154368 157325 gene locus_tag LOCUS_10970 154368 157325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 157408 161241 gene locus_tag LOCUS_10980 157408 161241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 161378 162124 gene locus_tag LOCUS_10990 161378 162124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 162920 162297 gene locus_tag LOCUS_11000 162920 162297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 163431 163012 gene locus_tag LOCUS_11010 163431 163012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 163567 163692 gene locus_tag LOCUS_11020 163567 163692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 163692 164717 gene locus_tag LOCUS_11030 163692 164717 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11030 165539 164892 gene locus_tag LOCUS_11040 165539 164892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 165747 166040 gene locus_tag LOCUS_11050 gene gatC 165747 166040 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722233.1 protein_id gnl|my_center|LOCUS_11050 166207 167679 gene locus_tag LOCUS_11060 gene gatA 166207 167679 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_11060 167691 169124 gene locus_tag LOCUS_11070 gene gatB 167691 169124 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_11070 169181 170623 gene locus_tag LOCUS_11080 gene purF 169181 170623 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_11080 170799 172229 gene locus_tag LOCUS_11090 gene purB 170799 172229 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_11090 172497 173357 gene locus_tag LOCUS_11100 172497 173357 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_11100 173543 174721 gene locus_tag LOCUS_11110 173543 174721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 174964 175803 gene locus_tag LOCUS_11120 174964 175803 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002349114.1 protein_id gnl|my_center|LOCUS_11120 175800 176627 gene locus_tag LOCUS_11130 gene panB 175800 176627 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_11130 176713 177555 gene locus_tag LOCUS_11140 gene panC 176713 177555 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_11140 177760 178155 gene locus_tag LOCUS_11150 177760 178155 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_11150 178176 179372 gene locus_tag LOCUS_11160 gene coaBC 178176 179372 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_11160 179571 180653 gene locus_tag LOCUS_11170 179571 180653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 180721 181509 gene locus_tag LOCUS_11180 180721 181509 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669815.1 protein_id gnl|my_center|LOCUS_11180 181853 181557 gene locus_tag LOCUS_11190 181853 181557 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906388.1 protein_id gnl|my_center|LOCUS_11190 182761 181964 gene locus_tag LOCUS_11200 182761 181964 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_11200 182875 184248 gene locus_tag LOCUS_11210 182875 184248 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_11210 184245 185021 gene locus_tag LOCUS_11220 184245 185021 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_11220 185141 188896 gene locus_tag LOCUS_11230 185141 188896 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_11230 189328 189858 gene locus_tag LOCUS_11240 189328 189858 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627663.1 protein_id gnl|my_center|LOCUS_11240 189994 190581 gene locus_tag LOCUS_11250 189994 190581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 191605 190727 gene locus_tag LOCUS_11260 191605 190727 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_11260 191810 193645 gene locus_tag LOCUS_11270 191810 193645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 193727 195001 gene locus_tag LOCUS_11280 193727 195001 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_11280 195063 195980 gene locus_tag LOCUS_11290 gene pyrF 195063 195980 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_11290 196077 196844 gene locus_tag LOCUS_11300 gene pyrK 196077 196844 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232111.1 protein_id gnl|my_center|LOCUS_11300 196844 197746 gene locus_tag LOCUS_11310 196844 197746 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_11310 197853 198152 gene locus_tag LOCUS_11320 197853 198152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 198232 199200 gene locus_tag LOCUS_11330 198232 199200 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549622.1 protein_id gnl|my_center|LOCUS_11330 199621 200940 gene locus_tag LOCUS_11340 199621 200940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 200918 201616 gene locus_tag LOCUS_11350 gene rgbR 200918 201616 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_11350 201755 209431 gene locus_tag LOCUS_11360 201755 209431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 209491 210147 gene locus_tag LOCUS_11370 209491 210147 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963936.1 protein_id gnl|my_center|LOCUS_11370 210184 210321 gene locus_tag LOCUS_11380 210184 210321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 210446 210853 gene locus_tag LOCUS_11390 210446 210853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 210988 212037 gene locus_tag LOCUS_11400 210988 212037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 212095 212541 gene locus_tag LOCUS_11410 212095 212541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 212564 213034 gene locus_tag LOCUS_11420 212564 213034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 213458 214513 gene locus_tag LOCUS_11430 213458 214513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 214798 215454 gene locus_tag LOCUS_11440 214798 215454 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963936.1 protein_id gnl|my_center|LOCUS_11440 215681 216775 gene locus_tag LOCUS_11450 215681 216775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 216819 217523 gene locus_tag LOCUS_11460 216819 217523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 217560 218348 gene locus_tag LOCUS_11470 217560 218348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 218362 218862 gene locus_tag LOCUS_11480 218362 218862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 219051 219731 gene locus_tag LOCUS_11490 gene pyrE 219051 219731 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_11490 219750 220205 gene locus_tag LOCUS_11500 219750 220205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 220247 220609 gene locus_tag LOCUS_11510 220247 220609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 220621 222627 gene locus_tag LOCUS_11520 220621 222627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 222828 223328 gene locus_tag LOCUS_11530 gene purE 222828 223328 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_11530 223467 224492 gene locus_tag LOCUS_11540 gene purM 223467 224492 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_11540 224612 225205 gene locus_tag LOCUS_11550 gene purN 224612 225205 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_11550 225108 225332 gene locus_tag LOCUS_11560 225108 225332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 225426 226697 gene locus_tag LOCUS_11570 gene purD 225426 226697 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_11570 226825 228534 gene locus_tag LOCUS_11580 226825 228534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 228652 231135 gene locus_tag LOCUS_11590 228652 231135 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_11590 231371 231784 gene locus_tag LOCUS_11600 231371 231784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 231908 233263 gene locus_tag LOCUS_11610 gene radA 231908 233263 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_11610 233350 233422 gene locus_tag LOCUS_t00120 233350 233422 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 233758 234381 gene locus_tag LOCUS_11620 233758 234381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 235858 234683 gene locus_tag LOCUS_11630 235858 234683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 236293 236607 gene locus_tag LOCUS_11640 236293 236607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 236616 238628 gene locus_tag LOCUS_11650 236616 238628 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_11650 238631 239119 gene locus_tag LOCUS_11660 238631 239119 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_11660 239129 239722 gene locus_tag LOCUS_11670 239129 239722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 239735 240703 gene locus_tag LOCUS_11680 239735 240703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 240696 241010 gene locus_tag LOCUS_11690 240696 241010 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_11690 241064 242836 gene locus_tag LOCUS_11700 241064 242836 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_11700 242838 244211 gene locus_tag LOCUS_11710 242838 244211 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_11710 244582 245247 gene locus_tag LOCUS_11720 244582 245247 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_11720 245369 246358 gene locus_tag LOCUS_11730 245369 246358 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_11730 246625 247914 gene locus_tag LOCUS_11740 246625 247914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 248293 250074 gene locus_tag LOCUS_11750 248293 250074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 250135 251361 gene locus_tag LOCUS_11760 250135 251361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 251659 253839 gene locus_tag LOCUS_11770 251659 253839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 253857 253994 gene locus_tag LOCUS_11780 253857 253994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence05 84 158 gene locus_tag LOCUS_t00130 84 158 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 246 319 gene locus_tag LOCUS_t00140 246 319 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 354 426 gene locus_tag LOCUS_t00150 354 426 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 430 513 gene locus_tag LOCUS_t00160 430 513 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 553 628 gene locus_tag LOCUS_t00170 553 628 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 633 707 gene locus_tag LOCUS_t00180 633 707 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 959 2533 gene locus_tag LOCUS_11790 959 2533 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 protein_id gnl|my_center|LOCUS_11790 2539 3123 gene locus_tag LOCUS_11800 2539 3123 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_11800 3275 4285 gene locus_tag LOCUS_11810 3275 4285 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_11810 4263 5156 gene locus_tag LOCUS_11820 4263 5156 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_11820 5274 6014 gene locus_tag LOCUS_11830 5274 6014 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_11830 6019 6855 gene locus_tag LOCUS_11840 gene rsmI 6019 6855 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_11840 7255 7025 gene locus_tag LOCUS_11850 7255 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 7598 8200 gene locus_tag LOCUS_11860 7598 8200 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213184.1 protein_id gnl|my_center|LOCUS_11860 8644 9795 gene locus_tag LOCUS_11870 8644 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 9903 11774 gene locus_tag LOCUS_11880 9903 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 11774 12634 gene locus_tag LOCUS_11890 11774 12634 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_11890 12607 14250 gene locus_tag LOCUS_11900 12607 14250 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392966.1 protein_id gnl|my_center|LOCUS_11900 14244 14864 gene locus_tag LOCUS_11910 14244 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 14998 16347 gene locus_tag LOCUS_11920 14998 16347 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_11920 16610 17134 gene locus_tag LOCUS_11930 16610 17134 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_11930 17190 18098 gene locus_tag LOCUS_11940 gene pfkB 17190 18098 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_11940 18378 19520 gene locus_tag LOCUS_11950 18378 19520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 21493 19688 gene locus_tag LOCUS_11960 21493 19688 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_11960 21630 22556 gene locus_tag LOCUS_11970 gene manA 21630 22556 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454782.1 protein_id gnl|my_center|LOCUS_11970 22581 24542 gene locus_tag LOCUS_11980 22581 24542 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989451.1 protein_id gnl|my_center|LOCUS_11980 24714 25157 gene locus_tag LOCUS_11990 24714 25157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 25183 26316 gene locus_tag LOCUS_12000 25183 26316 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004469.1 protein_id gnl|my_center|LOCUS_12000 26410 26721 gene locus_tag LOCUS_12010 26410 26721 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_12010 26944 27207 gene locus_tag LOCUS_12020 26944 27207 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949581.1 protein_id gnl|my_center|LOCUS_12020 27220 28914 gene locus_tag LOCUS_12030 gene ptsP 27220 28914 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_12030 29000 29833 gene locus_tag LOCUS_12040 29000 29833 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469110.1 protein_id gnl|my_center|LOCUS_12040 29875 30639 gene locus_tag LOCUS_12050 29875 30639 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963440.1 protein_id gnl|my_center|LOCUS_12050 30988 33342 gene locus_tag LOCUS_12060 30988 33342 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184871.1 protein_id gnl|my_center|LOCUS_12060 33361 34272 gene locus_tag LOCUS_12070 33361 34272 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_12070 34423 35100 gene locus_tag LOCUS_12080 34423 35100 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048325.1 protein_id gnl|my_center|LOCUS_12080 35408 36304 gene locus_tag LOCUS_12090 35408 36304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 36338 37723 gene locus_tag LOCUS_12100 36338 37723 CDS product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948806.1 protein_id gnl|my_center|LOCUS_12100 38171 40117 gene locus_tag LOCUS_12110 gene metG 38171 40117 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_12110 40193 40969 gene locus_tag LOCUS_12120 40193 40969 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_12120 41050 41910 gene locus_tag LOCUS_12130 gene rsmA 41050 41910 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_12130 42007 42732 gene locus_tag LOCUS_12140 gene cwlD 42007 42732 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_12140 42815 43882 gene locus_tag LOCUS_12150 42815 43882 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_12150 43898 44350 gene locus_tag LOCUS_12160 43898 44350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 44372 45001 gene locus_tag LOCUS_12170 gene upp 44372 45001 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514490.1 protein_id gnl|my_center|LOCUS_12170 45182 45673 gene locus_tag LOCUS_12180 45182 45673 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_12180 45828 46208 gene locus_tag LOCUS_12190 45828 46208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 47037 46363 gene locus_tag LOCUS_12200 47037 46363 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_12200 47242 48249 gene locus_tag LOCUS_12210 47242 48249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 48242 49426 gene locus_tag LOCUS_12220 48242 49426 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 protein_id gnl|my_center|LOCUS_12220 49433 50161 gene locus_tag LOCUS_12230 49433 50161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 50172 51605 gene locus_tag LOCUS_12240 50172 51605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 51645 51836 gene locus_tag LOCUS_12250 51645 51836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 51895 53577 gene locus_tag LOCUS_12260 51895 53577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 53678 54430 gene locus_tag LOCUS_12270 53678 54430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 54432 54863 gene locus_tag LOCUS_12280 54432 54863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 54856 55257 gene locus_tag LOCUS_12290 54856 55257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 55257 56585 gene locus_tag LOCUS_12300 55257 56585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 56728 57453 gene locus_tag LOCUS_12310 56728 57453 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_12310 57600 58811 gene locus_tag LOCUS_12320 57600 58811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 58883 60079 gene locus_tag LOCUS_12330 58883 60079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 60122 60832 gene locus_tag LOCUS_12340 60122 60832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 60987 61059 gene locus_tag LOCUS_t00190 60987 61059 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 61130 61201 gene locus_tag LOCUS_t00200 61130 61201 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 61284 62750 gene locus_tag LOCUS_12350 61284 62750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 62808 64511 gene locus_tag LOCUS_12360 62808 64511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_12360 64480 66258 gene locus_tag LOCUS_12370 64480 66258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 66258 66434 gene locus_tag LOCUS_12380 66258 66434 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398916.1 protein_id gnl|my_center|LOCUS_12380 66540 66830 gene locus_tag LOCUS_12390 gene rpsF 66540 66830 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883586.1 protein_id gnl|my_center|LOCUS_12390 66854 67303 gene locus_tag LOCUS_12400 66854 67303 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_12400 67324 67587 gene locus_tag LOCUS_12410 gene rpsR 67324 67587 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359407.1 protein_id gnl|my_center|LOCUS_12410 67757 68095 gene locus_tag LOCUS_12420 67757 68095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 69050 69769 gene locus_tag LOCUS_12430 69050 69769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 70006 71010 gene locus_tag LOCUS_12440 70006 71010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 71007 71645 gene locus_tag LOCUS_12450 gene vraR 71007 71645 CDS product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153535.1 protein_id gnl|my_center|LOCUS_12450 71830 73572 gene locus_tag LOCUS_12460 71830 73572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 73928 73680 gene locus_tag LOCUS_12470 73928 73680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 74512 74075 gene locus_tag LOCUS_12480 74512 74075 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_12480 75823 74525 gene locus_tag LOCUS_12490 75823 74525 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788204.1 protein_id gnl|my_center|LOCUS_12490 76252 79014 gene locus_tag LOCUS_12500 76252 79014 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_12500 79325 81754 gene locus_tag LOCUS_12510 79325 81754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 81819 83633 gene locus_tag LOCUS_12520 81819 83633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 84678 83887 gene locus_tag LOCUS_12530 84678 83887 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254023.1 protein_id gnl|my_center|LOCUS_12530 85813 84683 gene locus_tag LOCUS_12540 85813 84683 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237280.1 protein_id gnl|my_center|LOCUS_12540 86084 88369 gene locus_tag LOCUS_12550 86084 88369 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_12550 88421 90478 gene locus_tag LOCUS_12560 gene glgB 88421 90478 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_12560 90560 92665 gene locus_tag LOCUS_12570 90560 92665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 92684 93748 gene locus_tag LOCUS_12580 92684 93748 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_12580 93745 95646 gene locus_tag LOCUS_12590 93745 95646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 97038 95866 gene locus_tag LOCUS_12600 97038 95866 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_12600 98059 97067 gene locus_tag LOCUS_12610 98059 97067 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048435.1 protein_id gnl|my_center|LOCUS_12610 99303 98167 gene locus_tag LOCUS_12620 99303 98167 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_12620 100998 99616 gene locus_tag LOCUS_12630 gene murC 100998 99616 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_12630 101299 102570 gene locus_tag LOCUS_12640 101299 102570 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_12640 102570 103688 gene locus_tag LOCUS_12650 gene glgD 102570 103688 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_12650 103706 103978 gene locus_tag LOCUS_12660 gene spoVG 103706 103978 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_12660 103989 104156 gene locus_tag LOCUS_12670 103989 104156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 104373 108314 gene locus_tag LOCUS_12680 104373 108314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 108549 109103 gene locus_tag LOCUS_12690 gene pth 108549 109103 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_12690 109246 112740 gene locus_tag LOCUS_12700 gene mfd 109246 112740 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_12700 112778 113491 gene locus_tag LOCUS_12710 112778 113491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 113583 114623 gene locus_tag LOCUS_12720 113583 114623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 115722 114814 gene locus_tag LOCUS_12730 115722 114814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 116781 116053 gene locus_tag LOCUS_12740 116781 116053 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_12740 117565 116774 gene locus_tag LOCUS_12750 117565 116774 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_12750 118109 117657 gene locus_tag LOCUS_12760 118109 117657 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_12760 118404 119846 gene locus_tag LOCUS_12770 118404 119846 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_12770 119897 121096 gene locus_tag LOCUS_12780 119897 121096 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836799.1 protein_id gnl|my_center|LOCUS_12780 121229 122614 gene locus_tag LOCUS_12790 121229 122614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 122640 123413 gene locus_tag LOCUS_12800 122640 123413 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_12800 123422 124795 gene locus_tag LOCUS_12810 123422 124795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 124796 126037 gene locus_tag LOCUS_12820 124796 126037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 126030 126863 gene locus_tag LOCUS_12830 126030 126863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 126867 128138 gene locus_tag LOCUS_12840 126867 128138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 128142 129290 gene locus_tag LOCUS_12850 128142 129290 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068376.1 protein_id gnl|my_center|LOCUS_12850 129330 130898 gene locus_tag LOCUS_12860 129330 130898 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103238290.1 protein_id gnl|my_center|LOCUS_12860 130874 131980 gene locus_tag LOCUS_12870 130874 131980 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139014079.1 protein_id gnl|my_center|LOCUS_12870 131996 132964 gene locus_tag LOCUS_12880 131996 132964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 133022 133948 gene locus_tag LOCUS_12890 gene rfaS 133022 133948 CDS product LPS core biosynthesis protein RfaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158225.1 protein_id gnl|my_center|LOCUS_12890 133962 135104 gene locus_tag LOCUS_12900 133962 135104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 135115 135669 gene locus_tag LOCUS_12910 135115 135669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 135755 136711 gene locus_tag LOCUS_12920 135755 136711 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289773.1 protein_id gnl|my_center|LOCUS_12920 136821 137708 gene locus_tag LOCUS_12930 gene rfbA 136821 137708 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905191.1 protein_id gnl|my_center|LOCUS_12930 137914 139032 gene locus_tag LOCUS_12940 gene glf 137914 139032 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922747.1 protein_id gnl|my_center|LOCUS_12940 139822 140850 gene locus_tag LOCUS_12950 gene rfbB 139822 140850 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_12950 140980 141855 gene locus_tag LOCUS_12960 gene rfbD 140980 141855 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600896.1 protein_id gnl|my_center|LOCUS_12960 142003 142605 gene locus_tag LOCUS_12970 gene rfbC 142003 142605 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_12970 142871 143977 gene locus_tag LOCUS_12980 142871 143977 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824469.1 protein_id gnl|my_center|LOCUS_12980 144005 145249 gene locus_tag LOCUS_12990 144005 145249 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476426.1 protein_id gnl|my_center|LOCUS_12990 145270 145752 gene locus_tag LOCUS_13000 145270 145752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 145752 146906 gene locus_tag LOCUS_13010 145752 146906 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_13010 146924 147919 gene locus_tag LOCUS_13020 146924 147919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 147919 149025 gene locus_tag LOCUS_13030 147919 149025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 149031 150191 gene locus_tag LOCUS_13040 149031 150191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 150216 151298 gene locus_tag LOCUS_13050 gene lsgC 150216 151298 CDS product lipooligosaccharide biosynthesis family 4 glycosyltransferase LsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694187.1 protein_id gnl|my_center|LOCUS_13050 151310 152527 gene locus_tag LOCUS_13060 151310 152527 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476423.1 protein_id gnl|my_center|LOCUS_13060 152680 153573 gene locus_tag LOCUS_13070 152680 153573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 153585 154619 gene locus_tag LOCUS_13080 153585 154619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 154638 155609 gene locus_tag LOCUS_13090 154638 155609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 155675 156865 gene locus_tag LOCUS_13100 155675 156865 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476423.1 protein_id gnl|my_center|LOCUS_13100 156877 158058 gene locus_tag LOCUS_13110 156877 158058 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225909.1 protein_id gnl|my_center|LOCUS_13110 158045 158824 gene locus_tag LOCUS_13120 158045 158824 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 protein_id gnl|my_center|LOCUS_13120 158859 159296 gene locus_tag LOCUS_13130 158859 159296 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_13130 159310 160059 gene locus_tag LOCUS_13140 159310 160059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 160139 161608 gene locus_tag LOCUS_13150 160139 161608 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103238290.1 protein_id gnl|my_center|LOCUS_13150 161638 162690 gene locus_tag LOCUS_13160 161638 162690 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_13160 162692 163750 gene locus_tag LOCUS_13170 162692 163750 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966322.1 protein_id gnl|my_center|LOCUS_13170 163884 164717 gene locus_tag LOCUS_13180 163884 164717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 164719 166125 gene locus_tag LOCUS_13190 164719 166125 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803942.1 protein_id gnl|my_center|LOCUS_13190 166118 167755 gene locus_tag LOCUS_13200 166118 167755 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_13200 167739 168227 gene locus_tag LOCUS_13210 167739 168227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 169353 168181 gene locus_tag LOCUS_13220 169353 168181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 169946 169494 gene locus_tag LOCUS_13230 169946 169494 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 protein_id gnl|my_center|LOCUS_13230 170258 172297 gene locus_tag LOCUS_13240 170258 172297 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence06 462 259 gene locus_tag LOCUS_13250 462 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2195 651 gene locus_tag LOCUS_13260 gene lysS 2195 651 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_13260 2803 2315 gene locus_tag LOCUS_13270 gene greA 2803 2315 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_13270 3891 2938 gene locus_tag LOCUS_13280 gene dusB 3891 2938 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_13280 4680 3907 gene locus_tag LOCUS_13290 4680 3907 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_13290 5009 4680 gene locus_tag LOCUS_13300 5009 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6015 5101 gene locus_tag LOCUS_13310 6015 5101 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_13310 6456 6019 gene locus_tag LOCUS_13320 6456 6019 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_13320 6905 6468 gene locus_tag LOCUS_13330 6905 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 7278 7868 gene locus_tag LOCUS_13340 7278 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 10734 8041 gene locus_tag LOCUS_13350 10734 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 11275 11069 gene locus_tag LOCUS_13360 11275 11069 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_13360 11809 11288 gene locus_tag LOCUS_13370 11809 11288 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_13370 13507 12491 gene locus_tag LOCUS_13380 13507 12491 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_13380 15918 13825 gene locus_tag LOCUS_13390 15918 13825 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_13390 16980 16183 gene locus_tag LOCUS_13400 16980 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 19891 17276 gene locus_tag LOCUS_13410 19891 17276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 21207 20341 gene locus_tag LOCUS_13420 gene fba 21207 20341 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_13420 22628 21294 gene locus_tag LOCUS_13430 22628 21294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 23896 22652 gene locus_tag LOCUS_13440 23896 22652 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_13440 24106 24507 gene locus_tag LOCUS_13450 24106 24507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 24507 24764 gene locus_tag LOCUS_13460 gene cotJB 24507 24764 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_13460 24764 25051 gene locus_tag LOCUS_13470 24764 25051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 25150 26637 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttacgataacttaattctttcaggtactaaaat 27700 26705 gene locus_tag LOCUS_13480 27700 26705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 28023 27697 gene locus_tag LOCUS_13490 gene cas2 28023 27697 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_13490 28925 28020 gene locus_tag LOCUS_13500 gene cas1 28925 28020 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_13500 32397 29068 gene locus_tag LOCUS_13510 gene cas9 32397 29068 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_13510 32846 32706 gene locus_tag LOCUS_13520 32846 32706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 33038 33111 gene locus_tag LOCUS_t00210 33038 33111 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 33566 33189 gene locus_tag LOCUS_13530 33566 33189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 35264 33663 gene locus_tag LOCUS_13540 35264 33663 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_13540 35796 35389 gene locus_tag LOCUS_13550 35796 35389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 36187 35924 gene locus_tag LOCUS_13560 36187 35924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 36911 36204 gene locus_tag LOCUS_13570 36911 36204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 38298 36997 gene locus_tag LOCUS_13580 38298 36997 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_13580 38798 38556 gene locus_tag LOCUS_13590 38798 38556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 39578 38811 gene locus_tag LOCUS_13600 gene pflA 39578 38811 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921923.1 protein_id gnl|my_center|LOCUS_13600 41678 39606 gene locus_tag LOCUS_13610 gene pflB 41678 39606 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894660.1 protein_id gnl|my_center|LOCUS_13610 42270 41734 gene locus_tag LOCUS_13620 42270 41734 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048408.1 protein_id gnl|my_center|LOCUS_13620 42671 43321 gene locus_tag LOCUS_13630 42671 43321 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_13630 43500 43318 gene locus_tag LOCUS_13640 43500 43318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 45128 43743 gene locus_tag LOCUS_13650 45128 43743 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_13650 46214 45723 gene locus_tag LOCUS_13660 gene trmL 46214 45723 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_13660 47381 46215 gene locus_tag LOCUS_13670 47381 46215 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459619.1 protein_id gnl|my_center|LOCUS_13670 47860 47381 gene locus_tag LOCUS_13680 47860 47381 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_13680 49020 48061 gene locus_tag LOCUS_13690 gene hypE 49020 48061 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868428.1 protein_id gnl|my_center|LOCUS_13690 50465 49035 gene locus_tag LOCUS_13700 50465 49035 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_13700 51396 50674 gene locus_tag LOCUS_13710 51396 50674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 53113 51398 gene locus_tag LOCUS_13720 53113 51398 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 protein_id gnl|my_center|LOCUS_13720 53370 53300 gene locus_tag LOCUS_t00220 53370 53300 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 53452 53380 gene locus_tag LOCUS_t00230 53452 53380 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 54095 53532 gene locus_tag LOCUS_13730 54095 53532 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_13730 54324 54163 gene locus_tag LOCUS_13740 54324 54163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 55456 54290 gene locus_tag LOCUS_13750 gene dltD 55456 54290 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808969.1 protein_id gnl|my_center|LOCUS_13750 55716 55480 gene locus_tag LOCUS_13760 gene dltC 55716 55480 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227325.1 protein_id gnl|my_center|LOCUS_13760 56922 55777 gene locus_tag LOCUS_13770 gene dltB 56922 55777 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426712.1 protein_id gnl|my_center|LOCUS_13770 58454 56922 gene locus_tag LOCUS_13780 gene dltA 58454 56922 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198836.1 protein_id gnl|my_center|LOCUS_13780 60467 58590 gene locus_tag LOCUS_13790 60467 58590 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_13790 61294 60467 gene locus_tag LOCUS_13800 61294 60467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_13800 62347 61304 gene locus_tag LOCUS_13810 62347 61304 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_13810 65332 62546 gene locus_tag LOCUS_13820 65332 62546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 67237 65603 gene locus_tag LOCUS_13830 67237 65603 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282029.1 protein_id gnl|my_center|LOCUS_13830 68239 67403 gene locus_tag LOCUS_13840 68239 67403 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_13840 68827 68252 gene locus_tag LOCUS_13850 68827 68252 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_13850 70578 68830 gene locus_tag LOCUS_13860 gene iorA 70578 68830 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_13860 72205 70703 gene locus_tag LOCUS_13870 72205 70703 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_13870 73859 72249 gene locus_tag LOCUS_13880 73859 72249 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_13880 75445 73856 gene locus_tag LOCUS_13890 75445 73856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 76228 75464 gene locus_tag LOCUS_13900 76228 75464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_13900 77010 76225 gene locus_tag LOCUS_13910 77010 76225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339085.1 protein_id gnl|my_center|LOCUS_13910 78163 77207 gene locus_tag LOCUS_13920 78163 77207 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_13920 79905 78325 gene locus_tag LOCUS_13930 79905 78325 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_13930 81224 80103 gene locus_tag LOCUS_13940 81224 80103 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_13940 81747 81241 gene locus_tag LOCUS_13950 gene rpiB 81747 81241 CDS product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716794.1 protein_id gnl|my_center|LOCUS_13950 82524 81904 gene locus_tag LOCUS_13960 82524 81904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 82753 82670 gene locus_tag LOCUS_t00240 82753 82670 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 82839 82757 gene locus_tag LOCUS_t00250 82839 82757 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 83417 84172 gene locus_tag LOCUS_13970 gene srtB 83417 84172 CDS product sortase SrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903304.1 protein_id gnl|my_center|LOCUS_13970 84280 84591 gene locus_tag LOCUS_13980 84280 84591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 84663 85565 gene locus_tag LOCUS_13990 84663 85565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 85728 86030 gene locus_tag LOCUS_14000 85728 86030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 88193 86166 gene locus_tag LOCUS_14010 88193 86166 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922389.1 protein_id gnl|my_center|LOCUS_14010 90040 88211 gene locus_tag LOCUS_14020 gene ftsH 90040 88211 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_14020 90700 90179 gene locus_tag LOCUS_14030 gene hpt 90700 90179 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_14030 92235 90706 gene locus_tag LOCUS_14040 gene tilS 92235 90706 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_14040 93911 92208 gene locus_tag LOCUS_14050 93911 92208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 94431 94084 gene locus_tag LOCUS_14060 94431 94084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 94825 94376 gene locus_tag LOCUS_14070 94825 94376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 95109 94825 gene locus_tag LOCUS_14080 95109 94825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 95525 95286 gene locus_tag LOCUS_14090 95525 95286 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 protein_id gnl|my_center|LOCUS_14090 98512 95738 gene locus_tag LOCUS_14100 98512 95738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 98731 98543 gene locus_tag LOCUS_14110 98731 98543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 106128 98752 gene locus_tag LOCUS_14120 106128 98752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 109672 106259 gene locus_tag LOCUS_14130 109672 106259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 110265 109993 gene locus_tag LOCUS_14140 110265 109993 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213508.1 protein_id gnl|my_center|LOCUS_14140 110942 110394 gene locus_tag LOCUS_14150 gene spoVT 110942 110394 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_14150 111202 111963 gene locus_tag LOCUS_14160 111202 111963 CDS product DUF4866 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930717.1 protein_id gnl|my_center|LOCUS_14160 111950 113290 gene locus_tag LOCUS_14170 111950 113290 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_14170 113554 115707 gene locus_tag LOCUS_14180 113554 115707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 117183 115861 gene locus_tag LOCUS_14190 117183 115861 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_14190 117482 118252 gene locus_tag LOCUS_14200 117482 118252 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922402.1 protein_id gnl|my_center|LOCUS_14200 118780 118295 gene locus_tag LOCUS_14210 118780 118295 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_14210 119021 118902 gene locus_tag LOCUS_14220 119021 118902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 120530 119046 gene locus_tag LOCUS_14230 120530 119046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 120880 120602 gene locus_tag LOCUS_14240 120880 120602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 121104 120880 gene locus_tag LOCUS_14250 121104 120880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 121372 121097 gene locus_tag LOCUS_14260 121372 121097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 122113 121436 gene locus_tag LOCUS_14270 122113 121436 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_14270 124674 122122 gene locus_tag LOCUS_14280 124674 122122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 125819 124680 gene locus_tag LOCUS_14290 125819 124680 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_14290 126811 125816 gene locus_tag LOCUS_14300 gene argF 126811 125816 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_14300 127846 126869 gene locus_tag LOCUS_14310 127846 126869 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_14310 129180 128035 gene locus_tag LOCUS_14320 129180 128035 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence07 2658 1756 gene locus_tag LOCUS_14330 2658 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 5562 2866 gene locus_tag LOCUS_14340 5562 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 9243 6064 gene locus_tag LOCUS_14350 9243 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582531.1 protein_id gnl|my_center|LOCUS_14350 10253 9255 gene locus_tag LOCUS_14360 10253 9255 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_14360 11722 10331 gene locus_tag LOCUS_14370 11722 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 12742 11786 gene locus_tag LOCUS_14380 12742 11786 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909515.1 protein_id gnl|my_center|LOCUS_14380 13820 12732 gene locus_tag LOCUS_14390 13820 12732 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259693.1 protein_id gnl|my_center|LOCUS_14390 16351 13820 gene locus_tag LOCUS_14400 16351 13820 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259692.1 protein_id gnl|my_center|LOCUS_14400 18398 16335 gene locus_tag LOCUS_14410 18398 16335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259691.1 protein_id gnl|my_center|LOCUS_14410 19279 18410 gene locus_tag LOCUS_14420 19279 18410 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_14420 20246 19296 gene locus_tag LOCUS_14430 20246 19296 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259689.1 protein_id gnl|my_center|LOCUS_14430 23364 20239 gene locus_tag LOCUS_14440 23364 20239 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259688.1 protein_id gnl|my_center|LOCUS_14440 25122 23443 gene locus_tag LOCUS_14450 25122 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 26498 25731 gene locus_tag LOCUS_14460 26498 25731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 26783 27499 gene locus_tag LOCUS_14470 26783 27499 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616588.1 protein_id gnl|my_center|LOCUS_14470 27589 28053 gene locus_tag LOCUS_14480 27589 28053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 28595 28176 gene locus_tag LOCUS_14490 28595 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 29540 28725 gene locus_tag LOCUS_14500 gene murI 29540 28725 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_14500 29733 30347 gene locus_tag LOCUS_14510 gene spoIIR 29733 30347 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947973.1 protein_id gnl|my_center|LOCUS_14510 31283 30423 gene locus_tag LOCUS_14520 gene ispE 31283 30423 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_14520 33000 31447 gene locus_tag LOCUS_14530 33000 31447 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_14530 33465 33055 gene locus_tag LOCUS_14540 33465 33055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 35287 33545 gene locus_tag LOCUS_14550 35287 33545 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_14550 36361 35381 gene locus_tag LOCUS_14560 36361 35381 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947964.1 protein_id gnl|my_center|LOCUS_14560 37789 36419 gene locus_tag LOCUS_14570 37789 36419 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_14570 39222 37813 gene locus_tag LOCUS_14580 39222 37813 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_14580 39422 40261 gene locus_tag LOCUS_14590 39422 40261 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_14590 40868 40266 gene locus_tag LOCUS_14600 40868 40266 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_14600 42237 41047 gene locus_tag LOCUS_14610 gene metK 42237 41047 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_14610 43558 42650 gene locus_tag LOCUS_14620 43558 42650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 45630 43642 gene locus_tag LOCUS_14630 45630 43642 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_14630 46496 46047 gene locus_tag LOCUS_14640 46496 46047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 47458 46514 gene locus_tag LOCUS_14650 47458 46514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 48566 47859 gene locus_tag LOCUS_14660 48566 47859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 49098 48559 gene locus_tag LOCUS_14670 49098 48559 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_14670 50445 49153 gene locus_tag LOCUS_14680 50445 49153 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_14680 51457 50738 gene locus_tag LOCUS_14690 51457 50738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 52042 51533 gene locus_tag LOCUS_14700 52042 51533 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_14700 53307 52075 gene locus_tag LOCUS_14710 53307 52075 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_14710 53965 53393 gene locus_tag LOCUS_14720 53965 53393 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_14720 55114 53984 gene locus_tag LOCUS_14730 55114 53984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 55218 56222 gene locus_tag LOCUS_14740 55218 56222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 58204 56465 gene locus_tag LOCUS_14750 58204 56465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 59437 58499 gene locus_tag LOCUS_14760 59437 58499 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_14760 60264 59425 gene locus_tag LOCUS_14770 60264 59425 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_14770 63392 60321 gene locus_tag LOCUS_14780 63392 60321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 64023 63427 gene locus_tag LOCUS_14790 gene recR 64023 63427 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_14790 64373 64023 gene locus_tag LOCUS_14800 64373 64023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 65933 64374 gene locus_tag LOCUS_14810 gene dnaX 65933 64374 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_14810 68019 66070 gene locus_tag LOCUS_14820 68019 66070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 68950 68492 gene locus_tag LOCUS_14830 gene tadA 68950 68492 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 protein_id gnl|my_center|LOCUS_14830 70751 68964 gene locus_tag LOCUS_14840 70751 68964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 71279 72016 gene locus_tag LOCUS_14850 71279 72016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 73073 72303 gene locus_tag LOCUS_14860 73073 72303 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_14860 76619 73134 gene locus_tag LOCUS_14870 76619 73134 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_14870 79338 76825 gene locus_tag LOCUS_14880 79338 76825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 80284 79682 gene locus_tag LOCUS_14890 80284 79682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 80644 80390 gene locus_tag LOCUS_14900 80644 80390 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_14900 81599 80667 gene locus_tag LOCUS_14910 gene whiA 81599 80667 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_14910 82483 81623 gene locus_tag LOCUS_14920 gene rapZ 82483 81623 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416961.1 protein_id gnl|my_center|LOCUS_14920 83388 82498 gene locus_tag LOCUS_14930 gene murB 83388 82498 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_14930 84354 83410 gene locus_tag LOCUS_14940 84354 83410 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_14940 85318 84374 gene locus_tag LOCUS_14950 gene hprK 85318 84374 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_14950 87270 85366 gene locus_tag LOCUS_14960 gene uvrC 87270 85366 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_14960 89739 87790 gene locus_tag LOCUS_14970 gene ftsH 89739 87790 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_14970 90047 91645 gene locus_tag LOCUS_14980 90047 91645 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_14980 92593 91688 gene locus_tag LOCUS_14990 92593 91688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 94030 92921 gene locus_tag LOCUS_15000 94030 92921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 94684 94139 gene locus_tag LOCUS_15010 94684 94139 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_15010 95557 94703 gene locus_tag LOCUS_15020 gene nadC 95557 94703 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454666.1 protein_id gnl|my_center|LOCUS_15020 96916 95603 gene locus_tag LOCUS_15030 96916 95603 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_15030 98576 97128 gene locus_tag LOCUS_15040 98576 97128 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_15040 99134 98793 gene locus_tag LOCUS_15050 99134 98793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 99487 99134 gene locus_tag LOCUS_15060 99487 99134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 101643 99727 gene locus_tag LOCUS_15070 101643 99727 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_15070 102871 101741 gene locus_tag LOCUS_15080 102871 101741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 103623 102877 gene locus_tag LOCUS_15090 103623 102877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 104345 103845 gene locus_tag LOCUS_15100 104345 103845 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022620559.1 protein_id gnl|my_center|LOCUS_15100 104710 104513 gene locus_tag LOCUS_15110 104710 104513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 105707 104712 gene locus_tag LOCUS_15120 105707 104712 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_15120 106653 105730 gene locus_tag LOCUS_15130 gene metA 106653 105730 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_15130 107182 106715 gene locus_tag LOCUS_15140 107182 106715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 107427 108326 gene locus_tag LOCUS_15150 107427 108326 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682345.1 protein_id gnl|my_center|LOCUS_15150 109401 108628 gene locus_tag LOCUS_15160 109401 108628 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858826.1 protein_id gnl|my_center|LOCUS_15160 110453 109413 gene locus_tag LOCUS_15170 110453 109413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 111315 110476 gene locus_tag LOCUS_15180 111315 110476 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_15180 112406 111495 gene locus_tag LOCUS_15190 112406 111495 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_15190 113127 112408 gene locus_tag LOCUS_15200 113127 112408 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_15200 114161 113121 gene locus_tag LOCUS_15210 114161 113121 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_15210 114967 114299 gene locus_tag LOCUS_15220 114967 114299 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964798.1 protein_id gnl|my_center|LOCUS_15220 115249 115962 gene locus_tag LOCUS_15230 115249 115962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 115981 117156 gene locus_tag LOCUS_15240 115981 117156 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_15240 117378 117794 gene locus_tag LOCUS_15250 117378 117794 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence08 695 345 gene locus_tag LOCUS_15260 695 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1954 1016 gene locus_tag LOCUS_15270 1954 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3616 2150 gene locus_tag LOCUS_15280 gene rlmD 3616 2150 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_15280 4583 3633 gene locus_tag LOCUS_15290 4583 3633 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_15290 4855 7221 gene locus_tag LOCUS_15300 4855 7221 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_15300 7307 8011 gene locus_tag LOCUS_15310 7307 8011 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_15310 8011 9438 gene locus_tag LOCUS_15320 8011 9438 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_15320 10411 9614 gene locus_tag LOCUS_15330 gene spo0A 10411 9614 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_15330 10616 11356 gene locus_tag LOCUS_15340 10616 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 11497 11670 gene locus_tag LOCUS_15350 11497 11670 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_15350 12407 11727 gene locus_tag LOCUS_15360 12407 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 13981 12638 gene locus_tag LOCUS_15370 gene dnaB 13981 12638 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_15370 14537 14091 gene locus_tag LOCUS_15380 gene rplI 14537 14091 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429267.1 protein_id gnl|my_center|LOCUS_15380 16591 14537 gene locus_tag LOCUS_15390 16591 14537 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_15390 16863 17129 gene locus_tag LOCUS_15400 16863 17129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 18608 17262 gene locus_tag LOCUS_15410 18608 17262 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288574.1 protein_id gnl|my_center|LOCUS_15410 19469 18771 gene locus_tag LOCUS_15420 19469 18771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 20274 19582 gene locus_tag LOCUS_15430 20274 19582 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_15430 20583 20335 gene locus_tag LOCUS_15440 20583 20335 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_15440 21343 20600 gene locus_tag LOCUS_15450 21343 20600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_15450 22152 21352 gene locus_tag LOCUS_15460 22152 21352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143325.1 protein_id gnl|my_center|LOCUS_15460 22336 24795 gene locus_tag LOCUS_15470 22336 24795 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905630.1 protein_id gnl|my_center|LOCUS_15470 24805 26463 gene locus_tag LOCUS_15480 24805 26463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 26499 27056 gene locus_tag LOCUS_15490 26499 27056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 29732 27213 gene locus_tag LOCUS_15500 29732 27213 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_15500 29999 31441 gene locus_tag LOCUS_15510 29999 31441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 33833 31638 gene locus_tag LOCUS_15520 33833 31638 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195718935.1 protein_id gnl|my_center|LOCUS_15520 34259 33843 gene locus_tag LOCUS_15530 gene tagD 34259 33843 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_15530 35529 34342 gene locus_tag LOCUS_15540 35529 34342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 36650 35526 gene locus_tag LOCUS_15550 36650 35526 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060798.1 protein_id gnl|my_center|LOCUS_15550 37482 36661 gene locus_tag LOCUS_15560 37482 36661 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890771.1 protein_id gnl|my_center|LOCUS_15560 38853 37492 gene locus_tag LOCUS_15570 38853 37492 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_15570 39107 40480 gene locus_tag LOCUS_15580 39107 40480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 40516 41577 gene locus_tag LOCUS_15590 40516 41577 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_15590 42441 42028 gene locus_tag LOCUS_15600 42441 42028 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 protein_id gnl|my_center|LOCUS_15600 43059 42460 gene locus_tag LOCUS_15610 43059 42460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 45927 43111 gene locus_tag LOCUS_15620 45927 43111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 46942 45893 gene locus_tag LOCUS_15630 46942 45893 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833065.1 protein_id gnl|my_center|LOCUS_15630 47489 46944 gene locus_tag LOCUS_15640 47489 46944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 48491 47652 gene locus_tag LOCUS_15650 48491 47652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 49374 48481 gene locus_tag LOCUS_15660 49374 48481 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021379.1 protein_id gnl|my_center|LOCUS_15660 49686 50327 gene locus_tag LOCUS_15670 49686 50327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 50397 52295 gene locus_tag LOCUS_15680 50397 52295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 52307 52906 gene locus_tag LOCUS_15690 52307 52906 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_15690 54226 53105 gene locus_tag LOCUS_15700 54226 53105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 54728 54405 gene locus_tag LOCUS_15710 54728 54405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 55199 54804 gene locus_tag LOCUS_15720 55199 54804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 56091 55267 gene locus_tag LOCUS_15730 56091 55267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 57254 56115 gene locus_tag LOCUS_15740 57254 56115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 57515 57336 gene locus_tag LOCUS_15750 57515 57336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 59185 58100 gene locus_tag LOCUS_15760 59185 58100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 59684 59214 gene locus_tag LOCUS_15770 59684 59214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 60506 60748 gene locus_tag LOCUS_15780 60506 60748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 62824 60839 gene locus_tag LOCUS_15790 62824 60839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 63641 62973 gene locus_tag LOCUS_15800 63641 62973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 66538 63644 gene locus_tag LOCUS_15810 66538 63644 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_15810 67762 66914 gene locus_tag LOCUS_15820 67762 66914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15820 68046 67762 gene locus_tag LOCUS_15830 68046 67762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 68215 68748 gene locus_tag LOCUS_15840 68215 68748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 69264 69191 gene locus_tag LOCUS_t00260 69264 69191 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 73751 69507 gene locus_tag LOCUS_15850 73751 69507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 73935 75200 gene locus_tag LOCUS_15860 73935 75200 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_15860 76130 75492 gene locus_tag LOCUS_15870 gene trmB 76130 75492 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_15870 76552 76875 gene locus_tag LOCUS_15880 76552 76875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 76879 77934 gene locus_tag LOCUS_15890 76879 77934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 77935 79854 gene locus_tag LOCUS_15900 77935 79854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 79891 80313 gene locus_tag LOCUS_15910 79891 80313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 80340 80648 gene locus_tag LOCUS_15920 80340 80648 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_15920 80664 81236 gene locus_tag LOCUS_15930 80664 81236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 81248 83014 gene locus_tag LOCUS_15940 81248 83014 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_15940 83026 84408 gene locus_tag LOCUS_15950 83026 84408 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_15950 84424 85038 gene locus_tag LOCUS_15960 84424 85038 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_15960 85227 86615 gene locus_tag LOCUS_15970 85227 86615 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048018.1 protein_id gnl|my_center|LOCUS_15970 86650 87387 gene locus_tag LOCUS_15980 86650 87387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 88501 87497 gene locus_tag LOCUS_15990 88501 87497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 88601 88528 gene locus_tag LOCUS_t00270 88601 88528 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 90000 88714 gene locus_tag LOCUS_16000 gene serS 90000 88714 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_16000 90168 90905 gene locus_tag LOCUS_16010 90168 90905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 91909 91100 gene locus_tag LOCUS_16020 91909 91100 CDS product LiaF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549154.1 protein_id gnl|my_center|LOCUS_16020 92367 91906 gene locus_tag LOCUS_16030 92367 91906 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_16030 93074 92604 gene locus_tag LOCUS_16040 93074 92604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 94282 93347 gene locus_tag LOCUS_16050 94282 93347 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_16050 95301 94540 gene locus_tag LOCUS_16060 95301 94540 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_16060 96362 95847 gene locus_tag LOCUS_16070 96362 95847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 97092 96373 gene locus_tag LOCUS_16080 gene rsmG 97092 96373 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_16080 99174 97294 gene locus_tag LOCUS_16090 gene mnmG 99174 97294 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_16090 100691 99312 gene locus_tag LOCUS_16100 gene mnmE 100691 99312 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_16100 101487 100858 gene locus_tag LOCUS_16110 101487 100858 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_16110 102721 101498 gene locus_tag LOCUS_16120 102721 101498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 102987 102733 gene locus_tag LOCUS_16130 gene yidD 102987 102733 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966997.1 protein_id gnl|my_center|LOCUS_16130 103395 103060 gene locus_tag LOCUS_16140 gene rnpA 103395 103060 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_16140 103570 103436 gene locus_tag LOCUS_16150 gene rpmH 103570 103436 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_16150 104094 105503 gene locus_tag LOCUS_16160 gene dnaA 104094 105503 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_16160 105776 106876 gene locus_tag LOCUS_16170 gene dnaN 105776 106876 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_16170 106916 107128 gene locus_tag LOCUS_16180 106916 107128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 107128 108216 gene locus_tag LOCUS_16190 gene recF 107128 108216 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_16190 108234 110168 gene locus_tag LOCUS_16200 gene gyrB 108234 110168 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_16200 110181 112754 gene locus_tag LOCUS_16210 gene gyrA 110181 112754 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_16210 112880 113722 gene locus_tag LOCUS_16220 112880 113722 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_16220 113825 114376 gene locus_tag LOCUS_16230 113825 114376 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_16230 114639 114728 gene locus_tag LOCUS_t00280 114639 114728 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 458 772 gene locus_tag LOCUS_16240 gene rpsJ 458 772 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_16240 889 1518 gene locus_tag LOCUS_16250 gene rplC 889 1518 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_16250 1542 2162 gene locus_tag LOCUS_16260 gene rplD 1542 2162 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_16260 2162 2461 gene locus_tag LOCUS_16270 gene rplW 2162 2461 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_16270 2571 3413 gene locus_tag LOCUS_16280 gene rplB 2571 3413 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_16280 3427 3699 gene locus_tag LOCUS_16290 gene rpsS 3427 3699 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124453.1 protein_id gnl|my_center|LOCUS_16290 3733 4119 gene locus_tag LOCUS_16300 3733 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 4135 4782 gene locus_tag LOCUS_16310 gene rpsC 4135 4782 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_16310 4782 5219 gene locus_tag LOCUS_16320 gene rplP 4782 5219 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_16320 5209 5418 gene locus_tag LOCUS_16330 gene rpmC 5209 5418 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_16330 5456 5710 gene locus_tag LOCUS_16340 gene rpsQ 5456 5710 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_16340 5740 6108 gene locus_tag LOCUS_16350 gene rplN 5740 6108 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615912.1 protein_id gnl|my_center|LOCUS_16350 6121 6432 gene locus_tag LOCUS_16360 gene rplX 6121 6432 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_16360 6455 6994 gene locus_tag LOCUS_16370 gene rplE 6455 6994 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393925.1 protein_id gnl|my_center|LOCUS_16370 7010 7195 gene locus_tag LOCUS_16380 7010 7195 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_16380 7223 7624 gene locus_tag LOCUS_16390 gene rpsH 7223 7624 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_16390 7729 8268 gene locus_tag LOCUS_16400 gene rplF 7729 8268 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_16400 8285 8653 gene locus_tag LOCUS_16410 gene rplR 8285 8653 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_16410 8671 9180 gene locus_tag LOCUS_16420 gene rpsE 8671 9180 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_16420 9199 9381 gene locus_tag LOCUS_16430 gene rpmD 9199 9381 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_16430 9401 9841 gene locus_tag LOCUS_16440 gene rplO 9401 9841 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_16440 9843 11186 gene locus_tag LOCUS_16450 gene secY 9843 11186 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_16450 11247 11891 gene locus_tag LOCUS_16460 11247 11891 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_16460 11894 12643 gene locus_tag LOCUS_16470 gene map 11894 12643 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_16470 12662 12880 gene locus_tag LOCUS_16480 gene infA 12662 12880 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899265.1 protein_id gnl|my_center|LOCUS_16480 13586 13954 gene locus_tag LOCUS_16490 gene rpsM 13586 13954 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_16490 13986 14381 gene locus_tag LOCUS_16500 gene rpsK 13986 14381 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_16500 14399 14992 gene locus_tag LOCUS_16510 gene rpsD 14399 14992 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_16510 15068 16027 gene locus_tag LOCUS_16520 15068 16027 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_16520 16064 16591 gene locus_tag LOCUS_16530 gene rplQ 16064 16591 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_16530 16849 18324 gene locus_tag LOCUS_16540 16849 18324 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_16540 20566 18686 gene locus_tag LOCUS_16550 20566 18686 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569404.1 protein_id gnl|my_center|LOCUS_16550 20700 21539 gene locus_tag LOCUS_16560 20700 21539 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_16560 21530 22378 gene locus_tag LOCUS_16570 21530 22378 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_16570 22380 23183 gene locus_tag LOCUS_16580 22380 23183 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_16580 23199 23936 gene locus_tag LOCUS_16590 gene truA 23199 23936 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_16590 24099 24527 gene locus_tag LOCUS_16600 gene rplM 24099 24527 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 protein_id gnl|my_center|LOCUS_16600 24550 24942 gene locus_tag LOCUS_16610 gene rpsI 24550 24942 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_16610 25939 26382 gene locus_tag LOCUS_16620 25939 26382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 26523 26741 gene locus_tag LOCUS_16630 26523 26741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 26801 26974 gene locus_tag LOCUS_16640 26801 26974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 27715 27056 gene locus_tag LOCUS_16650 27715 27056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 27856 28533 gene locus_tag LOCUS_16660 27856 28533 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_16660 28601 29698 gene locus_tag LOCUS_16670 28601 29698 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 protein_id gnl|my_center|LOCUS_16670 29833 32037 gene locus_tag LOCUS_16680 29833 32037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 32371 36306 gene locus_tag LOCUS_16690 32371 36306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 36567 37415 gene locus_tag LOCUS_16700 36567 37415 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_16700 37558 38295 gene locus_tag LOCUS_16710 37558 38295 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_16710 38366 38608 gene locus_tag LOCUS_16720 38366 38608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 38839 40356 gene locus_tag LOCUS_16730 gene pyk 38839 40356 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_16730 40889 42334 gene locus_tag LOCUS_16740 gene mgtE 40889 42334 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062407.1 protein_id gnl|my_center|LOCUS_16740 43030 42482 gene locus_tag LOCUS_16750 43030 42482 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963743.1 protein_id gnl|my_center|LOCUS_16750 44552 43008 gene locus_tag LOCUS_16760 44552 43008 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895925.1 protein_id gnl|my_center|LOCUS_16760 44934 46313 gene locus_tag LOCUS_16770 44934 46313 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_16770 46744 48933 gene locus_tag LOCUS_16780 gene nrdD 46744 48933 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_16780 49209 50651 gene locus_tag LOCUS_16790 49209 50651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 50880 51575 gene locus_tag LOCUS_16800 50880 51575 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_16800 51572 51907 gene locus_tag LOCUS_16810 51572 51907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 51918 54872 gene locus_tag LOCUS_16820 51918 54872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 54885 56678 gene locus_tag LOCUS_16830 54885 56678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 56723 57520 gene locus_tag LOCUS_16840 56723 57520 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646328.1 protein_id gnl|my_center|LOCUS_16840 58369 57647 gene locus_tag LOCUS_16850 58369 57647 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965914.1 protein_id gnl|my_center|LOCUS_16850 58684 59985 gene locus_tag LOCUS_16860 58684 59985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 60551 61090 gene locus_tag LOCUS_16870 gene raiA 60551 61090 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_16870 61346 63919 gene locus_tag LOCUS_16880 gene secA 61346 63919 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 protein_id gnl|my_center|LOCUS_16880 64076 65191 gene locus_tag LOCUS_16890 gene prfB 64076 65191 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_16890 65301 66503 gene locus_tag LOCUS_16900 65301 66503 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_16900 66621 67949 gene locus_tag LOCUS_16910 66621 67949 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_16910 68365 68964 gene locus_tag LOCUS_16920 68365 68964 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_16920 69378 69803 gene locus_tag LOCUS_16930 gene tsaE 69378 69803 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_16930 69800 70513 gene locus_tag LOCUS_16940 gene tsaB 69800 70513 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_16940 70506 70946 gene locus_tag LOCUS_16950 gene rimI 70506 70946 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_16950 71039 71278 gene locus_tag LOCUS_16960 71039 71278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 71409 72317 gene locus_tag LOCUS_16970 71409 72317 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_16970 72340 73359 gene locus_tag LOCUS_16980 gene tsaD 72340 73359 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_16980 73361 74053 gene locus_tag LOCUS_16990 gene ispD 73361 74053 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_16990 74159 74244 gene locus_tag LOCUS_t00290 74159 74244 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 74276 74366 gene locus_tag LOCUS_t00300 74276 74366 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 1353 382 gene locus_tag LOCUS_17000 1353 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3945 2050 gene locus_tag LOCUS_17010 3945 2050 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230933.1 protein_id gnl|my_center|LOCUS_17010 5197 3986 gene locus_tag LOCUS_17020 5197 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 8053 5213 gene locus_tag LOCUS_17030 8053 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 8822 8241 gene locus_tag LOCUS_17040 8822 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 9011 8844 gene locus_tag LOCUS_17050 9011 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 9208 9026 gene locus_tag LOCUS_17060 9208 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 9940 9227 gene locus_tag LOCUS_17070 9940 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 12081 10252 gene locus_tag LOCUS_17080 12081 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 12585 12220 gene locus_tag LOCUS_17090 12585 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 13202 12615 gene locus_tag LOCUS_17100 13202 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 13311 13535 gene locus_tag LOCUS_17110 13311 13535 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_17110 13803 13573 gene locus_tag LOCUS_17120 13803 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 15168 13888 gene locus_tag LOCUS_17130 15168 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17130 15576 15280 gene locus_tag LOCUS_17140 15576 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 15905 15747 gene locus_tag LOCUS_17150 15905 15747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 16499 16254 gene locus_tag LOCUS_17160 16499 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 17298 16513 gene locus_tag LOCUS_17170 17298 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 18005 17460 gene locus_tag LOCUS_17180 18005 17460 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_17180 18604 18080 gene locus_tag LOCUS_17190 18604 18080 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_17190 20292 18802 gene locus_tag LOCUS_17200 gene glpK 20292 18802 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_17200 21343 20561 gene locus_tag LOCUS_17210 21343 20561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 22602 21526 gene locus_tag LOCUS_17220 22602 21526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 24104 23001 gene locus_tag LOCUS_17230 24104 23001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 24731 24132 gene locus_tag LOCUS_17240 24731 24132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 25415 25077 gene locus_tag LOCUS_17250 25415 25077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 26472 25450 gene locus_tag LOCUS_17260 26472 25450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 27400 26624 gene locus_tag LOCUS_17270 27400 26624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 27586 27921 gene locus_tag LOCUS_17280 27586 27921 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423377.1 protein_id gnl|my_center|LOCUS_17280 29101 28400 gene locus_tag LOCUS_17290 29101 28400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 29639 30061 gene locus_tag LOCUS_17300 29639 30061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_17300 31032 30211 gene locus_tag LOCUS_17310 31032 30211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 34258 31784 gene locus_tag LOCUS_17320 34258 31784 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_17320 37560 34399 gene locus_tag LOCUS_17330 gene ileS 37560 34399 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_17330 39266 38319 gene locus_tag LOCUS_17340 39266 38319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 40318 39551 gene locus_tag LOCUS_17350 40318 39551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 40487 40329 gene locus_tag LOCUS_17360 40487 40329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 48410 40521 gene locus_tag LOCUS_17370 48410 40521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 53023 48884 gene locus_tag LOCUS_17380 53023 48884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 56059 53441 gene locus_tag LOCUS_17390 56059 53441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 58562 56136 gene locus_tag LOCUS_17400 58562 56136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 66047 58755 gene locus_tag LOCUS_17410 66047 58755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 66531 66382 gene locus_tag LOCUS_17420 66531 66382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 67176 66628 gene locus_tag LOCUS_17430 67176 66628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 68002 67241 gene locus_tag LOCUS_17440 68002 67241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence11 1227 829 gene locus_tag LOCUS_17450 1227 829 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_17450 1962 1369 gene locus_tag LOCUS_17460 1962 1369 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_17460 2666 2328 gene locus_tag LOCUS_17470 2666 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3081 2884 gene locus_tag LOCUS_17480 3081 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3763 3173 gene locus_tag LOCUS_17490 3763 3173 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837539.1 protein_id gnl|my_center|LOCUS_17490 4100 3795 gene locus_tag LOCUS_17500 4100 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 6942 4309 gene locus_tag LOCUS_17510 6942 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 7027 7644 gene locus_tag LOCUS_17520 7027 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 8172 7729 gene locus_tag LOCUS_17530 8172 7729 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191984393.1 protein_id gnl|my_center|LOCUS_17530 8443 8700 gene locus_tag LOCUS_17540 8443 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17540 8779 9012 gene locus_tag LOCUS_17550 8779 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17550 10893 9799 gene locus_tag LOCUS_17560 10893 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 11661 10927 gene locus_tag LOCUS_17570 gene rpsB 11661 10927 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_17570 13955 11883 gene locus_tag LOCUS_17580 gene topA 13955 11883 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_17580 15065 13977 gene locus_tag LOCUS_17590 gene dprA 15065 13977 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047859.1 protein_id gnl|my_center|LOCUS_17590 16572 15067 gene locus_tag LOCUS_17600 16572 15067 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583879.1 protein_id gnl|my_center|LOCUS_17600 17249 16614 gene locus_tag LOCUS_17610 gene sigK 17249 16614 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_17610 18563 17352 gene locus_tag LOCUS_17620 18563 17352 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_17620 19295 18651 gene locus_tag LOCUS_17630 19295 18651 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_17630 19701 19306 gene locus_tag LOCUS_17640 19701 19306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 21374 19713 gene locus_tag LOCUS_17650 21374 19713 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_17650 21686 21420 gene locus_tag LOCUS_17660 21686 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 22140 21703 gene locus_tag LOCUS_17670 gene ruvX 22140 21703 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922752.1 protein_id gnl|my_center|LOCUS_17670 22513 22253 gene locus_tag LOCUS_17680 22513 22253 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703962.1 protein_id gnl|my_center|LOCUS_17680 23866 22571 gene locus_tag LOCUS_17690 gene mtaB 23866 22571 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_17690 23992 24219 gene locus_tag LOCUS_17700 23992 24219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 25552 24374 gene locus_tag LOCUS_17710 gene thiI 25552 24374 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_17710 26717 25563 gene locus_tag LOCUS_17720 26717 25563 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_17720 27457 26720 gene locus_tag LOCUS_17730 27457 26720 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_17730 28431 27466 gene locus_tag LOCUS_17740 gene prmA 28431 27466 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_17740 29814 28648 gene locus_tag LOCUS_17750 gene dnaJ 29814 28648 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 protein_id gnl|my_center|LOCUS_17750 31676 29823 gene locus_tag LOCUS_17760 gene dnaK 31676 29823 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_17760 32348 31716 gene locus_tag LOCUS_17770 gene grpE 32348 31716 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454752.1 protein_id gnl|my_center|LOCUS_17770 33410 32370 gene locus_tag LOCUS_17780 gene hrcA 33410 32370 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_17780 35467 34094 gene locus_tag LOCUS_17790 35467 34094 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_17790 37011 35899 gene locus_tag LOCUS_17800 37011 35899 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_17800 38120 37281 gene locus_tag LOCUS_17810 38120 37281 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_17810 38575 38117 gene locus_tag LOCUS_17820 38575 38117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 38957 38778 gene locus_tag LOCUS_17830 38957 38778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 39544 39011 gene locus_tag LOCUS_17840 39544 39011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 41010 39778 gene locus_tag LOCUS_17850 gene hemW 41010 39778 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_17850 42966 41152 gene locus_tag LOCUS_17860 gene lepA 42966 41152 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964590.1 protein_id gnl|my_center|LOCUS_17860 43503 42979 gene locus_tag LOCUS_17870 43503 42979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 44106 43507 gene locus_tag LOCUS_17880 gene yihA 44106 43507 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_17880 46457 44142 gene locus_tag LOCUS_17890 gene lon 46457 44142 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097310.1 protein_id gnl|my_center|LOCUS_17890 47770 46481 gene locus_tag LOCUS_17900 gene clpX 47770 46481 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_17900 48410 47829 gene locus_tag LOCUS_17910 gene clpP 48410 47829 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_17910 49727 48447 gene locus_tag LOCUS_17920 gene tig 49727 48447 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_17920 50494 49943 gene locus_tag LOCUS_17930 50494 49943 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_17930 50681 51133 gene locus_tag LOCUS_17940 50681 51133 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_17940 53530 51323 gene locus_tag LOCUS_17950 53530 51323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 55084 53531 gene locus_tag LOCUS_17960 55084 53531 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_17960 55538 55095 gene locus_tag LOCUS_17970 55538 55095 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071585416.1 protein_id gnl|my_center|LOCUS_17970 55707 55626 gene locus_tag LOCUS_t00310 55707 55626 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55845 55772 gene locus_tag LOCUS_t00320 55845 55772 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 55954 55883 gene locus_tag LOCUS_t00330 55954 55883 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 56037 55962 gene locus_tag LOCUS_t00340 56037 55962 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 56138 56065 gene locus_tag LOCUS_t00350 56138 56065 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56234 56164 gene locus_tag LOCUS_t00360 56234 56164 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 56313 56238 gene locus_tag LOCUS_t00370 56313 56238 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 56907 56425 gene locus_tag LOCUS_17980 56907 56425 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_17980 57506 56910 gene locus_tag LOCUS_17990 57506 56910 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_17990 59250 57526 gene locus_tag LOCUS_18000 59250 57526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 60409 59261 gene locus_tag LOCUS_18010 60409 59261 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_18010 60976 60689 gene locus_tag LOCUS_18020 60976 60689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 61281 61102 gene locus_tag LOCUS_18030 61281 61102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 64107 61405 gene locus_tag LOCUS_18040 64107 61405 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948591.1 protein_id gnl|my_center|LOCUS_18040 64348 64274 gene locus_tag LOCUS_t00380 64348 64274 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 64590 64507 gene locus_tag LOCUS_t00390 64590 64507 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 64687 64614 gene locus_tag LOCUS_t00400 64687 64614 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 64805 64731 gene locus_tag LOCUS_t00410 64805 64731 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 64887 64815 gene locus_tag LOCUS_t00420 64887 64815 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 65034 64961 gene locus_tag LOCUS_t00430 65034 64961 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 65137 65066 gene locus_tag LOCUS_t00440 65137 65066 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 <1 2391 gene locus_tag LOCUS_18050 <1 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094324403.1:DUF262 and DUF1524 domain-containing protein 2599 2946 gene locus_tag LOCUS_18060 2599 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2933 3463 gene locus_tag LOCUS_18070 2933 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 3546 4949 gene locus_tag LOCUS_18080 3546 4949 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18080 4942 5229 gene locus_tag LOCUS_18090 4942 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18090 5291 5488 gene locus_tag LOCUS_18100 5291 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5442 5990 gene locus_tag LOCUS_18110 5442 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5987 7348 gene locus_tag LOCUS_18120 5987 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 7335 7757 gene locus_tag LOCUS_18130 7335 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 7836 8042 gene locus_tag LOCUS_18140 7836 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 8122 8673 gene locus_tag LOCUS_18150 8122 8673 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679290.1 protein_id gnl|my_center|LOCUS_18150 8820 9581 gene locus_tag LOCUS_18160 8820 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 9908 10186 gene locus_tag LOCUS_18170 9908 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 10193 10732 gene locus_tag LOCUS_18180 10193 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 10945 11490 gene locus_tag LOCUS_18190 10945 11490 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908540.1 protein_id gnl|my_center|LOCUS_18190 11515 11961 gene locus_tag LOCUS_18200 11515 11961 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922703.1 protein_id gnl|my_center|LOCUS_18200 11983 12435 gene locus_tag LOCUS_18210 11983 12435 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 protein_id gnl|my_center|LOCUS_18210 12468 12818 gene locus_tag LOCUS_18220 12468 12818 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_18220 12853 14598 gene locus_tag LOCUS_18230 12853 14598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582943.1 protein_id gnl|my_center|LOCUS_18230 14599 16371 gene locus_tag LOCUS_18240 14599 16371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582944.1 protein_id gnl|my_center|LOCUS_18240 16580 17959 gene locus_tag LOCUS_18250 16580 17959 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_18250 17866 18126 gene locus_tag LOCUS_18260 17866 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 18315 18145 gene locus_tag LOCUS_18270 18315 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 19524 18337 gene locus_tag LOCUS_18280 gene gltS 19524 18337 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_18280 20493 19543 gene locus_tag LOCUS_18290 20493 19543 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_18290 21141 20506 gene locus_tag LOCUS_18300 21141 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 21546 22694 gene locus_tag LOCUS_18310 gene fucO 21546 22694 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_18310 22715 23623 gene locus_tag LOCUS_18320 22715 23623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 23986 24168 gene locus_tag LOCUS_18330 23986 24168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 24249 25292 gene locus_tag LOCUS_18340 24249 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 25264 26580 gene locus_tag LOCUS_18350 25264 26580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 26699 26839 gene locus_tag LOCUS_18360 26699 26839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 26841 27245 gene locus_tag LOCUS_18370 26841 27245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 27250 27594 gene locus_tag LOCUS_18380 27250 27594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 27575 30106 gene locus_tag LOCUS_18390 27575 30106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 30103 30471 gene locus_tag LOCUS_18400 30103 30471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 31445 30474 gene locus_tag LOCUS_18410 31445 30474 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475686.1 protein_id gnl|my_center|LOCUS_18410 31756 32313 gene locus_tag LOCUS_18420 31756 32313 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_18420 32329 32709 gene locus_tag LOCUS_18430 32329 32709 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545102.1 protein_id gnl|my_center|LOCUS_18430 33121 36045 gene locus_tag LOCUS_18440 33121 36045 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966288.1 protein_id gnl|my_center|LOCUS_18440 36055 36957 gene locus_tag LOCUS_18450 gene era 36055 36957 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_18450 37055 37240 gene locus_tag LOCUS_18460 37055 37240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 37185 37916 gene locus_tag LOCUS_18470 gene recO 37185 37916 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730435.1 protein_id gnl|my_center|LOCUS_18470 37982 38611 gene locus_tag LOCUS_18480 37982 38611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 38696 40093 gene locus_tag LOCUS_18490 38696 40093 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_18490 40611 41996 gene locus_tag LOCUS_18500 40611 41996 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_18500 42230 44857 gene locus_tag LOCUS_18510 gene ppdK 42230 44857 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_18510 44968 45291 gene locus_tag LOCUS_18520 44968 45291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 45301 45855 gene locus_tag LOCUS_18530 45301 45855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 45893 46120 gene locus_tag LOCUS_18540 45893 46120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 46308 47579 gene locus_tag LOCUS_18550 46308 47579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 47677 49092 gene locus_tag LOCUS_18560 47677 49092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 49268 49885 gene locus_tag LOCUS_18570 49268 49885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 49872 50783 gene locus_tag LOCUS_18580 49872 50783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 51041 51256 gene locus_tag LOCUS_18590 51041 51256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 51384 51551 gene locus_tag LOCUS_18600 51384 51551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 51548 51853 gene locus_tag LOCUS_18610 gene cas2 51548 51853 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_18610 52028 52213 gene locus_tag LOCUS_18620 52028 52213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 52335 52511 gene locus_tag LOCUS_18630 52335 52511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 52524 52757 gene locus_tag LOCUS_18640 52524 52757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 52833 53168 gene locus_tag LOCUS_18650 52833 53168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 53165 53326 gene locus_tag LOCUS_18660 53165 53326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 54056 53658 gene locus_tag LOCUS_18670 54056 53658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 54667 54056 gene locus_tag LOCUS_18680 54667 54056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 55244 54822 gene locus_tag LOCUS_18690 55244 54822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 55795 55325 gene locus_tag LOCUS_18700 55795 55325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 55918 56115 gene locus_tag LOCUS_18710 55918 56115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 56121 56318 gene locus_tag LOCUS_18720 56121 56318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 56690 58804 gene locus_tag LOCUS_18730 56690 58804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 59146 59427 gene locus_tag LOCUS_18740 59146 59427 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894809.1 protein_id gnl|my_center|LOCUS_18740 59455 60051 gene locus_tag LOCUS_18750 59455 60051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence13 531 2168 gene locus_tag LOCUS_18760 531 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2425 3753 gene locus_tag LOCUS_18770 2425 3753 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_18770 3864 5477 gene locus_tag LOCUS_18780 3864 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 5959 7563 gene locus_tag LOCUS_18790 gene pckA 5959 7563 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_18790 7678 11541 gene locus_tag LOCUS_18800 7678 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 11571 11708 gene locus_tag LOCUS_18810 11571 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 11733 12206 gene locus_tag LOCUS_18820 11733 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 12203 12436 gene locus_tag LOCUS_18830 12203 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 12492 13358 gene locus_tag LOCUS_18840 12492 13358 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 protein_id gnl|my_center|LOCUS_18840 13393 13701 gene locus_tag LOCUS_18850 gene trxA 13393 13701 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357302.1 protein_id gnl|my_center|LOCUS_18850 13811 14032 gene locus_tag LOCUS_18860 13811 14032 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_18860 15246 14065 gene locus_tag LOCUS_18870 15246 14065 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_18870 15442 15882 gene locus_tag LOCUS_18880 15442 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 15999 17768 gene locus_tag LOCUS_18890 15999 17768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_18890 17761 19554 gene locus_tag LOCUS_18900 17761 19554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_18900 19856 21841 gene locus_tag LOCUS_18910 19856 21841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 21930 22403 gene locus_tag LOCUS_18920 21930 22403 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_18920 22415 22984 gene locus_tag LOCUS_18930 22415 22984 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_18930 23312 28456 gene locus_tag LOCUS_18940 23312 28456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 28747 29103 gene locus_tag LOCUS_18950 28747 29103 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528058.1 protein_id gnl|my_center|LOCUS_18950 29459 30346 gene locus_tag LOCUS_18960 29459 30346 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_18960 30374 31246 gene locus_tag LOCUS_18970 30374 31246 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_18970 31248 31502 gene locus_tag LOCUS_18980 31248 31502 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_18980 33284 31734 gene locus_tag LOCUS_18990 33284 31734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 34224 33427 gene locus_tag LOCUS_19000 34224 33427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 34413 35852 gene locus_tag LOCUS_19010 34413 35852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 35873 36580 gene locus_tag LOCUS_19020 35873 36580 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 protein_id gnl|my_center|LOCUS_19020 36645 37472 gene locus_tag LOCUS_19030 36645 37472 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_19030 37604 38722 gene locus_tag LOCUS_19040 gene ugpC 37604 38722 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_19040 38872 39960 gene locus_tag LOCUS_19050 38872 39960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 40023 40694 gene locus_tag LOCUS_19060 gene ftsE 40023 40694 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130964.1 protein_id gnl|my_center|LOCUS_19060 40695 41603 gene locus_tag LOCUS_19070 gene ftsX 40695 41603 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_19070 41618 42832 gene locus_tag LOCUS_19080 41618 42832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 43003 44181 gene locus_tag LOCUS_19090 43003 44181 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_19090 44324 46309 gene locus_tag LOCUS_19100 gene uvrB 44324 46309 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_19100 46441 49281 gene locus_tag LOCUS_19110 gene uvrA 46441 49281 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_19110 50064 51608 gene locus_tag LOCUS_19120 gene guaA 50064 51608 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_19120 51623 51958 gene locus_tag LOCUS_19130 51623 51958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 52110 52364 gene locus_tag LOCUS_19140 52110 52364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 52443 52583 gene locus_tag LOCUS_19150 52443 52583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 52648 52995 gene locus_tag LOCUS_19160 52648 52995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence14 304 113 gene locus_tag LOCUS_19170 304 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1535 390 gene locus_tag LOCUS_19180 1535 390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681920.1 protein_id gnl|my_center|LOCUS_19180 2697 1522 gene locus_tag LOCUS_19190 2697 1522 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294551.1 protein_id gnl|my_center|LOCUS_19190 3458 2697 gene locus_tag LOCUS_19200 3458 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 4105 3488 gene locus_tag LOCUS_19210 4105 3488 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 protein_id gnl|my_center|LOCUS_19210 4338 4207 gene locus_tag LOCUS_19220 4338 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4930 4403 gene locus_tag LOCUS_19230 4930 4403 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_19230 6206 5007 gene locus_tag LOCUS_19240 6206 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 7495 6203 gene locus_tag LOCUS_19250 7495 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 7903 7712 gene locus_tag LOCUS_19260 7903 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 11079 8143 gene locus_tag LOCUS_19270 11079 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 13870 11273 gene locus_tag LOCUS_19280 13870 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 15671 13893 gene locus_tag LOCUS_19290 15671 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 16795 15701 gene locus_tag LOCUS_19300 16795 15701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 18079 16985 gene locus_tag LOCUS_19310 18079 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 18537 18223 gene locus_tag LOCUS_19320 18537 18223 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_19320 18734 20152 gene locus_tag LOCUS_19330 18734 20152 CDS product Sau3AI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068548.1 protein_id gnl|my_center|LOCUS_19330 21649 20300 gene locus_tag LOCUS_19340 gene dcm 21649 20300 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962895.1 protein_id gnl|my_center|LOCUS_19340 23124 21778 gene locus_tag LOCUS_19350 23124 21778 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_19350 23387 24751 gene locus_tag LOCUS_19360 23387 24751 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_19360 24873 25718 gene locus_tag LOCUS_19370 24873 25718 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476336.1 protein_id gnl|my_center|LOCUS_19370 25928 26662 gene locus_tag LOCUS_19380 25928 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 26823 27335 gene locus_tag LOCUS_19390 26823 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 27613 28590 gene locus_tag LOCUS_19400 27613 28590 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_19400 30114 28861 gene locus_tag LOCUS_19410 30114 28861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 35581 30176 gene locus_tag LOCUS_19420 35581 30176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 36517 35582 gene locus_tag LOCUS_19430 36517 35582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 37586 36867 gene locus_tag LOCUS_19440 37586 36867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 40832 37872 gene locus_tag LOCUS_19450 40832 37872 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808733.1 protein_id gnl|my_center|LOCUS_19450 41775 41050 gene locus_tag LOCUS_19460 41775 41050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 42331 41876 gene locus_tag LOCUS_19470 42331 41876 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135550050.1 protein_id gnl|my_center|LOCUS_19470 42930 42406 gene locus_tag LOCUS_19480 42930 42406 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 protein_id gnl|my_center|LOCUS_19480 43486 42959 gene locus_tag LOCUS_19490 43486 42959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036635.1 protein_id gnl|my_center|LOCUS_19490 44392 43850 gene locus_tag LOCUS_19500 44392 43850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 44888 44352 gene locus_tag LOCUS_19510 44888 44352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 46209 44890 gene locus_tag LOCUS_19520 46209 44890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 46855 46226 gene locus_tag LOCUS_19530 46855 46226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence15 852 85 gene locus_tag LOCUS_19540 852 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2396 1026 gene locus_tag LOCUS_19550 gene rlmD 2396 1026 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_19550 2732 2499 gene locus_tag LOCUS_19560 2732 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 5226 2908 gene locus_tag LOCUS_19570 gene pcrA 5226 2908 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_19570 5416 5994 gene locus_tag LOCUS_19580 5416 5994 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949129.1 protein_id gnl|my_center|LOCUS_19580 6448 6149 gene locus_tag LOCUS_19590 6448 6149 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_19590 7374 6532 gene locus_tag LOCUS_19600 7374 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 8690 7386 gene locus_tag LOCUS_19610 8690 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 9605 8730 gene locus_tag LOCUS_19620 gene hslO 9605 8730 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_19620 10524 9736 gene locus_tag LOCUS_19630 10524 9736 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_19630 10681 11649 gene locus_tag LOCUS_19640 10681 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 12200 11691 gene locus_tag LOCUS_19650 12200 11691 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_19650 12341 12535 gene locus_tag LOCUS_19660 12341 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 14190 12916 gene locus_tag LOCUS_19670 14190 12916 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_19670 15013 14387 gene locus_tag LOCUS_19680 15013 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 15181 15555 gene locus_tag LOCUS_19690 15181 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 15542 15694 gene locus_tag LOCUS_19700 15542 15694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 16035 16889 gene locus_tag LOCUS_19710 16035 16889 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_19710 16889 18274 gene locus_tag LOCUS_19720 gene gltA 16889 18274 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_19720 20500 18407 gene locus_tag LOCUS_19730 20500 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 20827 21207 gene locus_tag LOCUS_19740 20827 21207 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460706.1 protein_id gnl|my_center|LOCUS_19740 21264 21809 gene locus_tag LOCUS_19750 21264 21809 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence16 2483 1017 gene locus_tag LOCUS_19760 2483 1017 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_19760 4026 2473 gene locus_tag LOCUS_19770 4026 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770