>Feature sequence01 9458 8625 gene locus_tag LOCUS_00010 gene prmC 9458 8625 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_00010 10393 9458 gene locus_tag LOCUS_00020 10393 9458 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_00020 11850 10435 gene locus_tag LOCUS_00030 11850 10435 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_00030 12613 11924 gene locus_tag LOCUS_00040 12613 11924 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036073.1 protein_id gnl|my_center|LOCUS_00040 13933 12629 gene locus_tag LOCUS_00050 13933 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 15155 14124 gene locus_tag LOCUS_00060 15155 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 15808 15137 gene locus_tag LOCUS_00070 15808 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 15893 16564 gene locus_tag LOCUS_00080 15893 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 17768 16674 gene locus_tag LOCUS_00090 17768 16674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 18529 17759 gene locus_tag LOCUS_00100 18529 17759 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_00100 19143 18679 gene locus_tag LOCUS_00110 gene rimI 19143 18679 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546589.1 protein_id gnl|my_center|LOCUS_00110 20345 19140 gene locus_tag LOCUS_00120 gene alr 20345 19140 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_00120 20556 20332 gene locus_tag LOCUS_00130 20556 20332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 21106 20579 gene locus_tag LOCUS_00140 21106 20579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 21389 21314 gene locus_tag LOCUS_t00010 21389 21314 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 21534 21457 gene locus_tag LOCUS_t00020 21534 21457 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21622 21546 gene locus_tag LOCUS_t00030 21622 21546 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21702 21629 gene locus_tag LOCUS_t00040 21702 21629 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22889 21846 gene locus_tag LOCUS_00150 22889 21846 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_00150 24009 23038 gene locus_tag LOCUS_00160 24009 23038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 24571 23999 gene locus_tag LOCUS_00170 24571 23999 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669045.1 protein_id gnl|my_center|LOCUS_00170 25415 24573 gene locus_tag LOCUS_00180 25415 24573 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_00180 26313 25477 gene locus_tag LOCUS_00190 26313 25477 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932495.1 protein_id gnl|my_center|LOCUS_00190 27737 26337 gene locus_tag LOCUS_00200 gene citF 27737 26337 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_00200 28605 27730 gene locus_tag LOCUS_00210 28605 27730 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_00210 28872 28606 gene locus_tag LOCUS_00220 gene citD 28872 28606 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668023.1 protein_id gnl|my_center|LOCUS_00220 29048 30004 gene locus_tag LOCUS_00230 gene citC 29048 30004 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870396.1 protein_id gnl|my_center|LOCUS_00230 30027 30956 gene locus_tag LOCUS_00240 30027 30956 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_00240 30953 32704 gene locus_tag LOCUS_00250 30953 32704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32974 33399 gene locus_tag LOCUS_00260 gene glmS 32974 33399 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670492.1 protein_id gnl|my_center|LOCUS_00260 33396 34784 gene locus_tag LOCUS_00270 gene glmL 33396 34784 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_00270 34771 36222 gene locus_tag LOCUS_00280 34771 36222 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_00280 36279 37529 gene locus_tag LOCUS_00290 36279 37529 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_00290 38229 37588 gene locus_tag LOCUS_00300 38229 37588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 38114 39121 gene locus_tag LOCUS_00310 38114 39121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39304 39861 gene locus_tag LOCUS_00320 gene efp 39304 39861 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_00320 39921 40346 gene locus_tag LOCUS_00330 39921 40346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359049.1 protein_id gnl|my_center|LOCUS_00330 40625 41173 gene locus_tag LOCUS_00340 40625 41173 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_00340 41193 43493 gene locus_tag LOCUS_00350 41193 43493 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_00350 43733 44044 gene locus_tag LOCUS_00360 43733 44044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44211 45266 gene locus_tag LOCUS_00370 44211 45266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45863 45366 gene locus_tag LOCUS_00380 45863 45366 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_00380 47386 45986 gene locus_tag LOCUS_00390 47386 45986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47999 47406 gene locus_tag LOCUS_00400 gene rsxA 47999 47406 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_00400 48643 47996 gene locus_tag LOCUS_00410 48643 47996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49821 48640 gene locus_tag LOCUS_00420 49821 48640 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 protein_id gnl|my_center|LOCUS_00420 50864 49818 gene locus_tag LOCUS_00430 50864 49818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 51536 50877 gene locus_tag LOCUS_00440 gene rpe 51536 50877 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_00440 52306 51836 gene locus_tag LOCUS_00450 gene tadA 52306 51836 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_00450 53365 52319 gene locus_tag LOCUS_00460 53365 52319 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811640.1 protein_id gnl|my_center|LOCUS_00460 53637 53978 gene locus_tag LOCUS_00470 53637 53978 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_00470 53994 55931 gene locus_tag LOCUS_00480 53994 55931 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_00480 56263 56171 gene locus_tag LOCUS_t00050 56263 56171 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56396 56310 gene locus_tag LOCUS_t00060 56396 56310 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56688 56536 gene locus_tag LOCUS_00490 56688 56536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57243 56695 gene locus_tag LOCUS_00500 57243 56695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 58094 57492 gene locus_tag LOCUS_00510 58094 57492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58711 58091 gene locus_tag LOCUS_00520 58711 58091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59474 58698 gene locus_tag LOCUS_00530 59474 58698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60514 59609 gene locus_tag LOCUS_00540 60514 59609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 61217 60609 gene locus_tag LOCUS_00550 61217 60609 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291702.1 protein_id gnl|my_center|LOCUS_00550 63113 61983 gene locus_tag LOCUS_00560 63113 61983 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_00560 63556 63110 gene locus_tag LOCUS_00570 63556 63110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63782 63594 gene locus_tag LOCUS_00580 63782 63594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 63959 64816 gene locus_tag LOCUS_00590 63959 64816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_00590 64797 65444 gene locus_tag LOCUS_00600 64797 65444 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_00600 65441 65806 gene locus_tag LOCUS_00610 65441 65806 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167463.1 protein_id gnl|my_center|LOCUS_00610 66250 66786 gene locus_tag LOCUS_00620 66250 66786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66867 68270 gene locus_tag LOCUS_00630 66867 68270 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_00630 68295 69380 gene locus_tag LOCUS_00640 68295 69380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 69759 69424 gene locus_tag LOCUS_00650 69759 69424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70087 69848 gene locus_tag LOCUS_00660 70087 69848 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_00660 70461 71735 gene locus_tag LOCUS_00670 70461 71735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 71760 72293 gene locus_tag LOCUS_00680 71760 72293 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_00680 72382 73755 gene locus_tag LOCUS_00690 72382 73755 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_00690 73849 75189 gene locus_tag LOCUS_00700 73849 75189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 76598 75315 gene locus_tag LOCUS_00710 76598 75315 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_00710 76771 77607 gene locus_tag LOCUS_00720 76771 77607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 77723 78358 gene locus_tag LOCUS_00730 77723 78358 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_00730 78409 78783 gene locus_tag LOCUS_00740 78409 78783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 78860 79282 gene locus_tag LOCUS_00750 78860 79282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 80423 79611 gene locus_tag LOCUS_00760 80423 79611 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 protein_id gnl|my_center|LOCUS_00760 80889 80443 gene locus_tag LOCUS_00770 80889 80443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00770 81274 82473 gene locus_tag LOCUS_00780 81274 82473 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_00780 83492 82572 gene locus_tag LOCUS_00790 83492 82572 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 protein_id gnl|my_center|LOCUS_00790 84625 83543 gene locus_tag LOCUS_00800 84625 83543 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_00800 85700 84807 gene locus_tag LOCUS_00810 85700 84807 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_00810 85946 85870 gene locus_tag LOCUS_t00070 85946 85870 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 87301 86033 gene locus_tag LOCUS_00820 87301 86033 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704070.1 protein_id gnl|my_center|LOCUS_00820 87642 88028 gene locus_tag LOCUS_00830 87642 88028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 88053 88442 gene locus_tag LOCUS_00840 88053 88442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 90485 88524 gene locus_tag LOCUS_00850 90485 88524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_00850 92235 90478 gene locus_tag LOCUS_00860 92235 90478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_00860 92681 92223 gene locus_tag LOCUS_00870 92681 92223 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055872.1 protein_id gnl|my_center|LOCUS_00870 92963 93277 gene locus_tag LOCUS_00880 92963 93277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 93289 93960 gene locus_tag LOCUS_00890 93289 93960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 94104 94331 gene locus_tag LOCUS_00900 94104 94331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 95480 94443 gene locus_tag LOCUS_00910 gene gutB 95480 94443 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_00910 95705 96604 gene locus_tag LOCUS_00920 95705 96604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 97261 96725 gene locus_tag LOCUS_00930 gene spoVT 97261 96725 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_00930 98824 97430 gene locus_tag LOCUS_00940 98824 97430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 99552 98845 gene locus_tag LOCUS_00950 99552 98845 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_00950 99964 100431 gene locus_tag LOCUS_00960 99964 100431 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_00960 100448 101131 gene locus_tag LOCUS_00970 100448 101131 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_00970 102392 101184 gene locus_tag LOCUS_00980 102392 101184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 102992 103192 gene locus_tag LOCUS_00990 102992 103192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 105510 103477 gene locus_tag LOCUS_01000 105510 103477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 106151 105525 gene locus_tag LOCUS_01010 106151 105525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 106848 106144 gene locus_tag LOCUS_01020 106848 106144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 108809 107226 gene locus_tag LOCUS_01030 108809 107226 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_01030 109867 108830 gene locus_tag LOCUS_01040 109867 108830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 110687 109890 gene locus_tag LOCUS_01050 110687 109890 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_01050 111762 110689 gene locus_tag LOCUS_01060 111762 110689 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107643.1 protein_id gnl|my_center|LOCUS_01060 112823 111759 gene locus_tag LOCUS_01070 112823 111759 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025868262.1 protein_id gnl|my_center|LOCUS_01070 113950 112829 gene locus_tag LOCUS_01080 113950 112829 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679045.1 protein_id gnl|my_center|LOCUS_01080 115087 113966 gene locus_tag LOCUS_01090 115087 113966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 115889 115104 gene locus_tag LOCUS_01100 gene epsE 115889 115104 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_01100 116916 115900 gene locus_tag LOCUS_01110 116916 115900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 117663 117049 gene locus_tag LOCUS_01120 117663 117049 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_01120 118294 117656 gene locus_tag LOCUS_01130 118294 117656 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_01130 119418 118291 gene locus_tag LOCUS_01140 119418 118291 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_01140 121648 119708 gene locus_tag LOCUS_01150 121648 119708 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393552.1 protein_id gnl|my_center|LOCUS_01150 121885 122559 gene locus_tag LOCUS_01160 121885 122559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 123060 122650 gene locus_tag LOCUS_01170 123060 122650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 125057 123141 gene locus_tag LOCUS_01180 125057 123141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 125749 125054 gene locus_tag LOCUS_01190 125749 125054 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_01190 125994 126641 gene locus_tag LOCUS_01200 125994 126641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 126677 129253 gene locus_tag LOCUS_01210 gene clpB 126677 129253 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_01210 131470 129332 gene locus_tag LOCUS_01220 131470 129332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 131696 131613 gene locus_tag LOCUS_t00080 131696 131613 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 131838 133439 gene locus_tag LOCUS_01230 131838 133439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 133672 133890 gene locus_tag LOCUS_01240 133672 133890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 134107 135741 gene locus_tag LOCUS_01250 134107 135741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 135818 136165 gene locus_tag LOCUS_01260 135818 136165 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_01260 136185 136784 gene locus_tag LOCUS_01270 gene recR 136185 136784 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_01270 136847 137311 gene locus_tag LOCUS_01280 gene smpB 136847 137311 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_01280 137350 137697 gene locus_tag LOCUS_tm00010 137350 137697 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 138337 139005 gene locus_tag LOCUS_01290 138337 139005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 139002 141071 gene locus_tag LOCUS_01300 139002 141071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 141064 141933 gene locus_tag LOCUS_01310 gene cas7c 141064 141933 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384680.1 protein_id gnl|my_center|LOCUS_01310 143841 144164 gene locus_tag LOCUS_01320 143841 144164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 144584 145201 gene locus_tag LOCUS_01330 144584 145201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 145228 145755 gene locus_tag LOCUS_01340 145228 145755 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_01340 145852 146340 gene locus_tag LOCUS_01350 145852 146340 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_01350 146663 146391 gene locus_tag LOCUS_01360 146663 146391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 147501 146743 gene locus_tag LOCUS_01370 147501 146743 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_01370 148409 147537 gene locus_tag LOCUS_01380 148409 147537 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911764.1 protein_id gnl|my_center|LOCUS_01380 149545 148655 gene locus_tag LOCUS_01390 149545 148655 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_01390 149759 150610 gene locus_tag LOCUS_01400 149759 150610 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837501.1 protein_id gnl|my_center|LOCUS_01400 150681 151709 gene locus_tag LOCUS_01410 150681 151709 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_01410 151994 152638 gene locus_tag LOCUS_01420 151994 152638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 152777 153697 gene locus_tag LOCUS_01430 152777 153697 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_01430 153694 154590 gene locus_tag LOCUS_01440 153694 154590 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014849.1 protein_id gnl|my_center|LOCUS_01440 154600 155049 gene locus_tag LOCUS_01450 154600 155049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 155060 156028 gene locus_tag LOCUS_01460 155060 156028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 156205 156609 gene locus_tag LOCUS_01470 156205 156609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 156659 156862 gene locus_tag LOCUS_01480 156659 156862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_01480 156869 157567 gene locus_tag LOCUS_01490 156869 157567 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966304.1 protein_id gnl|my_center|LOCUS_01490 157564 158073 gene locus_tag LOCUS_01500 157564 158073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 158104 158814 gene locus_tag LOCUS_01510 158104 158814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_01510 158814 160409 gene locus_tag LOCUS_01520 158814 160409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_01520 161360 160530 gene locus_tag LOCUS_01530 161360 160530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 161598 161513 gene locus_tag LOCUS_t00090 161598 161513 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 161788 162483 gene locus_tag LOCUS_01540 gene tsaA 161788 162483 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_01540 162508 163401 gene locus_tag LOCUS_01550 162508 163401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 163482 164345 gene locus_tag LOCUS_01560 163482 164345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 164363 165223 gene locus_tag LOCUS_01570 164363 165223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 166018 165269 gene locus_tag LOCUS_01580 166018 165269 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_01580 167138 166041 gene locus_tag LOCUS_01590 gene galK 167138 166041 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_01590 167976 167302 gene locus_tag LOCUS_01600 167976 167302 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_01600 168136 169080 gene locus_tag LOCUS_01610 168136 169080 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_01610 169912 169154 gene locus_tag LOCUS_01620 169912 169154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730139.1 protein_id gnl|my_center|LOCUS_01620 170923 170033 gene locus_tag LOCUS_01630 170923 170033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 171063 174404 gene locus_tag LOCUS_01640 gene addB 171063 174404 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_01640 174391 177891 gene locus_tag LOCUS_01650 gene addA 174391 177891 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 protein_id gnl|my_center|LOCUS_01650 178021 178602 gene locus_tag LOCUS_01660 178021 178602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808298.1 protein_id gnl|my_center|LOCUS_01660 178884 179348 gene locus_tag LOCUS_01670 gene infC 178884 179348 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_01670 179400 179606 gene locus_tag LOCUS_01680 gene rpmI 179400 179606 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_01680 179677 180030 gene locus_tag LOCUS_01690 gene rplT 179677 180030 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_01690 180152 180937 gene locus_tag LOCUS_01700 180152 180937 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_01700 181014 182132 gene locus_tag LOCUS_01710 gene dprA 181014 182132 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_01710 182195 184321 gene locus_tag LOCUS_01720 gene topA 182195 184321 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_01720 184321 185619 gene locus_tag LOCUS_01730 gene trmFO 184321 185619 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645028.1 protein_id gnl|my_center|LOCUS_01730 185616 186608 gene locus_tag LOCUS_01740 gene plsX 185616 186608 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_01740 186612 187313 gene locus_tag LOCUS_01750 gene rnc 186612 187313 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_01750 187310 188314 gene locus_tag LOCUS_01760 187310 188314 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_01760 188401 191964 gene locus_tag LOCUS_01770 gene smc 188401 191964 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861158.1 protein_id gnl|my_center|LOCUS_01770 192041 193291 gene locus_tag LOCUS_01780 192041 193291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 193288 194061 gene locus_tag LOCUS_01790 193288 194061 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_01790 195541 194135 gene locus_tag LOCUS_01800 195541 194135 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054746.1 protein_id gnl|my_center|LOCUS_01800 195655 198201 gene locus_tag LOCUS_01810 195655 198201 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_01810 198909 198217 gene locus_tag LOCUS_01820 198909 198217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 199693 199157 gene locus_tag LOCUS_01830 199693 199157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 200777 199902 gene locus_tag LOCUS_01840 200777 199902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 201290 200850 gene locus_tag LOCUS_01850 201290 200850 CDS product DUF6323 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966705.1 protein_id gnl|my_center|LOCUS_01850 202491 201634 gene locus_tag LOCUS_01860 202491 201634 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948488.1 protein_id gnl|my_center|LOCUS_01860 202892 202665 gene locus_tag LOCUS_01870 202892 202665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 >Feature sequence02 <1 1002 gene locus_tag LOCUS_01880 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392748.1:6-phosphofructokinase 2178 1063 gene locus_tag LOCUS_01890 2178 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 2999 2205 gene locus_tag LOCUS_01900 2999 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4053 3256 gene locus_tag LOCUS_01910 4053 3256 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_01910 6452 4068 gene locus_tag LOCUS_01920 6452 4068 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_01920 7240 6449 gene locus_tag LOCUS_01930 gene recO 7240 6449 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 protein_id gnl|my_center|LOCUS_01930 7412 7194 gene locus_tag LOCUS_01940 7412 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 8411 7500 gene locus_tag LOCUS_01950 gene era 8411 7500 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_01950 8917 8426 gene locus_tag LOCUS_01960 gene ybeY 8917 8426 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_01960 9851 8871 gene locus_tag LOCUS_01970 9851 8871 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_01970 10105 10845 gene locus_tag LOCUS_01980 10105 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 10928 11500 gene locus_tag LOCUS_01990 10928 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 11658 11488 gene locus_tag LOCUS_02000 11658 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11996 11784 gene locus_tag LOCUS_02010 11996 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 12157 14052 gene locus_tag LOCUS_02020 12157 14052 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_02020 14049 14708 gene locus_tag LOCUS_02030 14049 14708 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904665.1 protein_id gnl|my_center|LOCUS_02030 15163 14696 gene locus_tag LOCUS_02040 15163 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 15199 15963 gene locus_tag LOCUS_02050 15199 15963 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_02050 15968 16909 gene locus_tag LOCUS_02060 15968 16909 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_02060 16906 17568 gene locus_tag LOCUS_02070 16906 17568 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429358.1 protein_id gnl|my_center|LOCUS_02070 18125 17625 gene locus_tag LOCUS_02080 18125 17625 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967909.1 protein_id gnl|my_center|LOCUS_02080 19177 18152 gene locus_tag LOCUS_02090 19177 18152 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_02090 19888 19250 gene locus_tag LOCUS_02100 19888 19250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02100 20017 19892 gene locus_tag LOCUS_02110 20017 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 20391 20227 gene locus_tag LOCUS_02120 20391 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 21106 20348 gene locus_tag LOCUS_02130 21106 20348 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_02130 21816 21214 gene locus_tag LOCUS_02140 21816 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 22285 22653 gene locus_tag LOCUS_02150 22285 22653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 22858 22785 gene locus_tag LOCUS_t00100 22858 22785 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25183 22901 gene locus_tag LOCUS_02160 25183 22901 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_02160 26369 25296 gene locus_tag LOCUS_02170 26369 25296 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_02170 26680 26474 gene locus_tag LOCUS_02180 26680 26474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 27137 26730 gene locus_tag LOCUS_02190 27137 26730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 27894 27208 gene locus_tag LOCUS_02200 27894 27208 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_02200 27991 28575 gene locus_tag LOCUS_02210 27991 28575 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_02210 29565 28615 gene locus_tag LOCUS_02220 29565 28615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 29922 30794 gene locus_tag LOCUS_02230 29922 30794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 31020 30865 gene locus_tag LOCUS_02240 31020 30865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 31345 31560 gene locus_tag LOCUS_02250 31345 31560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 31557 33980 gene locus_tag LOCUS_02260 31557 33980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 35182 34058 gene locus_tag LOCUS_02270 35182 34058 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949044.1 protein_id gnl|my_center|LOCUS_02270 35356 35192 gene locus_tag LOCUS_02280 35356 35192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 36341 35592 gene locus_tag LOCUS_02290 36341 35592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 39306 36475 gene locus_tag LOCUS_02300 gene uvrA 39306 36475 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_02300 41272 39257 gene locus_tag LOCUS_02310 gene uvrB 41272 39257 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_02310 44573 41472 gene locus_tag LOCUS_02320 44573 41472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 45167 44712 gene locus_tag LOCUS_02330 45167 44712 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964318.1 protein_id gnl|my_center|LOCUS_02330 45775 45182 gene locus_tag LOCUS_02340 45775 45182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 46518 45796 gene locus_tag LOCUS_02350 gene nadE 46518 45796 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869673.1 protein_id gnl|my_center|LOCUS_02350 47446 46535 gene locus_tag LOCUS_02360 gene trxB 47446 46535 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_02360 48772 47609 gene locus_tag LOCUS_02370 48772 47609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 52013 48795 gene locus_tag LOCUS_02380 52013 48795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 52306 52635 gene locus_tag LOCUS_02390 52306 52635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 52702 53433 gene locus_tag LOCUS_02400 52702 53433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 53455 54384 gene locus_tag LOCUS_02410 53455 54384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 57233 54504 gene locus_tag LOCUS_02420 57233 54504 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414652.1 protein_id gnl|my_center|LOCUS_02420 57877 57365 gene locus_tag LOCUS_02430 57877 57365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 59041 57893 gene locus_tag LOCUS_02440 59041 57893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 59712 59041 gene locus_tag LOCUS_02450 59712 59041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 60911 59820 gene locus_tag LOCUS_02460 gene ftsZ 60911 59820 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_02460 61988 61137 gene locus_tag LOCUS_02470 61988 61137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 63134 62010 gene locus_tag LOCUS_02480 gene murG 63134 62010 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130746.1 protein_id gnl|my_center|LOCUS_02480 64348 63170 gene locus_tag LOCUS_02490 gene ftsW 64348 63170 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_02490 65357 64380 gene locus_tag LOCUS_02500 gene mraY 65357 64380 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460699.1 protein_id gnl|my_center|LOCUS_02500 66750 65383 gene locus_tag LOCUS_02510 66750 65383 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_02510 68209 66770 gene locus_tag LOCUS_02520 68209 66770 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_02520 70432 68246 gene locus_tag LOCUS_02530 70432 68246 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_02530 71079 70594 gene locus_tag LOCUS_02540 71079 70594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 72040 71105 gene locus_tag LOCUS_02550 gene rsmH 72040 71105 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_02550 72468 72049 gene locus_tag LOCUS_02560 gene mraZ 72468 72049 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_02560 73042 72719 gene locus_tag LOCUS_02570 73042 72719 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 protein_id gnl|my_center|LOCUS_02570 73506 73042 gene locus_tag LOCUS_02580 73506 73042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 74012 73503 gene locus_tag LOCUS_02590 74012 73503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 74544 74071 gene locus_tag LOCUS_02600 74544 74071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 75051 74566 gene locus_tag LOCUS_02610 gene coaD 75051 74566 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_02610 75596 75048 gene locus_tag LOCUS_02620 gene rsmD 75596 75048 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_02620 <76439 75659 gene locus_tag LOCUS_02630 <76439 75659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963830.1:excinuclease ABC subunit UvrC >Feature sequence03 157 71 gene locus_tag LOCUS_t00110 157 71 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 395 2092 gene locus_tag LOCUS_02640 395 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2318 4186 gene locus_tag LOCUS_02650 2318 4186 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_02650 4493 5482 gene locus_tag LOCUS_02660 4493 5482 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729005.1 protein_id gnl|my_center|LOCUS_02660 5484 6584 gene locus_tag LOCUS_02670 5484 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 8016 6691 gene locus_tag LOCUS_02680 8016 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 8317 8547 gene locus_tag LOCUS_02690 8317 8547 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_02690 8910 8626 gene locus_tag LOCUS_02700 8910 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 9390 8980 gene locus_tag LOCUS_02710 9390 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 10184 9414 gene locus_tag LOCUS_02720 10184 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 10729 12756 gene locus_tag LOCUS_02730 10729 12756 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_02730 12957 13289 gene locus_tag LOCUS_02740 12957 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 13293 13562 gene locus_tag LOCUS_02750 13293 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 13889 14590 gene locus_tag LOCUS_02760 13889 14590 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 protein_id gnl|my_center|LOCUS_02760 15254 15412 gene locus_tag LOCUS_02770 15254 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 15480 15932 gene locus_tag LOCUS_02780 15480 15932 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_02780 17979 16267 gene locus_tag LOCUS_02790 17979 16267 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_02790 18653 18162 gene locus_tag LOCUS_02800 18653 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 19649 18882 gene locus_tag LOCUS_02810 19649 18882 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_02810 20185 19646 gene locus_tag LOCUS_02820 gene trmL 20185 19646 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_02820 22902 20182 gene locus_tag LOCUS_02830 gene secA 22902 20182 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_02830 23219 23911 gene locus_tag LOCUS_02840 23219 23911 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_02840 23932 24930 gene locus_tag LOCUS_02850 23932 24930 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_02850 25927 25202 gene locus_tag LOCUS_02860 25927 25202 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071300.1 protein_id gnl|my_center|LOCUS_02860 26598 25924 gene locus_tag LOCUS_02870 26598 25924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 27645 26791 gene locus_tag LOCUS_02880 27645 26791 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261968.1 protein_id gnl|my_center|LOCUS_02880 28551 28051 gene locus_tag LOCUS_02890 28551 28051 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_02890 29015 28548 gene locus_tag LOCUS_02900 29015 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 30775 29195 gene locus_tag LOCUS_02910 30775 29195 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_02910 31477 31064 gene locus_tag LOCUS_02920 31477 31064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 32770 31673 gene locus_tag LOCUS_02930 32770 31673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 33208 32960 gene locus_tag LOCUS_02940 33208 32960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 34991 33471 gene locus_tag LOCUS_02950 34991 33471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 36266 35748 gene locus_tag LOCUS_02960 36266 35748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 36465 36259 gene locus_tag LOCUS_02970 36465 36259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 36874 36518 gene locus_tag LOCUS_02980 36874 36518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 38271 36949 gene locus_tag LOCUS_02990 38271 36949 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_02990 38721 38518 gene locus_tag LOCUS_03000 38721 38518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 38959 38705 gene locus_tag LOCUS_03010 38959 38705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 39258 38956 gene locus_tag LOCUS_03020 39258 38956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 40720 41301 gene locus_tag LOCUS_03030 gene lexA 40720 41301 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_03030 42514 41384 gene locus_tag LOCUS_03040 gene tgt 42514 41384 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_03040 42994 43995 gene locus_tag LOCUS_03050 42994 43995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 45413 44166 gene locus_tag LOCUS_03060 45413 44166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 45640 47445 gene locus_tag LOCUS_03070 gene lepA 45640 47445 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_03070 47496 47960 gene locus_tag LOCUS_03080 47496 47960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 49359 48139 gene locus_tag LOCUS_03090 49359 48139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 49883 49392 gene locus_tag LOCUS_03100 49883 49392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 50709 51707 gene locus_tag LOCUS_03110 50709 51707 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_03110 51746 53503 gene locus_tag LOCUS_03120 51746 53503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 53797 54153 gene locus_tag LOCUS_03130 53797 54153 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_03130 54704 55801 gene locus_tag LOCUS_03140 gene rpoD 54704 55801 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_03140 56282 55944 gene locus_tag LOCUS_03150 56282 55944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 56433 58673 gene locus_tag LOCUS_03160 56433 58673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 59085 60086 gene locus_tag LOCUS_03170 59085 60086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 61600 60182 gene locus_tag LOCUS_03180 gene glgA 61600 60182 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_03180 62925 61810 gene locus_tag LOCUS_03190 gene glgD 62925 61810 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_03190 64100 62922 gene locus_tag LOCUS_03200 64100 62922 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_03200 66205 64313 gene locus_tag LOCUS_03210 gene glgB 66205 64313 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_03210 67288 67926 gene locus_tag LOCUS_03220 67288 67926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 68017 68298 gene locus_tag LOCUS_03230 68017 68298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 68295 68864 gene locus_tag LOCUS_03240 68295 68864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 70818 69043 gene locus_tag LOCUS_03250 70818 69043 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_03250 71263 71763 gene locus_tag LOCUS_03260 71263 71763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence04 382 948 gene locus_tag LOCUS_03270 382 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 941 1696 gene locus_tag LOCUS_03280 941 1696 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460112.1 protein_id gnl|my_center|LOCUS_03280 1766 2167 gene locus_tag LOCUS_03290 1766 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3109 2246 gene locus_tag LOCUS_03300 3109 2246 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 protein_id gnl|my_center|LOCUS_03300 3647 3273 gene locus_tag LOCUS_03310 3647 3273 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_03310 4177 3668 gene locus_tag LOCUS_03320 4177 3668 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_03320 4563 4195 gene locus_tag LOCUS_03330 4563 4195 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_03330 5666 4725 gene locus_tag LOCUS_03340 5666 4725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_03340 6808 5666 gene locus_tag LOCUS_03350 6808 5666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_03350 8343 6805 gene locus_tag LOCUS_03360 8343 6805 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_03360 9904 8606 gene locus_tag LOCUS_03370 9904 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 10686 10069 gene locus_tag LOCUS_03380 gene udk 10686 10069 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 protein_id gnl|my_center|LOCUS_03380 12010 10709 gene locus_tag LOCUS_03390 12010 10709 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_03390 12776 12030 gene locus_tag LOCUS_03400 gene deoD 12776 12030 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_03400 13375 12773 gene locus_tag LOCUS_03410 13375 12773 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210659.1 protein_id gnl|my_center|LOCUS_03410 14434 13520 gene locus_tag LOCUS_03420 14434 13520 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966679.1 protein_id gnl|my_center|LOCUS_03420 14574 15551 gene locus_tag LOCUS_03430 14574 15551 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815911.1 protein_id gnl|my_center|LOCUS_03430 15544 16776 gene locus_tag LOCUS_03440 15544 16776 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_03440 18443 16938 gene locus_tag LOCUS_03450 18443 16938 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_03450 21274 18671 gene locus_tag LOCUS_03460 21274 18671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 23542 21749 gene locus_tag LOCUS_03470 23542 21749 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_03470 23821 23737 gene locus_tag LOCUS_t00120 23821 23737 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 23932 23857 gene locus_tag LOCUS_t00130 23932 23857 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24195 25919 gene locus_tag LOCUS_03480 24195 25919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861067.1 protein_id gnl|my_center|LOCUS_03480 25916 27694 gene locus_tag LOCUS_03490 25916 27694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_03490 27711 28493 gene locus_tag LOCUS_03500 27711 28493 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263894.1 protein_id gnl|my_center|LOCUS_03500 28644 29465 gene locus_tag LOCUS_03510 28644 29465 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_03510 29481 29966 gene locus_tag LOCUS_03520 29481 29966 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_03520 29959 31137 gene locus_tag LOCUS_03530 29959 31137 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_03530 31140 32483 gene locus_tag LOCUS_03540 31140 32483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 32484 32948 gene locus_tag LOCUS_03550 32484 32948 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287575.1 protein_id gnl|my_center|LOCUS_03550 33012 33644 gene locus_tag LOCUS_03560 33012 33644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 33970 36006 gene locus_tag LOCUS_03570 33970 36006 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_03570 38298 36124 gene locus_tag LOCUS_03580 38298 36124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 39314 38295 gene locus_tag LOCUS_03590 39314 38295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 41748 39298 gene locus_tag LOCUS_03600 41748 39298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 42072 41779 gene locus_tag LOCUS_03610 42072 41779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 42239 42832 gene locus_tag LOCUS_03620 42239 42832 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 protein_id gnl|my_center|LOCUS_03620 45964 42896 gene locus_tag LOCUS_03630 45964 42896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 46347 45970 gene locus_tag LOCUS_03640 46347 45970 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461150.1 protein_id gnl|my_center|LOCUS_03640 46573 47289 gene locus_tag LOCUS_03650 46573 47289 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_03650 47995 47345 gene locus_tag LOCUS_03660 gene deoC 47995 47345 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130468.1 protein_id gnl|my_center|LOCUS_03660 48430 48017 gene locus_tag LOCUS_03670 48430 48017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 49816 48434 gene locus_tag LOCUS_03680 gene miaB 49816 48434 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_03680 49997 50353 gene locus_tag LOCUS_03690 49997 50353 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_03690 51275 50406 gene locus_tag LOCUS_03700 51275 50406 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_03700 52530 51286 gene locus_tag LOCUS_03710 52530 51286 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_03710 53146 52523 gene locus_tag LOCUS_03720 53146 52523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 54215 53229 gene locus_tag LOCUS_03730 gene pfkA 54215 53229 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_03730 54430 55605 gene locus_tag LOCUS_03740 54430 55605 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_03740 55702 56115 gene locus_tag LOCUS_03750 55702 56115 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 protein_id gnl|my_center|LOCUS_03750 56957 56163 gene locus_tag LOCUS_03760 56957 56163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965639.1 protein_id gnl|my_center|LOCUS_03760 57297 57055 gene locus_tag LOCUS_03770 57297 57055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 57608 57432 gene locus_tag LOCUS_03780 57608 57432 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_03780 57978 57799 gene locus_tag LOCUS_03790 57978 57799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 59195 58038 gene locus_tag LOCUS_03800 59195 58038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 60107 59214 gene locus_tag LOCUS_03810 60107 59214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 60590 60120 gene locus_tag LOCUS_03820 60590 60120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 60840 60580 gene locus_tag LOCUS_03830 60840 60580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 63426 60922 gene locus_tag LOCUS_03840 63426 60922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 63614 63964 gene locus_tag LOCUS_03850 gene perR 63614 63964 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_03850 64016 64549 gene locus_tag LOCUS_03860 64016 64549 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_03860 65650 64670 gene locus_tag LOCUS_03870 65650 64670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 65822 65897 gene locus_tag LOCUS_t00140 65822 65897 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 66165 66935 gene locus_tag LOCUS_03880 gene proB 66165 66935 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_03880 66940 68196 gene locus_tag LOCUS_03890 66940 68196 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255283.1 protein_id gnl|my_center|LOCUS_03890 68212 69012 gene locus_tag LOCUS_03900 gene proC 68212 69012 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_03900 69202 71292 gene locus_tag LOCUS_03910 69202 71292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence05 593 3235 gene locus_tag LOCUS_03920 gene alaS 593 3235 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_03920 3426 3764 gene locus_tag LOCUS_03930 3426 3764 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_03930 4100 4828 gene locus_tag LOCUS_03940 gene minD 4100 4828 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503310.1 protein_id gnl|my_center|LOCUS_03940 4856 5251 gene locus_tag LOCUS_03950 gene mgsA 4856 5251 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_03950 5349 6707 gene locus_tag LOCUS_03960 gene hisS 5349 6707 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_03960 7328 9103 gene locus_tag LOCUS_03970 gene aspS 7328 9103 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048075.1 protein_id gnl|my_center|LOCUS_03970 9278 9757 gene locus_tag LOCUS_03980 9278 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 9764 10411 gene locus_tag LOCUS_03990 9764 10411 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963740.1 protein_id gnl|my_center|LOCUS_03990 10436 11503 gene locus_tag LOCUS_04000 10436 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 11500 12120 gene locus_tag LOCUS_04010 11500 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 12232 13557 gene locus_tag LOCUS_04020 12232 13557 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_04020 13579 14646 gene locus_tag LOCUS_04030 13579 14646 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_04030 16921 15155 gene locus_tag LOCUS_04040 16921 15155 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_04040 17606 16983 gene locus_tag LOCUS_04050 17606 16983 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_04050 18011 17652 gene locus_tag LOCUS_04060 18011 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 18301 18020 gene locus_tag LOCUS_04070 18301 18020 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_04070 18627 19331 gene locus_tag LOCUS_04080 18627 19331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_04080 19354 22557 gene locus_tag LOCUS_04090 19354 22557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_04090 22707 22892 gene locus_tag LOCUS_04100 22707 22892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 23071 24213 gene locus_tag LOCUS_04110 gene rodA 23071 24213 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_04110 24230 25189 gene locus_tag LOCUS_04120 24230 25189 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_04120 25365 25790 gene locus_tag LOCUS_04130 gene tsaE 25365 25790 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_04130 25787 26497 gene locus_tag LOCUS_04140 gene tsaB 25787 26497 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_04140 26494 26931 gene locus_tag LOCUS_04150 gene rpiB 26494 26931 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_04150 27002 27634 gene locus_tag LOCUS_04160 gene upp 27002 27634 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 protein_id gnl|my_center|LOCUS_04160 27634 28062 gene locus_tag LOCUS_04170 gene ruvX 27634 28062 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719835.1 protein_id gnl|my_center|LOCUS_04170 29226 28117 gene locus_tag LOCUS_04180 29226 28117 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_04180 29708 29232 gene locus_tag LOCUS_04190 gene crtO 29708 29232 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_04190 30320 29727 gene locus_tag LOCUS_04200 30320 29727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 30514 31344 gene locus_tag LOCUS_04210 30514 31344 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028237.1 protein_id gnl|my_center|LOCUS_04210 31351 32748 gene locus_tag LOCUS_04220 gene dltA 31351 32748 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770518.1 protein_id gnl|my_center|LOCUS_04220 32745 32966 gene locus_tag LOCUS_04230 32745 32966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 33017 33259 gene locus_tag LOCUS_04240 33017 33259 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_04240 33349 33636 gene locus_tag LOCUS_04250 33349 33636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04250 33733 35526 gene locus_tag LOCUS_04260 gene pepF 33733 35526 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_04260 35852 36328 gene locus_tag LOCUS_04270 35852 36328 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574859.1 protein_id gnl|my_center|LOCUS_04270 36557 37732 gene locus_tag LOCUS_04280 36557 37732 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_04280 37788 38405 gene locus_tag LOCUS_04290 37788 38405 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_04290 38629 38465 gene locus_tag LOCUS_04300 38629 38465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 38767 40245 gene locus_tag LOCUS_04310 gene spoIVA 38767 40245 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_04310 40701 40297 gene locus_tag LOCUS_04320 40701 40297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 40876 42231 gene locus_tag LOCUS_04330 40876 42231 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_04330 42475 43023 gene locus_tag LOCUS_04340 42475 43023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 43171 43449 gene locus_tag LOCUS_04350 43171 43449 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_04350 43590 45152 gene locus_tag LOCUS_04360 43590 45152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 45778 45206 gene locus_tag LOCUS_04370 45778 45206 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 protein_id gnl|my_center|LOCUS_04370 45953 46684 gene locus_tag LOCUS_04380 45953 46684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 46868 47629 gene locus_tag LOCUS_04390 gene thyX 46868 47629 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421197.1 protein_id gnl|my_center|LOCUS_04390 47653 48180 gene locus_tag LOCUS_04400 47653 48180 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_04400 48442 48251 gene locus_tag LOCUS_04410 48442 48251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 48574 50085 gene locus_tag LOCUS_04420 48574 50085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 50273 50491 gene locus_tag LOCUS_04430 50273 50491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 50491 51636 gene locus_tag LOCUS_04440 50491 51636 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_04440 51870 52739 gene locus_tag LOCUS_04450 gene cdaA 51870 52739 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_04450 52732 53988 gene locus_tag LOCUS_04460 52732 53988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 54068 55654 gene locus_tag LOCUS_04470 54068 55654 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_04470 55651 56082 gene locus_tag LOCUS_04480 55651 56082 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571271.1 protein_id gnl|my_center|LOCUS_04480 56676 56200 gene locus_tag LOCUS_04490 56676 56200 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027567.1 protein_id gnl|my_center|LOCUS_04490 56958 56707 gene locus_tag LOCUS_04500 56958 56707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04500 57195 57010 gene locus_tag LOCUS_04510 57195 57010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 57343 57251 gene locus_tag LOCUS_t00150 57343 57251 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57545 59578 gene locus_tag LOCUS_04520 57545 59578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 60976 59651 gene locus_tag LOCUS_04530 60976 59651 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388389.1 protein_id gnl|my_center|LOCUS_04530 62037 61186 gene locus_tag LOCUS_04540 62037 61186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 62199 62633 gene locus_tag LOCUS_04550 62199 62633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 62794 64284 gene locus_tag LOCUS_04560 62794 64284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 64921 64343 gene locus_tag LOCUS_04570 64921 64343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 65129 67033 gene locus_tag LOCUS_04580 65129 67033 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011178617.1 protein_id gnl|my_center|LOCUS_04580 67036 67326 gene locus_tag LOCUS_04590 67036 67326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 67329 67517 gene locus_tag LOCUS_04600 67329 67517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 68151 67624 gene locus_tag LOCUS_04610 68151 67624 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_04610 68635 68165 gene locus_tag LOCUS_04620 68635 68165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476113.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence06 527 889 gene locus_tag LOCUS_04630 527 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 1052 1960 gene locus_tag LOCUS_04640 gene fabG 1052 1960 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_04640 3261 2038 gene locus_tag LOCUS_04650 gene tyrS 3261 2038 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367412.1 protein_id gnl|my_center|LOCUS_04650 5260 3596 gene locus_tag LOCUS_04660 gene recN 5260 3596 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986438.1 protein_id gnl|my_center|LOCUS_04660 5737 5288 gene locus_tag LOCUS_04670 5737 5288 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_04670 6631 5750 gene locus_tag LOCUS_04680 6631 5750 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_04680 7455 6628 gene locus_tag LOCUS_04690 7455 6628 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_04690 9302 7452 gene locus_tag LOCUS_04700 gene dxs 9302 7452 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460263.1 protein_id gnl|my_center|LOCUS_04700 10168 9305 gene locus_tag LOCUS_04710 10168 9305 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_04710 10368 10183 gene locus_tag LOCUS_04720 10368 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 11585 10365 gene locus_tag LOCUS_04730 gene xseA 11585 10365 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_04730 12531 11596 gene locus_tag LOCUS_04740 12531 11596 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_04740 12943 12509 gene locus_tag LOCUS_04750 gene nusB 12943 12509 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_04750 16152 13159 gene locus_tag LOCUS_04760 16152 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 17648 16149 gene locus_tag LOCUS_04770 17648 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 21391 17825 gene locus_tag LOCUS_04780 21391 17825 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_04780 22789 21413 gene locus_tag LOCUS_04790 22789 21413 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_04790 23713 22793 gene locus_tag LOCUS_04800 gene whiA 23713 22793 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_04800 24637 23729 gene locus_tag LOCUS_04810 gene murB 24637 23729 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_04810 25626 24652 gene locus_tag LOCUS_04820 gene hprK 25626 24652 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_04820 25961 29506 gene locus_tag LOCUS_04830 gene nifJ 25961 29506 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_04830 30107 29577 gene locus_tag LOCUS_04840 30107 29577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 30610 30104 gene locus_tag LOCUS_04850 30610 30104 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_04850 30688 31437 gene locus_tag LOCUS_04860 30688 31437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 32082 31474 gene locus_tag LOCUS_04870 gene plsY 32082 31474 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256563.1 protein_id gnl|my_center|LOCUS_04870 33981 32227 gene locus_tag LOCUS_04880 33981 32227 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_04880 34767 34003 gene locus_tag LOCUS_04890 34767 34003 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_04890 35461 34751 gene locus_tag LOCUS_04900 35461 34751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 35748 35542 gene locus_tag LOCUS_04910 35748 35542 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_04910 36474 35839 gene locus_tag LOCUS_04920 gene nth 36474 35839 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_04920 36603 37025 gene locus_tag LOCUS_04930 36603 37025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 37098 37174 gene locus_tag LOCUS_t00160 37098 37174 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 39020 37305 gene locus_tag LOCUS_04940 39020 37305 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_04940 40840 39014 gene locus_tag LOCUS_04950 40840 39014 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_04950 41708 40920 gene locus_tag LOCUS_04960 41708 40920 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_04960 43137 41740 gene locus_tag LOCUS_04970 43137 41740 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_04970 43256 43528 gene locus_tag LOCUS_04980 43256 43528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 43613 43942 gene locus_tag LOCUS_04990 43613 43942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 44189 44515 gene locus_tag LOCUS_05000 44189 44515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 45859 44579 gene locus_tag LOCUS_05010 45859 44579 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 protein_id gnl|my_center|LOCUS_05010 47221 46148 gene locus_tag LOCUS_05020 47221 46148 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_05020 47562 48113 gene locus_tag LOCUS_05030 47562 48113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 48110 48904 gene locus_tag LOCUS_05040 48110 48904 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_05040 49743 48970 gene locus_tag LOCUS_05050 49743 48970 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_05050 50671 49730 gene locus_tag LOCUS_05060 50671 49730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_05060 51652 50681 gene locus_tag LOCUS_05070 gene trpX 51652 50681 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792167.1 protein_id gnl|my_center|LOCUS_05070 53108 52239 gene locus_tag LOCUS_05080 gene eutC 53108 52239 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904029.1 protein_id gnl|my_center|LOCUS_05080 54499 53129 gene locus_tag LOCUS_05090 54499 53129 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462273.1 protein_id gnl|my_center|LOCUS_05090 56041 54632 gene locus_tag LOCUS_05100 56041 54632 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966007.1 protein_id gnl|my_center|LOCUS_05100 56639 56034 gene locus_tag LOCUS_05110 56639 56034 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_05110 57250 56663 gene locus_tag LOCUS_05120 57250 56663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 59377 57554 gene locus_tag LOCUS_05130 gene typA 59377 57554 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_05130 59754 59512 gene locus_tag LOCUS_05140 59754 59512 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 protein_id gnl|my_center|LOCUS_05140 59985 60173 gene locus_tag LOCUS_05150 59985 60173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 60173 60427 gene locus_tag LOCUS_05160 60173 60427 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964646.1 protein_id gnl|my_center|LOCUS_05160 60433 61032 gene locus_tag LOCUS_05170 60433 61032 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence07 335 183 gene locus_tag LOCUS_05180 335 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 655 731 gene locus_tag LOCUS_t00170 655 731 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 732 806 gene locus_tag LOCUS_t00180 732 806 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 926 1666 gene locus_tag LOCUS_05190 926 1666 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_05190 3240 1765 gene locus_tag LOCUS_05200 gene guaB 3240 1765 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_05200 4783 3488 gene locus_tag LOCUS_05210 gene serS 4783 3488 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_05210 5661 4801 gene locus_tag LOCUS_05220 gene spo0J 5661 4801 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_05220 6439 5663 gene locus_tag LOCUS_05230 gene soj 6439 5663 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_05230 7555 6683 gene locus_tag LOCUS_05240 gene noc 7555 6683 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990072.1 protein_id gnl|my_center|LOCUS_05240 7828 8307 gene locus_tag LOCUS_05250 7828 8307 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809105.1 protein_id gnl|my_center|LOCUS_05250 8320 8535 gene locus_tag LOCUS_05260 8320 8535 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 protein_id gnl|my_center|LOCUS_05260 8535 8948 gene locus_tag LOCUS_05270 8535 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 8945 9391 gene locus_tag LOCUS_05280 8945 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 9473 9907 gene locus_tag LOCUS_05290 9473 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 11161 9989 gene locus_tag LOCUS_05300 11161 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 11660 11496 gene locus_tag LOCUS_05310 11660 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12569 11859 gene locus_tag LOCUS_05320 gene rsmG 12569 11859 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288804.1 protein_id gnl|my_center|LOCUS_05320 14447 12579 gene locus_tag LOCUS_05330 gene mnmG 14447 12579 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_05330 15835 14471 gene locus_tag LOCUS_05340 gene mnmE 15835 14471 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_05340 17128 15995 gene locus_tag LOCUS_05350 17128 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 18249 17143 gene locus_tag LOCUS_05360 18249 17143 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_05360 18879 18532 gene locus_tag LOCUS_05370 18879 18532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 19107 18967 gene locus_tag LOCUS_05380 gene rpmH 19107 18967 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568442.1 protein_id gnl|my_center|LOCUS_05380 19630 20535 gene locus_tag LOCUS_05390 19630 20535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 20727 22067 gene locus_tag LOCUS_05400 gene dnaA 20727 22067 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_05400 22372 23475 gene locus_tag LOCUS_05410 gene dnaN 22372 23475 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_05410 23521 23808 gene locus_tag LOCUS_05420 23521 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 23805 24914 gene locus_tag LOCUS_05430 gene recF 23805 24914 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_05430 24934 25194 gene locus_tag LOCUS_05440 24934 25194 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_05440 25251 27200 gene locus_tag LOCUS_05450 gene gyrB 25251 27200 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_05450 27216 28025 gene locus_tag LOCUS_05460 27216 28025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 28078 30675 gene locus_tag LOCUS_05470 gene gyrA 28078 30675 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_05470 30931 31149 gene locus_tag LOCUS_05480 30931 31149 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_05480 31115 31297 gene locus_tag LOCUS_05490 31115 31297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 31630 31442 gene locus_tag LOCUS_05500 31630 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 35531 32067 gene locus_tag LOCUS_05510 gene mfd 35531 32067 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_05510 36247 35627 gene locus_tag LOCUS_05520 gene pth 36247 35627 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_05520 36764 36273 gene locus_tag LOCUS_05530 36764 36273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 39382 36785 gene locus_tag LOCUS_05540 gene polA 39382 36785 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 protein_id gnl|my_center|LOCUS_05540 39527 40552 gene locus_tag LOCUS_05550 39527 40552 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110022974.1 protein_id gnl|my_center|LOCUS_05550 40552 41520 gene locus_tag LOCUS_05560 gene dusB 40552 41520 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_05560 41937 43055 gene locus_tag LOCUS_05570 gene hemW 41937 43055 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729894.1 protein_id gnl|my_center|LOCUS_05570 43153 43935 gene locus_tag LOCUS_05580 43153 43935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 43958 44209 gene locus_tag LOCUS_05590 43958 44209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 44270 45673 gene locus_tag LOCUS_05600 44270 45673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 45703 47133 gene locus_tag LOCUS_05610 45703 47133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 47180 47389 gene locus_tag LOCUS_05620 47180 47389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 48447 47314 gene locus_tag LOCUS_05630 48447 47314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 48601 49758 gene locus_tag LOCUS_05640 48601 49758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 49848 50135 gene locus_tag LOCUS_05650 49848 50135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 50961 50176 gene locus_tag LOCUS_05660 50961 50176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 51145 51411 gene locus_tag LOCUS_05670 gene rpsT 51145 51411 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_05670 51963 51514 gene locus_tag LOCUS_05680 gene spoVAC 51963 51514 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_05680 52057 52434 gene locus_tag LOCUS_05690 52057 52434 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437532.1 protein_id gnl|my_center|LOCUS_05690 52431 52796 gene locus_tag LOCUS_05700 52431 52796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 52980 54002 gene locus_tag LOCUS_05710 gene spoVAD 52980 54002 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_05710 54002 54355 gene locus_tag LOCUS_05720 gene spoVAE 54002 54355 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_05720 56450 54432 gene locus_tag LOCUS_05730 56450 54432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 57522 56998 gene locus_tag LOCUS_05740 57522 56998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 58412 57519 gene locus_tag LOCUS_05750 58412 57519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 59580 58549 gene locus_tag LOCUS_05760 59580 58549 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964555.1 protein_id gnl|my_center|LOCUS_05760 60395 59973 gene locus_tag LOCUS_05770 60395 59973 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence08 271 507 gene locus_tag LOCUS_05780 271 507 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_05780 504 2558 gene locus_tag LOCUS_05790 gene feoB 504 2558 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_05790 2623 3003 gene locus_tag LOCUS_05800 2623 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3022 3555 gene locus_tag LOCUS_05810 3022 3555 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_05810 3692 4270 gene locus_tag LOCUS_05820 3692 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4409 5296 gene locus_tag LOCUS_05830 4409 5296 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_05830 5297 6157 gene locus_tag LOCUS_05840 5297 6157 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_05840 6749 6270 gene locus_tag LOCUS_05850 6749 6270 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242923.1 protein_id gnl|my_center|LOCUS_05850 7220 6786 gene locus_tag LOCUS_05860 7220 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 7694 7224 gene locus_tag LOCUS_05870 7694 7224 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_05870 8106 7855 gene locus_tag LOCUS_05880 8106 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 8391 9824 gene locus_tag LOCUS_05890 8391 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 10046 9970 gene locus_tag LOCUS_t00190 10046 9970 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10184 10582 gene locus_tag LOCUS_05900 10184 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643513.1 protein_id gnl|my_center|LOCUS_05900 10607 11491 gene locus_tag LOCUS_05910 10607 11491 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_05910 12642 11671 gene locus_tag LOCUS_05920 12642 11671 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888286.1 protein_id gnl|my_center|LOCUS_05920 13958 12639 gene locus_tag LOCUS_05930 13958 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 15959 14238 gene locus_tag LOCUS_05940 15959 14238 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_05940 16857 15973 gene locus_tag LOCUS_05950 16857 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 17113 18438 gene locus_tag LOCUS_05960 gene mtaB 17113 18438 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048000.1 protein_id gnl|my_center|LOCUS_05960 18438 18992 gene locus_tag LOCUS_05970 18438 18992 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_05970 18985 19548 gene locus_tag LOCUS_05980 18985 19548 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_05980 19724 19800 gene locus_tag LOCUS_t00200 19724 19800 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 19805 19880 gene locus_tag LOCUS_t00210 19805 19880 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20080 23013 gene locus_tag LOCUS_05990 gene ygfK 20080 23013 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_05990 23428 23763 gene locus_tag LOCUS_06000 23428 23763 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814298.1 protein_id gnl|my_center|LOCUS_06000 23766 24548 gene locus_tag LOCUS_06010 gene rlmB 23766 24548 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_06010 24583 27168 gene locus_tag LOCUS_06020 24583 27168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 27493 29256 gene locus_tag LOCUS_06030 27493 29256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 30064 29336 gene locus_tag LOCUS_06040 30064 29336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 30647 30201 gene locus_tag LOCUS_06050 30647 30201 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_06050 31770 30871 gene locus_tag LOCUS_06060 31770 30871 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_06060 32016 32357 gene locus_tag LOCUS_06070 32016 32357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 32344 32646 gene locus_tag LOCUS_06080 32344 32646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 32627 33055 gene locus_tag LOCUS_06090 32627 33055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 33052 33852 gene locus_tag LOCUS_06100 gene atpB 33052 33852 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_06100 33900 34166 gene locus_tag LOCUS_06110 gene atpE 33900 34166 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_06110 34228 34713 gene locus_tag LOCUS_06120 34228 34713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 34721 35260 gene locus_tag LOCUS_06130 34721 35260 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_06130 35283 36794 gene locus_tag LOCUS_06140 gene atpA 35283 36794 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966151.1 protein_id gnl|my_center|LOCUS_06140 36807 37727 gene locus_tag LOCUS_06150 gene atpG 36807 37727 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_06150 37741 38154 gene locus_tag LOCUS_06160 37741 38154 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966148.1 protein_id gnl|my_center|LOCUS_06160 38175 39572 gene locus_tag LOCUS_06170 gene atpD 38175 39572 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161587876.1 protein_id gnl|my_center|LOCUS_06170 39819 41522 gene locus_tag LOCUS_06180 39819 41522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 41708 43150 gene locus_tag LOCUS_06190 41708 43150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 43230 44831 gene locus_tag LOCUS_06200 43230 44831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 45407 44886 gene locus_tag LOCUS_06210 45407 44886 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_06210 45826 45404 gene locus_tag LOCUS_06220 45826 45404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 46144 46386 gene locus_tag LOCUS_06230 46144 46386 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_06230 47256 46456 gene locus_tag LOCUS_06240 47256 46456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 47423 47929 gene locus_tag LOCUS_06250 47423 47929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 48618 47983 gene locus_tag LOCUS_06260 48618 47983 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433837.1 protein_id gnl|my_center|LOCUS_06260 49306 48698 gene locus_tag LOCUS_06270 49306 48698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 49967 49338 gene locus_tag LOCUS_06280 49967 49338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 50444 50028 gene locus_tag LOCUS_06290 50444 50028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 51261 50596 gene locus_tag LOCUS_06300 51261 50596 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890745.1 protein_id gnl|my_center|LOCUS_06300 51849 51304 gene locus_tag LOCUS_06310 51849 51304 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_06310 52047 52232 gene locus_tag LOCUS_06320 52047 52232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 52392 54059 gene locus_tag LOCUS_06330 52392 54059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 54056 55309 gene locus_tag LOCUS_06340 54056 55309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 55306 55935 gene locus_tag LOCUS_06350 55306 55935 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883952.1 protein_id gnl|my_center|LOCUS_06350 56285 57256 gene locus_tag LOCUS_06360 56285 57256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 57273 57557 gene locus_tag LOCUS_06370 57273 57557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence09 141 974 gene locus_tag LOCUS_06380 141 974 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_06380 1008 2291 gene locus_tag LOCUS_06390 1008 2291 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_06390 2370 4124 gene locus_tag LOCUS_06400 2370 4124 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_06400 4145 4939 gene locus_tag LOCUS_06410 gene mazG 4145 4939 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_06410 4996 5271 gene locus_tag LOCUS_06420 4996 5271 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_06420 5344 5586 gene locus_tag LOCUS_06430 5344 5586 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966486.1 protein_id gnl|my_center|LOCUS_06430 5701 5964 gene locus_tag LOCUS_06440 5701 5964 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_06440 5967 6632 gene locus_tag LOCUS_06450 5967 6632 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_06450 6934 6596 gene locus_tag LOCUS_06460 6934 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 7772 8083 gene locus_tag LOCUS_06470 gene rpsJ 7772 8083 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_06470 8161 8859 gene locus_tag LOCUS_06480 gene rplC 8161 8859 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_06480 8878 9504 gene locus_tag LOCUS_06490 gene rplD 8878 9504 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_06490 9501 9797 gene locus_tag LOCUS_06500 gene rplW 9501 9797 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_06500 9812 10645 gene locus_tag LOCUS_06510 gene rplB 9812 10645 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_06510 10670 10951 gene locus_tag LOCUS_06520 gene rpsS 10670 10951 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_06520 10972 11307 gene locus_tag LOCUS_06530 gene rplV 10972 11307 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183025.1 protein_id gnl|my_center|LOCUS_06530 11324 12016 gene locus_tag LOCUS_06540 gene rpsC 11324 12016 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 12016 12444 gene locus_tag LOCUS_06550 gene rplP 12016 12444 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_06550 12441 12641 gene locus_tag LOCUS_06560 gene rpmC 12441 12641 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_06560 12661 12921 gene locus_tag LOCUS_06570 gene rpsQ 12661 12921 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_06570 12952 13320 gene locus_tag LOCUS_06580 gene rplN 12952 13320 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_06580 13333 13650 gene locus_tag LOCUS_06590 gene rplX 13333 13650 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_06590 13667 14206 gene locus_tag LOCUS_06600 gene rplE 13667 14206 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_06600 14225 14410 gene locus_tag LOCUS_06610 14225 14410 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_06610 14437 14835 gene locus_tag LOCUS_06620 gene rpsH 14437 14835 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_06620 14852 15397 gene locus_tag LOCUS_06630 gene rplF 14852 15397 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_06630 15414 15773 gene locus_tag LOCUS_06640 gene rplR 15414 15773 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_06640 15789 16289 gene locus_tag LOCUS_06650 gene rpsE 15789 16289 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_06650 16304 16483 gene locus_tag LOCUS_06660 gene rpmD 16304 16483 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567529.1 protein_id gnl|my_center|LOCUS_06660 16503 16943 gene locus_tag LOCUS_06670 gene rplO 16503 16943 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_06670 16946 18241 gene locus_tag LOCUS_06680 gene secY 16946 18241 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810127.1 protein_id gnl|my_center|LOCUS_06680 18259 18891 gene locus_tag LOCUS_06690 18259 18891 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_06690 18895 19647 gene locus_tag LOCUS_06700 gene map 18895 19647 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_06700 19657 19905 gene locus_tag LOCUS_06710 19657 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 19908 20126 gene locus_tag LOCUS_06720 gene infA 19908 20126 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_06720 20284 20652 gene locus_tag LOCUS_06730 gene rpsM 20284 20652 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_06730 20668 21069 gene locus_tag LOCUS_06740 gene rpsK 20668 21069 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_06740 21108 21734 gene locus_tag LOCUS_06750 gene rpsD 21108 21734 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_06750 21797 22747 gene locus_tag LOCUS_06760 21797 22747 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_06760 22768 23109 gene locus_tag LOCUS_06770 gene rplQ 22768 23109 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_06770 23960 23184 gene locus_tag LOCUS_06780 23960 23184 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_06780 25023 24073 gene locus_tag LOCUS_06790 25023 24073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 25248 26636 gene locus_tag LOCUS_06800 25248 26636 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_06800 26729 27058 gene locus_tag LOCUS_06810 26729 27058 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_06810 27055 27492 gene locus_tag LOCUS_06820 gene spoIIAB 27055 27492 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_06820 27494 28177 gene locus_tag LOCUS_06830 gene sigF 27494 28177 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_06830 29903 28167 gene locus_tag LOCUS_06840 gene feoB 29903 28167 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012939559.1 protein_id gnl|my_center|LOCUS_06840 29985 32513 gene locus_tag LOCUS_06850 29985 32513 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_06850 32661 32736 gene locus_tag LOCUS_t00220 32661 32736 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 33972 32830 gene locus_tag LOCUS_06860 33972 32830 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_06860 34178 33987 gene locus_tag LOCUS_06870 34178 33987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 35604 34198 gene locus_tag LOCUS_06880 35604 34198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399445.1 protein_id gnl|my_center|LOCUS_06880 36710 39931 gene locus_tag LOCUS_06890 36710 39931 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_06890 39945 40598 gene locus_tag LOCUS_06900 39945 40598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 40598 41566 gene locus_tag LOCUS_06910 40598 41566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 41589 43751 gene locus_tag LOCUS_06920 41589 43751 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555499.1 protein_id gnl|my_center|LOCUS_06920 43773 44279 gene locus_tag LOCUS_06930 43773 44279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 44263 47307 gene locus_tag LOCUS_06940 44263 47307 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_06940 47438 48604 gene locus_tag LOCUS_06950 47438 48604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 49236 55139 gene locus_tag LOCUS_06960 49236 55139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence10 <1 733 gene locus_tag LOCUS_06970 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064307.1:BMP family ABC transporter substrate-binding protein 891 2429 gene locus_tag LOCUS_06980 891 2429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_06980 2422 3534 gene locus_tag LOCUS_06990 2422 3534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_06990 3534 4520 gene locus_tag LOCUS_07000 3534 4520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_07000 4716 6434 gene locus_tag LOCUS_07010 4716 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 6599 7885 gene locus_tag LOCUS_07020 6599 7885 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_07020 7955 8746 gene locus_tag LOCUS_07030 7955 8746 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_07030 8757 9242 gene locus_tag LOCUS_07040 gene rlmH 8757 9242 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_07040 9263 11494 gene locus_tag LOCUS_07050 gene gyrA 9263 11494 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656784.1 protein_id gnl|my_center|LOCUS_07050 11523 11822 gene locus_tag LOCUS_07060 11523 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12072 12317 gene locus_tag LOCUS_07070 12072 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 13216 12413 gene locus_tag LOCUS_07080 13216 12413 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_07080 14241 13225 gene locus_tag LOCUS_07090 gene dacB 14241 13225 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_07090 14823 14374 gene locus_tag LOCUS_07100 gene ytfJ 14823 14374 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_07100 15457 14804 gene locus_tag LOCUS_07110 15457 14804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 16057 15479 gene locus_tag LOCUS_07120 gene scpB 16057 15479 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_07120 16805 16038 gene locus_tag LOCUS_07130 16805 16038 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_07130 17523 16837 gene locus_tag LOCUS_07140 17523 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 17787 17975 gene locus_tag LOCUS_07150 gene rpmB 17787 17975 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_07150 18465 18103 gene locus_tag LOCUS_07160 18465 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 19118 18462 gene locus_tag LOCUS_07170 gene plsY 19118 18462 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_07170 20470 19142 gene locus_tag LOCUS_07180 gene der 20470 19142 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_07180 21828 20491 gene locus_tag LOCUS_07190 21828 20491 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_07190 22151 21966 gene locus_tag LOCUS_07200 gene rpmF 22151 21966 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774376.1 protein_id gnl|my_center|LOCUS_07200 22686 22186 gene locus_tag LOCUS_07210 22686 22186 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_07210 23539 22859 gene locus_tag LOCUS_07220 gene radC 23539 22859 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_07220 23629 24594 gene locus_tag LOCUS_07230 23629 24594 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_07230 25558 24641 gene locus_tag LOCUS_07240 25558 24641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 29875 25574 gene locus_tag LOCUS_07250 29875 25574 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_07250 30916 29879 gene locus_tag LOCUS_07260 gene ispG 30916 29879 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 protein_id gnl|my_center|LOCUS_07260 31950 30922 gene locus_tag LOCUS_07270 gene rseP 31950 30922 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_07270 33102 31963 gene locus_tag LOCUS_07280 33102 31963 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_07280 33996 33181 gene locus_tag LOCUS_07290 33996 33181 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_07290 34698 34015 gene locus_tag LOCUS_07300 34698 34015 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969256.1 protein_id gnl|my_center|LOCUS_07300 35279 34725 gene locus_tag LOCUS_07310 gene frr 35279 34725 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985763.1 protein_id gnl|my_center|LOCUS_07310 36072 35365 gene locus_tag LOCUS_07320 gene pyrH 36072 35365 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_07320 36804 36256 gene locus_tag LOCUS_07330 36804 36256 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_07330 38156 36801 gene locus_tag LOCUS_07340 38156 36801 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989691.1 protein_id gnl|my_center|LOCUS_07340 39207 38287 gene locus_tag LOCUS_07350 gene tsf 39207 38287 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_07350 39935 39210 gene locus_tag LOCUS_07360 gene rpsB 39935 39210 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_07360 40529 40212 gene locus_tag LOCUS_07370 40529 40212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 40742 41554 gene locus_tag LOCUS_07380 gene sigG 40742 41554 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_07380 41602 42186 gene locus_tag LOCUS_07390 gene pcp 41602 42186 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379057.1 protein_id gnl|my_center|LOCUS_07390 43487 42231 gene locus_tag LOCUS_07400 43487 42231 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_07400 44693 43677 gene locus_tag LOCUS_07410 gene mnmA 44693 43677 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_07410 45414 44809 gene locus_tag LOCUS_07420 gene lepB 45414 44809 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_07420 45591 46274 gene locus_tag LOCUS_07430 45591 46274 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_07430 46271 46651 gene locus_tag LOCUS_07440 46271 46651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 47205 46693 gene locus_tag LOCUS_07450 47205 46693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 47285 51025 gene locus_tag LOCUS_07460 47285 51025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence11 <1 855 gene locus_tag LOCUS_07470 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016301.1:iron ABC transporter permease 873 1946 gene locus_tag LOCUS_07480 873 1946 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_07480 2615 2124 gene locus_tag LOCUS_07490 gene ybaK 2615 2124 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_07490 3451 2621 gene locus_tag LOCUS_07500 3451 2621 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920018.1 protein_id gnl|my_center|LOCUS_07500 4749 3451 gene locus_tag LOCUS_07510 4749 3451 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582614.1 protein_id gnl|my_center|LOCUS_07510 5657 4776 gene locus_tag LOCUS_07520 5657 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5976 7016 gene locus_tag LOCUS_07530 gene hrcA 5976 7016 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_07530 7016 7567 gene locus_tag LOCUS_07540 7016 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 7642 9507 gene locus_tag LOCUS_07550 gene dnaK 7642 9507 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_07550 9624 10790 gene locus_tag LOCUS_07560 gene dnaJ 9624 10790 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_07560 10794 11714 gene locus_tag LOCUS_07570 gene prmA 10794 11714 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_07570 12160 11873 gene locus_tag LOCUS_07580 gene spoVG 12160 11873 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814955.1 protein_id gnl|my_center|LOCUS_07580 12316 13683 gene locus_tag LOCUS_07590 gene murC 12316 13683 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_07590 13696 14085 gene locus_tag LOCUS_07600 13696 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14834 14166 gene locus_tag LOCUS_07610 14834 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 16691 15030 gene locus_tag LOCUS_07620 gene glnS 16691 15030 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454579.1 protein_id gnl|my_center|LOCUS_07620 18353 16707 gene locus_tag LOCUS_07630 18353 16707 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_07630 18588 19061 gene locus_tag LOCUS_07640 18588 19061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 19054 20301 gene locus_tag LOCUS_07650 19054 20301 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_07650 21251 20418 gene locus_tag LOCUS_07660 21251 20418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 22175 21375 gene locus_tag LOCUS_07670 22175 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_07670 22876 22160 gene locus_tag LOCUS_07680 22876 22160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_07680 23241 22882 gene locus_tag LOCUS_07690 gene stsR 23241 22882 CDS product GntR family transcriptional regulator StsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262158.1 protein_id gnl|my_center|LOCUS_07690 24840 23494 gene locus_tag LOCUS_07700 gene gdhA 24840 23494 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_07700 26185 26430 gene locus_tag LOCUS_07710 26185 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 27080 26592 gene locus_tag LOCUS_07720 gene eetB 27080 26592 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_07720 27457 27077 gene locus_tag LOCUS_07730 27457 27077 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_07730 28438 27638 gene locus_tag LOCUS_07740 28438 27638 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_07740 29046 28453 gene locus_tag LOCUS_07750 gene rsxA 29046 28453 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_07750 29731 29039 gene locus_tag LOCUS_07760 29731 29039 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_07760 31001 29736 gene locus_tag LOCUS_07770 31001 29736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 31942 30998 gene locus_tag LOCUS_07780 31942 30998 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_07780 33285 31942 gene locus_tag LOCUS_07790 gene rsxC 33285 31942 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_07790 33642 34724 gene locus_tag LOCUS_07800 33642 34724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 34988 36043 gene locus_tag LOCUS_07810 34988 36043 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461454.1 protein_id gnl|my_center|LOCUS_07810 36215 36856 gene locus_tag LOCUS_07820 36215 36856 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_07820 38681 37218 gene locus_tag LOCUS_07830 gene cls 38681 37218 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_07830 39058 39975 gene locus_tag LOCUS_07840 39058 39975 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_07840 40338 40955 gene locus_tag LOCUS_07850 40338 40955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 42055 40952 gene locus_tag LOCUS_07860 42055 40952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 42433 42215 gene locus_tag LOCUS_07870 42433 42215 CDS product BhlA/UviB family holin-like peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397083.1 protein_id gnl|my_center|LOCUS_07870 42982 42452 gene locus_tag LOCUS_07880 gene tcdR 42982 42452 CDS product glycosylating toxin sigma factor TcdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434528.1 protein_id gnl|my_center|LOCUS_07880 43205 43130 gene locus_tag LOCUS_t00230 43205 43130 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 43387 43701 gene locus_tag LOCUS_07890 43387 43701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 43810 44997 gene locus_tag LOCUS_07900 43810 44997 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_07900 46474 45413 gene locus_tag LOCUS_07910 46474 45413 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence12 1154 327 gene locus_tag LOCUS_07920 1154 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1985 3181 gene locus_tag LOCUS_07930 1985 3181 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986881.1 protein_id gnl|my_center|LOCUS_07930 4149 3262 gene locus_tag LOCUS_07940 4149 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4701 4321 gene locus_tag LOCUS_07950 4701 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5670 4783 gene locus_tag LOCUS_07960 gene rsmA 5670 4783 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_07960 6350 5685 gene locus_tag LOCUS_07970 6350 5685 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_07970 6494 7036 gene locus_tag LOCUS_07980 6494 7036 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816703.1 protein_id gnl|my_center|LOCUS_07980 7550 7239 gene locus_tag LOCUS_07990 7550 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7672 8577 gene locus_tag LOCUS_08000 7672 8577 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_08000 8567 9244 gene locus_tag LOCUS_08010 gene sfsA 8567 9244 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_08010 9292 9378 gene locus_tag LOCUS_t00240 9292 9378 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9654 10373 gene locus_tag LOCUS_08020 gene tepA 9654 10373 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_08020 10373 10576 gene locus_tag LOCUS_08030 10373 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 10641 11504 gene locus_tag LOCUS_08040 gene uppP 10641 11504 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_08040 11705 14461 gene locus_tag LOCUS_08050 11705 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 14480 15382 gene locus_tag LOCUS_08060 gene ftsY 14480 15382 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_08060 15721 16317 gene locus_tag LOCUS_08070 15721 16317 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_08070 16329 16625 gene locus_tag LOCUS_08080 gene yhbY 16329 16625 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_08080 16673 17236 gene locus_tag LOCUS_08090 gene nadD 16673 17236 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_08090 17286 18269 gene locus_tag LOCUS_08100 17286 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 18269 18907 gene locus_tag LOCUS_08110 gene yqeK 18269 18907 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360010.1 protein_id gnl|my_center|LOCUS_08110 18897 19256 gene locus_tag LOCUS_08120 gene rsfS 18897 19256 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_08120 19857 22256 gene locus_tag LOCUS_08130 gene leuS 19857 22256 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_08130 23610 22360 gene locus_tag LOCUS_08140 23610 22360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 23898 24413 gene locus_tag LOCUS_08150 23898 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 24555 25010 gene locus_tag LOCUS_08160 24555 25010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 26454 25084 gene locus_tag LOCUS_08170 26454 25084 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 protein_id gnl|my_center|LOCUS_08170 27029 26493 gene locus_tag LOCUS_08180 gene pyrR 27029 26493 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_08180 27359 27910 gene locus_tag LOCUS_08190 27359 27910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 27907 29166 gene locus_tag LOCUS_08200 27907 29166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 30261 29305 gene locus_tag LOCUS_08210 30261 29305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 30667 30248 gene locus_tag LOCUS_08220 30667 30248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 31227 30664 gene locus_tag LOCUS_08230 31227 30664 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704720.1 protein_id gnl|my_center|LOCUS_08230 31840 31361 gene locus_tag LOCUS_08240 31840 31361 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_08240 32559 33350 gene locus_tag LOCUS_08250 32559 33350 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267147.1 protein_id gnl|my_center|LOCUS_08250 34285 33392 gene locus_tag LOCUS_08260 34285 33392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 34388 34918 gene locus_tag LOCUS_08270 34388 34918 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_08270 34983 35066 gene locus_tag LOCUS_t00250 34983 35066 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35183 36085 gene locus_tag LOCUS_08280 35183 36085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 38470 36644 gene locus_tag LOCUS_08290 gene glmS 38470 36644 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_08290 39974 38700 gene locus_tag LOCUS_08300 39974 38700 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205037.1 protein_id gnl|my_center|LOCUS_08300 42386 40947 gene locus_tag LOCUS_08310 gene purB 42386 40947 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_08310 44146 42533 gene locus_tag LOCUS_08320 gene pyrG 44146 42533 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence13 35 877 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccctcctcacggagggcgtggattgaaat 1385 1011 gene locus_tag LOCUS_08330 gene rplL 1385 1011 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421186.1 protein_id gnl|my_center|LOCUS_08330 1963 1436 gene locus_tag LOCUS_08340 gene rplJ 1963 1436 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287282.1 protein_id gnl|my_center|LOCUS_08340 3502 2174 gene locus_tag LOCUS_08350 3502 2174 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393008.1 protein_id gnl|my_center|LOCUS_08350 3734 4414 gene locus_tag LOCUS_08360 3734 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4640 4428 gene locus_tag LOCUS_08370 4640 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4598 5158 gene locus_tag LOCUS_08380 4598 5158 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_08380 7809 5224 gene locus_tag LOCUS_08390 7809 5224 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_08390 8881 7946 gene locus_tag LOCUS_08400 gene fba 8881 7946 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_08400 10012 9170 gene locus_tag LOCUS_08410 10012 9170 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_08410 10360 10620 gene locus_tag LOCUS_08420 10360 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 11124 10630 gene locus_tag LOCUS_08430 11124 10630 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948450.1 protein_id gnl|my_center|LOCUS_08430 12518 11187 gene locus_tag LOCUS_08440 12518 11187 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_08440 12816 13157 gene locus_tag LOCUS_08450 12816 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 13195 13386 gene locus_tag LOCUS_08460 13195 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 14236 13421 gene locus_tag LOCUS_08470 14236 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 14845 14243 gene locus_tag LOCUS_08480 14845 14243 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004289236.1 protein_id gnl|my_center|LOCUS_08480 15030 15914 gene locus_tag LOCUS_08490 15030 15914 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101278.1 protein_id gnl|my_center|LOCUS_08490 16714 15980 gene locus_tag LOCUS_08500 16714 15980 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_08500 17817 16810 gene locus_tag LOCUS_08510 17817 16810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114797.1 protein_id gnl|my_center|LOCUS_08510 18629 17823 gene locus_tag LOCUS_08520 18629 17823 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479788.1 protein_id gnl|my_center|LOCUS_08520 19531 18635 gene locus_tag LOCUS_08530 19531 18635 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770467.1 protein_id gnl|my_center|LOCUS_08530 20815 19625 gene locus_tag LOCUS_08540 20815 19625 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870212.1 protein_id gnl|my_center|LOCUS_08540 21070 22299 gene locus_tag LOCUS_08550 gene pepT 21070 22299 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_08550 23676 22438 gene locus_tag LOCUS_08560 23676 22438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 24284 24529 gene locus_tag LOCUS_08570 24284 24529 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_08570 24544 24843 gene locus_tag LOCUS_08580 24544 24843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 26670 25024 gene locus_tag LOCUS_08590 gene groL 26670 25024 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_08590 26995 26708 gene locus_tag LOCUS_08600 26995 26708 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_08600 27804 27121 gene locus_tag LOCUS_08610 gene trmB 27804 27121 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965915.1 protein_id gnl|my_center|LOCUS_08610 28589 27804 gene locus_tag LOCUS_08620 28589 27804 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_08620 30535 28589 gene locus_tag LOCUS_08630 gene metG 30535 28589 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_08630 31863 30559 gene locus_tag LOCUS_08640 31863 30559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 32046 32498 gene locus_tag LOCUS_08650 32046 32498 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_08650 32512 32934 gene locus_tag LOCUS_08660 32512 32934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 34661 32985 gene locus_tag LOCUS_08670 34661 32985 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_08670 35533 34700 gene locus_tag LOCUS_08680 35533 34700 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_08680 35749 36699 gene locus_tag LOCUS_08690 35749 36699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 38673 36757 gene locus_tag LOCUS_08700 gene htpG 38673 36757 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_08700 38856 40031 gene locus_tag LOCUS_08710 38856 40031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 40848 40081 gene locus_tag LOCUS_08720 40848 40081 CDS product 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964779.1 protein_id gnl|my_center|LOCUS_08720 41758 40979 gene locus_tag LOCUS_08730 41758 40979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 42070 42654 gene locus_tag LOCUS_08740 42070 42654 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence14 482 96 gene locus_tag LOCUS_08750 482 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 576 830 gene locus_tag LOCUS_08760 576 830 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_08760 823 1143 gene locus_tag LOCUS_08770 823 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2892 1405 gene locus_tag LOCUS_08780 2892 1405 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_08780 5403 3076 gene locus_tag LOCUS_08790 5403 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5649 6200 gene locus_tag LOCUS_08800 5649 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6464 6388 gene locus_tag LOCUS_t00260 6464 6388 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7653 6613 gene locus_tag LOCUS_08810 7653 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 7828 8331 gene locus_tag LOCUS_08820 gene cobO 7828 8331 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_08820 8799 9116 gene locus_tag LOCUS_08830 8799 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 9944 9243 gene locus_tag LOCUS_08840 9944 9243 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898686.1 protein_id gnl|my_center|LOCUS_08840 10830 9928 gene locus_tag LOCUS_08850 10830 9928 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 protein_id gnl|my_center|LOCUS_08850 11299 10835 gene locus_tag LOCUS_08860 gene mscL 11299 10835 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 protein_id gnl|my_center|LOCUS_08860 12772 11324 gene locus_tag LOCUS_08870 12772 11324 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_08870 14135 12777 gene locus_tag LOCUS_08880 gene trkA 14135 12777 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_08880 14860 14264 gene locus_tag LOCUS_08890 14860 14264 CDS product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 protein_id gnl|my_center|LOCUS_08890 15060 15920 gene locus_tag LOCUS_08900 15060 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 16553 16134 gene locus_tag LOCUS_08910 16553 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 17565 16540 gene locus_tag LOCUS_08920 gene galE 17565 16540 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_08920 19041 17671 gene locus_tag LOCUS_08930 gene rlmD 19041 17671 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_08930 20480 19050 gene locus_tag LOCUS_08940 20480 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 21895 20495 gene locus_tag LOCUS_08950 21895 20495 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_08950 23415 22027 gene locus_tag LOCUS_08960 23415 22027 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811050.1 protein_id gnl|my_center|LOCUS_08960 24379 23516 gene locus_tag LOCUS_08970 24379 23516 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792714.1 protein_id gnl|my_center|LOCUS_08970 24509 24697 gene locus_tag LOCUS_08980 24509 24697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 25215 24694 gene locus_tag LOCUS_08990 gene yfbR 25215 24694 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705878.1 protein_id gnl|my_center|LOCUS_08990 25593 28136 gene locus_tag LOCUS_09000 25593 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 28230 29294 gene locus_tag LOCUS_09010 28230 29294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 29791 29360 gene locus_tag LOCUS_09020 29791 29360 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948707.1 protein_id gnl|my_center|LOCUS_09020 30298 29837 gene locus_tag LOCUS_09030 30298 29837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 32360 30375 gene locus_tag LOCUS_09040 gene fusA 32360 30375 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_09040 32739 32972 gene locus_tag LOCUS_09050 32739 32972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 33969 33091 gene locus_tag LOCUS_09060 33969 33091 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_09060 34296 34018 gene locus_tag LOCUS_09070 34296 34018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 35011 34286 gene locus_tag LOCUS_09080 35011 34286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 35246 35067 gene locus_tag LOCUS_09090 35246 35067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 38579 35259 gene locus_tag LOCUS_09100 38579 35259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 39405 38989 gene locus_tag LOCUS_09110 39405 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_09110 40795 39461 gene locus_tag LOCUS_09120 40795 39461 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722393.1 protein_id gnl|my_center|LOCUS_09120 42098 40902 gene locus_tag LOCUS_09130 gene dacF 42098 40902 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831996.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence15 442 657 gene locus_tag LOCUS_09140 442 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 871 1020 gene locus_tag LOCUS_09150 gene rpmG 871 1020 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_09150 1040 1261 gene locus_tag LOCUS_09160 1040 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1282 1803 gene locus_tag LOCUS_09170 gene nusG 1282 1803 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_09170 1945 2370 gene locus_tag LOCUS_09180 gene rplK 1945 2370 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_09180 2389 3081 gene locus_tag LOCUS_09190 gene rplA 2389 3081 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_09190 3596 3162 gene locus_tag LOCUS_09200 3596 3162 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245754.1 protein_id gnl|my_center|LOCUS_09200 3862 3623 gene locus_tag LOCUS_09210 3862 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 4474 3941 gene locus_tag LOCUS_09220 4474 3941 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_09220 5015 6076 gene locus_tag LOCUS_09230 5015 6076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_09230 6073 6897 gene locus_tag LOCUS_09240 6073 6897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_09240 6894 7682 gene locus_tag LOCUS_09250 6894 7682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_09250 7684 8916 gene locus_tag LOCUS_09260 7684 8916 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964155.1 protein_id gnl|my_center|LOCUS_09260 9263 11494 gene locus_tag LOCUS_09270 9263 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 11737 12780 gene locus_tag LOCUS_09280 11737 12780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963501.1 protein_id gnl|my_center|LOCUS_09280 12800 14755 gene locus_tag LOCUS_09290 12800 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 14769 15782 gene locus_tag LOCUS_09300 14769 15782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682379.1 protein_id gnl|my_center|LOCUS_09300 15748 17361 gene locus_tag LOCUS_09310 15748 17361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 17358 17582 gene locus_tag LOCUS_09320 17358 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 17741 18436 gene locus_tag LOCUS_09330 gene sigK 17741 18436 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_09330 18426 18689 gene locus_tag LOCUS_09340 18426 18689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 18701 19909 gene locus_tag LOCUS_09350 18701 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 20010 20465 gene locus_tag LOCUS_09360 20010 20465 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_09360 20466 21383 gene locus_tag LOCUS_09370 20466 21383 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_09370 21569 22153 gene locus_tag LOCUS_09380 gene thiT 21569 22153 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_09380 22268 24874 gene locus_tag LOCUS_09390 gene mutS 22268 24874 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_09390 24890 26878 gene locus_tag LOCUS_09400 gene mutL 24890 26878 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_09400 26875 27828 gene locus_tag LOCUS_09410 gene miaA 26875 27828 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_09410 27825 29048 gene locus_tag LOCUS_09420 27825 29048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 29026 29739 gene locus_tag LOCUS_09430 29026 29739 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_09430 29769 30245 gene locus_tag LOCUS_09440 gene sepF 29769 30245 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416162.1 protein_id gnl|my_center|LOCUS_09440 30279 30884 gene locus_tag LOCUS_09450 30279 30884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 30909 33674 gene locus_tag LOCUS_09460 gene ileS 30909 33674 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_09460 33736 34272 gene locus_tag LOCUS_09470 gene lspA 33736 34272 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_09470 34265 35179 gene locus_tag LOCUS_09480 34265 35179 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_09480 35179 35994 gene locus_tag LOCUS_09490 35179 35994 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583591.1 protein_id gnl|my_center|LOCUS_09490 35987 36388 gene locus_tag LOCUS_09500 35987 36388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 36511 36586 gene locus_tag LOCUS_t00270 36511 36586 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 36590 36665 gene locus_tag LOCUS_t00280 36590 36665 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 36708 36782 gene locus_tag LOCUS_t00290 36708 36782 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 36838 37245 gene locus_tag LOCUS_09510 36838 37245 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_09510 37339 38346 gene locus_tag LOCUS_09520 gene ansA 37339 38346 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 protein_id gnl|my_center|LOCUS_09520 38362 39042 gene locus_tag LOCUS_09530 38362 39042 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_09530 39055 39579 gene locus_tag LOCUS_09540 39055 39579 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence16 835 284 gene locus_tag LOCUS_09550 835 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1190 1522 gene locus_tag LOCUS_09560 1190 1522 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_09560 3722 2217 gene locus_tag LOCUS_09570 gene gpmI 3722 2217 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_09570 4780 4013 gene locus_tag LOCUS_09580 gene tpiA 4780 4013 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_09580 6058 4865 gene locus_tag LOCUS_09590 6058 4865 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_09590 6484 7323 gene locus_tag LOCUS_09600 6484 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7588 7427 gene locus_tag LOCUS_09610 7588 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 7518 8534 gene locus_tag LOCUS_09620 7518 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 8733 9692 gene locus_tag LOCUS_09630 8733 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 9892 11142 gene locus_tag LOCUS_09640 9892 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 14549 11235 gene locus_tag LOCUS_09650 14549 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 15829 14654 gene locus_tag LOCUS_09660 gene thiI 15829 14654 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_09660 17048 15915 gene locus_tag LOCUS_09670 17048 15915 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_09670 18180 17263 gene locus_tag LOCUS_09680 18180 17263 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_09680 18509 19234 gene locus_tag LOCUS_09690 18509 19234 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482805.1 protein_id gnl|my_center|LOCUS_09690 19284 20744 gene locus_tag LOCUS_09700 19284 20744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 21672 20818 gene locus_tag LOCUS_09710 21672 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 22403 21669 gene locus_tag LOCUS_09720 22403 21669 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_09720 23000 22422 gene locus_tag LOCUS_09730 23000 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 23173 24162 gene locus_tag LOCUS_09740 23173 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 24199 25356 gene locus_tag LOCUS_09750 24199 25356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 25467 26693 gene locus_tag LOCUS_09760 25467 26693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 26898 28988 gene locus_tag LOCUS_09770 26898 28988 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_09770 29061 30272 gene locus_tag LOCUS_09780 29061 30272 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807909.1 protein_id gnl|my_center|LOCUS_09780 30894 30355 gene locus_tag LOCUS_09790 30894 30355 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828569.1 protein_id gnl|my_center|LOCUS_09790 31032 32144 gene locus_tag LOCUS_09800 31032 32144 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_09800 33727 32231 gene locus_tag LOCUS_09810 gene glpK 33727 32231 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_09810 33851 34777 gene locus_tag LOCUS_09820 33851 34777 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_09820 35352 36878 gene locus_tag LOCUS_09830 gene guaA 35352 36878 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence17 2065 542 gene locus_tag LOCUS_09840 2065 542 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_09840 3527 2436 gene locus_tag LOCUS_09850 3527 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5297 3585 gene locus_tag LOCUS_09860 5297 3585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485152.1 protein_id gnl|my_center|LOCUS_09860 6876 5380 gene locus_tag LOCUS_09870 6876 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 8423 6879 gene locus_tag LOCUS_09880 8423 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 9269 8439 gene locus_tag LOCUS_09890 9269 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 10032 9286 gene locus_tag LOCUS_09900 10032 9286 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_09900 11107 10313 gene locus_tag LOCUS_09910 11107 10313 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157662.1 protein_id gnl|my_center|LOCUS_09910 12035 11100 gene locus_tag LOCUS_09920 12035 11100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563799.1 protein_id gnl|my_center|LOCUS_09920 13138 12215 gene locus_tag LOCUS_09930 13138 12215 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_09930 14324 13311 gene locus_tag LOCUS_09940 14324 13311 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_09940 14547 14419 gene locus_tag LOCUS_09950 14547 14419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 15553 14798 gene locus_tag LOCUS_09960 15553 14798 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_09960 17461 15773 gene locus_tag LOCUS_09970 17461 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 17823 19127 gene locus_tag LOCUS_09980 17823 19127 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_09980 20581 19229 gene locus_tag LOCUS_09990 gene brnQ 20581 19229 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_09990 21050 21331 gene locus_tag LOCUS_10000 21050 21331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 21335 22162 gene locus_tag LOCUS_10010 gene rlmA 21335 22162 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_10010 22166 22426 gene locus_tag LOCUS_10020 22166 22426 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_10020 23705 22500 gene locus_tag LOCUS_10030 23705 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 25407 23710 gene locus_tag LOCUS_10040 25407 23710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 26316 25414 gene locus_tag LOCUS_10050 26316 25414 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_10050 27353 26316 gene locus_tag LOCUS_10060 27353 26316 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_10060 29980 27416 gene locus_tag LOCUS_10070 29980 27416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 32731 30209 gene locus_tag LOCUS_10080 32731 30209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 33504 33139 gene locus_tag LOCUS_10090 33504 33139 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459713.1 protein_id gnl|my_center|LOCUS_10090 33834 33625 gene locus_tag LOCUS_10100 33834 33625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 34099 34758 gene locus_tag LOCUS_10110 gene cysE 34099 34758 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071396735.1 protein_id gnl|my_center|LOCUS_10110 35074 36471 gene locus_tag LOCUS_10120 gene cysS 35074 36471 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048360.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence18 541 62 gene locus_tag LOCUS_10130 541 62 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645445.1 protein_id gnl|my_center|LOCUS_10130 662 898 gene locus_tag LOCUS_10140 662 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 900 1325 gene locus_tag LOCUS_10150 900 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1329 1784 gene locus_tag LOCUS_10160 1329 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2550 1828 gene locus_tag LOCUS_10170 2550 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680349.1 protein_id gnl|my_center|LOCUS_10170 2715 3371 gene locus_tag LOCUS_10180 2715 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3799 3515 gene locus_tag LOCUS_10190 3799 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4779 4201 gene locus_tag LOCUS_10200 gene eutD 4779 4201 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889877.1 protein_id gnl|my_center|LOCUS_10200 5606 4866 gene locus_tag LOCUS_10210 5606 4866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061295975.1 protein_id gnl|my_center|LOCUS_10210 6328 5603 gene locus_tag LOCUS_10220 6328 5603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948430.1 protein_id gnl|my_center|LOCUS_10220 6984 6532 gene locus_tag LOCUS_10230 6984 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7495 7181 gene locus_tag LOCUS_10240 7495 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 7759 7511 gene locus_tag LOCUS_10250 7759 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 7937 8353 gene locus_tag LOCUS_10260 7937 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 8374 8745 gene locus_tag LOCUS_10270 8374 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 8761 9060 gene locus_tag LOCUS_10280 8761 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 9057 9581 gene locus_tag LOCUS_10290 9057 9581 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_10290 10327 9836 gene locus_tag LOCUS_10300 10327 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 11419 10352 gene locus_tag LOCUS_10310 gene orr 11419 10352 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_10310 12693 11437 gene locus_tag LOCUS_10320 12693 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 13044 12757 gene locus_tag LOCUS_10330 13044 12757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 13405 13106 gene locus_tag LOCUS_10340 13405 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 16934 13443 gene locus_tag LOCUS_10350 16934 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 21024 16918 gene locus_tag LOCUS_10360 21024 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 23125 21176 gene locus_tag LOCUS_10370 23125 21176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 26665 23156 gene locus_tag LOCUS_10380 26665 23156 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175155.1 protein_id gnl|my_center|LOCUS_10380 29005 26681 gene locus_tag LOCUS_10390 29005 26681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 29947 29387 gene locus_tag LOCUS_10400 29947 29387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 35782 30218 gene locus_tag LOCUS_10410 35782 30218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence19 67 1575 gene locus_tag LOCUS_10420 67 1575 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_10420 3595 1646 gene locus_tag LOCUS_10430 3595 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3936 3861 gene locus_tag LOCUS_t00300 3936 3861 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4280 4504 gene locus_tag LOCUS_10440 4280 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5094 4657 gene locus_tag LOCUS_10450 5094 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 7113 5353 gene locus_tag LOCUS_10460 7113 5353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_10460 7938 7195 gene locus_tag LOCUS_10470 7938 7195 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 protein_id gnl|my_center|LOCUS_10470 8947 7931 gene locus_tag LOCUS_10480 8947 7931 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_10480 11265 9055 gene locus_tag LOCUS_10490 11265 9055 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_10490 11905 11408 gene locus_tag LOCUS_10500 11905 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 12416 11931 gene locus_tag LOCUS_10510 12416 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 12640 13125 gene locus_tag LOCUS_10520 12640 13125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 14679 13351 gene locus_tag LOCUS_10530 14679 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 14916 15671 gene locus_tag LOCUS_10540 14916 15671 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458912.1 protein_id gnl|my_center|LOCUS_10540 15668 16174 gene locus_tag LOCUS_10550 15668 16174 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485423.1 protein_id gnl|my_center|LOCUS_10550 16310 16981 gene locus_tag LOCUS_10560 16310 16981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_10560 17058 18413 gene locus_tag LOCUS_10570 17058 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 18601 21219 gene locus_tag LOCUS_10580 18601 21219 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_10580 21285 22571 gene locus_tag LOCUS_10590 21285 22571 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_10590 22637 23152 gene locus_tag LOCUS_10600 22637 23152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 23237 23662 gene locus_tag LOCUS_10610 23237 23662 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_10610 23895 25055 gene locus_tag LOCUS_10620 23895 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 25666 25944 gene locus_tag LOCUS_10630 25666 25944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 25941 27272 gene locus_tag LOCUS_10640 25941 27272 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_10640 27523 29796 gene locus_tag LOCUS_10650 27523 29796 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_10650 29978 30385 gene locus_tag LOCUS_10660 29978 30385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 30902 30426 gene locus_tag LOCUS_10670 30902 30426 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047822.1 protein_id gnl|my_center|LOCUS_10670 31070 31606 gene locus_tag LOCUS_10680 31070 31606 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_10680 31612 31827 gene locus_tag LOCUS_10690 31612 31827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 33066 31906 gene locus_tag LOCUS_10700 gene metK 33066 31906 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_10700 33652 33326 gene locus_tag LOCUS_10710 33652 33326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 34693 33713 gene locus_tag LOCUS_10720 34693 33713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 34905 34696 gene locus_tag LOCUS_10730 34905 34696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence20 4521 3268 gene locus_tag LOCUS_10740 4521 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 6198 4993 gene locus_tag LOCUS_10750 gene tuf 6198 4993 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_10750 8406 6337 gene locus_tag LOCUS_10760 gene fusA 8406 6337 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_10760 8927 8457 gene locus_tag LOCUS_10770 gene rpsG 8927 8457 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_10770 9511 9086 gene locus_tag LOCUS_10780 gene rpsL 9511 9086 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_10780 11486 9711 gene locus_tag LOCUS_10790 11486 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 15319 11720 gene locus_tag LOCUS_10800 gene rpoC 15319 11720 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_10800 19063 15338 gene locus_tag LOCUS_10810 gene rpoB 19063 15338 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966421.1 protein_id gnl|my_center|LOCUS_10810 20545 19520 gene locus_tag LOCUS_10820 20545 19520 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_10820 21753 20542 gene locus_tag LOCUS_10830 gene aroA 21753 20542 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896990.1 protein_id gnl|my_center|LOCUS_10830 22209 21784 gene locus_tag LOCUS_10840 gene aroQ 22209 21784 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124539.1 protein_id gnl|my_center|LOCUS_10840 23441 22206 gene locus_tag LOCUS_10850 23441 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 24535 23444 gene locus_tag LOCUS_10860 gene aroC 24535 23444 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249217.1 protein_id gnl|my_center|LOCUS_10860 25074 24532 gene locus_tag LOCUS_10870 25074 24532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 26318 25071 gene locus_tag LOCUS_10880 gene aroB 26318 25071 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_10880 26503 27246 gene locus_tag LOCUS_10890 26503 27246 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_10890 27408 27989 gene locus_tag LOCUS_10900 27408 27989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 28921 28193 gene locus_tag LOCUS_10910 28921 28193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 29142 29636 gene locus_tag LOCUS_10920 29142 29636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 30968 29703 gene locus_tag LOCUS_10930 gene obgE 30968 29703 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048021.1 protein_id gnl|my_center|LOCUS_10930 31349 31065 gene locus_tag LOCUS_10940 gene rpmA 31349 31065 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_10940 31672 31355 gene locus_tag LOCUS_10950 31672 31355 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_10950 31986 31678 gene locus_tag LOCUS_10960 gene rplU 31986 31678 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 protein_id gnl|my_center|LOCUS_10960 32349 33188 gene locus_tag LOCUS_10970 32349 33188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence21 930 88 gene locus_tag LOCUS_10980 930 88 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_10980 1874 927 gene locus_tag LOCUS_10990 gene holB 1874 927 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_10990 2201 1878 gene locus_tag LOCUS_11000 2201 1878 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722052.1 protein_id gnl|my_center|LOCUS_11000 3526 2240 gene locus_tag LOCUS_11010 3526 2240 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_11010 4575 3523 gene locus_tag LOCUS_11020 4575 3523 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_11020 5362 4577 gene locus_tag LOCUS_11030 5362 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 6893 5364 gene locus_tag LOCUS_11040 6893 5364 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_11040 7636 9300 gene locus_tag LOCUS_11050 7636 9300 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_11050 9311 9931 gene locus_tag LOCUS_11060 9311 9931 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_11060 10403 10203 gene locus_tag LOCUS_11070 gene rpmE 10403 10203 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_11070 11442 10546 gene locus_tag LOCUS_11080 11442 10546 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_11080 12644 11502 gene locus_tag LOCUS_11090 gene ygeW 12644 11502 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303128.1 protein_id gnl|my_center|LOCUS_11090 13187 14137 gene locus_tag LOCUS_11100 13187 14137 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970319.1 protein_id gnl|my_center|LOCUS_11100 14479 16041 gene locus_tag LOCUS_11110 14479 16041 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_11110 16084 16473 gene locus_tag LOCUS_11120 16084 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 16479 16829 gene locus_tag LOCUS_11130 16479 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11130 17630 17334 gene locus_tag LOCUS_11140 17630 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 17926 18087 gene locus_tag LOCUS_11150 17926 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 18180 19193 gene locus_tag LOCUS_11160 gene tsaD 18180 19193 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_11160 19307 21070 gene locus_tag LOCUS_11170 19307 21070 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_11170 22864 21362 gene locus_tag LOCUS_11180 22864 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 24507 23014 gene locus_tag LOCUS_11190 24507 23014 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_11190 25208 24513 gene locus_tag LOCUS_11200 25208 24513 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_11200 25687 26433 gene locus_tag LOCUS_11210 25687 26433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 26612 28099 gene locus_tag LOCUS_11220 26612 28099 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743581.1 protein_id gnl|my_center|LOCUS_11220 28116 28868 gene locus_tag LOCUS_11230 28116 28868 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_11230 29105 30205 gene locus_tag LOCUS_11240 gene ychF 29105 30205 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_11240 30292 30816 gene locus_tag LOCUS_11250 30292 30816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 30914 31933 gene locus_tag LOCUS_11260 gene spoIID 30914 31933 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence22 446 619 gene locus_tag LOCUS_11270 446 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 694 1167 gene locus_tag LOCUS_11280 694 1167 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765314.1 protein_id gnl|my_center|LOCUS_11280 1187 2251 gene locus_tag LOCUS_11290 1187 2251 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172812.1 protein_id gnl|my_center|LOCUS_11290 2352 3674 gene locus_tag LOCUS_11300 2352 3674 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948178.1 protein_id gnl|my_center|LOCUS_11300 3671 4384 gene locus_tag LOCUS_11310 3671 4384 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_11310 4929 6554 gene locus_tag LOCUS_11320 4929 6554 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714962.1 protein_id gnl|my_center|LOCUS_11320 6709 7653 gene locus_tag LOCUS_11330 6709 7653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 protein_id gnl|my_center|LOCUS_11330 7643 8683 gene locus_tag LOCUS_11340 7643 8683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974099.1 protein_id gnl|my_center|LOCUS_11340 8699 9778 gene locus_tag LOCUS_11350 8699 9778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854348.1 protein_id gnl|my_center|LOCUS_11350 9780 10724 gene locus_tag LOCUS_11360 gene opp1F 9780 10724 CDS product oligopeptide ABC transporter ATP-binding protein Opp1F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355795.1 protein_id gnl|my_center|LOCUS_11360 11714 10938 gene locus_tag LOCUS_11370 11714 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 11881 13185 gene locus_tag LOCUS_11380 11881 13185 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_11380 13164 14051 gene locus_tag LOCUS_11390 13164 14051 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_11390 14342 15790 gene locus_tag LOCUS_11400 14342 15790 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_11400 15792 17075 gene locus_tag LOCUS_11410 15792 17075 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_11410 17072 17428 gene locus_tag LOCUS_11420 17072 17428 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680676.1 protein_id gnl|my_center|LOCUS_11420 18146 17493 gene locus_tag LOCUS_11430 18146 17493 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383630.1 protein_id gnl|my_center|LOCUS_11430 18850 18158 gene locus_tag LOCUS_11440 18850 18158 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_11440 18971 19540 gene locus_tag LOCUS_11450 18971 19540 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_11450 20559 19633 gene locus_tag LOCUS_11460 20559 19633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 20728 22755 gene locus_tag LOCUS_11470 gene recG 20728 22755 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_11470 23258 23884 gene locus_tag LOCUS_11480 23258 23884 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356501.1 protein_id gnl|my_center|LOCUS_11480 23911 25086 gene locus_tag LOCUS_11490 23911 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 25164 25868 gene locus_tag LOCUS_11500 25164 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 25910 28222 gene locus_tag LOCUS_11510 25910 28222 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_11510 28219 29319 gene locus_tag LOCUS_11520 28219 29319 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_11520 29880 29371 gene locus_tag LOCUS_11530 29880 29371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 31322 30045 gene locus_tag LOCUS_11540 31322 30045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence23 186 845 gene locus_tag LOCUS_11550 186 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1003 1311 gene locus_tag LOCUS_11560 1003 1311 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_11560 1957 1355 gene locus_tag LOCUS_11570 1957 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2175 4151 gene locus_tag LOCUS_11580 2175 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4355 4768 gene locus_tag LOCUS_11590 4355 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 5553 5011 gene locus_tag LOCUS_11600 gene yfcE 5553 5011 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_11600 6117 5560 gene locus_tag LOCUS_11610 gene nrdG 6117 5560 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_11610 8305 6128 gene locus_tag LOCUS_11620 gene nrdD 8305 6128 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_11620 9420 10256 gene locus_tag LOCUS_11630 9420 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 10262 10633 gene locus_tag LOCUS_11640 10262 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 10653 11162 gene locus_tag LOCUS_11650 10653 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 11162 12949 gene locus_tag LOCUS_11660 gene atpA 11162 12949 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_11660 12972 13919 gene locus_tag LOCUS_11670 gene atpG 12972 13919 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_11670 13900 15312 gene locus_tag LOCUS_11680 gene atpD 13900 15312 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_11680 15331 15756 gene locus_tag LOCUS_11690 15331 15756 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_11690 16565 15888 gene locus_tag LOCUS_11700 16565 15888 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582678.1 protein_id gnl|my_center|LOCUS_11700 17758 16580 gene locus_tag LOCUS_11710 17758 16580 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582679.1 protein_id gnl|my_center|LOCUS_11710 18366 17935 gene locus_tag LOCUS_11720 18366 17935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 19309 18380 gene locus_tag LOCUS_11730 19309 18380 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_11730 20122 19325 gene locus_tag LOCUS_11740 20122 19325 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_11740 20465 20295 gene locus_tag LOCUS_11750 20465 20295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 21222 20497 gene locus_tag LOCUS_11760 gene sigE 21222 20497 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_11760 22089 21223 gene locus_tag LOCUS_11770 gene spoIIGA 22089 21223 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_11770 22214 22387 gene locus_tag LOCUS_11780 22214 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 22647 23732 gene locus_tag LOCUS_11790 22647 23732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 23778 24461 gene locus_tag LOCUS_11800 gene ftsE 23778 24461 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_11800 24455 25357 gene locus_tag LOCUS_11810 gene ftsX 24455 25357 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_11810 25394 26674 gene locus_tag LOCUS_11820 25394 26674 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_11820 26692 27942 gene locus_tag LOCUS_11830 gene ctpA 26692 27942 CDS product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 protein_id gnl|my_center|LOCUS_11830 28023 28499 gene locus_tag LOCUS_11840 gene greA 28023 28499 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_11840 28610 29245 gene locus_tag LOCUS_11850 28610 29245 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843675.1 protein_id gnl|my_center|LOCUS_11850 29489 31003 gene locus_tag LOCUS_11860 gene lysS 29489 31003 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence24 1130 756 gene locus_tag LOCUS_11870 1130 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1386 1120 gene locus_tag LOCUS_11880 1386 1120 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_11880 2482 1430 gene locus_tag LOCUS_11890 2482 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 3010 2501 gene locus_tag LOCUS_11900 3010 2501 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_11900 5356 3242 gene locus_tag LOCUS_11910 gene pnp 5356 3242 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_11910 5851 5585 gene locus_tag LOCUS_11920 gene rpsO 5851 5585 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_11920 6789 6073 gene locus_tag LOCUS_11930 6789 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7842 6892 gene locus_tag LOCUS_11940 7842 6892 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_11940 8593 7844 gene locus_tag LOCUS_11950 gene truA 8593 7844 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_11950 9408 8590 gene locus_tag LOCUS_11960 9408 8590 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_11960 10277 9408 gene locus_tag LOCUS_11970 10277 9408 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_11970 11139 10270 gene locus_tag LOCUS_11980 11139 10270 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_11980 11861 11160 gene locus_tag LOCUS_11990 11861 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 12774 11914 gene locus_tag LOCUS_12000 12774 11914 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_12000 14129 12783 gene locus_tag LOCUS_12010 gene glmM 14129 12783 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_12010 15191 14133 gene locus_tag LOCUS_12020 gene ruvB 15191 14133 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_12020 15809 15204 gene locus_tag LOCUS_12030 gene ruvA 15809 15204 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_12030 16324 15821 gene locus_tag LOCUS_12040 gene ruvC 16324 15821 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_12040 16517 17146 gene locus_tag LOCUS_12050 16517 17146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 17832 17209 gene locus_tag LOCUS_12060 17832 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 18744 17902 gene locus_tag LOCUS_12070 18744 17902 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_12070 19015 20244 gene locus_tag LOCUS_12080 19015 20244 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_12080 20241 21416 gene locus_tag LOCUS_12090 20241 21416 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_12090 22557 21514 gene locus_tag LOCUS_12100 22557 21514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 22782 23768 gene locus_tag LOCUS_12110 22782 23768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 26255 23877 gene locus_tag LOCUS_12120 gene pheT 26255 23877 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_12120 26597 26277 gene locus_tag LOCUS_12130 26597 26277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 27632 26613 gene locus_tag LOCUS_12140 gene pheS 27632 26613 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_12140 28123 29661 gene locus_tag LOCUS_12150 28123 29661 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865220.1 protein_id gnl|my_center|LOCUS_12150 29737 30261 gene locus_tag LOCUS_12160 29737 30261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence25 6183 250 gene locus_tag LOCUS_12170 6183 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6510 6896 gene locus_tag LOCUS_12180 6510 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 6893 8770 gene locus_tag LOCUS_12190 6893 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9613 9353 gene locus_tag LOCUS_12200 9613 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 10595 9621 gene locus_tag LOCUS_12210 10595 9621 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 protein_id gnl|my_center|LOCUS_12210 11005 10625 gene locus_tag LOCUS_12220 11005 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 11679 11506 gene locus_tag LOCUS_12230 11679 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 14219 11727 gene locus_tag LOCUS_12240 14219 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 14523 14302 gene locus_tag LOCUS_12250 14523 14302 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_12250 14790 14578 gene locus_tag LOCUS_12260 14790 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 15416 15081 gene locus_tag LOCUS_12270 15416 15081 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_12270 16949 15594 gene locus_tag LOCUS_12280 16949 15594 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_12280 17241 18623 gene locus_tag LOCUS_12290 gene pepV 17241 18623 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_12290 18686 18928 gene locus_tag LOCUS_12300 18686 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 18992 19234 gene locus_tag LOCUS_12310 18992 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 21128 19356 gene locus_tag LOCUS_12320 21128 19356 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_12320 23007 21142 gene locus_tag LOCUS_12330 gene nuoF 23007 21142 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_12330 23497 22991 gene locus_tag LOCUS_12340 gene nuoE 23497 22991 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 protein_id gnl|my_center|LOCUS_12340 23658 23903 gene locus_tag LOCUS_12350 23658 23903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 24372 24296 gene locus_tag LOCUS_t00310 24372 24296 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24946 24455 gene locus_tag LOCUS_12360 24946 24455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 26226 25054 gene locus_tag LOCUS_12370 26226 25054 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_12370 27035 26382 gene locus_tag LOCUS_12380 27035 26382 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_12380 27853 27395 gene locus_tag LOCUS_12390 27853 27395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 28518 27973 gene locus_tag LOCUS_12400 28518 27973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 <29714 28800 gene locus_tag LOCUS_12410 <29714 28800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389524.1:recombinase family protein >Feature sequence26 1415 1152 gene locus_tag LOCUS_12420 1415 1152 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_12420 2290 1565 gene locus_tag LOCUS_12430 2290 1565 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_12430 2989 2291 gene locus_tag LOCUS_12440 gene trmD 2989 2291 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_12440 3494 2979 gene locus_tag LOCUS_12450 gene rimM 3494 2979 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_12450 3785 3552 gene locus_tag LOCUS_12460 3785 3552 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_12460 4048 3803 gene locus_tag LOCUS_12470 gene rpsP 4048 3803 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_12470 5483 4116 gene locus_tag LOCUS_12480 gene ffh 5483 4116 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_12480 5861 5499 gene locus_tag LOCUS_12490 5861 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6838 6044 gene locus_tag LOCUS_12500 6838 6044 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_12500 7427 6972 gene locus_tag LOCUS_12510 7427 6972 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893336.1 protein_id gnl|my_center|LOCUS_12510 8804 7554 gene locus_tag LOCUS_12520 gene eutH 8804 7554 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016133.1 protein_id gnl|my_center|LOCUS_12520 9297 9019 gene locus_tag LOCUS_12530 9297 9019 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721582.1 protein_id gnl|my_center|LOCUS_12530 10076 9330 gene locus_tag LOCUS_12540 10076 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 10952 10131 gene locus_tag LOCUS_12550 gene eutJ 10952 10131 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815263.1 protein_id gnl|my_center|LOCUS_12550 11584 10967 gene locus_tag LOCUS_12560 gene eutD 11584 10967 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889877.1 protein_id gnl|my_center|LOCUS_12560 12373 11603 gene locus_tag LOCUS_12570 12373 11603 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868838.1 protein_id gnl|my_center|LOCUS_12570 12702 12421 gene locus_tag LOCUS_12580 12702 12421 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868831.1 protein_id gnl|my_center|LOCUS_12580 13014 12727 gene locus_tag LOCUS_12590 13014 12727 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357513.1 protein_id gnl|my_center|LOCUS_12590 14525 13083 gene locus_tag LOCUS_12600 14525 13083 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836566.1 protein_id gnl|my_center|LOCUS_12600 15158 14541 gene locus_tag LOCUS_12610 15158 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 15876 15223 gene locus_tag LOCUS_12620 gene eutL 15876 15223 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868828.1 protein_id gnl|my_center|LOCUS_12620 16863 15961 gene locus_tag LOCUS_12630 gene eutC 16863 15961 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904029.1 protein_id gnl|my_center|LOCUS_12630 18278 16911 gene locus_tag LOCUS_12640 18278 16911 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868826.1 protein_id gnl|my_center|LOCUS_12640 19867 18428 gene locus_tag LOCUS_12650 gene eutA 19867 18428 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861388.1 protein_id gnl|my_center|LOCUS_12650 20400 19930 gene locus_tag LOCUS_12660 20400 19930 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816703.1 protein_id gnl|my_center|LOCUS_12660 20762 20403 gene locus_tag LOCUS_12670 gene pduU 20762 20403 CDS product propanediol utilization microcompartment protein PduU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168417.1 protein_id gnl|my_center|LOCUS_12670 21818 21270 gene locus_tag LOCUS_12680 21818 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 22718 21894 gene locus_tag LOCUS_12690 22718 21894 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_12690 22885 22960 gene locus_tag LOCUS_t00320 22885 22960 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23096 23959 gene locus_tag LOCUS_12700 23096 23959 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026644807.1 protein_id gnl|my_center|LOCUS_12700 24100 25011 gene locus_tag LOCUS_12710 24100 25011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 25075 26049 gene locus_tag LOCUS_12720 25075 26049 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_12720 26068 26574 gene locus_tag LOCUS_12730 26068 26574 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262690.1 protein_id gnl|my_center|LOCUS_12730 26719 27090 gene locus_tag LOCUS_12740 26719 27090 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904036.1 protein_id gnl|my_center|LOCUS_12740 27103 27534 gene locus_tag LOCUS_12750 27103 27534 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002345864.1 protein_id gnl|my_center|LOCUS_12750 27554 28072 gene locus_tag LOCUS_12760 27554 28072 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189433.1 protein_id gnl|my_center|LOCUS_12760 28130 28921 gene locus_tag LOCUS_12770 28130 28921 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence27 956 1672 gene locus_tag LOCUS_12780 956 1672 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_12780 1721 2239 gene locus_tag LOCUS_12790 1721 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2243 2506 gene locus_tag LOCUS_12800 2243 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_12800 3211 2690 gene locus_tag LOCUS_12810 gene raiA 3211 2690 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_12810 4180 3383 gene locus_tag LOCUS_12820 4180 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4293 5078 gene locus_tag LOCUS_12830 4293 5078 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_12830 5086 5649 gene locus_tag LOCUS_12840 5086 5649 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130266.1 protein_id gnl|my_center|LOCUS_12840 6164 5739 gene locus_tag LOCUS_12850 gene iscR 6164 5739 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072275.1 protein_id gnl|my_center|LOCUS_12850 7243 6161 gene locus_tag LOCUS_12860 gene mnmA 7243 6161 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_12860 7811 7245 gene locus_tag LOCUS_12870 7811 7245 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_12870 8762 7830 gene locus_tag LOCUS_12880 gene cysK 8762 7830 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_12880 9996 9130 gene locus_tag LOCUS_12890 9996 9130 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_12890 10409 9993 gene locus_tag LOCUS_12900 10409 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 10682 10834 gene locus_tag LOCUS_12910 10682 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 10955 11239 gene locus_tag LOCUS_12920 10955 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 11786 12082 gene locus_tag LOCUS_12930 11786 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 12113 12565 gene locus_tag LOCUS_12940 12113 12565 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287412.1 protein_id gnl|my_center|LOCUS_12940 12629 13786 gene locus_tag LOCUS_12950 12629 13786 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_12950 13854 14483 gene locus_tag LOCUS_12960 13854 14483 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_12960 15751 14543 gene locus_tag LOCUS_12970 15751 14543 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_12970 16422 15745 gene locus_tag LOCUS_12980 16422 15745 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_12980 16637 18091 gene locus_tag LOCUS_12990 16637 18091 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965728.1 protein_id gnl|my_center|LOCUS_12990 18479 18225 gene locus_tag LOCUS_13000 gene rpsR 18479 18225 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_13000 18999 18535 gene locus_tag LOCUS_13010 gene ssb 18999 18535 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_13010 19305 19012 gene locus_tag LOCUS_13020 gene rpsF 19305 19012 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_13020 19547 19912 gene locus_tag LOCUS_13030 19547 19912 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_13030 19914 23657 gene locus_tag LOCUS_13040 19914 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 24856 23723 gene locus_tag LOCUS_13050 gene prfB 24856 23723 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226186.1 protein_id gnl|my_center|LOCUS_13050 25088 26071 gene locus_tag LOCUS_13060 25088 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 26098 26610 gene locus_tag LOCUS_13070 26098 26610 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence28 2059 320 gene locus_tag LOCUS_13080 gene argS 2059 320 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_13080 2489 2052 gene locus_tag LOCUS_13090 2489 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3404 2586 gene locus_tag LOCUS_13100 gene murI 3404 2586 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_13100 4477 3404 gene locus_tag LOCUS_13110 4477 3404 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_13110 5416 4859 gene locus_tag LOCUS_13120 5416 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 7557 5497 gene locus_tag LOCUS_13130 7557 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8853 7999 gene locus_tag LOCUS_13140 8853 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9195 8923 gene locus_tag LOCUS_13150 gene spoIIID 9195 8923 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_13150 9451 10704 gene locus_tag LOCUS_13160 9451 10704 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_13160 10701 11048 gene locus_tag LOCUS_13170 10701 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 11856 11227 gene locus_tag LOCUS_13180 gene tmk 11856 11227 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_13180 12090 14066 gene locus_tag LOCUS_13190 12090 14066 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397329.1 protein_id gnl|my_center|LOCUS_13190 14167 14610 gene locus_tag LOCUS_13200 gene rplI 14167 14610 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_13200 14777 16126 gene locus_tag LOCUS_13210 14777 16126 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_13210 16123 17529 gene locus_tag LOCUS_13220 gene tilS 16123 17529 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_13220 17600 18151 gene locus_tag LOCUS_13230 gene hpt 17600 18151 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_13230 18265 20124 gene locus_tag LOCUS_13240 gene ftsH 18265 20124 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_13240 21480 20272 gene locus_tag LOCUS_13250 21480 20272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 21673 21500 gene locus_tag LOCUS_13260 21673 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 22158 21670 gene locus_tag LOCUS_13270 22158 21670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 22893 22456 gene locus_tag LOCUS_13280 22893 22456 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965636.1 protein_id gnl|my_center|LOCUS_13280 23450 22977 gene locus_tag LOCUS_13290 gene ispF 23450 22977 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_13290 24172 23447 gene locus_tag LOCUS_13300 gene ispD 24172 23447 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_13300 25042 24305 gene locus_tag LOCUS_13310 25042 24305 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189492.1 protein_id gnl|my_center|LOCUS_13310 25854 25039 gene locus_tag LOCUS_13320 25854 25039 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence29 769 185 gene locus_tag LOCUS_13330 gene clpP 769 185 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_13330 2373 907 gene locus_tag LOCUS_13340 gene tig 2373 907 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105215.1 protein_id gnl|my_center|LOCUS_13340 3181 2492 gene locus_tag LOCUS_13350 3181 2492 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_13350 4133 3204 gene locus_tag LOCUS_13360 4133 3204 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_13360 4509 4120 gene locus_tag LOCUS_13370 4509 4120 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_13370 5116 4520 gene locus_tag LOCUS_13380 gene rnhB 5116 4520 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534532.1 protein_id gnl|my_center|LOCUS_13380 5975 5103 gene locus_tag LOCUS_13390 gene ylqF 5975 5103 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_13390 6423 6082 gene locus_tag LOCUS_13400 gene rplS 6423 6082 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_13400 7306 6620 gene locus_tag LOCUS_13410 7306 6620 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_13410 9134 7296 gene locus_tag LOCUS_13420 9134 7296 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_13420 9750 9190 gene locus_tag LOCUS_13430 9750 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 10448 9750 gene locus_tag LOCUS_13440 10448 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 11161 10511 gene locus_tag LOCUS_13450 11161 10511 CDS product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358875.1 protein_id gnl|my_center|LOCUS_13450 11738 11190 gene locus_tag LOCUS_13460 11738 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 12222 11725 gene locus_tag LOCUS_13470 12222 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 13325 12219 gene locus_tag LOCUS_13480 13325 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 13717 13322 gene locus_tag LOCUS_13490 gene spoIIIAD 13717 13322 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428424.1 protein_id gnl|my_center|LOCUS_13490 13908 13714 gene locus_tag LOCUS_13500 13908 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 14421 13924 gene locus_tag LOCUS_13510 14421 13924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 15332 14418 gene locus_tag LOCUS_13520 gene spoIIIAA 15332 14418 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_13520 17410 15425 gene locus_tag LOCUS_13530 gene ligA 17410 15425 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_13530 17519 18130 gene locus_tag LOCUS_13540 17519 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 18872 18180 gene locus_tag LOCUS_13550 18872 18180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 22179 18928 gene locus_tag LOCUS_13560 22179 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 23364 22522 gene locus_tag LOCUS_13570 gene xerD 23364 22522 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583825.1 protein_id gnl|my_center|LOCUS_13570 23577 24029 gene locus_tag LOCUS_13580 23577 24029 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence30 10307 10888 gene locus_tag LOCUS_13590 10307 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 11332 10991 gene locus_tag LOCUS_13600 11332 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 11465 11956 gene locus_tag LOCUS_13610 11465 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 11971 12390 gene locus_tag LOCUS_13620 11971 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 12573 13379 gene locus_tag LOCUS_13630 12573 13379 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_13630 13441 14307 gene locus_tag LOCUS_13640 gene pstC 13441 14307 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_13640 14313 15176 gene locus_tag LOCUS_13650 gene pstA 14313 15176 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_13650 15173 15928 gene locus_tag LOCUS_13660 gene pstB 15173 15928 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_13660 15928 16590 gene locus_tag LOCUS_13670 gene phoU 15928 16590 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_13670 16574 17251 gene locus_tag LOCUS_13680 16574 17251 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_13680 17248 18909 gene locus_tag LOCUS_13690 17248 18909 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_13690 18956 19741 gene locus_tag LOCUS_13700 18956 19741 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_13700 20267 19896 gene locus_tag LOCUS_13710 20267 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 21711 20326 gene locus_tag LOCUS_13720 21711 20326 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_13720 23263 21842 gene locus_tag LOCUS_13730 23263 21842 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_13730 24497 23391 gene locus_tag LOCUS_13740 24497 23391 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence31 <1 909 gene locus_tag LOCUS_13750 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964681.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase 906 1448 gene locus_tag LOCUS_13760 gene cobU 906 1448 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_13760 1445 2200 gene locus_tag LOCUS_13770 gene cobS 1445 2200 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_13770 2219 2596 gene locus_tag LOCUS_13780 2219 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2593 3201 gene locus_tag LOCUS_13790 2593 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3198 3764 gene locus_tag LOCUS_13800 3198 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3876 4577 gene locus_tag LOCUS_13810 3876 4577 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_13810 4593 5243 gene locus_tag LOCUS_13820 4593 5243 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 protein_id gnl|my_center|LOCUS_13820 5347 7191 gene locus_tag LOCUS_13830 5347 7191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004469008.1 protein_id gnl|my_center|LOCUS_13830 7188 8999 gene locus_tag LOCUS_13840 7188 8999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_13840 10010 9042 gene locus_tag LOCUS_13850 10010 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 10487 12415 gene locus_tag LOCUS_13860 10487 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 12412 13431 gene locus_tag LOCUS_13870 12412 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 13450 14397 gene locus_tag LOCUS_13880 13450 14397 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_13880 14851 14375 gene locus_tag LOCUS_13890 14851 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 14904 15548 gene locus_tag LOCUS_13900 14904 15548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 15545 17767 gene locus_tag LOCUS_13910 15545 17767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 17790 21053 gene locus_tag LOCUS_13920 17790 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 21940 21131 gene locus_tag LOCUS_13930 21940 21131 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812431.1 protein_id gnl|my_center|LOCUS_13930 22129 22053 gene locus_tag LOCUS_t00330 22129 22053 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 1425 790 gene locus_tag LOCUS_13940 1425 790 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_13940 1861 1505 gene locus_tag LOCUS_13950 1861 1505 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_13950 2328 1897 gene locus_tag LOCUS_13960 2328 1897 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_13960 3373 2363 gene locus_tag LOCUS_13970 3373 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4017 3673 gene locus_tag LOCUS_13980 4017 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4139 5023 gene locus_tag LOCUS_13990 gene dpsA 4139 5023 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_13990 5016 5591 gene locus_tag LOCUS_14000 5016 5591 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_14000 5732 6367 gene locus_tag LOCUS_14010 5732 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7217 6285 gene locus_tag LOCUS_14020 7217 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 7430 8077 gene locus_tag LOCUS_14030 7430 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 8173 14616 gene locus_tag LOCUS_14040 8173 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 14782 14979 gene locus_tag LOCUS_14050 14782 14979 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_14050 14969 16036 gene locus_tag LOCUS_14060 gene prfA 14969 16036 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_14060 16044 17069 gene locus_tag LOCUS_14070 16044 17069 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_14070 17081 17710 gene locus_tag LOCUS_14080 gene coaE 17081 17710 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438041.1 protein_id gnl|my_center|LOCUS_14080 17707 18279 gene locus_tag LOCUS_14090 17707 18279 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438043.1 protein_id gnl|my_center|LOCUS_14090 18351 19757 gene locus_tag LOCUS_14100 18351 19757 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_14100 21072 19804 gene locus_tag LOCUS_14110 21072 19804 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921831.1 protein_id gnl|my_center|LOCUS_14110 <22155 21210 gene locus_tag LOCUS_14120 <22155 21210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004450718.1:proline--tRNA ligase >Feature sequence33 92 167 gene locus_tag LOCUS_t00340 92 167 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 172 247 gene locus_tag LOCUS_t00350 172 247 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 254 363 gene locus_tag LOCUS_r00010 254 363 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 799 1341 gene locus_tag LOCUS_14130 799 1341 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_14130 1334 2188 gene locus_tag LOCUS_14140 1334 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2269 4476 gene locus_tag LOCUS_14150 2269 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4522 6861 gene locus_tag LOCUS_14160 4522 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7014 8996 gene locus_tag LOCUS_14170 gene gyrB 7014 8996 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_14170 9026 11485 gene locus_tag LOCUS_14180 gene priA 9026 11485 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_14180 11505 11999 gene locus_tag LOCUS_14190 gene def 11505 11999 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_14190 11996 12928 gene locus_tag LOCUS_14200 gene fmt 11996 12928 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_14200 12941 13642 gene locus_tag LOCUS_14210 12941 13642 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_14210 13674 14996 gene locus_tag LOCUS_14220 gene rsmB 13674 14996 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 protein_id gnl|my_center|LOCUS_14220 14993 16072 gene locus_tag LOCUS_14230 gene rlmN 14993 16072 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450546.1 protein_id gnl|my_center|LOCUS_14230 16144 16875 gene locus_tag LOCUS_14240 16144 16875 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034581407.1 protein_id gnl|my_center|LOCUS_14240 16891 18810 gene locus_tag LOCUS_14250 gene prkC 16891 18810 CDS product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 protein_id gnl|my_center|LOCUS_14250 18825 19757 gene locus_tag LOCUS_14260 gene rsgA 18825 19757 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence34 2178 1120 gene locus_tag LOCUS_14270 2178 1120 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016300.1 protein_id gnl|my_center|LOCUS_14270 2602 2423 gene locus_tag LOCUS_14280 2602 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2652 3362 gene locus_tag LOCUS_14290 2652 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14290 4409 3639 gene locus_tag LOCUS_14300 4409 3639 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949000.1 protein_id gnl|my_center|LOCUS_14300 5189 4422 gene locus_tag LOCUS_14310 5189 4422 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 protein_id gnl|my_center|LOCUS_14310 5988 5206 gene locus_tag LOCUS_14320 5988 5206 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_14320 6704 6201 gene locus_tag LOCUS_14330 6704 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 6821 7045 gene locus_tag LOCUS_14340 6821 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 9101 7098 gene locus_tag LOCUS_14350 9101 7098 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_14350 9757 9092 gene locus_tag LOCUS_14360 gene cmk 9757 9092 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640590.1 protein_id gnl|my_center|LOCUS_14360 11020 9773 gene locus_tag LOCUS_14370 11020 9773 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_14370 11864 10992 gene locus_tag LOCUS_14380 11864 10992 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_14380 12789 12010 gene locus_tag LOCUS_14390 12789 12010 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898387.1 protein_id gnl|my_center|LOCUS_14390 12938 13471 gene locus_tag LOCUS_14400 12938 13471 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956957.1 protein_id gnl|my_center|LOCUS_14400 13534 14772 gene locus_tag LOCUS_14410 gene hflX 13534 14772 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_14410 15742 14843 gene locus_tag LOCUS_14420 gene truB 15742 14843 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_14420 16698 15736 gene locus_tag LOCUS_14430 16698 15736 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_14430 17083 16736 gene locus_tag LOCUS_14440 gene rbfA 17083 16736 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_14440 <19324 17096 gene locus_tag LOCUS_14450 <19324 17096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460393.1:translation initiation factor IF-2 >Feature sequence35 113 188 gene locus_tag LOCUS_t00360 113 188 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 299 904 gene locus_tag LOCUS_14460 299 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1057 2055 gene locus_tag LOCUS_14470 gene asnA 1057 2055 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_14470 2285 3700 gene locus_tag LOCUS_14480 gene murD 2285 3700 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_14480 3714 4736 gene locus_tag LOCUS_14490 3714 4736 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963538.1 protein_id gnl|my_center|LOCUS_14490 4736 5770 gene locus_tag LOCUS_14500 4736 5770 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_14500 5767 6573 gene locus_tag LOCUS_14510 5767 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6566 7825 gene locus_tag LOCUS_14520 6566 7825 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_14520 8153 8581 gene locus_tag LOCUS_14530 gene rplM 8153 8581 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_14530 8603 9004 gene locus_tag LOCUS_14540 gene rpsI 8603 9004 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_14540 9240 9737 gene locus_tag LOCUS_14550 9240 9737 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022620559.1 protein_id gnl|my_center|LOCUS_14550 9867 11255 gene locus_tag LOCUS_14560 gene mgtE 9867 11255 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_14560 11471 12160 gene locus_tag LOCUS_14570 11471 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 13088 12246 gene locus_tag LOCUS_14580 13088 12246 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_14580 14188 13376 gene locus_tag LOCUS_14590 14188 13376 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027948.1 protein_id gnl|my_center|LOCUS_14590 14974 14225 gene locus_tag LOCUS_14600 14974 14225 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_14600 15657 14980 gene locus_tag LOCUS_14610 15657 14980 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027947.1 protein_id gnl|my_center|LOCUS_14610 17199 15853 gene locus_tag LOCUS_14620 17199 15853 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_14620 17400 17488 gene locus_tag LOCUS_t00370 17400 17488 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence36 <1 1169 gene locus_tag LOCUS_14630 <1 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357457.1:ATP-dependent Clp protease ATP-binding subunit ClpX 1244 3676 gene locus_tag LOCUS_14640 gene lon 1244 3676 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357593.1 protein_id gnl|my_center|LOCUS_14640 3689 4312 gene locus_tag LOCUS_14650 gene yihA 3689 4312 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 protein_id gnl|my_center|LOCUS_14650 4302 4919 gene locus_tag LOCUS_14660 4302 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5851 4964 gene locus_tag LOCUS_14670 gene dapA 5851 4964 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_14670 6996 5917 gene locus_tag LOCUS_14680 gene asd 6996 5917 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_14680 7124 8149 gene locus_tag LOCUS_14690 gene queA 7124 8149 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_14690 8310 8867 gene locus_tag LOCUS_14700 8310 8867 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_14700 9054 11138 gene locus_tag LOCUS_14710 9054 11138 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_14710 11135 13231 gene locus_tag LOCUS_14720 11135 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 13584 14714 gene locus_tag LOCUS_14730 gene tgt 13584 14714 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_14730 14778 15131 gene locus_tag LOCUS_14740 gene yajC 14778 15131 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_14740 15202 15579 gene locus_tag LOCUS_14750 15202 15579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 16287 15622 gene locus_tag LOCUS_14760 16287 15622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986489.1 protein_id gnl|my_center|LOCUS_14760 17451 16291 gene locus_tag LOCUS_14770 17451 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence37 2256 1873 gene locus_tag LOCUS_14780 2256 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3606 2491 gene locus_tag LOCUS_14790 3606 2491 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_14790 4245 4075 gene locus_tag LOCUS_14800 4245 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14800 4951 4304 gene locus_tag LOCUS_14810 4951 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 5796 4948 gene locus_tag LOCUS_14820 5796 4948 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808284.1 protein_id gnl|my_center|LOCUS_14820 6301 5810 gene locus_tag LOCUS_14830 6301 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 7004 6303 gene locus_tag LOCUS_14840 7004 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 7976 7191 gene locus_tag LOCUS_14850 7976 7191 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 protein_id gnl|my_center|LOCUS_14850 8701 7973 gene locus_tag LOCUS_14860 8701 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 9145 9669 gene locus_tag LOCUS_14870 9145 9669 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 protein_id gnl|my_center|LOCUS_14870 9739 10290 gene locus_tag LOCUS_14880 9739 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 10178 11512 gene locus_tag LOCUS_14890 10178 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14890 11517 13271 gene locus_tag LOCUS_14900 11517 13271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986745.1 protein_id gnl|my_center|LOCUS_14900 13388 13882 gene locus_tag LOCUS_14910 13388 13882 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948700.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence38 938 231 gene locus_tag LOCUS_14920 938 231 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 protein_id gnl|my_center|LOCUS_14920 2584 920 gene locus_tag LOCUS_14930 2584 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3468 2566 gene locus_tag LOCUS_14940 3468 2566 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_14940 4054 3482 gene locus_tag LOCUS_14950 4054 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4632 4228 gene locus_tag LOCUS_14960 4632 4228 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805090.1 protein_id gnl|my_center|LOCUS_14960 5208 4642 gene locus_tag LOCUS_14970 5208 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5725 7290 gene locus_tag LOCUS_14980 5725 7290 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365951.1 protein_id gnl|my_center|LOCUS_14980 7565 9175 gene locus_tag LOCUS_14990 7565 9175 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836560.1 protein_id gnl|my_center|LOCUS_14990 9403 10467 gene locus_tag LOCUS_15000 9403 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 10464 12176 gene locus_tag LOCUS_15010 10464 12176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886531.1 protein_id gnl|my_center|LOCUS_15010 12329 12256 gene locus_tag LOCUS_t00380 12329 12256 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12418 12342 gene locus_tag LOCUS_t00390 12418 12342 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence39 2079 3365 gene locus_tag LOCUS_15020 gene glmU 2079 3365 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_15020 3459 4424 gene locus_tag LOCUS_15030 3459 4424 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_15030 6005 4557 gene locus_tag LOCUS_15040 6005 4557 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_15040 7804 6110 gene locus_tag LOCUS_15050 gene ade 7804 6110 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245362.1 protein_id gnl|my_center|LOCUS_15050 9216 7864 gene locus_tag LOCUS_15060 9216 7864 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_15060 11239 9404 gene locus_tag LOCUS_15070 gene ftsH 11239 9404 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_15070 11468 11908 gene locus_tag LOCUS_15080 11468 11908 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence40 797 165 gene locus_tag LOCUS_15090 797 165 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387519.1 protein_id gnl|my_center|LOCUS_15090 1726 797 gene locus_tag LOCUS_15100 1726 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1980 2417 gene locus_tag LOCUS_15110 gene rnhA 1980 2417 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228761.1 protein_id gnl|my_center|LOCUS_15110 2441 2749 gene locus_tag LOCUS_15120 2441 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3527 3072 gene locus_tag LOCUS_15130 3527 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4617 3553 gene locus_tag LOCUS_15140 4617 3553 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035713.1 protein_id gnl|my_center|LOCUS_15140 4862 5581 gene locus_tag LOCUS_15150 4862 5581 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360546.1 protein_id gnl|my_center|LOCUS_15150 6140 5661 gene locus_tag LOCUS_15160 6140 5661 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151333.1 protein_id gnl|my_center|LOCUS_15160 7250 6177 gene locus_tag LOCUS_15170 7250 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 8737 7568 gene locus_tag LOCUS_15180 8737 7568 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861386.1 protein_id gnl|my_center|LOCUS_15180 10162 8891 gene locus_tag LOCUS_15190 10162 8891 CDS product cyclic nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990029.1 protein_id gnl|my_center|LOCUS_15190 11481 10288 gene locus_tag LOCUS_15200 11481 10288 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence41 1105 554 gene locus_tag LOCUS_15210 gene pgsA 1105 554 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_15210 2475 1129 gene locus_tag LOCUS_15220 gene rimO 2475 1129 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_15220 2968 2462 gene locus_tag LOCUS_15230 2968 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4074 2971 gene locus_tag LOCUS_15240 gene recA 4074 2971 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_15240 4262 4414 gene locus_tag LOCUS_15250 4262 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 5396 4530 gene locus_tag LOCUS_15260 5396 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 6410 5469 gene locus_tag LOCUS_15270 6410 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 7459 6470 gene locus_tag LOCUS_15280 7459 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 8841 7504 gene locus_tag LOCUS_15290 8841 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 9972 9142 gene locus_tag LOCUS_15300 gene rsmI 9972 9142 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_15300 10642 9980 gene locus_tag LOCUS_15310 10642 9980 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910686.1 protein_id gnl|my_center|LOCUS_15310 10904 10731 gene locus_tag LOCUS_15320 10904 10731 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence42 306 1520 gene locus_tag LOCUS_15330 gene spoIVB 306 1520 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_15330 1778 2539 gene locus_tag LOCUS_15340 gene spo0A 1778 2539 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_15340 2730 4859 gene locus_tag LOCUS_15350 2730 4859 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_15350 4876 5526 gene locus_tag LOCUS_15360 gene cas5c 4876 5526 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_15360 5523 7259 gene locus_tag LOCUS_15370 gene cas8c 5523 7259 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_15370 7263 8156 gene locus_tag LOCUS_15380 gene cas7c 7263 8156 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_15380 8161 8817 gene locus_tag LOCUS_15390 gene cas4 8161 8817 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_15390 8820 9851 gene locus_tag LOCUS_15400 gene cas1c 8820 9851 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_15400 9859 10149 gene locus_tag LOCUS_15410 gene cas2 9859 10149 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_15410 10333 >10758 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccctcctcacggagggcgtggattgaaat >Feature sequence43 854 105 gene locus_tag LOCUS_15420 854 105 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_15420 1153 851 gene locus_tag LOCUS_15430 1153 851 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965963.1 protein_id gnl|my_center|LOCUS_15430 1379 2098 gene locus_tag LOCUS_15440 gene cwlD 1379 2098 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_15440 2101 3489 gene locus_tag LOCUS_15450 gene radA 2101 3489 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_15450 3496 4245 gene locus_tag LOCUS_15460 3496 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 protein_id gnl|my_center|LOCUS_15460 4333 5340 gene locus_tag LOCUS_15470 4333 5340 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_15470 5880 5326 gene locus_tag LOCUS_15480 5880 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 7360 5984 gene locus_tag LOCUS_15490 gene scfB 7360 5984 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_15490 7588 7430 gene locus_tag LOCUS_15500 gene scfA 7588 7430 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_15500 8186 8584 gene locus_tag LOCUS_15510 8186 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence44 429 503 gene locus_tag LOCUS_t00400 429 503 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 760 1200 gene locus_tag LOCUS_15520 760 1200 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_15520 2643 1264 gene locus_tag LOCUS_15530 2643 1264 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_15530 4480 2906 gene locus_tag LOCUS_15540 4480 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 6303 4798 gene locus_tag LOCUS_15550 6303 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 6503 7063 gene locus_tag LOCUS_15560 6503 7063 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388638.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence45 456 1328 gene locus_tag LOCUS_15570 456 1328 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_15570 1309 1965 gene locus_tag LOCUS_15580 1309 1965 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_15580 2634 3176 gene locus_tag LOCUS_15590 2634 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3363 4568 gene locus_tag LOCUS_15600 gene nifS 3363 4568 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_15600 4589 5014 gene locus_tag LOCUS_15610 gene nifU 4589 5014 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_15610 5334 5654 gene locus_tag LOCUS_15620 5334 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5657 6295 gene locus_tag LOCUS_15630 5657 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence46 <1 818 gene locus_tag LOCUS_15640 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase 984 1601 gene locus_tag LOCUS_15650 984 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2045 1680 gene locus_tag LOCUS_15660 2045 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2390 2067 gene locus_tag LOCUS_15670 2390 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3101 2520 gene locus_tag LOCUS_15680 3101 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3952 3128 gene locus_tag LOCUS_15690 3952 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 5062 3968 gene locus_tag LOCUS_15700 5062 3968 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_15700 5569 5081 gene locus_tag LOCUS_15710 5569 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence47 1358 171 gene locus_tag LOCUS_15720 gene ugpC 1358 171 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_15720 1611 1790 gene locus_tag LOCUS_15730 1611 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2877 1867 gene locus_tag LOCUS_15740 gene gap 2877 1867 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_15740 3079 3855 gene locus_tag LOCUS_15750 3079 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence48 138 1565 gene locus_tag LOCUS_15760 gene pepV 138 1565 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_15760 2862 1660 gene locus_tag LOCUS_15770 2862 1660 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_15770